UCF Men's Tennis Yearbook

24
A WINNING PROGRAM Since arriving in Orlando prior to the 2000 season, head coach Bobby Cashman has built the Knights into a consistent winner. Thanks to Cashman, UCF is a naonally-recognized program that competes with many of the elite teams in the naon each season. On three occasions during Cashman’s tenure, the Knights have parcipated in the NCAA Championship. With a challenging schedule every season, the squad has ample opportunies to play against the best teams in the country. As a result, the Knights are no strangers to spending me in the naonal rankings. Facing the naon’s nest teams allows the Knights to tour the United States. Previous trips have taken the Knights to desnaons such as San Diego, Calif., Dallas, Texas, and Philadelphia, Pa. The Knights compete in one of the top leagues in the naon in Conference USA. Along with UCF, programs like Rice, SMU and Tulsa rounely represent the conference on the naonal stage. In 2009, the Knights hosted the C-USA Men’s Tennis Championship. The weather in Orlando allows the Knights to pracce and play all year round. Facility upgrades have also helped Cashman maintain a top-notch program. The UCF Tennis Complex provides UCF with a rst-class facility and makes it convenient for fans to aend matches. During the 2010 season the Knights will face eight squads who nished the 2009 campaign ranked among the top-75 teams in the country, including two contests against top-20 ranked teams. PLAYING THE BEST

description

Learn about the 2009-10 UCF men's tennis team and the Knights' program.

Transcript of UCF Men's Tennis Yearbook

Page 1: UCF Men's Tennis Yearbook

A WINNING PROGRAMSince arriving in Orlando prior to the 2000 season, head coach Bobby Cashman has built the Knights into a consistent winner. Thanks to Cashman, UCF is a nati onally-recognized program that competes with many of the elite teams in the nati on each season.

On three occasions during Cashman’s tenure, the Knights have parti cipated in the NCAA Championship. With a challenging schedule every season, the squad has ample opportuniti es to play against the best teams in the country. As a result, the Knights are no strangers to spending ti me in the nati onal rankings.

Facing the nati on’s fi nest teams allows the Knights to tour the United States. Previous trips have taken the Knights to desti nati ons such as San Diego, Calif., Dallas, Texas, and Philadelphia, Pa.

The Knights compete in one of the top leagues in the nati on in Conference USA. Along with UCF, programs like Rice, SMU and Tulsa routi nely represent the conference on the nati onal stage. In 2009, the Knights hosted the C-USA Men’s Tennis Championship.

The weather in Orlando allows the Knights to practi ce and play all year round. Facility upgrades have also helped Cashman maintain a top-notch program. The UCF Tennis Complex provides UCF with a fi rst-class facility and makes it convenient for fans to att end matches.

During the 2010 season the Knights will face eight squads who fi nished the 2009 campaign ranked among the top-75 teams in the country, including two contests against top-20 ranked teams.

PLAYING THE BEST

Page 2: UCF Men's Tennis Yearbook

AN EXPERIENCED STAFFThe UCF coaching staff features a unique blend of unparalleled experience and youthful vigor. Head coach Bobby Cashman and assistant Nick Zieziula possess all of the elements to help the Knights succeed both on and off the court: college and professional playing experience, postseason appearances, knowledge of the ins and outs of the game and most importantly, a passion for UCF tennis.

One of the most respected coaches in the country, Cashman is in his 11th season at UCF. The Knights have enjoyed great success since he began his tenure in 2000. He has guided three of his squads to conference ti tles and berths in the postseason. Cashman has also helped his players enjoy great individual success. He has mentored dozens of all-conference honorees and two league player of the year recipients.

Cashman has helped the Knights become fi xtures in the nati onal rankings. His 2002 squad climbed to No. 47 nati onally, the highest spot in school history.

On the collegiate level, Cashman played at Miami-Dade Community College before moving to Barry. Aft er college, he played professionally and was ranked as high as fourth in the men’s open division in the Sunshine State.

Zieziula is in his second campaign in Orlando. He was a standout player at Buff alo. When he concluded his four-year career in 2005, he was the Bulls’ all-ti me leader in both singles wins and doubles victories. Before heading to UCF, he served as an assistant at his alma mater.

During his ti me with the Knights, Bobby Cashman has led his team to the NCAA Championship three ti mes. Most recently, his 2005 squad parti cipated in the postseason aft er winning the conference ti tle. Before Cashman arrived in Orlando, the Knights had never earned an invitati on to the NCAA Championship.

POSTSEASON PLAY

Page 3: UCF Men's Tennis Yearbook

The Knights uti lize the inti mate UCF Tennis Complex for matches and practi ces. The facility has served as the program’s home since 2001. During the summer of 2005, the complex was given a facelift when it was resurfaced and 80 permanent seats were added for spectators at the championship court. The facility includes seven wind-screened hardcourts with four shaded benches.

The UCF Tennis Complex is located near the Academic Village housing community. The complex is also within close proximity to UCF’s state-of-the-art Recreati on and Wellness Center, one of the busiest buildings on campus. The center’s popular leisure pool is adjacent to the tennis complex.

The Knights have claimed 29 matches at home since the venue was renovated. Because of the region’s warm temperatures, the Knights annually host some of the nati on’s top squads in Orlando. In recent years, UCF has faced programs like Denver, Miami and Utah at home.

In the spring of 2009, the Knights hosted the Conference USA Championship at the facility. The event marked the fi rst ti me that UCF hosted a league tennis tournament on campus. All eight of the C-USA schools that sponsor men’s tennis were in acti on at the championship.

UCF TENNIS COMPLEX

The men’s tennis team enjoys the convienent locati on of the UCF Tennis Complex in relati on to where they live and take classes.

ON THE COURT

Page 4: UCF Men's Tennis Yearbook

Under head coach Bobby Cashman, the UCF men’s tennis team has experienced unprecedented academic achievement. Since Cashman arrived in Orlando prior to the 2000 season, UCF student-athletes have earned Intercollegiate Tennis Associati on Scholar-Athlete recogniti on on 13 occasions. Two ti mes under Cashman, the Knights have been honored as an ITA Academic All-America Team. At UCF, a student-athlete’s success on the tennis courts is evenly matched in the classroom.

“The combinati on of athleti cs and academics is important,” Cashman said. “In order to succeed at a great school like UCF, a student-athlete must handle the workload academically in order to be successful on the tennis court. I expect my players to be true student-athletes.”

Following the 2009 spring season, six Knights were named to the Conference USA Commissioner’s Academic Honor Roll with a grade-point average of 3.00 or higher. On the list were fi ve returning players: Brock Sakey, Blaze Schwartz, Claudio Romano, Joe Delinks and Eugene Dolgovykh. Since the Knights began competi ng in the league in 2006, UCF student-athletes have been selected to the commissioner’s academic honor roll on 18 occasions.

UCF student-athletes are supported by a nine-person professional staff of advisors and counselors from the Offi ce of Academic Services for Student-Athletes. The ASSA mission is to support student-athletes’ academic development, personal growth and career planning, while maintaining stati sfactory progress toward their degree.

ASSA advisors off er admissions counseling for incoming student-athletes, plan tutoring and organized study sessions, and also coordinate priority class registrati on. UCF student-athletes also receive a special academic/athleti c orientati on, study skills and ti me management instructi on, career planning advice and job placement assistance.

EXCELLENCE ON AND OFF THE COURT

Page 5: UCF Men's Tennis Yearbook

Conference USA features 12 nati onally prominent, traditi on-rich members in East Carolina, Houston, Marshall, Memphis, Rice, SMU, Southern Miss, Tulane, Tulsa, UAB, UCF and UTEP. All C-USA insti tuti ons sponsor football, along with several other men’s and women’s athleti c programs, many which compete regularly for NCAA Championships. C-USA sponsors competi ti on in 19 sports – nine for men (baseball, basketball, cross country, football, golf, soccer, tennis and indoor and outdoor track and fi eld) and 10 for women (basketball, cross country, golf, soft ball, soccer, swimming and diving, tennis, indoor and outdoor track and fi eld and volleyball).

The conference’s footprint is concentrated with 12 members in nine states and a combined area populati on of nearly 17 million. Along with the ACC, Big East, Big Ten, Big 12, Pac-10 and SEC, C-USA is one of the seven conferences having signifi cant representati on in the NCAA governance structure.

C-USA was formed in 1995 and quickly emerged as one of the nati on’s top conferences. The league’s charter members included Charlott e, Cincinnati , DePaul, Houston, Louisville, Marquett e, Memphis, Saint Louis, Southern Miss, Tulane, UAB and USF. Britt on Banowsky was named commissioner in 2002, succeeding Mike Slive, the league’s fi rst leader. Aft er celebrati ng its 10th anniversary during the 2004-05 season, C-USA began a new chapter the following year when its current membership came together to form the new look of the league.

CONFERENCE USA

Page 6: UCF Men's Tennis Yearbook

UCF - THE OPPORTUNITY OF A LIFETIMEUCF is the university that seeks opportuniti es, creates opportuniti es and brings them to fruiti on. The school’s culture of opportunity is driven by the diverse people it att racts, its Orlando environment, its history of entrepreneurship, and its youth, relevance and energy. Located in one of the most vibrant citi es in the world, UCF is among the fastest-growing research universiti es in the country.

One of Florida’s 11 public universiti es, UCF opened its doors to students in 1968. The school has grown quickly and UCF now off ers almost 200 bachelor’s and master’s degrees and 29 doctoral programs. UCF began off ering a doctor of medicine degree program in

2009. The M.D. Program enrolled an initi al class of 41 students and will eventually produce about 120 medical graduates each year.

UCF off ers degrees through its 12 colleges:College of Arts and Humaniti esThe Burnett Honors CollegeCollege of Business Administrati onCollege of Educati onCollege of Engineering and Computer ScienceCollege of Graduate StudiesCollege of Health and Public Aff airsCollege of MedicineCollege of NursingCollege of Opti cs and PhotonicsRosen College of Hospitality ManagementCollege of Sciences

With a total enrollment of 53,537, UCF has the third-largest student populati on in the country and has become a prominent player in undergraduate educati on nati onwide off ering innovati ve corporate partnerships, world-renowned faculty and cutti ng-edge technology and undergraduate research opportuniti es.

FORGING AHEAD

Page 7: UCF Men's Tennis Yearbook

UCF - THE OPPORTUNITY OF A LIFETIMEWe have a talented and unique student body.UCF has a diverse student body, with students coming from 63 Florida counti es, 50 states and 142 countries.

We have connecti ons.Internati onally known companies such as Disney, Universal, Google, Marriott , Anheuser-Busch and many others recruit on the campus regularly and are partners with the university.

We’ll help you land a job.Our career services professionals help students gain practi cal work knowledge during their collegiate experience at schools, hospitals, high-tech companies, local municipaliti es and in the entertainment industry. Students typically enjoy success in landing employment thanks to their due diligence, their preparati on at UCF and the university’s fi ne reputati on among employers.

University Profi leStudent Populati on: 53, 537Undergraduate Enrollment: 45,301Graduate: 8,195Student/Faculty Rati o: 24 to 1

Don Reynolds’ statue, “The Charging Knight,” at the Insurance Offi ce of America Plaza outside Bright House Networks Stadium, symbolizes UCF’s excellence in academics, partnerships and athleti cs.

CHARGING KNIGHT

Page 8: UCF Men's Tennis Yearbook

CAMPUS LIFEUCF’s 1,415-acre campus provides a safe, serene setti ng for learning with 600 acres of natural lakes and woodlands. At UCF, there is always something to do. Students att end Division I athleti cs events, concerts and shows at the UCF Arena and are off ered a wide array of cultural events and opportuniti es.

Personal development programs and acti viti es in a broad range of educati onal, recreati onal and social-awareness topics allow students a chance to expand their understanding of the world.

Among the acti viti es available to all students are an 85,000-square foot recreati onal fi tness center, a 181,000-gallon outdoor recreati onal pool and nine sandy beach volleyball courts. UCF’s exciti ng campus includes a variety of on-campus residenti al communiti es, and the additi on of new housing, a new alumni center and a full-service medical clinic provides expanded opportuniti es for acti viti es.

Many UCF student-athletes reside on campus at the Towers at Knight Plaza; modern apartment-style dormitories on the north side of campus, allowing the Knights to live within close proximity to the UCF Arena and UCF’s other athleti cs faciliti es. The apartments fea-ture common kitchen and living room areas as well as four single bedrooms with full-size beds. Each bedroom includes high-speed internet access, cable television and local phone service.

The Towers at Knights Plaza feature 100,000 square feet of retail shops and restaurants. Tenants include Barnes & Noble bookstore, Subway and Knightro’s cafeteria, where UCF student-athletes dine. The apartments are located near the majority of athleti c faciliti es, including The Venue at UCF, Bright House Networks Stadium, the UCF Arena, Jay Bergman Field, the UCF Soft ball Complex and the UCF Track and Field and Soccer Complex. The Towers at Knights Plaza are also in close proximity to the Wayne Densch Sports Center and Nicholson Field House.

TOWERS AT KNIGHT PLAZA

Page 9: UCF Men's Tennis Yearbook

WELCOME TO ORLANDO

One of the area’s biggest att racti ons is its year round mild weather. At the heart of the Sunshine State, the region’s average annual temperature is a comfortable 72.4 degrees.

UCF students have easy access to one of the world’s most vibrant citi es – Orlando. Looking for theme parks, att racti ons, museums, world-class shopping, great restaurants, golf courses, jogging trails and nature preserves? You can fi nd it all here in Orlando.

Orlando is one of the most popular vacati on desti nati ons in the world. In 2007, 48.8 million visitors traveled to the region. Walt Disney World, Universal Studios Orlando and Sea World are just a short drive away from the UCF campus. The Kennedy Space Center, state parks and sandy beaches off the coast of the Atlanti c Ocean are also all nearby.

Orlando is a frequent desti nati on for today’s top nati onal musical acts, who visit popular venues like Hard Rock Live at Universal’s CityWalk and House of Blues, which is located at Downtown Disney. The city’s world-renowned theme parks have added a variety of new entertainment experiences, including Disney’s Cirque de Soleil and Universal’s Blue Man Group performances.

Beyond the theme parks, downtown Orlando features an ever-changing skyline, fi ne dining opti ons and a newly developed arts district. Cultural desti nati ons in the city include the Orlando Museum of Art, the Orange County Regional History Center and Lake Eola Park.

SUNSHINE STATE

Page 10: UCF Men's Tennis Yearbook

DR. JOHN C. HITT • PRESIDENT John C. Hitt became the fourth president of the University of Central Florida on March 1, 1992, aft er nineteen years of administrati ve experience and a disti nguished academic career.

A nati ve of Houston, Texas, he graduated cum laude in 1962 from Austi n College in Sherman, Texas, earning a B.A. degree in psychology. He completed his M.S. degree in 1964 and his Ph.D. degree two years later, both in physiological psychology at Tulane University. His graduate study was supported by fellowships from the Danforth Foundati on and the Nati onal Science Foundati on.

Dr. Hitt served as an assistant professor of psychology at Tulane before moving to Texas Christi an University as an associate professor of psychology in 1969. Three years later, he became associate dean of the university. In 1974, he was appointed vice president of the Texas Christi an University Research Foundati on and was named dean of the graduate school in 1975.

In 1977, Dr. Hitt left Texas Christi an University to become provost and vice president for academic aff airs and professor of psychology at Bradley University in Peoria, Illinois. In 1987, he moved to the University of Maine as vice president for academic aff airs and professor of psychology. In 1991, Dr. Hitt was named Maine’s interim president.

Early in his tenure, President Hitt outlined the following fi ve major goals for UCF:• Off er the best undergraduate educati on in Florida• Achieve internati onal prominence in key programs of graduate study and research• Provide an internati onal focus to the curricula and research programs• Become more inclusive and diverse• Become America’s leading partnership university

Under President Hitt ’s leadership, enrollment at UCF has more than doubled, the number of doctoral degrees awarded each year has increased sevenfold, and research funding has increased from $6.2 million to $121 million a year. President Hitt has conferred more than 130,000 degrees during his presidency.

One of President Hitt ’s greatest achievements occurred when the Florida Board of Governors approved the UCF College of Medicine, and the Lake Nona Medical City was founded. This multi -billion dollar development includes new faciliti es for medical educati on, hospital care, and biomedical research. The Lake Nona Medical City will be a principal driver of the central Florida economy for decades to come.

President Hitt ’s current civic service includes membership on the Metro Orlando Economic Development Commission Fundraising Campaign leadership cabinet and the MD Anderson Cancer Center Orlando’s Council of Governors. He serves on the boards of the American Heart Associati on, Central Florida Partnership, the Metro Orlando Economic Development Commission, SunTrust N.A., and United Arts. President Hitt is a member of the American College & University Presidents Climate Commitment Leadership Circle. He is also a member, vice-chair, and chair-elect of the Conference USA Board of Directors.

President Hitt is two-term past-chair of the State University Presidents Associati on, a member of the Florida Council of 100, and founder of the Florida High-Tech Corridor Council. He is a two-term past-president of the Florida Associati on of Colleges and Universiti es. He chaired the Governor’s Select Task Force on Healthcare Professional Liability Insurance and was a member of the Florida Distance Learning Task Force. He was a member of the Orange County Chairman’s Transportati on Commission, and in 2008, he co-chaired the Orange County Underage Drinking Task Force.

President Hitt is a former member of the boards of the American Associati on of State Colleges and Universiti es, EDUCAUSE, Orlando Health, and the Orlando Regional Chamber of Commerce. He is a former member of the NCAA President’s Commission and the former Chair of Board of the Atlanti c Sun Athleti cs Conference.

In recent years, the Central Florida community has honored President Hitt with a number of presti gious awards. He was the recipient of the 2008 Junior Achievement Spirit of Achievement Award. He has been listed for a number of years among the Orlando Senti nel’s 25 Most Powerful People in Central Florida and the Orlando Magazine’s 50 Most Powerful People. He received the Seminole Chamber of Commerce Lifeti me Achievement award in 2007. In 2006, he received the Orlando Business Journal’s fi rst-ever Legacy Award, and in 2005 he was named the Orlando Senti nel’s Central Floridian of the Year. In 2002, he received the James B. Greene award from the Metro Orlando Economic Development Commission; in 1999, he was awarded the Tree of Life from the Jewish Nati onal Fund and the Jack Halloway Star of Grati tude from United Cerebral Palsy of Central Florida; and in 1998, he earned the John Young Award from the Greater Orlando Regional Chamber of Commerce. President Hitt is an avid fi sherman and golfer. He has been married to the former Martha Halsted for 47 years, and they have two children and two grandchildren.

FIVE GOALS

Page 11: UCF Men's Tennis Yearbook

David Chambers

David Hansen

Jeff Ulmer

Jessica Reo

KEITH R. TRIBBLE • DIRECTOR OF ATHLETICSThe thread that has bridged together nearly three decades working in and around the collegiate community has been Keith Tribble’s history of building programs with strong foundati ons and dynamic structure.

Since his start as Director of Athleti cs and Executi ve Vice President for the University of Central Florida Athleti cs Associati on on June 6, 2006, Tribble has quickly taken hold of the program’s blueprints and promised to lead with a principle that everyone associated with the program will also share - to “fi nish.”

In additi on, the other focal point of his concentrati on is the oversight of the constructi on, expansion and completi on of the noted UCF Athleti cs Faciliti es Master Plan. When fi nished, the plan will touch all areas of the student-athletes’ well-being, including residenti al housing, academic and mentoring support faciliti es and state-of-the-art performance venues where UCF fans and supporters can cheer on the Knights. To date, Tribble has overseen $150 million in new constructi on and improvements to UCF athleti c faciliti es since his arrival.

Through a renewed commitment, Tribble has been most proud of the record academic achievement of the UCF student-athletes during his ti me in Orlando. The Knights, for the third-straight year in 2008-09, placed the highest number of student-athletes on the Conference USA Commissioner’s Academic Honor Roll with 224 representati ves maintaining a 3.0 grade-point average or bett er.

Much of UCF Athleti cs went from transiti oning into C-USA to competi ng for its ti tles in just a few short years.

The football program has played for two C-USA ti tles since 2005, winning the championship and coveted AutoZone Liberty Bowl berth in 2007. In 2007-08, other programs such as women’s soccer and soft ball, and members of women’s track and fi eld, claimed C-USA ti tles. In 2008-09, men’s golf reigned over the league, in additi on to a big league tournament championship from women’s basketball. Over half of the programs have competed in NCAA postseason tournaments the past two years.

Successful student-athletes start with top-notch coaching and at UCF the commitment to coaching excellence has been evident. Among Tribble’s transacti ons so far has been the renewal of several successful veteran coaches, including Amanda Cromwell (women’s soccer), Renee Luers-Gillispie (soft ball), George O’Leary (football) and Kirk Speraw (men’s basketball).

Additi onally, Tribble was instrumental in the hiring of several new head coaches, including Bryan Cunningham (men’s soccer), Todd Dagenais (volleyball), Becky Cramer (rowing), Stephanie Nickitas (women’s tennis), Terry Rooney (baseball), Caryl Smith-Gilbert (track and fi eld/cross country) and Joi Williams (women’s basketball).

Tribble att ended the University of Florida where he played off ensive guard for three bowl teams. He graduated in 1977 with a bachelor’s degree in journalism (public relati ons and marketi ng). Tribble and his wife, Terri, have a daughter, Carlyn, and a son, Kyle.

Keith Tribble is committ ed to the concept of the well-rounded student-athlete, emphasizing the importance of their academic prowess off the fi eld as well as championship results on.

COMMITTED TO EXCELLENCE

SENIOR ADMINISTRATION

Page 12: UCF Men's Tennis Yearbook

From Bright House Networks Stadium to the UCF Arena, UCF student-athletes play and train in top-notch venues. The school’s always growing and improving athleti cs complex is part of UCF’s commitment to provide student-athletes with excepti onal and modern faciliti es. In the past few years, this commitment has assured that the UCF athleti cs faciliti es are not only among the best in Conference USA, but across the nati on.

The 45,000-seat Bright House Networks Stadium, the home of the UCF football program, shared its debut season on campus in 2007 with another brand new facility - the UCF Arena. Home to the Knights’ men’s and women’s basketball programs, the 10,000-seat venue also opened in the fall of 2007. The arena, which also hosts concerts and UCF commencement ceremonies, includes luxury boxes and suites, open concourse areas and numerous concession opti ons.

Other faciliti es that have seen upgrades in recent years are Jay Bergman Field – home to the baseball program - and The Venue at UCF, the renovated previous arena which now houses exclusive modern practi ce faciliti es and offi ces for the men’s and women’s basketball programs, as well as an equally-spacious home facility for volleyball. Off campus, two new faciliti es opened in 2009 - the UCF Intercollegiate Rowing Center and the UCF Golf Practi ce Facility.

UCF’s Faciliti es Master Plan includes numerous facility enhancements in the coming years, including the planned constructi on of a new stadium and entrance structure at the UCF Soccer and Track and the expansion of Jay Bergman Field. The vision for a new academic services center is imminent, one which will provide student-athletes greater access to resources near their new Athleti cs Village residences, and further assist their progress towards their degrees and post-graduate success.

When UCF Athleti cs completes its Faciliti es Master Plan during the next decade, every sport and every student-athlete will have received the benefi t of an improved facility to practi ce, train and compete for championships in.

BRIGHT HOUSENETWORKS STADIUM

UCF ARENA

ATHLETICS FACILITIES

UCF SOFTBALLCOMPLEX

UCF SOCCERCOMPLEX

UCF ROWINGCENTER

UCF GOLFPRACTICE FACILITY

JAY BERGMANFIELD

NICHOLSONFIELDHOUSE

THE VENUE AT UCF

UCF TRACK &FIELD COMPLEX

UCF TENNISCOMPLEX

Page 13: UCF Men's Tennis Yearbook

STRENGTH AND CONDITIONING/SPORTS MEDICINE

Strength and conditi oning is a key aspect of UCF’s successful men’s tennis program. The Knights uti lize a state-of-the-art weight room. An 11,200-square foot facility inside the Wayne Densch Sports Center provides the Knights with one of the best strength training venues in the country. The facility contains the fi nest free weight and machine equipment, cardio equipment and treadmills.

UCF’s sports medicine staff also works out of the Wayne Densch Sports Center. The sports medicine facility is equipped with the latest in aquati c technology, including a SwimEx pool, which is used for both treatment and rehabilitati on, helping student-athletes return to competi ti on quickly and safely.

In additi on to providing the fi nest medical care for the UCF men’s tennis program, the UCF sports medicine staff , under the directi on of Jen Scalin Perez, helps ensure the welfare of student-athletes from 16 diff erent sports.

UCF’s sports medicine staff also strives to provide leadership in educati on for athleti c training students through quality didacti c and clinical experiences. The UCF sports medicine staff serves as a major intellectual and creati ve resource for the Knights, develops interacti ve partnerships with allied health professionals and parti cipates in the explorati on and development of the student-athlete’s health and well being.

UCF’s sports medicine center is located inside the Wayne Densch Sports Center. The Wayne Densch Sports Center opened in 2003.

STELLAR FACILITY

Page 14: UCF Men's Tennis Yearbook

UCF KNIGHTS

14

TABLE OF CONTENTS

A WINNING PROGRAM - 1Under head coach Bobby Cashman, UCF is a nati onally-recognized program.AN EXPERIENCED STAFF - 2UCF’s coaching staff features a unique blend of unparalled experience and youthful vigor.UCF TENNIS COMPLEX - 3In 2009 the facility hosted the Conference USA Championship.EXCELLENCE ON AND OFF THE COURT - 4UCF student-athletes are also excelling in the classroom.CONFERENCE USA - 5UCF joined the league in 2005.THE UNIVERSITY OF CENTRAL FLORIDA - 6-7With an enrollment of over 50,000, UCF is one of the fastest-growing schools in the country.CAMPUS LIFE/TOWERS AT KNIGHTS PLAZA - 8With such a diverse campus, there are events for all students. ORLANDO - 9UCF is located in one of the most vibrant citi es in the world.UCF PRESIDENT JOHN C. HITT - 10UCF President John C. Hitt has transformed UCF into one of the nati on’s top universiti es.UCF DIRECTOR OF ATHLETICS KEITH R. TRIBBLE - 11Keith R. Tribble has spearheaded tremendous growth within UCF Athleti cs.UCF ATHLETICS FACILITIES - 12UCF has some of the fi nest athleti cs faciliti es in the nati on, including new basketball and football venues.STRENGTH AND CONDITIONING/SPORTS MEDICINE - 13UCF’s strength and conditi oning and sports medicine faciliti es are located inside the Wayne Densch Sports Center.TABLE OF CONTENTS/QUICK FACTS - 14HEAD COACH BOBBY CASHMAN - 15The veteran coach is in his 11th year at the helm of the Knights.UCF TENNIS STAFF - 16Nick Zieziula is in his second campaign as an assistant coach at UCF.SEASON PREVIEW/ROSTER - 17The Knights are looking for more success in Conference USA in 2010.JOHAN BEIGART/MARC ROCAFORT - 18Two of the three seniors on the UCF roster.BROCK SAKEY/BLAZE SCHWARTZ- 19- 19Sakey and Schwartz are expected to make a huge splash in singles play this season.JOE DELINKS/EUGENE DOLGOVYKH - 20The pair is expected to contribute for the Knights in 2010.CLAUDIO ROMANO/MARIO SAMSON - 21With strong underclassmen the Knights are well prepared for the spring.PROGRAM HISTORY - 22-23The UCF program began in 1972.CHAMPIONSHIP TEAMS - 24The Knights parti cipated in the NCAA Championships in 2003, 2004 and 2005.

UCF INFORMATIONLocati on Orlando, Fla.Founded 1963Enrollment 53,537Nickname KnightsColors Black and GoldConference Conference USAHome Facility UCF Tennis ComplexPresident Dr. John C. Hitt Director of Athleti cs Keith R. TribbleNCAA Faculty Representati ve Dr. Consuelo StebbinsAthleti cs Phone (407) 823-4114

COACHING STAFFHead Coach Bobby CashmanAlma Mater/Year Barry/1989Year at UCF/Overall 11th/11thUCF Record/Career Record 136-87/SamePhone (407) 823-2257E-mail rcashman@athleti cs.ucf.eduFax (407) 823-5293Assistant Coach Nick ZieziulaAlma Mater/Year Buff alo/2005E-mail nzieziula@athleti cs.ucf.eduPhone (407) 823-2257

TEAM INFORMATION2009 Record 10-11Lett erwinners Returning 5

ATHLETICS COMMUNICATIONSAssociate Director/Men’s Tennis Doug RichardsPhone (407) 823-2142E-mail drichards@athleti cs.ucf.eduStudent Assistant Sarah BishopPhone (352) 317-1353E-mail sbishop@athleti cs.ucf.eduFax (407) 823-5293Mailing Address PO Box 163555 Orlando, Fla. 32816Web Site UCFAthleti cs.com

The 2010 UCF Men’s Tennis Yearbook was writt en and designed by Sarah Bishop. Editorial assistance provided by Doug Richards, Joe Hornstein, Andrew Gavin, Brian Ormiston, Leigh Torbin and Sarah Tarasewicz. Covers designed by Doug Richards and Sarah Bishop. Photographs provided by Sideline Sports (UCFphotos.com), Jay Hatch, UCF University Marketi ng and the Orlando/Orange County Conventi on and Visitors Bureau.

Senior Johan Beigart has been named to the All-Conference USA Second Team on two occasions.

Head coach Bobby Cashman’s team will face eight squads that fi nished the 2009 season ranked in the top 75 in the country.

The Knights hosted the C-USA Championship in 2009 at the UCF Tennis Complex.

Page 15: UCF Men's Tennis Yearbook

MEN’S TENNIS

15

In 11 years at UCF, Bobby Cashman has enjoyed unprecedented success as the Knights' head coach. Cashman has guided his teams to three appearances in the NCAA Championship as he has built UCF into not only a consistent winner on the regional level, but also a nati onally-recognized program. Since arriving in Orlando in 1999, Cashman has a 136-87 record. In additi on to guiding three of his squads to conference ti tles and berths in the postseason, Cashman has helped his players enjoy great individual success. He has mentored two conference players of the year, three league freshmen of the year and 17 all-conference honorees. UCF enjoyed a successful campaign in 2009. The Knights entered the Intercollegiate Tennis Associati on nati onal rankings in March aft er a win over No. 59 Florida Atlanti c. Under Cashman's guidance, Blaze Schwartz, who recorded 15 victories in dual-match play, earned a spot on the All-Conference USA Second Team. UCF also shined off the courts during the campaign. Several Knights received C-USA Commissioner's Academic Honor Roll status. With a rigorous schedule in 2008, Cashman used the fall season to help prepare his team for what lay ahead. The Knights played in tournaments against some of the nati on's top teams, such as Alabama, Arizona, Florida, Florida State and Wisconsin. The plan paid off as UCF advanced past the quarterfi nals of the C-USA Championship for the fi rst ti me since joining the league. Getti ng to the tournament was not easy, though. The Knights played nine matches against nati onally-ranked opponents, but Cashman's young team claimed three of them. UCF fi nished the 2008 season with a 12-9 record. In 2008, the Knights broke into the Fila Collegiate Tennis Rankings for the second-consecuti ve season, following a 5-2 home win against No. 51 Tennessee Tech. For the second-straight year, one of Cashman’s youngest players, Johan Beigart, was selected to the all-league second team. Cashman challenged the sophomore to play at the top of the lineup and the Sweden nati ve did not disappoint. Beigart recorded three victories at the No. 1 spot and posted an impressive 4-0 mark at No. 3. In 2007, the Knights spent eight weeks in the nati onal rankings, reaching as high as 62nd. UCF traditi onally plays a diffi cult schedule and that year was no diff erent. The team faced seven nati onally-ranked squads and claimed three victories. Overall, the team went 12-12. The Knights faced six nati onally-ranked opponents, including two matches against top-25 squads on the road, in 2006 and went 11-10. Playing in C-USA for the fi rst ti me, the Knights won three of four contests against league foes. Two of Cashman's players garnered all-conference recogniti on as Brock Sakey was named the C-USA Freshman of the Year and Sinan Sudas earned a spot on the all-league second team. In its fi nal campaign in the Atlanti c Sun Conference in 2005, UCF fi nished the season with a 14-9 record. Aft er Cashman's squad claimed the A-Sun Championship ti tle and a berth in the NCAA Championship, he earned conference coach of the year honors. All three of UCF's trips to the postseason have come under Cashman. In 2004, Cashman guided the Knights to their second-consecuti ve A-Sun ti tle, earning the league's automati c bid to the NCAA Championship. When UCF took the 2003 conference crown, it marked the fi rst league ti tle in school history. UCF went 15-9 in 2004. A pair of players, Catalin Bradu and Antonio Sierra, earned all-conference fi rst-team honors. Joel Allen and Ener Gursoy took spots on the second team. For the second-straight season, the squad capped its year with a trip to the NCAA Championship. In 2003, Cashman was named the A-Sun Coach of the Year aft er guiding his team to a 20-4 record and a perfect 5-0 showing in conference matches. Bradu garnered the player of the year award and Gursoy took the freshman of the year honor. Cashman guided UCF to one of the fi nest campaigns in school history in 2002. On their way to a 17-4 overall and 6-1 A-Sun record, the Knights climbed to No. 47 in the nati onal rankings, the highest spot in school history. Aft er arriving on the UCF campus in 1999, Cashman's Knights faced the toughest schedule in school history and fi nished the season with an 11-12 mark. One year later, he brought a more experienced team and two talented freshmen into the 2001 season. That squad ended the year 14-7 overall and posted upset victories over No. 45 UAB, No. 59 Penn State and No. 70 Georgia State. During his tenure, Cashman's teams have dominated conference competi ti on. Prior to leaving the league, the Knights played in fi ve straight A-Sun ti tle matches. In its fi nal four years in the conference, UCF was 18-2 against league foes in regular season matches - the best mark of any A-Sun team. Four Knights that Cashman coached won at least 60 matches during their collegiate careers. In fact, the four-winningest players in school history all played for Cashman. Sierra concluded his career with 75 wins, the most victories in program history. In additi on to success on the court, Cashman has also stressed academic excellence to his players. Twice, his squads have earned academic team All-America recogniti on from the ITA. Additi onally, Cashman has had players earn ITA Scholar-Athlete All-America honors on 11 occasions. A pair of UCF players, Johan Westi n (2002) and Bradu (2004), earned academic all-district recogniti on by ESPN The Magazine. Collegiately, Cashman played at Miami-Dade Community College before moving to Barry. Aft er college, he played professionally and was ranked as high as fourth in the men's open division in Florida. In 1993, he returned to Barry as an associate head coach. Following his sti nt at Barry, he spent two years as the assistant coach and recruiti ng coordinator at Kansas. A member of the United States Professional Tennis Associati on (USPTA) and the Fellowship of Christi an Athletes, Cashman has also volunteered his ti me at the Lipton Tennis Tournament in Miami, working a series of free clinics for inner-city children. He also taught fi ft h grade at St. James Elementary School from 1993-95. Cashman, who earned his degree in human resource development and leadership from Barry in 1995, is married to the former Amy Blunck. The couple resides in Oviedo with their three children - Ryan, Patrick and Grace.

COACHING RECORD AT UCF:Year Record Pct.2000 11-12 .4782001 14-7 .6672002 17-4 .8102003 20-4 .8332004 15-9 .6252005 13-9 .5912006 11-10 .5242007 12-12 .5002008 12-9 .5712009 10-11 .476Total 136-87 .610

ted success as the Knights' head coach. Cashhman hasnship as he has built UCF into not only a cconsistent program.ecord. In additi on to guiding three of his squsquads toos helped his players enjoy grg eat inindivdividuual al sucsu cess. sleague freshmen o of tf the he yeayear ar nd nd 17 17 all-coonfenferenr ce e

tered the e IntIntercercollollegegiateate Tennis Associati on nati onaal l Under er CasCashmahman'sn's gug idance, Blaze Schwartz, who

e All-Co-Confeferenrence ce USAS Second Team.l Knignightshts rereceiceived C-USA Commissioner's Academicic

son tto ho helpelp prepare his team for whwhat at layay aheada . T. The hop teaeams,ms, such as Alabamma, , AriAr zonona, a, FloFloridrida, a, FloFloridrida a

e C-U-USA SA ChaC mpiionsn hiphip fofor tr tthe he he fi rfi rfi rfirfi rrrst st st st st stt ti mti mti mti mti mti mti mme se se se se se se se se incincincincincincincncince je je je je e e oinoinoinoiningingiThee KnKnigights playedyed ninine ne matmattchechechehehehehees as as as as as as agaigaigaigaigaigaigaigaia nstnstnstnstnstnstnstnstt na nanna na na na nann ti oti oti oti oti oti oti otioti onalnaln ly-ly-yof thethemm. UCF fi nishedhed th the 2e 22200008080080808088 se se se se se se seseasoasoasoasoasoasosoasoon wn wn wn wn wn wn wn wn wwithithithithithithithith a a a a a a a a aa 12-12-12-9 9

kingsgs fofor tr the second-co-consenseecuticuticuti ve vev seseeeee seasoasoasoasoasoasososoa n, n,n, n, n, n, n, n,, folfolfolfolfofolfolfolfo lowlowlowlowowlowowlowowo inginginingg a a a a aaa

ayers, JoJohanhan Beigart,, was sselee ctecteed td td to to to to the he hehe allallallaa -le-le-leleeeaguaguaguaguaguagagagagg e e e e ethe tot p op of tf the he linlineup ananand td tthehe e SweSweS dendendenden nananan natiti vti vti ve de de de de ididdid id notnotnotnotototand popostested ad an imprrmp essessiveivee 4-4- 4-0 m0 m0 m0 maarkarkarkark at at atat No No NoNo NoNoN . 3. 3. 3. 3. 33. . . ..gs, reachchingng as high as 62n62nd. d. UCFUCFUCF t tr trtr dadiadiadiditioti oti oti onanalnalnalnalally ly ly ly yly plaplaplaplaplplaays ys ys ys ysy a a a a aaaed seven nanati onally-ranked d squsquadsadsds an anna d cd cd clailaila medmedmedmeddm th th thhthhreereereereereeeree

g two matches s agaagainsinst tt op-25 squadsads on onn thththe re rroadoadadoad, i, i, ii, n n n nnnights won three of ff fourour co contentestssts agagaininainst st st lealeagueguegue fof fo foesses.es.es.n as Brock Sakey was nameamed td he C-USA Frereshmshman anan of ofof ond team. , UCF fi nished the season wiwith th a 1a 14-94-9 rerecorcord. d. Aft Aft After ererd a berth in the NCAA Champiopionshs ip,p, he earneedd o the postseason have come under Cashmman.uti ve A-Sun ti tle, earning the league's automtomati c bidence crown, it marked the fi rst league ti tlee in school

nd Antonio Sierra, earned all-conference fi first-teamd team. For the second-straight season, thhe squad

ft er guiding his team to a 20-4 record andd a perfecter of the year award and Gursoy took thee freshman

ol history in 2002. On their way to a 17-4 overall and al rankings, the highest spot in school histtory.ts faced the toughest schedule in school history androught a more experienced team and twwo talented

14-7 overall and posted upset victories oover No. 45

rence competition Prior to leaving the leeague the

BOBBY CASHMAN • HEAD COACH • 11th SEASON

Page 16: UCF Men's Tennis Yearbook

UCF KNIGHTS

16

TENNIS STAFF

SHELBY BALLAcademic Advisor • First Season

NICK ZIEZIULAAssistant Coach • Second Season

BEN FLEMINGStrength & Conditioning • Second Season

Nick Zieziula is in his second campaign as an assistant coach at UCF. He joined the UCF staff in July 2008 aft er three seasons as an assistant at Buff alo. With the Knights, Zieziula assists with recruiti ng, practi ce organizati on and individual instructi on. He is also responsible for managing the Knights’ video analysis. In his fi rst year in Orlando, Zieziula helped the Knights enjoy a successful campaign. UCF entered the nati onal rankings in March aft er a win over No. 59 Florida Atlanti c. Zieziula mentored Blaze Schwartz, who recorded 15 victories in dual-match play and earned a spot on the All-Conference USA Second Team. UCF also shined off the courts in 2008-09 as six Knights received C-USA Commissioner’s Academic Honor Roll status. Zieziula was a standout student-athlete at Buff alo. When he concluded his four-year career in 2005, he was the Bulls’ all-ti me leader in both singles wins (69) and doubles victories (65) at the Division I level. As a senior, he garnered All-Mid-American Conference Second Team honors. Zieziula was a UB Scholar Athlete and an Academic All-MAC honoree in 2003-04. He earned his bachelor’s degree in psychology. During his ti me as an assistant at his alma mater, Zieziula also served as a part-owner of a pro shop and worked as a teaching professional.

Ben Fleming is in his second year as an assistant strength and conditi oning coach. He supervises the strength and conditi oning programs for men’s and women’s golf, rowing, cross country, men’s and women’s tennis and cheerleading. He is a certi fi ed strength and conditi oning coach (SCCC) by the Collegiate Strength and Conditi oning Coaches Associati on (CSCCA) of which he is also a member. He holds a level one coaching certi fi cati on from USA Weightlift ing as well as being Etcheberry Certi fi ed by Pat Etcheberry, one of the top tennis and golf strength and conditi oning coaches in the world. Fleming earned a bachelor’s of science in parks and recreati on administrati on from Wingate where he was also a member of the soccer team. In 2009, he earned a master’s degree in health/wellness and applied exercise physiology from UCF.

Shelby Ball is in her fi rst year at UCF. As a coordinator of academic advising services at Academic Services for Student-Athletes, she oversees men’s soccer, men’s tennis and varsity rowing. She also manages the SABRE Center Computer Lab, and is an acti ve member of the Nati onal Associati on for Academic Advisors (N4A). Ball earned her bachelor’s degree in psychology from Texas in 2007. She went on to att ain an AACSB-Accredited M.B.A in Sport Management from Florida Atlanti c. In the process of earning her master’s degree, she served as an intern at the Student-Athlete Center for Academic Excellence at FAU, where she mentored, tutored and advised football and basketball student-athletes, in additi on to the university’s other NCAA-sponsored athleti c teams.

Page 17: UCF Men's Tennis Yearbook

MEN’S TENNIS

17

2010 ROSTERName Class Height Hometown/Previous SchoolJohan Beigart Sr. 6-3 Vaxjo, Sweden/KatedralskolanJoe Delinks So. 6-0 Falmouth, Mass./FalmouthEugene Dolgovykh So. 6-2 Palm Coast, Fla./MatanzasMarc Rocafort Sr. 6-4 Barcelona, Spain/Middle TennesseeClaudio Romano So. 6-1 Valencia, VenezuelaBrock Sakey Sr. 6-3 Gulf Breeze, Fla./Gulf BreezeMario Samson Fr. 5-10 Miami, Fla./La SalleBlaze Schwartz Jr. 5-10 Pensacola, Fla./Washington

2010 PREVIEW Looking forward to the spring season, UCF head coach Bobby Cashman believes that the ti me has arrived for the Knights to take the spotlight in Conference USA. “I am excited for them as a group; we have been waiti ng pati ently for years. We really want it, they really want it, you can tell. They are hungry to prove that they are a viable opti on.” Aft er fi ve successful tournaments in the fall, the Knights are moving confi dently into their spring campaign. “During the fall, our levels of play picked up once everyone was more comfortable and match ready. The team fi nished on a positi ve note which was good for the level of play they faced,” noted Cashman. This year is unique for the Knights; they have an older team. With three seniors and two juniors, depth will be a key role. “There will always be a teammate there to step up and win,” said Cashman. Senior Johan Beigart returns for his fi nal collegiate campaign aft er registering an 11-9 mark last spring that included a 7-2 record at the No. 4 spot. Beigart also went 7-1 in doubles competi ti on with Blaze Schwartz. “He is one of our interchangeable players, making him an asset,” noted Cashman. “In Beigart you see unique strengths you do not see in any of the other players.” Two seniors are also returning strong aft er injuries last spring – Marc Rocafort and Brock Sakey. With Sakey only able to play in two tournaments and Rocafort’s arduous season last spring, Cashman has the Knights being extra careful with workouts. Letti ng them rest when they are ti red, trying to prevent injuries, with what they call “prehab.” “Brock is healthy and got a lot of playing ti me this fall,” said Cashman. “Marc is fi nally serving like he used to – bigger and bett er, now winning that free point.” Aft er being selected to the All-C-USA Second Team in 2009, Schwartz is ready for the competi ti on ahead. Schwartz led UCF with a 15-6 singles mark, including 9-6 at No. 3 and 5-0 at No. 4, last spring. Aft er his undefeated run with Rocafort in doubles at the USF Invitati onal in the fall, Cashman is sure that they will be ranked this spring. “Aft er some inconsistency this fall, Blaze played well in the end,” added Cashman. “He has improved on all the things we have been working on.” Aft er sitti ng out the enti re 2009 spring season due to injury, sophomore Claudio Romano worked hard last fall in preparati on for the spring. “Claudio puts a lot more into the game than expected. He is tough on himself, he feels comfortable during play, and has been hitti ng the ball well,” raved Cashman. Last season, Joe Delinks and Eugene Dolgovykh were two key members of the team as freshmen. Delinks recorded six singles wins last spring, and Dolgovykh won two matches at the C-USA shootout. Together the two took the doubles draw ti tle at the FSU Invitati onal during the fall. In the fall, freshman Mario Samson was able to compete for the fi rst ti me. Samson fi nished the fall campaign with a winning record, taking the singles D crown at the UCF Invitati onal. “The younger players will allow me to be able to rest some guys, which we haven’t been able to do in the past. They will defi nitely see playing ti me,” noted Cashman. “As the youngest player, Mario has grown quicker than I thought, not just physically, but he has also matured a lot being around serious players.” With the return of many strong players, the Knights hope to keep up the momentum from the fall campaign and move confi dently into the spring. The squad will begin the season at the USF Spring Invitati onal. Aft er their trip to Tampa, the schedule does not get any easier as the team travels to Gainesville where they will meet No. 11 Florida. The Knights will face eight squads that fi nished the 2009 campaign ranked among the top-75 teams in the country. “We have chances with ranked teams throughout the season, some of which we saw in the fall. Now we have to believe we are a good team,” said Cashman. “The team will keep it competi ti ve because they care about each other.”

Senior Brock Sakey is ready for the spring slate aft er an injury that kept him out of the lineup last spring.

Junior Blaze Schwartz was selected to the All-Conference USA Second Team in 2009 aft er leading UCF with a 15-6 singles mark.

Page 18: UCF Men's Tennis Yearbook

UCF KNIGHTS

18

JOHAN BEIGARTSenior • 6-3 • Vaxjo, Sweden • Katedralskolan

MARC ROCAFORTSenior • 6-4 • Barcelona, Spain • Middle Tennessee

2009 - FALL SEASON• Won two matches at the FSU Invitati onal, including a 6-3, 7-6 (4) victory over Florida State’s Anderson Reed• With Blaze Schwartz, posted an 8-2 win over Florida State’s Aaron May and Anderson Reed• With Mario Samson, defeated South Carolina’s David Wolff and Chris Sheehan at the UCF Invitati onal, 8-5• Along with Joe Delinks had two doubles wins at the USF Invitati onal over Miami and USF

2008-2009 SEASON• Recorded an 11-9 mark in the spring• At the No. 4 spot, went 7-2 in the spring• Went 3-0 at No. 4 at the Conference USA Shootout• Posted a 6-3, 6-3 win at No. 4 over Denis Ermilov of No. 70 East Carolina• Against Samford, topped Carson Kadi (6-3, 6-3) at No. 2• Went 7-1 in doubles competi ti on with Blaze Schwartz• The pair was 5-1 at the No. 1 positi on• With Schwartz, posted a 9-8 (7-4) win over 53rd-ranked Darren Walsh and Adham el-Eff endi at No. 1 at the C-USA Championship• Joined Schwartz to go 3-0 at No. 1 at the C-USA Shootout• Went 5-4 in tournament play in the fall• In doubles acti on, went 3-2

2007-2008 SEASON• Selected to the All-Conference USA Second Team • Won nine contests in dual-match play

• Went 4-0 at the No. 3 spot in the spring• Rallied to post a 1-6, 7-5, 6-3 win at No. 3 over Corey Smith of No. 72 Florida Atlanti c• Eased to a 6-2, 7-5 win against No. 36 USF’s Jamaal Adderly• At No. 2, knocked off Cornell’s Joshua Goldstein (3-6, 6-2, 6-2)• Won two matches at the C-USA Shootout, including a 6-2, 6-3 victory at No. 1 over UAB’s Hans Spangenberg• In doubles play, recorded an 11-7 record with Brock Sakey• Also went 3-0 with Niko Overkemping at No. 1• With Overkemping, won at No. 1 against No. 70 UAB’s Tyrone Ewels and Slawomir Szermeta, 8-4, at the C-USA Championship• With Overkemping, knocked off No. 32 Rice’s Tobias Schiel and Ralph Knupfer (8-5)• Went 4-3 in singles acti on in the fall• Was victorious at the UCF Fall Invitati onal against North Florida’s Javier Ferrin, 6-7 (5), 7-5, 10-2• Compiled a 5-1 record in doubles

2006-2007 SEASON• Named to the All-Conference USA Second Team• Registered a 17-6 singles mark in the spring• At the No. 3 positi on, held an 11-2 record • Went 6-1 at the No. 4 spot in the spring• Prevailed at the No. 4 spot against 15th-ranked Florida’s Billy Mulligan (4-6, 6-0, 6-0)• Went 9-8 in doubles with Sinan Sudas• Opened collegiate career with a 4-1 singles mark• At the UCF Fall Invitati onal, went 3-0• Recorded a 7-6 (5), 6-4 win against Ben Smith of

North Florida• Topped Daniel Harden of Georgia Southern (6-1, 6-1)

PRIOR TO UCF• Ranked in Sweden’s 21 and under division• Was a singles quarterfi nalist at the under-21 nati onal championship and a semifi nalist in doubles• Was mentored by former UCF star David Winberg in Sweden

PERSONAL• Born in Vaxjo, Sweden• Son of Lars and Ingegard Beigart• Majoring in interdisciplinary studies

2009 - FALL SEASON• Went 1-1 at the Southern Intercollegiates• Facing Jamal Adderly and Romain Deridder of USF at the Southern Intercollegiates, joined Blaze Schwartz for an 8-2 win• With Schwartz, took the doubles A ti tle at the UCF Invitati onal with an 8-4 victory over South Carolina’s Ivan Cressoni and Johannes Pulsfort • At the UCF Invitati onal posted a 6-3, 6-2 victory over South Carolina’s Ivan Machado• Won two matches at the USF Invitati onal, including a 6-2, 7-5 victory over Carl Sunberg of Miami• Went undefeated with Schwartz in doubles play at the USF Invitati onal

2008-2009 SEASON• In singles acti on, went 10-9 in the spring• Won three matches at the No. 1 positi on • Facing No. 70 East Carolina’s Stephen Whitwell at No. 1, rallied for a 3-6, 6-1, 6-0 triumph at the Conference USA Shootout• Topped Winthrop’s Roy Sichel (6-3, 6-4) at No. 1• Against Daniel Vardag of No. 47 Florida Atlanti c, recorded a 6-3, 6-0 win at No. 2• At 29th-ranked Auburn, handled Milan Krnjeti n (6-4, 6-1) at No. 4• Registered a 6-4, 6-1 victory at No. 3 over North Florida’s Kurt Gatti ker• Went 5-2 in doubles acti on with Eugene Dolgovykh, with all fi ve wins coming at No. 3• Facing Robin Fahgen and Gaston Cuadranti of No. 68 SMU at the C-USA Championship, joined Dolgovykh for an 8-4 win• Along with Dolgovykh, topped Gustave Diep and Stefan McKinney (8-6) of No. 67 New Mexico State• Recorded a 3-0 mark in singles play in the fall• Won the fl ight A crown at the C.L. Varner Memorial Invitati onal• Topped Stetson’s Njal Stene in the fi nals, 7-5, 4-6, 6-1• Also defeated Rollins’ Neil Clausen (6-4, 6-2) and Emmanuel Fraitzl of Barry (6-3, 6-1) at the tournament• Competed in one doubles match with Johan Beigart at the event

2007-2008 SEASON• Competed for two years at Middle Tennessee• Went 11-10 in dual-match play in the spring• Defeated three ranked foes during the spring• Spent three weeks during the dual-match season in the nati onal rankings, moving as high as 88th on March 4• Posted a 6-2, 7-6 (6) win at No. 1 over 99th-ranked

Piotre Banas of Louisiana-Lafayett e at the Sun Belt Championship• Held on to defeat ninth-ranked Jack Baker of South Alabama (6-3, 2-6, 6-2) at No. 1• Facing Indiana’s Phillip Eilers at No. 2, rallied for a 3-6, 7-5, 1-0 (10-8) win• Eased past 46th-ranked Raoul Schwark of Minnesota (6-1, 6-4)• Went 5-5 during the fall campaign in the fall• Won a pair of matches at the MT Fall Invitati onal, including a 6-1, 6-3 victory over 98th-ranked Amrit Narasimhan of Memphis• Also won two matches at the Southern Intercollegiates

2006-2007 SEASON• Won 16 contests during the dual-match season, including 10 at the No. 3 spot• Ended the campaign by winning six-consecuti ve contests• In the fall, posted a team-high 10 singles victories• Advanced to the round of 32 at the ITA Southeast Championship

PERSONAL• Born in Barcelona, Spain• Son of Luis Rocafort and Olsa Dolc• Majoring in business - fi nance

Page 19: UCF Men's Tennis Yearbook

MEN’S TENNIS

19

BROCK SAKEYSenior • 6-3 • Gulf Breeze, Fla.• Gulf Breeze

BLAZE SCHWARTZJunior • 5-10 • Pensacola, Fla. • Washington

2009 - FALL SEASON• Defeated Magin Orti ga, 2-6, 6-4, 1-0 (10-5), of Georgia Tech at the Southern Intercollegiates• Won the singles C crown at the UCF Invitati onal• Had a 6-2, 6-2 win over South Carolina’s David Wolff at the UCF Invitati onal• Registered a 6-7, 6-2, 1-0 (13-11) win over USF’s Juan Carlos at the USF Invitati onal

2008-2009 - SEASON• Named to the Conference USA Commissioner’s Academic Honor Roll• Only appeared in two spring matches due to an injury• Posted a 7-3 singles mark in the fall• Recorded a 6-2, 6-1 victory over Virginia Tech’s Preston Lemon at the Southern Intercollegiate Championship• Competed at the D’Novo All-American Championship and collected a 2-6, 7-5, 6-1 win against Francois Van Lampe of Nebraska• In doubles play, went 7-0 with Joe Delinks

2007-2008 - SEASON• Earned a spot on the Conference USA Commissioner’s Academic Honor Roll• Won 13 singles ti lts during spring dual-match play • Went 6-3 at the No. 3 spot• Also posted a 6-3 mark at No. 4• Defeated Brian Ly, 6-4, 4-6, 6-3, of No. 70 UAB at the C-USA Championship• Went 2-1 at the C-USA Shootout• Registered an 11-7 mark in doubles with Johan Beigart• At the USF Invitati onal, eased to an 8-1 win against Virginia Tech’s Brandon Corace and Albert Larregola

with Beigart• Registered a 6-3 mark in singles acti on in the fall• Beat Arkansas’ Dmitry Lebedev (2-6, 6-3, 6-1) in the pre-qualifying round of the All-American Tennis Championships• Compiled a 5-1 record in doubles

2006-2007 - SEASON• Selected to the Conference USA Commissioner’s Academic Honor Roll• Registered an 11-10 singles mark in the spring• Went 2-2 at No. 3; at the No. 4 and No. 5 spots, posted 4-4 records• Against UNC-Greensboro’s Jason Steinhorn at No. 4, was a 6-0, 6-0 winner• Facing Hector Neito of No. 11 Miami at No. 5, recorded a 3-6, 6-3, 1-0 (10-8) win• Won 15 matches in doubles play with Norman Alcantara• The duo was ranked as high as 55th nati onally in doubles• Posted a 5-3 record in the fall• At the UCF Fall Invitati onal, went 3-0

2005-2006 - SEASON• Named the Conference USA Freshman of the Year• Garnered C-USA Commissioner’s Academic Honor Roll accolades• Won 16 matches in the spring• Went 4-2 at No. 4 and 9-2 at the No. 5 spot• At the C-USA Championship versus UAB, posted a 6-4, 6-4 victory at No. 4 over Andre Maier• Defeated Juan Barragan of USF, 6-2, 6-4, at No. 4• Won all three matches at the UCF/C-USA Shootout,

including a 6-3, 2-6, 6-1 win over Andrew Poole of Southern Miss at No. 4• Led UCF with fi ve total singles wins in the fall

PRIOR TO UCF• Advanced to the Florida Class 2A state ti tle match as a senior• Named the Northwest Florida Player of the Year in 2005

PERSONAL• Born in Gulf Breeze, Fla.• Son of Brian Sakey• Earned his undergraduate degree in marketi ng at UCF• Working on his master’s in sports and fi tness

2009 - FALL SEASON• Posted a win against Wake Forest’s Amogh Prabhaker, 6-4, 6-4, at the Southern Intercollegiates• Defeated Bethune-Cookman’s Marc Masinovic, 6-3, 6-2, at the FSU Invitati onal• With Johan Beigart, posted an 8-2 win over Florida State’s Aaron May and Anderson Reed• Took the Singles B ti tle over South Carolina’s Chris Sheehan with a 6-1, 6-3 victory at the UCF Invitati onal• With Marc Rocafort, took the doubles A ti tle at the UCF Invitati onal with an 8-4 victory over South Carolina’s Ivan Cressoni and Johannes Pulsfort • Went undefeated with Rocafort in doubles play at the USF Invitati onal

2008-2009 - SEASON• Selected to the All-Conference USA Second Team

• Earned a spot on the C-USA Commissioner’s Academic Honor Roll• Led UCF with a 15-6 singles mark in the spring• Went 9-6 at No. 3 and 5-0 at No. 4• Began the year with a 4-6, 6-0, 6-1 triumph at No. 5 over Marko Ballok of No. 13 Tulsa• In doubles play, recorded a 7-1 mark with Johan Beigart• The pair went 5-1 at the top spot• With Beigart, registered a 9-8 (7) win over 53rd-ranked Darren Walsh and Adham el-Eff endi of SMU at the C-USA Championship• The tandem posted three wins at the top spot at the C-USA Shootout• Also went 2-1 with Danny Colón• Recorded a 7-2 singles mark in the fall• Claimed the fl ight B ti tle at the C.L. Varner Memorial Invitati onal• Went 4-2 in doubles acti on• Along with Joe Delinks, defeated Georgia State’s Trenton Spinks and Henri Mangin, 8-4, at the USF Invitati onal• Also bested Florida Gulf Coast’s Danny Lee and Ervin Garibovic, 8-5

2007-2008 - SEASON• Earned Intercollegiate Tennis Associati on All-Scholar Athlete honors• Named to the Conference USA Commissioner’s Academic Honor Roll• Recorded a 9-2 mark in singles, all at the No. 6 positi on in spring• Missed the fi rst half of the spring campaign due to an injury• Topped No. 72 Florida Atlanti c’s Joe Cadogan, 6-4, 6-2• Took a 6-1, 6-4 win against Murilo Marti ns of Louisiana-Lafayett e• Prevailed at No. 57 UC-Irvine against Ryan Mayer

(6-1, 6-4)• Posted a 6-3, 3-6, 6-1 win over No. 51 Tennessee Tech’s Mario Guti errez• Defeated USF’s Thomas Estrada (6-4, 6-1)• Registered a 6-2 doubles record with Tarek Ben Soltane• Teamed with Sinan Sudas to defeat No. 70 UAB’s Dan Cornei and Alex Emery, 8-5, at No. 3 at the C-USA Championship• Prevailed over James Crawford and Mario Guti errez of No. 51 Tennessee Tech, 8-1, at No. 3• Recorded an 8-3 singles mark in the fall• Knocked off Jacksonville’s Jordi Ballester, 6-4, 1-6, 6-3, at the Seminole Invitati onal• Topped Rollins’ Jack Barrett (6-1, 6-0) at the C.L. Varner Memorial Invitati onal• Also defeated Ray Duyungan, 6-0, 6-1, at the tournament• Went 6-1 in doubles

PRIOR TO UCF• Played for coach Krissy Mayew at Washington High School• Florida Class 2A state doubles champion in 2007• Helped lead Washington to the Florida Class 2A state ti tle• Named the Pensacola News-Journal Boys Tennis Athlete of the Year in 2006• Was listed in the top 30 in the United States Tennis Associati on Florida junior rankings• Ranked in the top 15 in doubles• Achieved a perfect 4.0 grade-point average in high school

PERSONAL• Born in Pensacola, Fla.• Son of Jay and Babett e Schwartz• Majoring in politi cal science

Page 20: UCF Men's Tennis Yearbook

UCF KNIGHTS

20

JOE DELINKSSophomore • 6-0 • Falmouth, Mass. • Falmouth

EUGENE DOLGOVYKHSophomore • 6-2 • Palm Coast, Fla. • Matanzas

2009 - FALL SEASON• Registered a 6-2, 6-2 victory over Florida State’s Owen Long at the FSU Invitati onal• Along with Eugene Dolgovykh, took the doubles draw ti tle at the FSU Invitati onal with a 9-7 victory over North Florida’s Graham Edgar and Daniel Sotomarino• With Dolgovykh, posted an 8-6 victory over South Carolina’s Chris Sheehan and David Wolff at the UCF Invitati onal• Along with Johan Beigart had two doubles wins at the USF Invitati onal over Miami and USF

2008-2009 SEASON• Named to the Conference USA Commissioner’s Academic Honor Roll• Recorded six singles wins in the spring• Went 4-4 at No. 6• Registered a 6-4, 6-3 win over Stephen Shao at No. 4• Topped Matej Stakne of No. 67 New Mexico State, 6-1, 6-3, at No. 5• At No. 29 Auburn, recorded a 6-3, 6-2 victory over Michel Monteiro at No. 6• Opened the campaign with a 6-2, 6-1 win over Bethune-Cookman’s Vitor Belucci at No. 6• In doubles played mostly with Tarek Ben Soltane• Went 4-3 in singles play in the fall• At the USF Invitati onal, posted a 6-1, 6-3 victory over Florida Gulf Coast’s Frank Acierno• Beat LSU’s Andrew Meyers, 6-0, 6-0, at the UCF Invitati onal• Compiled a 10-2 record in doubles• Advanced to the semifi nals of the Southern Intercollegiate Championship with partner Brock Sakey• The pair posted an 8-1 win over Middle Tennessee’s Alex McCann and Kyle Wishing• The duo also topped Jacksonville’s Murilo Souza and Victor Vaz, 9-8 (2)

PRIOR TO UCF• Captured the 2008 Massachusett s Interscholasti cAthleti c Associati on individual championship• Went 31-0 in singles play for Falmouth High School as a senior

• Concluded high school career with a 72-0 singles mark• Earned all-scholasti c honors three ti mes from the Boston Herald• Named to the Boston Globe all-scholasti c squad as a senior• Ranked fourth in the United States Tennis Associati on New England Under-18 list• As a junior, led Falmouth to an 18-0 mark and the state division I ti tle

PERSONAL• Born in Falmouth, Mass.• Son of Donald and Patricia Delinks• Majoring in environmental studies

2009 - FALL SEASON• Along with Joe Delinks, took the doubles draw ti tle at the FSU Invitati onal with a 9-7 victory over North Florida’s Graham Edgar and Daniel Sotomarino• Took a 6-1, 6-2 victory over JU’s Andrew Lerner at the FSU Invitati onal• With Delinks, posted an 8-6 victory over South Carolina’s Chris Sheehan and David Wolff at the UCF Invitati onal• At home, during the UCF Invitati onal, defeated Sheehan of South Carolina, 6-0, 7-5• At the USF Invitati onal, defeated Barnabas Carrega of Miami, 6-4, 6-0

2008-2009 - SEASON• Earned a spot on the Conference USA Commissioner’s Academic Honor Roll• Went 10-10 in singles play during the spring• At the No. 4 spot, recorded a 4-4 mark• Won two matches at the C-USA Shootout• Facing No. 59 Florida Atlanti c, registered a 7-5, 6-4 victory over Santi ago Nieto at No. 5• At No. 29 Auburn, rallied for a 3-6, 6-2, 7-6 (5) win over Alex Petropoulos at No. 5• Against Erik Corace of seventh ranked Florida at No. 5, posted a 7-6, 6-3 win• In doubles play, went 5-2 with Marc Rocafort• Joined Rocafort at No. 3 for an 8-4 victory over Robin Fahgen and Gaston Cuadranti of No. 68 SMU at the C-USA Championship• Also played with Joe Delinks and Tarek Ben Soltane• Posted a 7-2 singles record in the fall• Won the fl ight six ti tle at the USF Invitati onal• Concluded the event with a 6-4, 6-3 win over USF’s Yanick Yoshizawa• Collected a 6-2, 6-0 victory over Georgia State’s William Adeimy at the UCF Invitati onal• Also topped David Roberts of LSU, 6-2 5-7, 6-3, at the tournament

• Recorded a 4-1 doubles mark• At the USF Invitati onal, joined Danny Colón for an 8-5 win against USF’s Alex Pukal and Mark Oljaca

PRIOR TO UCF• Earned All-America honors as a senior at Mantanzas High School• A fi ve-star player according to Tennisrecruiti ng.net• Ranked 42nd nati onally and 13th in the southeast in 2008• Went 18-1 in singles play as a senior and helped lead team to the regional fi nals• Garnered Daytona Beach News-Journal Player of the Year honors• In June 2008, advanced to the round of 16 at the United States Tennis Associati on Florida Closed Singles Championship• Claimed the 18s Winter Secti onal in January 2008• Ranked fourth in Florida at the under-18 level

PERSONAL• Born in Riga, Latvia• Son of Alexander and Natalia Dolgovykh• Majoring in business management

Page 21: UCF Men's Tennis Yearbook

MEN’S TENNIS

21

CLAUDIO ROMANOSophomore • 6-1 • Valencia, Venezuela

MARIO SAMSONFreshman • 5-10 • Miami, Fla. • La Salle

2009 - FALL SEASON• Parti cipated in the Southern Intercollegiates• Won two matches at the FSU Invitati onal, including a 4-6, 6-3, 7-6 (1) victory over Florida’s Dan Cash• With Mario Samson, posted an 8-4 victory in the quarterfi nals of the FSU Invitati onal against John Hollimon and Thomas Petrich• At the UCF Invitati onal defeated Ivan Machado of South Carolina, 6-2, 6-1• With Brock Sakey, had an 8-4 victory over South Carolina’s Ivan Cressoni and Johannes Pulsfort at UCF Invitati onal• Defeated Alex Hill of Georgia, 7-5, 6-1, at the ITA Southern Regional Championship

• Captured a 6-4, 5-7, 1-0 (10-3) victory over Julien Gauthier of LSU at the USF Invitati onal

2008-2009 - SEASON• Named to the Conference USA Commissioner’s Academic Honor Roll• Did not play due to injury during the spring• Went 5-1 in singles acti on in the fall• Finished with a 3-0 record at the USF Invitati onal and claimed the fl ight two ti tle• Defeated Georgia State’s Jackson Moore, 6-1, 6-1, and Florida Gulf Coast’s Andrew Kam, 6-2, 6-4• Also topped 91st-ranked Jamal Adderley of USF (6-4, 6-2) at the tournament• Won both matches at the UCF Invitati onal• Topped Georgia State’s Nejc Podkrajsek, 7-6 (7), 6-2, and LSU’s Sebasti on Carlsson, 3-6, 6-3, 7-5• Posted a 3-2 doubles record• Won two doubles ti lts at the USF Invitati onal with Johan Beigart• The pair topped Jackson Moore and Nejic Podrajsek of Georgia State, 8-6

2007-2008 - SEASON• Registered a 12-6 record in singles play• At the No. 5 positi on, went 10-0 during the spring• Won one match at No. 3 and also claimed a victory at the No. 4 spot• Defeated No. 44 Denver’s Andrew Landwerlen 7-6 (8), 6-2 at No. 5• Prevailed at No. 5 versus 57th-ranked UC-Irvine’s Stephen Stege (6-1, 6-4)• Posted a win against Cal Poly’s Alexander Sonesson

at No. 5, 4-6, 6-3, 6-0• Knocked off Juan Pablo Gomez of No. 51 Tennessee Tech at No. 5 (6-2, 6-0)• At No. 5, defeated East Carolina’s Bryan Oakley, 6-1, 6-1• In doubles play, went 8-8 with Sinan Sudas• Defeated Cornell’s Kyle Doppelt and Weston Nichols at No. 1 with Sudas (8-4)• Posted a 7-5 record in singles acti on in the fall• Defeated Florida Gulf Coast’s Steve Binninger, 6-3, 6-1, at the C.L. Varner Memorial Invitati onal• Went 3-1 in doubles during the fall• With Johan Beigart, defeated Florida Gulf Coast’s Gonzalo Da Villa and Danny Lee, 8-2, at the UCF Fall Invitati onal

PRIOR TO UCF• Was ranked 164th out of more than 2,000 players in the Internati onal Tennis Federati on• Registered a 36-24 career record in singles in the ITF• Had a 29-21 record in doubles• In 2007, was a doubles fi nalist at the Uruguay Bowl• Was ranked No. 1 in his age group in 2000, 2002, 2004 and 2006• Mentored by Willy Campos and Ott o Sarquis

PERSONAL• Born in Valencia, Venezuela• Son of Claudio and Rosaluisa Romano• Majoring in computer science

2009 - FALL SEASON• Took the singles D crown at the UCF Invitati onal aft er defeati ng South Carolina’s Harry Menzies 6-2, 4-6, 7-6 (3)• With Johan Beigart, defeated South Carolina’s David Wolff and Chris Sheehan at the UCF Invitati onal, 8-5• Had two singles wins at the USF Invitati onal, including a 6-4, 6-3 victory over Hector Nieto of Miami

Prior to UCF• In January 2009, parti cipated in the USA F1 Futures tournament in Boca Raton, Fla., recording a fi rst-round victory• As a junior at La Salle, joined Santi ago Nieto to win the Florida Class 2A doubles ti tle• Garnered Miami Herald All-Dade County Second Team honors• Ranked second in Paraguay in his age group in 2004 and 2006• Was mentored by his uncle, Ricardo Mena

Personal• Born in Asuncion, Paraguay• Son of Betti na and Mario Samson• Majoring in engineering

Page 22: UCF Men's Tennis Yearbook

UCF KNIGHTS

22

AAkesson, Mati as, 1995-97Alcantara, Norman, 2005-07Allen, Craig, 1992-93Allen, Joel, 2003-05Andersson, Fredrik, 1992-94Arecco, Andres, 1991-92Atherton, Scott , 1983-84Auge, Jean, 1992-93

BBadalucco, Bob, 1987-90Barnard, Neil, 1977-78Barrett , Mike, 1981-83Bauer, Jeff , 1983-84Baxter, Doug, 1976-78Beigart, Johan, 2006-PresentBen Soltane, Tarek, 2005-09Berg, Eric, 1991-92Bolanos, Salvador, 1989-90Bradu, Catalin, 2001-04Brass, Drew, 1978-79Brick, Merrill, 1992-93Brodrick, Wayne, 1991-92Brunskog, Pelle, 1996-98Bryant, Steve, 1974-78Buoni, Greg, 1982-83Burrows, Todd, 1991-92

CCail, Tom, 1986-87Carlstrom, Christi an, 1992-94Camacho, Federico, 1998-01Chafe, Dave, 1979-84Chappell, Gilbert, 1979-82Cochran, Mark, 1986-87Cohen, David, 1986-87Cohen, Jeff , 1984-85Colett a, Jason, 1994-96Colón, Danny, 2006-09Collins, Scott , 1985-86Conkling, Ray, 1988-89Crabel, Toby, 1976-78Curry, Pat, 1986-89

DDavis, Jeff , 1983-88DeFranco, Mike, 1982-85Delgado, Sebasti an, 2004-06Delinks, Joe, 2008-PresentDertein, Joe, 1976-77DeZeeuw, Mike, 1973-74Diez, Francisco, 1987-88Dolgovykh, Eugene, 2008-Present

EEngle, Lenny, 1981-86

FFeistmann, Jon, 1994-95Feldman, Marty, 1987-89Fowler, Jeff , 1980-81

GGarcia, Esteban, 1995-97Garcia, Juan, 1994-95Goldfarb, David, 1991-93Grguric, Marko, 1994-97Guerin, William, 1998-01Gunderson, Mark, 1977-78Gursoy, Ener, 2002-07

HHall, Jim, 1976-77Hargett , Bradley, 1995-96Heinerman, Brad, 1985-86Hicks, Dan, 1978-79Horne, Brian, 1991-96Huber, Steve, 1988-89

IImhoff , Sean, 1987-88

JJackson, Ken, 1987-90Jaeger, Simon, 2001-05Jankovic, Goran, 1995-97

KKahn, Brian, 1992-94Kanaan, Adam, 1999-02Kessler, Carl, 1985-86Kjoraas, Jesper, 1993-95Kjoraas, Matti as, 1996-98Krass, Ed, 1978-82

LLangill, Kyle, 1979-82Lucci, Tom, 1976-79

MMarti nez, Fernando, 1998-00Marti s, Sigmund, 1997-98Moore, David, 1999-00Moore, Grayden, 1999-00Morris, Jeff , 1985-86Muzio, Robert, 1997-99

NNelson, Don, 1984-85Novak, Greg, 1997-99Novak, Jiri, 1994-96

OO’Brien, Charlie, 1984-85Overkemping, Niko, 2007-08

PPacheco, Mauricio, 1992-95Pacheco, Pedro, 1995-99Perez, Jose, 1986-88

RRamy, Paul, 2001-05Rocafort, Marc, 2008-PresentRocchio, Ricardo, 1992-95Rodgers, Mike, 1983-85Roesch, Jimmy, 2005-07Romano, Claudio, 2007-PresentRosen, Rhett , 2001-05

SSakey, Brock, 2005-PresentSanabria, Augusto, 1999-03Schwartz, Blaze, 2007-PresentScott , Jim, 1978-79Seay, Jackson, 1980-81Sebring, Trip, 1985-86Segfeldt, Patrik, 1994-96Shea, Jim, 1977-78Sheriff , Duane, 1980-81Sierra, Antonio, 2001-05Snoyenbous, Todd, 1982-86Stauble, David, 1978-80Stetzer, Bill, 1977-78Stone, Vince, 1984-85Strangberg, Gabriel, 2000-04Sudas, Sinan, 2004-08Sundin, Mike, 1980-81Sutt on, Mark, 1987-92

TTandjung, Teddy, 1996-98Trombetti , Todd, 1992-94

WWali, Alamgir, 2005-06Watf ord, Mark, 1976-77Westi n, Johan, 1998-02Willems, Gerben, 1993-94Williams, Brian, 1989-92Winberg, David, 1998-99Winnegren, Pat, 1984-85Winter, Ryan, 2000-01

ZZebendon, J., 1986-87

LETTERWINNERS

Catalin Bradu

Page 23: UCF Men's Tennis Yearbook

MEN’S TENNIS

23

David Winberg

CONFERENCE USA FRESHMAN OF THE YEARBrock Sakey 2006

ALL-CONFERENCE USA SECOND TEAMBlaze Schwartz 2009Johan Beigart 2007, 2008Sinan Sudas 2006

ATLANTIC SUN PLAYER OF THE YEARCatalin Bradu 2003David Winberg 1999Mati s Akesson 1997Christi an Carlstrom 1994

ATLANTIC SUN FRESHMAN OF THE YEAREner Gursoy 2003Gabriel Strangberg 2001

ATLANTIC SUN COACH OF THE YEARBobby Cashman 2003, 2005

ALL-ATLANTIC SUN FIRST TEAMJoel Allen 2005Ener Gursoy 2005Antonio Sierra 2004Catalin Bradu 2002, 2003, 2004Gabriel Strangberg 2002, 2003Federico Camacho 2001David Winberg 1998, 1999Pelle Brunskog 1997, 1998Mati as Akesson 1996, 1997Jesper Kjoraas 1995Christi an Carlstrom 1994

ALL-ATLANTIC SUN SECOND TEAMSinan Sudas 2005Joel Allen 2004Ener Gursoy 2004

ATLANTIC SUN ALL-FRESHMAN TEAM Sinan Sudas 2005Ener Gursoy 2003Paul Ramy 2002

ALL-ATLANTIC SUN HONORABLE MENTIONGabriel Strangberg 2001Federico Camacho 2000William Guerin 2000

UCF MOST VALUABLE PLAYERBlaze Schwartz 2008Johan Beigart 2007Brock Sakey 2006Joel Allen 2005Ener Gursoy 2005Antonio Sierra 2004Ener Gursoy 2003Catalin Bradu 2003Catalin Bradu 2002Gabriel Strangberg 2001Fedrico Camacho 2000

UCF COACHES’ AWARDTarek Ben Soltane 2008Brock Sakey 2007Sinan Sudas 2006Rhett Rosen 2005UCF Team 2004Catalin Bradu 2003Augusto Sanabria 2002Adam Kanaan 2001Johan Westi n 2000

ITA ALL-ACADEMIC TEAM1997, 1998, 2001, 2002

ITA SCHOLAR-ATHLETEBlaze Schwartz 2008Jimmy Roesch 2006Sinan Sudas 2006Simon Jaeger 2003, 2004, 2005Catalin Bradu 2003, 2004Adam Kanaan 2001, 2002Johan Westi n 2001, 2002Teddy Tandjung 1998Pelle Brunskog 1997, 1998Mati as Akesson 1997

ESPN THE MAGAZINE All-DISTRICT III TEAMCatalin Bradu 2004Johan Westi n 2002

CONFERENCE USA COMMISSIONER’S ACADEMIC MEDALJimmy Roesch 2006, 2007

CONFERENCE USA COMMISSIONER’S HONOR ROLLNiko Overkemping 2008Brock Sakey 2006, 2007, 2008Blaze Schwartz 2008Sinan Sudas 2006, 2007, 2008Norman Alcantara 2006

ATLANTIC SUN MALE STUDENT-ATHLETE OF THE YEARMati as Akesson 1997

NATIONAL STUDENT-ATHLETE DAY AWARDAugusto Sanabria 2000David Winberg 1999

ATLANTIC SUN ALL-ACADEMIC TEAMSimon Jaeger 2002, 2003, 2004, 2005Paul Ramy 2002, 2003, 2005Sinan Sudas 2005Catalin Bradu 2001, 2002, 2003, 2004Jacob Auerbach 2003Rhett Rosen 2001, 2003Adam Kanaan 2000, 2001, 2002Antonio Sierra 2001, 2002Gabriel Strangberg 2001, 2002Johan Westi n 1999, 2000, 2001, 2002William Guerin 1999, 2000, 2001Federico Camacho 1999David Winberg 1998, 1999Pelle Brunskog 1997, 1998Sigmund Marti s 1998Greg Novak 1998Pedro Pacheco 1997, 1998Constanti ne Spiliotpoylos 1998Teddy Tandjung 1997, 1998Mati as Akesson 1996, 1997Marko Grguric 1996, 1997Goran Jankovic 1996, 1997Jason Colett a 1996Brian Horne 1995, 1996Jiri Novak 1995, 1996Jonathon Feitsmann 1995Esteban Garcia 1995Jesper Kjoraas 1995Mauricio Pacheco 1995Richard Rocchio 1994, 1995Magnus Wikstrom 1995Frederik Anderson 1994Christi an Carlstrom 1994Frederic Menou 1994Gerben Williams 1994

UCF ACADEMIC ACHIEVEMENT AWARDBrock Sakey 2008Jimmy Roesch 2006, 2007Simon Jaeger 2005Catalin Bradu 2004Simon Jaeger 2004Catalin Bradu 2003Johan Westi n 1999, 2000, 2001, 2002

HONORS

Page 24: UCF Men's Tennis Yearbook

UCF KNIGHTS

24

UCF is no stranger to the NCAA Championships. The Knights have made three trips to the postseason in the last eight years, all under head coach Bobby Cashman. The program also claimed three conference championships during that span.

In its fi nal season in the Atlanti c Sun Conference in 2005, UCF went out on top with the league ti tle. Seeded third at the conference championship in DeLand, Fla., the Knights posted a 4-2 victory over top-seeded Troy in the ti tle match. UCF won 13 contests during the campaign. Following the A-Sun Championship, Cashman was named the league’s coach of the year. Joel Allen and Ener Gursoy were both selected to the all-conference fi rst team. Sinan Sudas garnered All-A-Sun Second Team honors and was also named to the all-freshman squad.

The Knights served as the top seed at the 2004 A-Sun Championship in Macon, Ga. Cashman’s squad recorded a 4-0 win over Campbell to earn its second-straight conference championship crown. Cashman guided UCF to 15 victories in 2004. Several Knights earned individual accolades for their play. Catalin Bradu and Antonio Sierra both earned spots on the All-A-Sun First Team. Allen and Gursoy were named to the league’s second team.

UCF began its impressive run in the A-Sun in 2003, winning the fi rst league ti tle in school history at the Division I level. At the tournament in DeLand, top-seeded UCF breezed past the competi ti on on its way to the championship match. The Knights defeated No. 2 Georgia State, 4-1, in the ti tle contest to earn the conference’s automati c bid to the NCAA Championship. Prior to 2003, the Knights had never advanced to the NCAA Championships at the D-I level. The school joined the D-I ranks in 1985.

The Knights won 20 matches in 2003 as Cashman was named the A-Sun Coach of the Year for the fi rst ti me. Bradu was honored as the league’s player of the year. Gursoy was recognized as the A-Sun Freshman of the Year. Bradu joined Gabriel Strangberg on the All-A-Sun First Team. In additi on to earning the freshman of the year honor, Gursoy was selected to the all-freshman squad.

Each ti me that it has played in the postseason, UCF has faced nati onal power Florida in the opening round of the NCAA Championships in Gainesville.

2005 Atlanti c Sun ChampionsRecord: 13-9Head Coach: Bobby CashmanAssistant Coach: Eleazar MagallanTeam MVP: Ener GursoyJoel Allen, Brandon Delanois, Sebasti an Delgado, Ener Gursoy, Simon Jaeger, Paul Ramy, Rhett Rosen, Antonio Sierra, Sinan Sudas

2004 Atlanti c Sun ChampionsRecord: 15-9Head Coach: Bobby CashmanAssistant Coach: Fernando Marti nezTeam MVP: Antonio SierraJoel Allen, Catalin Bradu, Ener Gursoy, Simon Jaeger, Paul Ramy, Rhett Rosen, Antonio Sierra, Gabriel Strangberg

2003 Atlanti c Sun ChampionsRecord: 20-4Head Coach: Bobby CashmanAssistant Coach: Fernando Marti nezTeam MVP: Ener GursoyJacob Auerbach, Catalin Bradu, Ener Gursoy, Simon Jaeger, Rhett Rosen, Augusto Sanabria, Antonio Sierra, Gabriel Strangberg

CHAMPIONSHIP TEAMS

Ener Gursoy was a member of UCF’s NCAA Championship teams in 2003, 2004 and 2005. Gursoy was the team MVP in 2003.