1 The emergence of different resistance mechanisms towards ...
Transcript of 1 The emergence of different resistance mechanisms towards ...
1
The emergence of different resistance mechanisms towards nucleoside
inhibitors is explained by the properties of the wild type HIV-1 reverse
transcriptase
Catherine Isel§, Chantal Ehresmann, Philippe Walter, Bernard Ehresmann and Roland Marquet
UPR9002 du CNRS, IBMC, 15 rue René Descartes, 67084 Strasbourg cedex, France
§To whom correspondence should be addressed: Catherine Isel
Tel: 00 33 (0)3 88 41 70 40/ Fax : 00 33 (0)3 88 60 22 18 / [email protected]
Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on October 19, 2001 as Manuscript M108352200 by guest on A
pril 7, 2018http://w
ww
.jbc.org/D
ownloaded from
2
Nucleoside reverse transcriptase inhibitors (NRTIs) represent one of the main drug families
used against AIDS. Once incorporated in DNA, they act as chain terminators, due to the lack of
a 3' hydroxyl group. As for the other anti-HIV-1 drugs, their efficiency is limited by the
emergence of resistant viral strains. Unexpectedly, previous studies indicated that resistance
towards NRTIs is achieved via two distinct and generally exclusive mechanisms. Resistance
mutations either decrease the efficiency of NRTIs incorporation, or increase their excision from
the extended primer. To understand the emergence of different resistance mechanisms
towards a single inhibitor class, we compared the incorporation and the pyrophosphorolysis of
several NRTIs using wild-type reverse transcriptase (WT RT). We found that the efficiency of
discrimination or excision by pyrophosphorolysis in the presence of nucleotides of a given
NRTI is a key determinant in the emergence of one or the other resistance pathway. Indeed, our
results suggest that the pathway by which RT become resistant towards a given NRTI can be
predicted by studying the inhibition of WT RT, because the resistance mutations do not confer
new properties to the mutant enzyme, but rather exacerbate pre-existing properties of the WT
enzyme. They also help to understand the low cross-resistance towards d4T observed with the
AZT-resistant RT.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
3
Introduction
Reverse transcription is a key event in the replication cycle of retroviruses. The virally encoded
reverse transcriptase (RT), an RNA- and DNA dependent DNA polymerase, converts the viral (+) RNA
genome into a double stranded DNA (1) that will integrate into the host genome. Reverse
transcriptase (RT) of human immunodeficiency virus type 1 (HIV-1), the causative agent of the
acquired immunodeficiency syndrome (AIDS), is the target for two families of therapeutic: non
nucleoside inhibitors (NNRTIs) and nucleoside analogues (NRTIs).
Amongst the group of nucleosides used in multi-therapies, two compounds are analogues of
thymidine, 3’-azido-3’ deoxythymidine (AZT or zidovudine) and 2’,3’didehydro-2’,3’–dideoxythymidine
(d4T or stavudine), two are cytidine analogues , 2’,3’ dideoxycytidine (ddC or zalcitabine) and β-L-(-)-
2’,3’-dideoxy-3’-thyacytidine (3TC or lamivudine), one is an adenosine analogue, 2’, 3’-dideoxyinosine
(ddI or didanosine), and one is a guanosine analogue, abacavir. Those nucleoside analogues are
metabolically activated by host cellular kinases to their corresponding triphosphate forms (for review
see (2)) which are incorporated into the DNA by HIV-1 RT. The base moiety of didanosine and
abacavir are also modified during this process, generating ddATP and ddGTP, respectively (for an
overview, see http://www.niaid.nih.gov/daids/dtpdb/fdadrug.htm). Due to the lack of a 3’ OH group on
the ribose ring, NRTIs act as chain terminators by blocking further elongation of the nascent DNA,
leading to inhibition of viral replication. The efficiency of a nucleoside as an inhibitor and hence the
effectiveness of the therapy depends on i) the cellular uptake of the compound and its activation into
the triphosphate form ii) the incorporation of the analogue into the DNA and iii) the removal of the
incorporated chain terminator.
Prolonged use of NRTIs in clinical treatment and in cell culture of HIV-1 invariably give rise to
resistant viruses bearing substitutions in the pol gene. Patients treated with AZT display a set of up to
6 mutations in the pol gene involving M41L/D67N/K70R/L210W/T215F or T215Y/K219Q which confer
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
4
a >100-fold AZT resistance to HIV-1. When d4T is given as the only drug to patients naive to AZT, RT
bearing a V75T substitution is selected in 10% of the cases (3). Notably, the most important resistance
mutations associated to treatment with d4T are in fact AZT-associated resistance mutations (4).
Resistance to ddC, ddI and 3TC are conferred by single mutations in the pol gene, which map to
K65R (5,6), L74V (7), located in the finger subdomain of RT, and M184V (8-10), in the catalytic site,
respectively.
In principle, the resistance mutations could act either by i) decreasing the incorporation
efficiency of the triphosphate form of the NRTI or ii) increasing the removal of the incorporated NRTI.
In fact, the two latter mechanisms are now well documented.
Retroviral RTs lack 3’-exonuclease proof-reading activitiy (11) but are capable of
pyrophosphorolysis, the reversal reaction of polymerisation, releasing an unblocked, extensible DNA
chain and the analogue triphosphate (12,13). It has been reported that AZT resistance mutations lead
to enhanced excision of AZT from the nascent DNA strand by pyrophosphorolysis (14-16), although
this observation was not confirmed by other groups (17,18). More recently, it was shown that the AZT-
resistant enzyme, can efficiently unblock AZT-terminated primers by transfer of the chain terminator to
a nucleoside triphosphate, most likely ATP in vivo, in a reaction similar to pyrophosphorolysis (16,18-
20). In addition, it has been shown that AZT-resistant RT binds AZTMP-terminated primers more
tightly than WT RT does (21). Moreover, removal by ATP-lysis of d4TMP from the primer terminus is
more efficient with AZT-resistant enzyme as compared to WT RT, but only when the concentration of
the next incoming nucleotide is low (19).
Most of the resistance mutations associated with the other nucleoside analogues cluster into a
different mechanism, whereby the acquisition of the mutation interferes with nucleoside incorporation
into the DNA. Resistance to 3TC, due to M184V/I mutations in the RT, most likely involves steric
hindrance, decreasing either binding of the analogue (22,23) or the rate of incorporation (24). Recent
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
5
structural data show that the incoming 3TCTP is able to form a close complex with the primer/template
(P/T):RT which is however less stable than in the presence of the normal nucleotide (25). In addition, it
was shown that the 3TC-resistant enzyme has very poor pyrophosphorolysis and ATP-lysis properties
on 3TCMP- or AZTMP-terminated primers (16). Similarly, mutations K65R (26) and L74V (27) also
confer resistance to RT by decreasing the incorporation efficiency of NRTIs. Finally, the molecular
mechanism underlying d4T resistance has very recently been investigated, showing that the V75T
mutation changes both nucleotide selectivity and repair of d4TMP-terminated DNA chains by PPi, but
not ATP (28), unlike the situation with the AZT-resistant enzyme.
In order to understand the emergence of different resistance mechanisms towards a single
class of inhibitors, we performed a study on AZTTP, d4TTP, ddCTP, 3TCTP and ddATP, the
metabolised products of inhibitors used in the clinic, using WT HIV-1 RT. We conducted a comparative
study of the incorporation and the pyrophosphorolysis, in the presence or absence of the next
incoming nucleotide, of these NRTIs. We found that the efficiency of NRTI discrimination or excision
by pyrophosphorolysis in the presence of the next incoming nucleotide by WT RT was a key
determinant in evolution towards one or the other resistance pathways. Indeed, our results suggest
that the pathway by which RT will evolve to become resistant towards a given inhibitor can be
predicted by studying the inhibition of WT RT by this inhibitor. In addition, comparison of our results
with those published by others (6,14-16,18-20,24,27-29) using resistant RTs indicate that the
resistance mutations do not confer new properties to the mutant enzyme, but rather exacerbate pre-
existing properties of the WT enzyme towards a given inhibitor. They also help to understand the
existence of low cross-resistance towards d4T observed with the AZT-resistant RT (30).
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
6
MATERIALS AND METHODS
Templates, primers and RTs
Viral RNA encompassing nucleotides 1-311 of HIV genomic RNA (Mal isolate) was used as a
template. It was synthesised by in vitro transcription and purified as previously described (31). We also
used as a template a 38-mer oligodeoxyribonucleotide (DPBS20) carrying, in addition to the primer
binding site (PBS) sequence, 20 nucleotides of the HIV-1 Mal sequence upstream of the PBS.
Natural tRNA3Lys, used as a primer, was purified from beef liver as previously described (32).
After dephosphorylation with calf intestine phosphatase, it was labelled at the 5’ end with [γ-32ATP] and
phage T4 polynucleotide kinase. An 18-mer oligodeoxyribonucleotide (ODN) complementary to the
PBS, labelled at the 5’ end with phage T4 polynucleotide kinase, was also used as a primer.
Chimerical primers, consisting of analogue-terminated-ODN primers were prepared as follows: 5’ end-
labelled ODN was hybridised to DPBS20 in 100 mM NaCl for 20 min at 70°C prior to extension at
37°C for 1 hour with 7.5 µM RNase H(-) HIV-1 RT using the appropriate set of dNTP and chain
terminator (AZTTP, d4TTP, ddTTP, 3TCTP, ddCTP and ddATP), at 0.2 mM each, in 50 mM Tris-HCl
(pH 8), 50 mM KCl, 6 mM MgCl2, 1 mM DTE, to obtain the expected analogue-terminated primer. After
proteinase K treatment and phenol/chloroform extraction, the chimerical primers were ethanol
precipitated and purified on 15% denaturing polyacrylamide gels.
Plasmids used for production of WT and RNase H(-) HIV-1 RT, bearing the E478Q mutation
were kindly provided to us by Dr. Torsten Unge (Uppsala, Sweden), together with the protocols for
protein over expression and purification.
For primer/template (P/T) formation, the primers were quantitatively heat-annealed with RNA
or DNA templates at a 1:2.5 ratio, as described previously (33).
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
7
RT assays
Minus strand strong-stop DNA synthesis. Ten nM of P/T (tRNA3Lys /1-311 RNA or ODN/1-311
RNA) were pre-incubated at 37°C for 4 min with 20 nM HIV-1 RT (WT or RNase H (-)) in 50 mM Tris-
HCl (pH 8), 50 mM KCl, 6 mM MgCl2, 1 mM DTE. Reverse transcription was initiated by addition of 50
µM of each dNTP, in the presence or absence of 5 µM chain terminator (AZTTP, d4TTP, ddTTP,
3TCTP, ddCTP and ddATP) and 150 µM PPi. The reaction was stopped at various times ranging from
1 min to 3 hours by addition of one volume of formamide containing 50 mM EDTA, and the reaction
products were analysed on 8% denaturing polyacrylamide gels and quantified with a BioImager BAS
2000 (Fuji).
+1 rescue of DNA synthesis from analogue-terminated primers. Ten nM of analogue-
terminated primer/template were pre-incubated at 37°C for 4 min with 200 nM of RNase H(-) HIV-1
RT. Reactions were initiated by addition of 150 µM PPi, 50 µM of the dNTP corresponding to the
analogue present at the end of the chain and 50 µM of the next complementary ddNTP, allowing
synthesis of the +1 product with respect to the analogue. Reactions were stopped at various times
from 30 s to 3 hours and the products analysed as described above.
Primer unblocking by pyrophosphorolysis. Pyrophosphorolysis reactions were performed
essentially as described above, except that the reaction was initiated by addition of 150 µM PPi to the
P/T/RT complex, in the absence of nucleotides.
Electrophoretic Mobility Shift Assay
The 5’ end-labelled, chain-terminated primer (ODN)/template (DPBS20) were incubated for 10
min at room temperature with a 25 fold excess of RNase H(-) RT and increasing concentrations of the
next incoming dNTP (Fig. 2), in 40 mM Hepes (pH 7.5), 20 mM MgCl2, 60 mM KCl, 1 mM DTE, 2.5%
glycerol and 100 µl/ml Bovine Serum Albumin. The reaction mixture was further incubated at 37°C for
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
8
5 min, after the addition of KCl (to 100 mM final) and poly(rA)/oligo(dT) to 0.3 OD260 unit/ml. The
mixture was then cooled on ice prior to analysis on a 6% non-denaturing polyacrylamide gel. Both the
gel and the migration buffer contained 45 mM Tris-borate (pH 8.3) and 50 mM KCl.
Quantification and curve fitting.
For all experiments, quantification of the radioactivity and curve fitting were performed with
MacBAS 2.5 (Fuji) and IGOR Pro 3.1 (WaveMetrics, Inc.) softwares, respectively.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
9
RESULTS
A number a studies compared the relative incorporation of NRTIs and their natural
counterpart. Indeed, it has been shown that wild-type (WT) HIV-1 RT barely discriminated between
dTTP and AZTTP (34,35) or d4TTP (36). On the contrary, ddCTP was incorporated less efficiently
than dCTP (22), and incorporation of 3TCTP was even worse (22,24). Finally, ddATP was also shown
to be a moderately efficient substrate for WT HIV-1 RT (37). However, these data were obtained using
different experimental conditions and P/T complexes and can hardly be used to compare the inhibitory
efficiency of these nucleotide analogues. In addition, to our knowledge, no detailed pre-steady state
kinetics of the pyrophophorolysis of NRTIs has been performed, and thus, the available data
(16,18,19) are hardly amenable to quantitative comparison. Therefore, we undertook a comparative
study of the incorporation and pyrophosphorolysis of the available NRTIs by WT HIV-1 RT, with the
aim of understanding the emergence of two distinct resistance mechanisms for this class of RT
inhibitors.
Minus strong-stop DNA synthesis in the presence of nucleoside analogues
First, we performed (-) strand strong-stop DNA synthesis experiments using as a template a
viral RNA encompassing the first 311 nts of the 5’ end of the HIV-1 Mal genome and as a primer either
the natural tRNA3Lys or a DNA oligodeoxyribonucleotide complementary to the PBS (ODN). Using ODN
as a primer allows DNA synthesis to start immediately in the processive elongation mode (38,39). In
the absence of nucleoside analogues and PPi, when tRNA3Lys was used as a primer (Fig. 1A, left
panel), reverse transcription proceeded as previously described (38). During the initiation phase, i.e.
the addition of the first 6 nucleotides to the tRNA3Lys, the +3 and +5 products accumulated at short
incubation times (1 min) but disappeared after prolonged incubation. Quantification of the gels
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
10
indicated that, after 1 to 3 hours of incubation, the amount of (-) strand strong-stop product
represented 14% of the total radioactivity.
When 5 µM of a given inhibitor was added to the reaction, taking it at 1/10 the dNTP
concentration, the inhibition rate varied (Fig. 1B, C, D, E and F, left panels). Calculation of the
percentage of final product in the presence of each analogue, relative to no inhibitors (Table I),
allowed us to classify the nucleoside analogues according to their efficiency of inhibition : AZTTP was
the most effective inhibitor, followed by ddCTP, d4TTP, ddATP and 3TCTP. The results followed the
same trend when ODN was used as a primer for reverse transcription (data not shown). Overall, these
results are qualitatively in keeping with the previous studies discussed above, except for ddCTP,
which was expected to be a significantly weaker inhibitor than d4T (22,36).
As expected, addition of the T-analogues to the reaction induced arrest of reverse
transcription where As were present in the template, e.g. at positions +2 and +5, or at positions 157,
155, 150, 147 (compare Fig. 1A, left panel, to Fig. 1B and C, left panels). C-analogues (3TC and ddC)
did not seem to be incorporated efficiently at position +1. However, they were undoubtedly
incorporated at position +4 and at the other expected sites on the template (Fig. 1D and E, left
panels). The same holds true for ddATP, which was incorporated at position +6 and further along,
where Ts are present in the template (Fig. 1F, left panel).
Addition of physiological concentrations of PPi (150 µΜ) (40) did not significantly affect the
synthesis of (-) strand strong-stop DNA in the absence of inhibitor (Fig. 1A, right panel), the amount of
this product representing 12% of the total radioactivity after 1 to 3 hours of incubation. At short
incubation times, the pauses of RT were more pronounced. However, theses pauses rapidly
disappeared with increased incubation times.
When PPi was added to the reaction in presence of the nucleoside analogues, synthesis of
longer DNA chains, including the (-) strand strong-stop product, was partially restored, with various
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
11
efficiencies depending on the inhibitors (Fig. 1B, C, D, E and F, right panels). The highest level of DNA
repair observed was with the AZT/PPi combination. The rescue ratio, calculated as the ratio between
the percentage of (-) strand strong-stop DNA in the absence and presence of PPi for a given inhibitor
was 6 fold (Table I). When ODN was used as a primer, the rescue ratio was 30 fold (data not shown),
in agreement with previously published results showing that repair was not occurring during the
initiation step of reverse transcription (35). Consistently, the intensity of the band at position +2, within
the initiation complex, did not diminish with the addition of PPi to the reaction.
Using the same type of calculation, we determined the rescue ratio for the other nucleoside
analogues used in this assay (Table I), allowing us to asses their ability to be removed from the end of
the pr imer in the presence of the four natural dNTPs as fo l lows:
AZTTP>>d4TTP>ddCTP=3TCTP=ddATP. The same conclusions were drawn from experiments
performed with ODN as primer (data not shown).
+1 extension of T analogue-terminated primers in the presence of PPi
As the incorporation efficiency during (-) strand strong stop DNA differed among the various
NRTIs, the efficiency of primer unblocking and extension in the presence of PPi could not strictly be
compared in these experiments. To further address the issue of unblocking of analogue-terminated
DNA chains, and in order to reduce the complexity of the reaction to a minimum by monitoring the
rescue of DNA synthesis at only one position, we quantitatively prepared three T-analogue-terminated
primers, ODN-dC-AZTMP, ODN-dC-d4TMP and ODN-dC-dTMP (Fig. 2). Those primers were
hybridised to either 1-311 viral RNA or a DNA oligodeoxyribonucleotide, DPBS20 (see the Material
and Methods section) acting as a template. Hybrids were pre-incubated with HIV-1 RT and the repair
of T-analogue-terminated primers was initiated by addition of PPi, dTTP, the correct nucleotide to be
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
12
incorporated in place of AZTMP, d4TMP, or ddTMP, and ddGTP, corresponding to the next
complementary ddNTP, to stop the reaction at the following position on the template (Fig. 2).
The time course experiment presented in Fig. 3A shows that WT HIV-1 RT repaired
considerably more efficiently AZTMP- than d4TMP- or ddTMP-terminated primers. Indeed, synthesis
of the ODN-dC-dT-ddG product reached nearly completion (93%) after 1 hour incubation in the first
case, (Fig. 2A and B) while repair was much less efficient when ddTMP or d4TMP were the chain
terminators (44% and 23% after 1 hour incubation, respectively) (Fig. 3A and B). The experimental
data presented in Fig. 3A were fit to a first order rate equation and the rate constants of the repair
reaction were summarised in Table II. Interestingly, the repair rate constant of AZTMP-terminated
primers was 4 times higher than the one observed with the other T-analogue terminated primers. The
same results were obtained with the two types of hybrids described above.
Comparison of the pyrophosphorolysis rate of T-analogue terminated primers
In order to test whether diminished rates of repair of d4TMP- and ddTMP-terminated primers
as compared to AZTMP-terminated DNA chains were due to the presence of the next incoming
nucleotide, we compared the rate of pyrophosphorolysis of primers terminated by the chain
terminators cited above or by dTMP. The P/T hybrids were prepared as described previously, pre-
incubated with HIV-1 RT and the reaction was initiated by addition of PPi (Fig.2). As shown in Fig. 4A,
pyrophosphorolysis conducted in the absence of nucleotides revealed no important differences
between the four T-analogue-terminated primers. Quantification of the data and curve fitting (Fig. 4B)
further proved this statement, since the pyrophosphorolysis rate constants were all in the same range
(Table II). Remarkably, the T-analogues were removed as efficiently as the unmodified parent
nucleotide.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
13
Since the rate of T-analogue incorporation (34-36,41) is 4 to 5 orders of magnitude faster than
the overall repair reaction rates listed in the first column of Table II, the rate limiting step of the repair
reaction must be pyrophosphorolysis in the presence of the next incoming nucleotide (19). Thus,
differences between the two columns of Table II correspond to the effects of the next incoming
nucleotide on pyrophosphorolysis. Our results indicate that primer unblocking, allowing subsequent
repair, was inhibited about ten fold by the presence of the next incoming nucleotide in the case of
d4TMP- and ddTMP- terminated DNA chains, but only a two fold when AZT was used as inhibitor.
Repair and pyrophosphorolysis of the C- and A-analogue terminated primers
We next used the same experimental strategy to investigate the repair and unblocking of C-
and A-analogue-terminated primers (Fig. 2). As shown in Table II, the initial rate constants for the
combined removal reaction and further extension of C-analogue terminated primers were similar for
3TC and ddC-terminated primers. These values were slightly lower than the ones obtained previously
with d4T and ddT.
In addition, the initial rate constants for pyrophosphorolysis were also in the same range when
comparing the two C-analogues. Noticeably, these rates were 5-8 fold lower as compared to dCMP-
terminated primers and around 10 fold lower than those measured in the case of T-analogues.
Contrary to what we observed with the T-analogues, we did not detect any significant inhibition of the
pyrophosphorolysis of the C-analogues in the presence of the next incoming nucleotide (Table II).
The last family of inhibitors we studied were A-analogues. ddATP is the activated triphosphate
form of ddI, given as such to the patients. Surprisingly, repair of ddAMP-terminated primers was hardly
detectable (Table II) even though pyrophosphorolysis was taking place at a rate higher than the one
obtained for ddCTP-terminated primers (Table II). Pyrophosphorolysis of a dAMP-terminated primer
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
14
was also measured (Table II). Similarly to the situation with dCTP, the rate constant we found for that
reaction was also lower than the one obtained with dTTP.
The difference between T analogue- and other dNMP-terminated primers that we point out in
this pyrophosphorolysis assay could either be due to an intrinsic difference in the pyrophosphorolysis
rate linked to the nature of the nucleotide, or could reflect a context dependent phenomenon.
Addressing this issue would need the construction of mutant templates that would permit the different
end of the primers to be replaced in the same sequence context. This is of interest but was not the aim
of our study.
Efficiency of P/T:RT:dNTP complex formation
The results presented so far, together with similar experiments performed by others using
resistant RTs (14-16,18,19), suggest that the efficiency of a NRTI depends not only on its efficiency to
be incorporated and removed from the end of the DNA chain, but also on the sensitivity of the removal
reaction to the inhibition by the next incoming nucleotide. The latter observation is biologically
relevant, since the “incoming dNTP” used in our experiments is representative for the pool of dNTP
present in cells. It was suggested that analogue-terminated primers can follow two distinct pathways
(18): either the next incoming nucleotide does not bind efficiently and the removal reaction via
pyrophosphorolysis or ATP-lysis will be favoured, or, on the contrary, the repair reaction is impaired by
the next incoming nucleotide binding efficiently in a quaternary P/T:RT:dNTP complex, resulting in the
formation of a so called dead-end complex (DEC) (18,19,42). These DEC, formed at low salt
concentration, remain stable in a “higher” salt buffer (100-150 mM KCl) and can be visualised on non-
denaturing polyacrylamide gels. The increased stability is due to the closed conformation of the
polymerase, where the fingers of HIV-1 RT fold onto the P/T, once the incoming nucleotide is bound
(43).
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
15
According to our results, the primer rescue pathway should be favoured when AZTTP is the
chain terminator, with AZTMP-terminated P/T:RT:dGTP complexes being unstable whereas ddAMP-
terminated complexes should be amongst the most stable ones. To test this hypothesis, formation of
DEC was investigated for the three T-analogue terminated P/Ts. Incubation of HIV-1 RT with the
different hybrids and with increasing concentrations of dGTP, the next complementary nucleotide (Fig
2) showed that DEC was formed less readily by AZTMP-terminated primers as compared to the two
other T-analogue-terminated primers (Fig. 5A). Quantification of these data revealed that the most
stable complex was obtained with d4TMP as a chain terminator, followed by ddTMP and AZTMP (Fig.
5B). These results are in agreement with the +1 rescue experiments previously described. We next
tested the ability of ddAMP-terminated P/T to form the closed ternary complex in the presence of
dGTP. As predicted, this complex was highly stable (Fig. 5B): at the highest dGTP concentrations
tested, the same amount of complex was obtained as compared to d4T, but at low concentrations of
incoming dGTP (10 µM), the ddAMP-terminated P/T complex was significantly more stable. Finally,
our results also showed that a ddCMP-terminated P/T formed a weakly stable DEC, in keeping with
the absence of inhibition of the pyrophosphorolysis of the corresponding primer by the next incoming
nucleotide. Unexpectedly, we were unable to detect any DEC formation when the primer was
terminated by 3TCMP.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
16
DISCUSSION
NRTIs represent the largest familly of drugs approved for treatment of AIDS. Even though
multi-therapy treatments combining NRTIs, NNRTIs and protease inhibitors are relatively efficient,
they fail to totally eradicate the virus from the body of infected patients (44). The major problem is the
emergence of viral strains resistant to the inhibitors as a result of point mutations in the gene encoding
the viral RT and protease. Numerous studies using recombinant RTs bearing the NRTI resistance
mutations have been performed. Their general goal was to test whether the in vitro assays with the
mutant RTs could account for the resistance observed in vivo and in cell culture, and hence, to
elucidate the resistance mechanism(s). From these studies, two distinct resistance pathways towards
NRTIs emerged. Some RT mutations lead to enhanced excision of the analogue (principally AZT, and
to a lesser extent d4T) from the nascent DNA strand (14-16,18-20,28); other mutations (mainly single
point mutations) reduce the efficiency of incorporation of the nucleotide into the DNA (24-27). The
goal of the present study was different. Our aim was to understand why two different resistance
mechanisms emerged against a single class of inhibitors. More specifically, we wanted to know
whether the mechanism by which RT becomes resistant towards a particular NRTI could be predicted
from in vitro studies using WT RT. Therefore, we compared the incorporation and the
pyrophosphorolysis, by WT RT, of several NRTIs used in the clinic.
We first compared the efficiency of inhibition of NRTIs in an in vitro assay of (-) strand strong
stop DNA synthesis. In the absence of PPi, the efficiency of DNA synthesis inhibition was
AZT>>ddC>d4T>ddA>3TC. Interestingly, with the exception of ddC, the NRTIs for which resistance
arise via a decreased incorporation are those that are the less efficiently incorporated in our assay. In
agreement with our data, Arts et al. (45) also found that ddC efficiently inhibits (-) strand strong stop
DNA synthesis. However, pre-steady state kinetics showed that WT HIV-1 RT very efficiently
discriminates against ddCTP on a DNA template (22). Therefore, it appears that if WT RT efficiently
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
17
discriminates a nucleoside analogue from its natural counterpart, resistance is very likely to evolve by
further increasing this discrimination. Obviously, the mutation(s) increasing the negative discrimination
might differ from one analogue to another and cannot be predicted from the simple experiments
described here. On the contrary, AZT, which is the most efficient NRTI, because WT RT hardly
discriminates between AZTTP and dTTP (34,35,41), gives rise to another resistance mechanism.
By comparing the inhibition of (-) strand strong stop DNA synthesis by NRTIs in the absence
and presence of physiological concentrations of PPi (40), we could evaluate the efficacy of the rescue
provided by pyrophosphorolysis. Interestingly, in this assay, WT RT repaired efficiently the AZTMP-
terminated primers and moderately the d4TMP-terminated primers, while those terminated by other
NRTIs were very poorly repaired. Thus, the NRTIs that select resistance mutations enhancing the
removal of the nucleoside analogue from the primer termini (AZT and d4T) (14-16,18-20,28) are
precisely those that can be efficiently excised by WT RT by pyrophosphorolysis. Indeed, our study
indicates that AZT and d4T are the only NRTIs used in the clinic that were pyrophosphorolysed as
efficiently as their natural counterpart. In other words, if WT RT efficiently excised an incorporated
NRTI in the presence of the complete pool of natural dNTPs, it will select resistance mutations that
enhance repair of the blocked primers, rather than increasing counter-selection of this substrate.
Thus, our results strongly suggest that the mechanism by which HIV-1 will become resistant to
a given NRTI can be predicted from in vitro inhibition studies conducted with WT RT in the absence
and presence of PPi. This finding implies that resistance mutations exacerbate pre-existing properties
of WT RT, rather than conferring new properties to the mutant polymerase.
A particular case is that of d4T, which is at the border between the two resistance
mechanisms. Our results, as well as previous data, indicate that WT RT very poorly discriminates
against d4T (36), and that d4TMP is poorly excised from the primer termini by the WT polymerase in
the presence of rather high concentrations (50 µM) of dNTP (19). Strikingly, resistance against d4T is
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
18
mediated either by mutations enhancing excision (M41L/D67N/K70R/L210W/T215F or T215Y/K219Q)
(4) or by a mutation enhancing discrimination (L75V) (28). Interestingly, both resistance mechanisms
proved rather inefficient (<2 and 8 fold, respectively), as compared to the resistance provided by the
M41L/D67N/K70R/L210W/T215F or T215Y/K219Q mutations towards AZT (180 fold), or by the
M184V mutation towards 3TC (>100 fold) (http://resdb.lanl.gov/Resist_DB/default.htm). Once again,
these observations are in keeping with our proposal that resistance mutations only increase the pre-
existing capabilities of WT RT rather than creating new ones. Starting with poor excision and
discrimination capabilities of WT RT towards d4T, mutations can only provide limited resistance. On
the contrary, high basal discrimination (against 3TC) or excision (of terminal AZTMP) by the WT RT
allow mutations to confer a high level of resistance.
Our results also help to understand the cross-resistance between d4T and AZT. It had been
previously concluded, from phenotypic assays obtained from cell culture, that AZT-resistant HIV-1 is
not cross-resistant to d4T (46,47). However, d4T treatment selects for AZT resistance mutations (for
review, see (48)), and prior exposure of patients to AZT reduces the efficiency of subsequent
treatment with d4T (30). However, our results, as well as other (19), showed that the excision
mechanism, which is enhanced by the AZT-resistance mutations, might be largely underestimated in
the phenotypic assays performed at high nucleotide concentration, while this mechanism might be
efficient in cells with low dNTP pools.
Parniak and co-workers suggested that the M41L/D67N/K70R/L210W/T215F or T215Y/K219Q
mutations provide resistance towards AZT by increasing pyrophosphorolysis. More recently, Scott and
co-workers demonstrated that the resistant RT is able to unblock the primer strand by transferring the
terminal AZTMP to ATP, whereas this reaction is inefficient with WT RT (18,20). However, we observe
a remarkable parallel between our study of the PPi-mediated primer unblocking by WT RT, and the
ATP-mediated unblocking by the AZT-resistant RT studied by Scott and co-workers (18-20). Indeed,
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
19
they showed that, in the absence of the next incoming nucleotide, ATP-mediated unblocking is
efficient with both AZT- and d4T-terminated primers, but that addition of the next nucleotide strongly
inhibits removal of d4TMP (19). Similarly, ATP-lysis of terminal ddAMP by the AZT-resistant RT was
efficiently inhibited by DEC formation (18). We observed exactly the same pattern of inhibition of
pyrophosphorolysis by the incoming nucleotide in the presence of WT RT. All together, these results
showed that the AZT-resistance mutations, while favouring the use of the most abundant substrate
(ATP, instead of PPi), essentially do not affect the fundamental features of the unblocking reaction.
Interestingly, molecular modelling, based on the crystal structure of a ternary P/T:RT:incoming
dNTP complex (43), also indicated that the specificity of the excision reaction for AZTMP-terminated
primers is not due to the mutations that confer resistance, but depends instead on the structure
around the RT polymerase active site (49). Based on their model, Boyer et al. proposed that the P/T
complex is in equilibrium between polymerisation (P) and nucleotide (N) sites of RT. PPi or ATP
mediated excision could take place only when the P/T is in the N site. In the case of AZTMP-
terminated primers, the bulky azido group on the ribose ring makes a steric clash with the catalytic
Mg2+ bound to D185 when in the P site, thus favouring binding in the N site, and hence nucleotide
excision (49). This model correctly accounts for our pyrophosphorolysis data obtained in the presence
of the next nucleotide. However, it would predict that pyrophosphorolysis of AZTMP should also be
more efficient than that of d4TMP or ddTMP in the absence of nucleotides, contrary to our
observations. In addition, since the next complementary nucleotide and PPi (or ATP) compete for
binding to the same Mg ions in the catalytic site, (43), one would expect that all excision reactions
should be, at least partially, inhibited by the next incoming nucleotide. However, we observed that
pyrophosphorolysis of terminal ddCMP and 3TCMP took place essentially at the same rate in the
absence and presence of the next nucleotide. All these data show that although the excision
mechanism is being progressively better understood, the phenomenon is not fully elucidated yet.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
20
Understanding the behaviour of WT HIV-1 RT towards the existing inhibitors provides
important insights into the mechanism by which mutations selected during drug therapy can give rise
to drug resistant forms of the enzyme. Such experiments are important in order to predict the evolution
towards resistance and the possible cross-resistance. They are also indispensable for the evaluation
of new inhibitors and for rational design of novel nucleosides.
Acknowledgements
This work was supported by a grant from the “Agence Nationale de la Recherche contre le Sida” and a
“Jeunes Equipes” grant from the Centre National de la Recherche Scientifique to R.M. We thank M.
Rigourd for helpfull discussions, T. Unge who kindly provided us the clones for HIV-1 RT and G. Bec
and G. Keith for purification of tRNA3Lys.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
21
REFERENCES
1. Skalka, A. M., and Goff, S. P. (eds) (1993) Reverse Transcriptase, Cold Spring Harbor
Laboratory Press, N.Y.
2. Guedj, R. (1999) Virologie 3, 17-28
3. Coakley, E. P., Gillis, J. M., and Hammer, S. M. (2000) Aids 14(2), F9-15.
4. Lin, P. F., Gonzalez, C. J., Griffith, B., Friedland, G., Calvez, V., Ferchal, F., Schinazi, R. F.,
Shepp, D. H., Ashraf, A. B., Wainberg, M. A., Soriano, V., Mellors, J. W., and Colonno, R. J.
(1999) Antivir Ther 4(1), 21-8
5. Gu, Z., Gao, Q., Fang, H., Salomon, H., Parniak, M. A., Goldberg, E., Cameron, J., and
Wainberg, M. A. (1994) Antimicrob Agents Chemother 38(2), 275-81.
6. Zhang, D., Caliendo, A. M., Eron, J. J., DeVore, K. M., Kaplan, J. C., Hirsch, M. S., and
D'Aquila, R. T. (1994) Antimicrob Agents Chemother 38(2), 282-7.
7. St. Clair, M. H., Martin, J. L., Tudor-Williams, G., Bach, M. C., Vavro, C. L., King, D. M.,
Kellam, P., Kemp, S. D., and Larder, B. A. (1991) Science 253(5027), 1557-1559
8. Gao, Q., Gu, Z., Parniak, M. A., Cameron, J., Cammack, N., Boucher, C., and Wainberg, M. A.
(1993) Antimicrob Agents Chemother 37(6), 1390-2.
9. Schinazi, R. F., Lloyd, R. M., Jr., Nguyen, M. H., Cannon, D. L., McMillan, A., Ilksoy, N., Chu,
C. K., Liotta, D. C., Bazmi, H. Z., and Mellors, J. W. (1993) Antimicrob Agents Chemother
37(4), 875-81.
10. Tisdale, M., Kemp, S. D., Parry, N. R., and Larder, B. A. (1993) Proc Natl Acad Sci U S A
90(12), 5653-6.
11. Roberts, J. D., Bebenek, K., and Kunkel, T. A. (1988) Science 242(4882), 1171-3.
12. Hsieh, J. C., Zinnen, S., and Modrich, P. (1993) J Biol Chem 268(33), 24607-13
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
22
13. Reardon, J. E. (1993) J Biol Chem 268(12), 8743-51
14. Arion, D., Kaushik, N., McCormick, S., Borkow, G., and Parniak, M. A. (1998) Biochemistry
37(45), 15908-17
15. Arion, D., Sluis-Cremer, N., and Parniak, M. A. (2000) J Biol Chem 275(13), 9251-5.
16. Götte, M., Arion, D., Parniak, M. A., and Wainberg, M. A. (2000) J Virol 74(8), 3579-85
17. Carroll, S. S., Geib, J., Olsen, D. B., Stahlhut, M., Shafer, J. A., and Kuo, L. C. (1994)
Biochemistry 33(8), 2113-20
18. Meyer, P. R., Matsuura, S. E., Mian, A. M., So, A. G., and Scott, W. A. (1999) Mol. Cell 4(1),
35-43
19. Meyer, P. R., Matsuura, S. E., Schinazi, R. F., So, A. G., and Scott, W. A. (2000) Antimicrob
Agents Chemother 44(12), 3465-72.
20. Meyer, P. R., Matsuura, S. E., So, A. G., and Scott, W. A. (1998) Proc Natl Acad Sci USA
95(23), 13471-6
21. Canard, B., Sarfati, S. R., and Richardson, C. C. (1998) J Biol Chem 273(23), 14596-604
22. Feng, J. Y., and Anderson, K. S. (1999) Biochemistry 38(1), 55-63.
23. Wilson, J. E., Aulabaugh, A., Caligan, B., McPherson, S., Wakefield, J. K., Jablonski, S.,
Morrow, C. D., Reardon, J. E., and Furman, P. A. (1996) J Biol Chem 271(23), 13656-62.
24. Krebs, R., Immendorfer, U., Thrall, S. H., Wohrl, B. M., and Goody, R. S. (1997) Biochemistry
36(33), 10292-300
25. Gao, H. Q., Boyer, P. L., Sarafianos, S. G., Arnold, E., and Hughes, S. H. (2000) J Mol Biol
300(2), 403-18.
26. Gu, Z., Arts, E. J., Parniak, M. A., and Wainberg, M. A. (1995) Proc Natl Acad Sci U S A 92(7),
2760-4.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
23
27. Martin, J. L., Wilson, J. E., Haynes, R. L., and Furman, P. A. (1993) Proc Natl Acad Sci U S A
90(13), 6135-9.
28. Selmi, B., Boretto, J., Navarro, J. M., Sire, J., Longhi, S., Guerreiro, C., Mulard, L., Sarfati, S.,
and Canard, B. (2001) J Biol Chem 276(17), 13965-74.
29. Gu, Z., Quan, Y., Li, Z., Arts, E. J., and Wainberg, M. A. (1995) J Biol Chem 270(52), 31046-
51
30. Katlama, C., Valantin, M. A., Matheron, S., Coutellier, A., Calvez, V., Descamps, D., Longuet,
C., Bonmarchand, M., Tubiana, R., De Sa, M., Lancar, R., Agut, H., Brun-Vezinet, F., and
Costagliola, D. (1998) Ann Intern Med 129(7), 525-31.
31. Marquet, R., Baudin, F., Gabus, C., Darlix, J. L., Mougel, M., Ehresmann, C., and Ehresmann,
B. (1991) Nucleic Acids Res. 19(9), 2349-2357
32. Bénas, P., Bec, G., Keith, G., Marquet, R., Ehresmann, C., Ehresmann, B., and Dumas, P.
(2000) RNA 6(10), 1347-1355
33. Isel, C., Marquet, R., Keith, G., Ehresmann, C., and Ehresmann, B. (1993) J Biol Chem
268(34), 25269-25272
34. Kerr, S. G., and Anderson, K. S. (1997) Biochemistry 36(46), 14064-70
35. Rigourd, M., Lanchy, J. M., Le Grice, S. F., Ehresmann, B., Ehresmann, C., and Marquet, R.
(2000) J Biol Chem 275(35), 26944-51.
36. Vaccaro, J. A., Parnell, K. M., Terezakis, S. A., and Anderson, K. S. (2000) Antimicrob Agents
Chemother 44(1), 217-21.
37. Ueno, T., and Mitsuya, H. (1997) Biochemistry 36(5), 1092-9.
38. Isel, C., Lanchy, J. M., Le Grice, S. F. J., Ehresmann, C., Ehresmann, B., and Marquet, R.
(1996) EMBO J 15, 917-924
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
24
39. Lanchy, J. M., Ehresmann, C., Le Grice, S. F. J., Ehresmann, B., and Marquet, R. (1996)
EMBO J 15, 7178-7187
40. Barshop, B. A., Adamson, D. T., Vellom, D. C., Rosen, F., Epstein, B. L., and Seegmiller, J. E.
(1991) Anal Biochem 197(1), 266-72.
41. Vaccaro, J. A., and Anderson, K. S. (1998) Biochemistry 37(40), 14189-94
42. Tong, W., Lu, C. D., Sharma, S. K., Matsuura, S., So, A. G., and Scott, W. A. (1997)
Biochemistry 36(19), 5749-57.
43. Huang, H., Chopra, R., Verdine, G. L., and Harrison, S. C. (1998) Science 282, 1669-1675
44. Finzi, D., Hermankova, M., Pierson, T., Carruth, L. M., Buck, C., Chaisson, R. E., Quinn, T. C.,
Chadwick, K., Margolick, J., Brookmeyer, R., Gallant, J., Markowitz, M., Ho, D. D., Richman,
D. D., and Siliciano, R. F. (1997) Science 278(5341), 1295-300.
45. Arts, E. J., Marois, J. P., Gu, Z., Le Grice, S. F., and Wainberg, M. A. (1996) J Virol 70(2),
712-20.
46. Larder, B. A., Chesebro, B., and Richman, D. D. (1990) Antimicrob Agents Chemother 34(3),
436-41.
47. Lin, P. F., Samanta, H., Rose, R. E., Patick, A. K., Trimble, J., Bechtold, C. M., Revie, D. R.,
Khan, N. C., Federici, M. E., Li, H., and et al. (1994) J Infect Dis 170(5), 1157-64.
48. Schinazi, R. F., Larder, B. A., and Mellors, J. W. (2000) Int Antiviral News 8, 65-91
49. Boyer, P. L., Sarafianos, S. G., Arnold, E., and Hughes, S. H. (2001) J Virol 75(10), 4832-42.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
25
FOOTNOTES
The costs of publication of this article were defrayed in part by the payment of page charges. This
article must therefore be hereby marked “advertisment” in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
The abbreviations used are : AIDS, acquired immunodeficiency syndrome ; RT, reverse transriptase ;
HIV-1, human immunodeficiency type 1; NNRTI, non nucleoside inhibitor; NRTI, nucleoside inhibitor;
AZT, 3’-azido-3’ deoxythymidine; d4T, 2’,3’didehydro-2’,3’–dideoxythymidine; ddC, 2’,3’
dideoxycytidine; 3TC β-L-(-)-2’,3’-dideoxy-3’-thyacytidine; ddI, 2’, 3’-dideoxyinosine; AZTTP 3’-azido-3’
deoxythymidine 5’-triphosphate; d4TTP, 2’,3’didehydro-2’,3’–dideoxythymidine 5’-triphosphate; dTTP,
thymidine 5’-triphosphate; ddTTP, 3’-deoxythymidine 5’-triphosphate; dGTP, deoxyguanosine 5’-
triphosphate; 3TCTP, β-L-(-)-2’,3’-dideoxy-3’-thyacytidine 5’-triphosphate; ddCTP, 2’,3’ dideoxycytidine
5’-triphosphate; ddATP, 2’,3’ dideoxyadenosine 5’-triphosphate; PPi, inorganic pyrophosphate; P/T,
primer:template; AZTMP, 3’-azido-3’ deoxythymidine 5’-monophosphate; d4TMP, 2’,3’didehydro-
2’,3’–dideoxythymidine 5’-monophosphate; ddCMP, 2’,3’ dideoxycytidine 5’-monophosphate; 3TCMP,
β-L-(-)-2’,3’-dideoxy-3’-thyacytidine 5’-monophosphate; ddAMP, 2’,3’ dideoxyadenosine 5’-
monophosphate; PBS, Primer Binding Site; WT, wild type; dNTP, deoxynucleotide triphosphate; DTE,
; DEC, dead-end complex; P site, polymerisation site; N site, Nucleotide binding site.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
26
Legends to figures and tables
Figure 1: Minus strand strong-stop DNA synthesis in the presence of various NRTIs and PPi.
Ten nM of tRNA3Lys/1-311 viral RNA were pre-incubated with 20 nM of HIV-1 RT and the
polymerisation reaction was initiated by the addition of a mixture of the four dNTPs (50 µM each) in
the absence or presence of PPi (150 µM) and 5 µM AZTTP (B) , d4TTP (C) , 3TCTP (D) , ddCTTP (E)
and ddATP (F). The reaction was stopped after 1 min, 30 min, 1 hour and 3 hours.
Figure 2 : Experimental strategy. (A) Only part of the sequence of the 1-311 HIV-1 RNA used as a
template is shown. The PBS corresponds to nucleotides 179-196 of this RNA. Various analogue-
terminated primers, listed underneath, were purified prior to their use. (B) Binary complexes,
containing purified analogue-terminated primers hybridised to the RNA template were pre-incubated
with HIV-1 RT and used either in a primer-rescue experiment or in a direct pyrophosphorolysis
experiment, depending on the substrates added to the reaction mixture (PPi + dNTPs/ddNTP or PPi
alone, respectively).
Figure 3: PPi-dependent rescue of T-analogue terminated primers. (A) Ten nM of ODN-dC-
AZTMP(or ODN-dC-d4TMP, or ODN-dC-ddTMP)/1-311 viral RNA were incubated with 200 nM of HIV-
1 RT, and the reaction was initiated by the addition of 150 µM PPi, 50 µM dTTP and 50 µM ddGTP in
order to allow synthesis of the +1 product with respect to the NRTI-terminated primer. The reaction
was stopped after 15, 30, 60 s, 4, 10, 20, 30 and 60 min. (B) Quantification of the non-extended and
+1 extended products allowed calculation of the percentage of rescue. Experimental data were fit to
equation ODN A e k text+[ ] = • −( )− •3 1 , where [ODN+3] is the concentration of T-analogue
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
27
terminated primer extended by one nucleotide, A is the amplitude of the reaction, and kext is the
apparent repair rate constant. The curves shown correspond to fits with kextAZTMP = 1.88 10-3 s-1, kextd4TMP
= 0.46 10-3 s-1 and kextddTMP = 0.46 10-3 s-1.
Figure 4: Pyrophosphorolysis of T-analogue terminated primers. (A) Ten nM of ODN-dC-AZTMP
(or ODN-dC-d4TMP, or ODN-dC-ddTMP, or ODN-dC-dTMP)/1-311 viral RNA were incubated with 200
nM of HIV-1 RT, the reaction was initiated by the addition of 150 µM PPi and stopped after 6, 12, 18,
24, 30, 36, 42, 48, 54, 60 s, 3, 5,10 20, 30 and 60 min. (B) Quantification of the initial amount of primer
and the amount of product that has been pyrophosphorolysed allowed calculation of the percentage of
pyrophosphorolysis. Experimental data were fit to equation %pyro A ek tpyro= • −( )− •1 , where A is the
amplitude of the reaction and kpyro is the apparent rate constant of the pyrophosphorolysis reaction.
The curves shown correspond to fits with kpyroAZTMP = 3.35 10-3 s-1, kpyrod4TMP = 5.4 10-3 s-1, kpyroddTMP =
4.82 10-3 s-1 and kpyrodTMP = 4.2 10-3 s-1.
Figure 5: Stable complex formation between HIV-1 RT, chain-terminated P/T and the next
incoming nucleotide. (A) Dead-end complex (DEC) formation with AZTMP-, d4TMP- and ddTMP-
terminated P/Ts. The labelled T-analogue-terminated P/T (8 nM) were incubated with 200 nM of HIV-1
RT and dGTP, the next complementary nucleotide, in increasing concentrations ranging from 0.01 to
1000 µM. After 10 min of complex formation at room temperature, the salt concentration was
increased to 100 mM KCl and an unlabeled chase substrate, poly(rA)/oligo(dT), was added, for a
further 5 min incubation at 37°C. The free P/T and the dead-end P/T:RT:dGTP complexes were
separated by electrophoresis on a 6% non-denaturing polyacrylamide gel. (B) Quantification of the
data obtained in (A) and data obtained on ddAMP- and ddCMP-terminated P/T:RT:dNTP complexes.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
28
The amount of free P/T and DEC were quantified and the percentage of DEC formed was plotted as a
function of the concentration of the incoming nucleotide.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
29
Table I : Efficiency of inhibition of (-) strand strong-stop DNA synthesis and rescue ratio by
pyrophosphorolysis.
% of final product
relative to no
inhibitor
Rescue ratio
AZT 2.5%
AZT/PPi 15%
6x
d4T 8.4%
d4T/PPi 18%
2.14x
3TC 36%
3TC/PPi 48.6%
1.35x
ddC 4.6%
ddC/PPi 7%
1.52x
ddA 20%
ddA/PPi 24%
1.2x
The amount of (-) strand strong-stop DNA versus the total radioactivity was quantified in the absence
and presence of the various NRTIs and PPi. The percentage of final product relative to no inhibitor
was the ratio between the amount of (-) strand strong-stop DNA in the presence and absence of
inhibitor. The rescue ratio was calculated as the ratio between the percentage of final product in the
presence and in the absence of PPi, for a given inhibitor.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
30
Table II: Rate constants for PPi-dependent rescue and pyrophosphorolysis of analogue-
terminated P/Ts.
Primer/templateRepair
Kext (10-3) (s-1) ± SD
Pyrophosphorolysis
Kpyro (10-3) (s-1) ± SD
AZTMP-terminated 1.88 ± 0.24 3.35± 0.05
d4TMP-terminated 0.46 ± 0.27 5.4 ± 0.4
ddTMP-terminated 0.46 ± 0.12 4.82 ±0.28
dTMP-terminated 4.2 ± 0.4
3TCMP-terminated 0.33 ± 0.1 0.32 ± 0.07
ddCMP-terminated 0.35 ± 0.12 0.49 ±0.1
dCMP-terminated 2.5 ± 1.5
ddAMP-terminated not detected 0.69 ± 0.06
dAMP-terminated 1.32 ± 0.25
SD: Standard Deviation
kext is the rate of PPi dependent +1 rescue of analogue terminated primers. kpyro is the rate of
pyrophosphorolysis of analogue-terminated primers, in the absence of nucleotides. The fit were
performed as described in Fig. 3 and 4 , except that data points up to 3 hours were collected to ensure
that a plateau was reached in all cases.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
3h0
3h0
PP
i
A.
3h3h
00
d4Td4T
+P
Pi
A-rich loop
C.
03h
03h
ddCddC
+P
Pi
E.
3h3h
00
AZ
TA
ZT
+P
Pi
A-rich loop
B.
A174
A157
A155
A150
A147
3h
2h
00 3T
C+
PP
i3T
C
D.
G162
G160
G159
G156
+5
+3
tRN
A3 Lys
primer
(-) sstopD
NA
3H3H
00
ddA+
PP
iddA
F.
U173
U171
+6
Fig
ure 1, Isel et al.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
+PPi
+PPi+dCTP+ddTTP
UCUAGCAGUGGCGCCCGAACAGGGAC
C-ACCGCGGGCTTGTCCCTG ddC-ACCGCGGGCTTGTCCCTG 3TC-ACCGCGGGCTTGTCCCTG
AZT-CACCGCGGGCTTGTCCCTG d4T-CACCGCGGGCTTGTCCCTG ddT-CACCGCGGGCTTGTCCCTG T-CACCGCGGGCTTGTCCCTG
ddA-TCGTCACCGCGGGCTTGTCCCTG A-TCGTCACCGCGGGCTTGTCCCTG
ODN-3TCMPODN-ddCMPODN-dCMP
ODN-dC-AZTMPODN-dC-d4TMPODN-dC-ddTMPODN-dC-dTMP
ODN-dC-dT-dG-dC-dT-ddAMPODN-dC-dT-dG-dC-dT-dAMP
+6 +2 +1
+PPi
+PPi+dTTP+ddGTP
+PPi
+PPi+dATP+ddGTP
5' 3' Template
B. Analogue-terminated primer/1-311 viral RNA
+ HIV-1 RT (200 nM)
4 min 37°C
150 mM PPiPPi + dNTP corresponding tothe analogue+ next complementary ddNTP
Pyrophosphorolysis+1 rescue of DNA synthesis
Primer Binding SiteA.
Figure 2, Isel et al.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
PPi-dependent rescue of T-analogue terminated primers
0 1H
ODN-dC-AZTMP ODN-dC-d4TMP ODN-dC-ddTMP
0 1H 0 1H
+1
A.
B.
100
80
60
40
20
0
[% O
DN
+3
]
40003000200010000time (sec)
AZT d4T ddT
Figure 3, Isel et al.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
0 1H 0 1H0 1H
ODN-dC-AZTMP ODN-dC-d4TMP ODN-dC-ddTMP
Pyrophosphorolysis of T-analogue terminated primers
A.
B.
100
80
60
40
20
0
[% o
f py
roph
osph
orol
ysis
]
40003000200010000time (sec)
AZT d4T dT ddT
Figure 4, Isel et al.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
B.
60
50
40
30
20
10
% o
f com
ple
x
0.01 0.1 1 10 100 1000
conc. incoming nucleotide (µM)
AZT
d4T ddT
ddA
ddC
A.
1000
500
250
100
50100.01
1000
500
250
100
50100.01
1000
500
250
100
50100.01
ODN-dC-AZTMP ODN-dC-d4TMP ODN-dC-ddTMP
P/T
P/T/RT0 0 0
µM dGTP
Figure 5, Isel et al.
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from
MarquetCatherine Isel, Chantal Ehresmann, Philippe Walter, Bernard Ehresmann and Roland
explained by the properties of the wild type HIV-1 reverse transcriptaseThe emergence of different resistance mechanisms towards nucleoside inhibitors is
published online October 19, 2001J. Biol. Chem.
10.1074/jbc.M108352200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 7, 2018
http://ww
w.jbc.org/
Dow
nloaded from