genesdev.cshlp.orggenesdev.cshlp.org/.../Supplemental_Information.docx · Web viewSupplemental...
Transcript of genesdev.cshlp.orggenesdev.cshlp.org/.../Supplemental_Information.docx · Web viewSupplemental...
Supplemental Material
The poly(A) binding protein Nab2 functions in RNA polymerase III transcription
L. Maximilian Reuter, Dominik M. Meinel, Katja Sträßer
Supplemental Figure S1. Nab2 occupies all RNAPIII transcribed genes. (A-F) Individual
traces of Rpb3 (RNAPII), Rpc160 (RNAPIII), and Nab2 at tRNA genes as well as at the
SCR1, RDN5, SNR6, SNR52, and RPR1 gene loci show that Nab2 is recruited to single genes
transcribed by RNAPIII.
Supplemental Figure S2. Growth properties of NAB2 mutants. (A) Comparison of the growth
properties of different NAB2 mutants. Strains expressing wild-type NAB2, the new nab2-34
allele, the previously generated temperature sensitive nab2-1-GFP and nab2-1 alleles or the
nab2-C437S allele, which is impaired in RNA binding, were spotted in 10-fold serial dilutions
on YPD plates and grown for 2 or 4 days at the indicated temperatures. (B) Growth curves of
NAB2 and nab2-34 cells at 30°C and 37°C in liquid YPD culture. The mean values and
standard deviation (SD) of three replicates are shown.
Supplemental Figure S3. Nab2 is required for full RNAPIII transcriptional activity in vivo.
(A,B) Northern blots of total RNA extracted from NAB2 and nab2-34 (A) as well as RPC25
and rpc25-S100P cells (B), which were used for the quantifications shown in Figures 5A-C.
Since the tRNAIle probe hybridizes to the intronic region, only transcripts still containing the
intron are detected. SNR14 (U4 snRNA) is synthesized by RNAPII and served as control.
tRNAIle precursors (two highest bands), the RPR1 precursor and the SNR6 levels were used for
quantification. (C) Amount of RNA used in Northern Blots. 1 µg of total RNA was loaded on
2% Formaldehyde agarose gels. Total RNA was visualized by Ethidiumbromide staining. 25S
rRNA and 18S rRNA levels were quantified. Data represent the mean ± SD of at least 4
independent biological replicates.
Supplemental Figure S4. Nab2 is required for RNAPIII transcription in vitro. (A,B) Gels of
the vitro transcription assays using transcription active extracts and a tRNAAla(UGC)E (A) or
an SNR6 (B) template, which were used for the quantifications shown in Figures 5D and 5E.
All bands were used for quantification. (C) In vitro transcription assays on the SNR6 template
with add back of recombinant Nab2, which were used for the quantifications shown in Figure
5F. All bands were used for quantification. (D) Fully reconstituted in vitro transcription assay
with add back of recombinant Nab2 on the SNR6 template, which were used for the
quantifications shown in Figure 5G.
Supplemental Figure S5. ChIP profiles on SCR1. (A) Scheme of the longest RNAPIII
transcribed gene SCR1 including amplicon sizes and locations. (B-E) Occupancy profiles of
RNAPIII (B), TFIIIC (C), TFIIIB (D) and Nab2 (E) are shown. Data represent the mean ± SD
of at least three independent replicates.
Supplemental Figure S6. Nab2 is needed for full occupancy of RNAPIII and TFIIIB but not
of TFIIIC on SCR1. ChIP occupancies of Rpc160 (RNAPIII) (A), Bdp1 (TFIIIB) (B), and
Tfc1 (TFIIIC) (C) on SCR1 in NAB2 and nab2-34 cells grown at 30°C and 37°C were
determined by ChIP-qPCR as for Supplemental Figure S5. SCR1-1 to SCR1-7 according to
Supplemental Figure S5. Data represent the mean ± SD of at least three independent
replicates, *: p < 0.05 and **: p < 0.01.
Supplemental Figure S7. DNA binding of Nab2 to dsDNA probes. Increasing amounts of
Nab2-His6 (0, 0.5, and 1 µg) were incubated with the specific RNAPIII promoter dsDNA
(TA-30-B6) and four scrambled probes with (dsDNA1(+) and dsDNA2(+)) and without
(dsDNA1(-) and dsDNA2(-)) two 2-nucleotide mismatches, each as detailed in Materials and
Methods. DNA sequences for the different dsDNA probes are given in Supplemental Table
S3.
Supplemental Table S1. Yeast strains used in this study.
Strain Description Source
RS453MATa; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ Euroscarf
W303MATa; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+ Euroscarf
BDP1-TAP MATa; BDP1-TAP::TRP1; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study
BRF1-HA MATa; BRF1-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study
NAB2 shuffle MATa ;nab2::HIS3mx6; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+; pRS316-NAB2 this study
NAB2 shuffle BDP1-TAP
MATa ;nab2::HIS3mx6; BDP1-TAP::TRP1; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+; pRS316-NAB2
this study
NAB2 shuffle RPC160-TAP
MATa; nab2::HIS3mx6; RPC160-TAP::TRP1; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+; pRS316-NAB2
this study
NAB2 shuffle TFC1-TAP
MATa ;nab2::HIS3mx6; TFC1-TAP::TRP1; ura3-1; trp1-1; his3-11,15; leu2-3,112; ade2-1; can1-100; GAL+; pRS316-NAB2
this study
NAB2-TAP MATa; NAB2-TAP::TRP1; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study
NAB2-TAP MATa; NAB2-TAP::URA3; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 (Meinel et al. 2013)
NAB2-TAP BRF1-HA
MATa; NAB2-TAP::TRP1; BRF1-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study
NAB2-TAP TFC8-HA
MATa; NAB2-TAP::TRP1; TFC8-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study
NAB2-TAPRPC160-HA
MATa; NAB2-TAP::TRP1; RPC160-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+
this study
RPA190-TAP MATa; RPA190-TAP::TRP1; his3-11,15; ura3-52; leu2-3,112; trp1-1;can1-100; GAL+ this study
RPB3-TAP MATa; RPB3-TAP::HIS3mx6; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 (Meinel et al. 2013)
RPC25
(YPH500)MATα; ura3-52; lys2-801_amber; ade2-101_ochre; trp1-Δ63; his1-Δ200; leu2-Δ1
(Zaros and Thuriaux 2005)
RPC25NAB2-TAP
MATα; NAB2-TAP::TRP1; ura3-52; lys2-801_amber; ade2-101_ochre; trp1-Δ63; his1-Δ200; leu2-Δ1 this study
RPC25RPC160-TAP
MATα; RPC160-TAP::TRP1; ura3-52; lys2-801_amber; ade2-101_ochre; trp1-Δ63; his1-Δ200; leu2-Δ1 this study
rpc25-S100P(DS3-6b) MATa; ura3-52; trp1-Δ63; his3-Δ200; leu2; rpc25-S100P (Zaros and Thuriaux
2005)
rpc25-S100PNAB2-TAP
MATa; NAB2-TAP::TRP1; ura3-52; trp1-Δ63; his3-Δ200; leu2; rpc25-S100P this study
rpc25-S100P RPC160-TAP
MATa; RPC160-TAP::TRP1; ura3-52; trp1-Δ63; his3-Δ200; leu2; rpc25-S100P this study
RPC160-HA MATa; RPC160-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study
RPC160-TAP MATa; RPC160-TAP::TRP1; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study
RPC160-TAP MATa; RPC160-TAP::HIS; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 this study
TAP-NPL3 MATa; TAP-NPL3; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 (Meinel et al. 2013)
TAP-THO2 MATa; TAP-THO2; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 (Meinel et al. 2013)
TFC1-TAP MATa; TFC1-TAP::TRP1; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL++ this study
TFC8-HA MATa; TFC8-HA::HIS3mx6; ade2-1; his3-11,15; ura3-52; leu2-3,112; trp1-1; can1-100; GAL+ this study
Supplemental Table S2. Plasmids used in this study.
Plasmid Description Source
pAC1038 ∆N-NAB2-GFP, CEN, LEU2 (Green et al. 2002)
pAC1152 ∆N-NAB2 (nab2-1), CEN, LEU2 (Marfatia et al. 2003)
pAC2307 nab2-C437S, CEN, LEU2 (Kelly et al. 2007)
pGex-6P-1-NAB2 the coding region of NAB2 was amplified by PCR creating BamHI and NotI sites and cloned into the same sites of pGex-6P-1
this study
pBluescriptIIKS-SNR6 the genomic SNR6 locus including 117 upstream and 253 downstream was amplified by PCR creating EcoRI and XbaI sites and cloned into the same site of pBluescriptIIKS
(Brow and Guthrie 1990)
pBluescriptIIKS-tA the coding region of tRNAAla(UGC)E was amplified this study
by PCR creating NotI and XbaI sites and cloned into the same sites of pBluescriptII KS
pBS1479 plasmid for genomic TAP-tagging with the TRP1-KL marker
Euroscarf
pET21a-BDP1 the coding region of BDP1 was amplified by PCR creating EcoRI and NotI sites and cloned into the same sites of pET21a
this study
pET21a-BRF1 the coding region of BRF1 was amplified by PCR creating SacI and NotI sites and cloned into the same sites of pET21a
this study
pET21a-NAB2 the coding region of NAB2 was amplified by PCR creating SacI and NotI sites and cloned into the same sites of pET21a
this study
pET21a-TBP the coding region of TBP was amplified by PCR creating EcoRI and NotI sites and cloned into the same sites of pET21a
this study
pRS315-NAB2 the ORF of NAB2 including 532 bp 5’ and 311 bp 3’ was amplified by PCR creating Not1 and Xho1 sites and cloned into the same sites of pRS315
this study
pRS315-nab2-34 nab2-34 inserted by homologous recombination after mutagenic PCR of the NAB2 ORF
this study
pRS316-NAB2 the ORF of NAB2 including 532 bp 5’ and 311 bp 3’ was amplified by PCR creating Not1 and Xho1 sites and cloned into the same sites of pRS316
this study
pYM15 plasmid for genomic HA tagging with the HIS3mx6 marker
Euroscarf
Supplemental Table S3. dsDNA probe sequences used in this study.
Oligo DNA sequence
TA-30-B6_1 GCTGAAATCTCTTTTTCAATTGCTCCGGTGTATAAAGCCGCGGTCCCTTACTCTTTCTTCAACAATTAAATACTC
TA-30-B6_2 GAGTATTTAATTGTTGAAGAAAGAGTAAGGGACCGCCCCTTTATTGACCGGAGCAATTGAAAAAGAGATTTCAGC
dsDNA1(+)_1 ATCGTAGATACTGAGTACTCACATCGTCAAGATCACAAGACTATGCACTAGTCACGTCACGTCATAGACTAGATA
dsDNA1(+)_2 TATCTAGTCTATGACGTGACGTGACTAGTGCATAGTCAAGTGATCAAGACGATGTGAGTACTCAGTATCTACGAT
dsDNA1(-)_2 TATCTAGTCTATGACGTGACGTGACTAGTGCATAGTCTTGTGATCTTGACGATGTGAGTACTCAGTATCTACGAT
dsDNA2(+)_1 GACTATCTAGACTGCGATCTCAATCTTCGAAGCTTACAAGTATCACCTATGCATTCAAGTTGCAACGTACTGCAT
dsDNA2(+)_2 ATGCAGTACGTTGCAACTTGAATGCATAGGTGATACAAGTAAGC
AACGAAGATTGAGATCGCAGTCTAGATAGTC
dsDNA2(-)_2 ATGCAGTACGTTGCAACTTGAATGCATAGGTGATACTTGTAAGCTTCGAAGATTGAGATCGCAGTCTAGATAGTC
Supplemental Materials and methods
Quantification of ChIP experiments
For quantification of the purified DNA, the Step One Plus cycler (Applied Biosystems) was
used with the Applied Biosystems Power Sybr Green PCR Master Mix. For calculation of the
enrichments, a non-transcribed region (NTR) on Chromosome V (174131-174200) was
applied. To determine the primer efficiencies, standard curves were used. Occupancies were
calculated as enrichments of the tested gene over the NTR with the following formula:
(E^(CTIP-CT
INP))NTR/(E^(CTIP-CT
INP)YFG). Regions amplified by the respective primer pairs are:
SNR6 (chromosome XII, 366249-366328), tDNALys (amplification of 21 genes encoding
tRNALys(CUU), .e.g. chromosome III, 151295-151354), RPR1 (chromosome V, 117975-
118091) and SCR1 (chromosome V, 441987-442508, primers as shown in Supplemental
Figure S5A and described in (Ghavi-Helm et al. 2008)).
Oligo design for EMSAs
Used oligos were annealed in 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, heated
to 95°C for 5 min and slowly cooled to room temperature (45 min). dsDNA code: (+): 4-
nucleotide mismatches; (-): no mismatches; 1: no double nucleotides; 2: double nucleotides
allowed. Combinations of oligo sequences were as follows:
dsDNA1(+): dsDNA1(+)_1 and dsDNA1(+)_2;
dsDNA1(-): dsDNA1(+)_1 and dsDNA1(-)_2;
dsDNA2(+): dsDNA2(+)_1 and dsDNA2(+)_2;
dsDNA2(-): dsDNA2(+)_1 and dsDNA2(-)_2
Supplemental References
Brow DA, Guthrie C. 1990. Transcription of a yeast U6 snRNA gene requires a polymerase III promoter element in a novel position. Genes & Development 4: 1345-1356.
Ghavi-Helm Y, Michaut M, Acker J, Aude JC, Thuriaux P, Werner M, Soutourina J. 2008. Genome-wide location analysis reveals a role of TFIIS in RNA polymerase III transcription. Genes & development 22: 1934-1947.
Green DM, Marfatia KA, Crafton EB, Zhang X, Cheng X, Corbett AH. 2002. Nab2p is required for poly(A) RNA export in Saccharomyces cerevisiae and is regulated by arginine methylation via Hmt1p. The Journal of biological chemistry 277: 7752-7760.
Kelly SM, Pabit SA, Kitchen CM, Guo P, Marfatia KA, Murphy TJ, Corbett AH, Berland KM. 2007. Recognition of polyadenosine RNA by zinc finger proteins. Proceedings of the National Academy of Sciences of the United States of America 104: 12306-12311.
Marfatia KA, Crafton EB, Green DM, Corbett AH. 2003. Domain analysis of the Saccharomyces cerevisiae heterogeneous nuclear ribonucleoprotein, Nab2p. Dissecting the requirements for Nab2p-facilitated poly(A) RNA export. The Journal of biological chemistry 278: 6731-6740.
Meinel DM, Burkert-Kautzsch C, Kieser A, O'Duibhir E, Siebert M, Mayer A, Cramer P, Soding J, Holstege FC, Strasser K. 2013. Recruitment of TREX to the transcription machinery by its direct binding to the phospho-CTD of RNA polymerase II. PLoS Genet 9: e1003914.
Zaros C, Thuriaux P. 2005. Rpc25, a conserved RNA polymerase III subunit, is critical for transcription initiation. Molecular microbiology 55: 104-114.