Post on 24-Feb-2016
description
Lesson 5: Transcription & Translation
• LT: Be able to explain the process of DNA transcription.
THE BIG PICTURE!!!
DNA RNA proteinTranscription Translation
Notes from reading pgs. 425-426
• RNA = ribonucleic acid– Made of nucleotides– Sugar in nucleotides is ribose
• RNA uses uracil instead of thymine• RNA is single-stranded and not double stranded• mRNA = messenger RNA
• Carries the message of DNA from the nucleus to the cytoplasm to be made into a protein
• Transcription: the process by which DNA is copied into a complementary RNA molecule
Process & Procedure: Modeling Transcription
• Create a double stranded DNA molecule that is 15 bases long
Our Code:RED = adenine (A)BLUE = thymine (T)
YELLOW = cytosine (C)GREEN = guanine (G)
BLACK = uracil (U)Work through step #3a-f
Stop & Think
1. How is DNA transcription like DNA replication? How are the 2 processes different?
In this activity, you transcribed 2 different DNA strands. Each one was only 15 nucleotides long. That seems pretty short.a. How many different arrangements of nucleotides are possible in a strand of DNA that is 15 nucleotides long?
Same: complementary bases, DNA acts as a templateDifferent: transcription uses uracil, replication uses thymine
4^15 = 1,073,741,824 possibilities
b. How would the number in 2a compare with the number of different arrangements of nucleotides possible in a real strand of DNA?
4^80,000,000 is a ridiculously HUGE number
Notes on DNA transcription
Do the cells in your eye and your tongue have the same functions?
Do the cells in your eye and your tongue have the same proteins?
Do the cells in your eye and your tongue have the same DNA?
What have we learned?
• Proteins determine most characteristics of a cell and organism
• Information stored in DNA determines which proteins can be made by a cell
• The environment influences which proteins are made by a cell
Where is protein made in a cell?
DNA does not leave the nucleus of eukaryotic cells... but proteins are made outside of the nucleus by ribosomes
human cheekcell mitochondria
chloroplasts
nucleus
vacuole
Elodea leaf cell
(DNA here)(DNA here)
DNA does not leave the nucleus of eukaryotic cells... but proteins are made outside of the nucleus by ribosomes
nucleus(DNA here)
(DNA here)
ribosomes
(proteins made here)
(proteins made here)
DNA and ribosomes are at different locations in a prokaryoic cell.
E. coli bacteria cell
DNA
(proteins made here)ribosomes
Information flow from DNA to trait
DNA protein Observed trait
Stored in nucleus
Made by ribosomes outside of nucleus
So how does DNA get turned into a protein if it can’t leave the nucleus???
messenger RNA
• mRNA transfers information from the DNA in the nucleus to the ribosomes.
• mRNA is made in the nucleus and then travels to the cytoplasm through nuclear pores
• Ribosomes build proteins according to the mRNA information received.
Information flow from DNA to trait
DNA messengerRNA protein Observed
traitStored in nucleus
Made by ribosomes outside of nucleus
DNA information mRNA information
Transcription is the process used to convert DNA information into mRNA information.
Note: DNA does not become RNA; the information in DNA is copied as RNA
DNA messengerRNA
RNA is different than DNA
• Single strand of nucleotides
• Contains uracil (U) instead of thymine (T)
• Made of the 5-Carbon sugar Ribose instead of deoxyribose (DNA)
http://www.makingthemodernworld.org.uk/learning_modules/biology/01.TU.03/illustrations/01.IL.09.gif
Difference between DNA and RNA
DNA RNA
5-Carbon Sugar: deoxyribose
5-Carbon sugar:Ribose
A,T,C,G A,U,C,G
Double stranded Single stranded
Different Sugars
DNA
RNA
Can you spot the difference?
Different Bases
Can you spot the difference?
DNA- double stranded
RNA- single stranded
RNA and DNA Nucleotides
DNA
RNA
RNA IS COPIED FROM DNA
COPIED
RNA(single strand -
mobile)
DNA(double stranded original, protected
in nucleus)
mRNA: the messengerRNA is how the body gets information from the nucleus (DNA) to the place where protein gets made (ribosomes)
3 Types of RNA
mRNA: messenger RNA
tRNA: transfer RNA
rRNA: ribosomal RNA
THE BIG PICTURE!!!
DNA RNA proteinTranscription Translation
http://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpg
Transcription• Molecule of DNA is copied into a
complimentary mRNA strand
http://fig.cox.miami.edu/~cmallery/150/gene/c7.17.7b.transcription.jpg
RNA Polymerase
• RNA polymerase is an enzyme• Attaches to promoters (special sequences
on the DNA)• Unzips the two strands of DNA• Synthesizes the mRNA strand
https://publicaffairs.llnl.gov/news/news_releases/2005/images/RNA_polymerase309x283.jpg
Steps of Transcription
Step 1: RNA polymerase attaches to DNAStep 2: RNA polymerase unzips DNAStep 3: RNA polymerase hooks together the
nucleotides as they base-pair along the DNA template
Step 4: Completed mRNA strand leaves the nucleus
Transcription
http://fig.cox.miami.edu/~cmallery/150/gene/c7.17.7b.transcription.jpg
If the DNA code is this:
UACGAGUUACAUAAA
TACGAGTTACATAAAATGCTCAATGTATTT
What is the mRNA code?Use the bottom strand as the template for mRNA
Which proteins are made in a cell?
• Controlled by activator molecules• Bind to enhancers (segments of DNA)• “Turns on” transcription of the geneExample: Arabinose and araC protein
Information flow from DNA to trait
DNA protein Observed trait
Stored in nucleus
Made by ribosomes outside of nucleus
Information flow from DNA to trait
DNA messengerRNA protein Observed
traitStored in nucleus
Made by ribosomes outside of nucleus
Transcription
Transcription Video
Part II: Translation
LT: Be able to explain the process of translation.
THE BIG PICTURE!!!
DNA RNA proteinTranscription Translation
Information flow from DNA to trait
DNA protein Observed trait
Stored in nucleus
Made by ribosomes outside of nucleus
Information flow from DNA to trait
DNA messengerRNA protein Observed
traitStored in nucleus
Made by ribosomes outside of nucleus
Transcription
Information flow from DNA to trait
DNA messengerRNA protein Observed
traitStored in nucleus
Made by ribosomes outside of nucleus
Translation
mRNA information protein
Translation is the process used to convert mRNA information into proteins.- also known as “protein synthesis”
Note: mRNA does not become a protein, the information on mRNA is “read” and ribosomes assemble proteins from this code
messengerRNA protein
Translation
• Ribosomes use mRNA as a guide to make proteins
http://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpg
4 Components used in Translation1. mRNA- the message to be translated into protein.
2. Amino acids- the building blocks that are linked together to form the protein.
3. Ribosomes- the “machines” that carry out translation.
4. tRNA (transfer RNA)- brings an amino acid to the mRNA and ribosome.
The message
• mRNA is a strand of nucleotides– Ex. AUGCCGUUGCCA…
• Each combination of three nucleotides on the mRNA is called a codon
tRNA• Transfer RNA• Single strand of RNA that loops back on itself• Has an Amino Acid attached at one end
– Amino Acids are the building blocks of proteins• Has an anticodon at the other end
http://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gif
What is an anticodon?
• The anticodon is a set of three nucleotides on the tRNA that are complimentary to the codon on the mRNA
http://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gif
Steps of Translation
Step 1: mRNA binds to ribosomeStep 2: tRNA anticodon attaches to the first mRNA
codonStep 3: the anticodon of another tRNA binds to the next
mRNA codonStep 4: A peptide bond is formed between the amino
acids the tRNA molecules are carrying.
Translation
Steps of Translation cont.
Step 5: After the peptide bond is formed, the first tRNA leaves. The ribosome moves down to the next codon.
Step 6: This process continues until the ribosome reaches a stop codon.
Step 7: The chain of peptides (protein) is released and the mRNA and ribosome come apart.
Translation
http://www.medicine.uottawa.ca/Pathology/devel/images/text_figure8.gif
mRNA nucleotides are translated in groups of 3 called codons.
AUGCACUGCAGUCGAUGA
CODONS
Remember…
Decoding the message…Each codon codes for a specific amino acid. 20
different amino acids can be used in different combinations to form a protein.
For example:mRNA codon amino acid
AAU asparagineCGC arginineGGG glycine
The Genetic Code
http://www.cbs.dtu.dk/staff/dave/roanoke/fig13_18.jpg
Simulation!
• I need 6 volunteers who don’t mind holding hands.
• And then one more volunteer.
Translation Video
Amino Acid sequence determines the 3-D protein shape
• Interactions between amino acids cause folding and bending of the chain
Examples: – positive (+) and negative (-) parts of amino acids are
attracted to each other.– hydrophobic regions are attracted to each other
• Foldinghttp://www.stolaf.edu/people/giannini/flashanimat/proteins/hydrophobic%20force.swf• Structure levelshttp://www.stolaf.edu/people/giannini/flashanimat/proteins/protein structure.swf
How is the amino acid sequence determined?
• The mRNA• Each codon is a code for one amino acid
DNA sequence: T A C C G A G A T T C AmRNA sequence: A U G G C U C U A A G Uamino acid sequence: Met -- Ala -- Leu -- Ser
Whole Process Video
Special Codons
• Start codon: AUG• Stop codons: UAA, UGA, UAG
Your turn:
• For each of the codons below, determine the amino acid it corresponds with:– AUG: Methionine (Met)– CCA: Proline (Pro)– UUG: Leucine (Leu)– GCA: Alanine (Ala)– UAG: STOP!
The Activity
• My desk: NUCLEUS• Your desk space is the CYTOPLASM• In your group of 3, decide who will be:
– mRNA: transcribes the DNA template and delivers the message to the cytoplasm
– rRNA: makes up the ribosome and interprets the message in codons
– tRNA: brings correct amino acids to the ribosome using anticodons
Steps:1: mRNA comes to desk to transcribe the message (can’t just copy the DNA sequence)2: Take message back to cytoplasm & ribosome.3: rRNA: breaks message into codons4: tRNA: use the codons to find the amino acids – look for the ANTICODONS that are complementary to the codons.5: Bring back the card with the correct anticodon.6: Record the word that is on the back of the card in your notebook.7: Make sure to take the card back to where you got it so other teams can use it!8: Continue finding the correct anticodon cards and record the sequence of words in order. Check your end result with me.
Share sentences in order
Repeat steps, but change roles for round 2.
1: mRNA comes to desk to transcribe the message (can’t just copy the DNA sequence)2: Take message back to cytoplasm & ribosome.3: rRNA: breaks message into codons4: tRNA: use the codons to find the amino acids – look for the ANTICODONS that are complementary to the codons.5: Bring back the card with the correct anticodon.6: Record the word that is on the back of the card in your notebook.7: Make sure to take the card back to where you got it so other teams can use it!8: Continue finding the correct anticodon cards and record the sequence of words in order. Check your end result with me.
Share sentences in order
Repeat steps, but exchange roles for round 3.
1: mRNA comes to desk to transcribe the message (can’t just copy the DNA sequence)2: Take message back to cytoplasm & ribosome.3: rRNA: breaks message into codons4: tRNA: use the codons to find the amino acids – look for the ANTICODONS that are complementary to the codons.5: Bring back the card with the correct anticodon.6: Record the word that is on the back of the card in your notebook.7: Make sure to take the card back to where you got it so other teams can use it!8: Continue finding the correct anticodon cards and record the sequence of words in order. Check your end result with me.
Share sentences.
Follow-up Questions:
• What do the following analogies from the simulation represent in a real cell?– Words– Sentence
• What may have happened in round 3 of the simulation to give us the outcomes we got?
• Do you think this happens in nature?
Amino Acids
Proteins (polypeptides)