Post on 04-Jul-2020
Research ArticleCharacterization of South American Snails ofthe Genus Biomphalaria (Basommatophora Planorbidae) andSchistosoma mansoni (Platyhelminthes Trematoda) inMolluscs by PCR-RFLP
Roberta Lima Caldeira1 Tatiana Maria Teodoro2
Liana Konovaloff Jannotti-Passos3 Pollanah M Lira-Moreira4
Christiane De Oliveira Goveia5 and Omar dos Santos Carvalho1
1Grupo de Pesquisa em Helmintologia e Malacologia Medica Centro de Pesquisas Rene Rachou FiocruzAvenida Augusto de Lima 1715 30190-001 Belo Horizonte MG Brazil2Biociencias e Biotecnologia em Saude Departamento de Entomologia Centro de Pesquisas Aggeu Magalhaes (CPqAm)Recife PE Brazil3Moluscario ldquoLobato Paraenserdquo Centro de Pesquisas Rene Rachou Fiocruz Avenida Augusto de Lima 171530190-001 Belo Horizonte MG Brazil4Prefeitura Municipal de Belo Horizonte Av Afonso Pena 1212 30130-003 Belo Horizonte MG Brazil5Sessao de Parasitologia Laboratorio de Parasitoses Intestinais e Malacologia Instituto Evandro ChagasRodovia BR-316 Km 7 sn Levilandia 67030-000 Ananindeua PA Brazil
Correspondence should be addressed to Roberta Lima Caldeira caldeiracpqrrfiocruzbr
Received 5 November 2015 Accepted 11 February 2016
Academic Editor Anna K Walduck
Copyright copy 2016 Roberta Lima Caldeira et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited
The identification of snails of the genus Biomphalaria can be done usingmorphological characteristics which depends on the size ofthe snails and skill and knowledge of researcherThese methods sometimes are not adequate for identification of speciesThe PCR-RFLP using the ITS region of the rDNA has been used to identify Brazilian species of the genus Biomphalaria Nevertheless thereis a lack of information about snails from other Latin American countries In addition some snails may be infected by Schistosomamansoni and when submitted to PCR-RFLP they showmolecular profiles different from those previously standardized for the othermollusc species In this work the molecular profiles of 15 species and the subspecies were established by PCR-RFLP of ITS-rDNAwith the enzyme DdeI Moreover the molecular profiles of host species B glabrata B straminea B tenagophila and B pronainfected by S mansoni were also established The molluscs were dissected to permit morphological identification These resultscontribute to a correct identification of snails of the genus Biomphalaria and detection of these snails infected by S mansoni
1 Introduction
Despite therapeutic advances in the last decade Schistoso-miasis remains one of the most prevalent parasitic diseasesworldwide and endemic in 76 countries and territories [1]In Africa and Neotropical Region there are species of thegenus Biomphalaria (Gastropoda Planorbidae) which areintermediate hosts of Schistosoma mansoni Sambon 1907 InLatin America 24 species and one subspecies were registered
(Table 1) four of them can be found naturally infected byS mansoni whereas six were found to be susceptible in thelaboratory
The classical identification of snails of the genus Biom-phalaria is based onmorphological characteristics of the shelland the reproductive system [2] However this approach iscomplicated in cases of inadequate fixation or interspecificsimilarity The Polymerase Chain Reaction and RestrictionFragment Length Polymorphism (PCR-RFLP) directed to
Hindawi Publishing CorporationBioMed Research InternationalVolume 2016 Article ID 1045391 5 pageshttpdxdoiorg10115520161045391
2 BioMed Research International
Table 1 Molluscs of the genus Biomphalaria present in Latin America
Species Geographical distribution aSusceptibility to Schistosoma mansoniBiomphalaria amazonica Paraense1966 Brazil Bolivia Colombia EI
Biomphalaria andecola (Orbigny 1835) Bolivia Peru Chile NIBiomphalaria cousini Paraense 1966 Brazil Ecuador EIBiomphalaria edisoni (Estrada et al2006) Colombia NI
Biomphalaria equatoria (Cousin 1887) Ecuador NI
Biomphalaria glabrata (Say 1818)
Antigua Brazil Curacao Dominica GuadeloupeFrench Guiana Haiti Saint Kitts and Nevis
Martinique Montserrat Puerto Rico DominicanRepublic Saint Lucia Suriname Venezuela
S
Biomphalaria havanensis (Pfeiffer1839) Haiti Mexico Puerto Rico Cuba Venezuela EI
Biomphalaria helophila (Orbigny 1835)Peru Cuba Costa Rica Guatemala Belize HaitiMexico Saint Thomas El Salvador DominicanRepublic Puerto Rico Barbados Nicaragua
EI
Biomphalaria intermedia (Paraense ampDeslandes 1962) Brazil Argentine NS
Biomphalaria kuhniana (Clessin 1883) Suriname Brazil Venezuela Panama Colombia NSBiomphalaria nicaraguana (Morelet1851) Nicaragua NI
Biomphalaria occidentalis Paraense1981 Brazil Paraguay Argentine NS
Biomphalaria oligoza Paraense 1974 Bolivia Brazil Argentine EIBiomphalaria orbignyi Paraense 1975 Argentine Uruguay EI
Biomphalaria obstructa (Morelet 1849) Mexico Puerto Rico Guatemala El Salvador BelizeCuba NS
Biomphalaria pallida (Adams 1846) Jamaica Cuba NIBiomphalaria peregrina (Orbigny1835)
Ecuador Bolivia Chile Brazil Paraguay PeruUruguay Argentine Colombia EI
Biomphalaria prona (Martens 1873) Venezuela SBiomphalaria schrammi (Crosse 1864) French Guiana Guadeloupe Brazil NSBiomphalaria sericea (Dunker 1848) Ecuador EI
Biomphalaria straminea (Dunker1848)
Venezuela Suriname French Guiana Guyana PeruBrazil Paraguay Argentine Dominica GrenadaGuadeloupe Martinique Dominican Republic
Trinidad Uruguay Costa Rica
S
Biomphalaria subprona (Martens1899) Mexico Guatemala NI
Biomphalaria tenagophila (Orbigny1835) Argentine Paraguay Uruguay Brazil Peru Bolivia S
Biomphalaria tenagophila guaibensisParaense 1984 Brazil Uruguay Paraguay Argentine NS
Biomphalaria trigyra (Philippi 1869) Peru Ecuador NSa susceptible = S not susceptible = NS experimental infection = EI not information = NI
the internal transcribed spacer (ITS) region of the rDNAgene has been used with success to resolve these casesThe molecular profile of Brazilian species of the genusBiomphalaria using this method has been established [3]Thus the specific profile of all these species together willbe useful to facilitate interspecific identification in the genus
Biomphalaria Besides the specific identification could bedone by comparing the sequences between closely relatedspecies [4ndash6] aswell as using themorphology associatedwiththe species-specific PCR [7 8]
Furthermore the snails which were collected in the fieldmay be infected with S mansoni during the prepatent period
BioMed Research International 3
and when they are submitted to the molecular identificationtheir DNA is simultaneously amplified with the DNA fromthe parasite In this case themolecular profile differs from theprofile established for the snail alone
The aim of the present work is to present the previouslyspecies-specific profiles established by PCR-RFLP of ITS-rDNA with DdeI and to establish the profiles for B glabrataB tenagophila B straminea and B prona infected by Smansoni
2 Material and Methods
21 Samples Of the 24 species registered for Latin Americathe Medical Malacological Collection (Fiocruz-CMM) hasfifteen species and a subspecies B glabrata B tenagophilaB occidentalis B schrammi B oligoza B peregrina B inter-media B straminea B kuhniana B amazonica B cousiniB prona B edisoni B havanensis B orbignyi and B tena-gophila guaibensis The molluscs were dissected to permitmorphological identification DNA of specimens of the Fio-cruz-CMM collection was cryopreserved
Biomphalaria glabrata B tenagophila and B stramineamolluscs and AL SJ and LE strains of S mansoni usedin this study were maintained and raised in the ldquoLobatoParaenserdquo Mollusc Rearing of Rene Rachou Research CenterCPqRRFiocruz in Belo Horizonte MG Brazil The LEstrain was isolated in 1968 from a patient residing in BeloHorizonte MG (Brazil) The SJ strain was isolated in 1975from naturally infected snails from Sao Jose dos Campos SaoPaulo (Brazil) The AL strain was isolated in 1980 from Bglabrata that originated fromAlagoas state (Brazil) To obtainspecimens of B glabrata B tenagophila and B stramineashedding S mansoni cercariae experimental infection withLE SJ and AL strains respectively was carried out [9]However there was no population of B prona in the ldquoLobatoParaenserdquo Mollusc Rearing so the DNA of the snails andthe parasite (LE strain) was mixed and amplified togetherto obtain the profile of this infected species DNA of adultworms of S mansoni was used for control of amplification
Cercaria macrogranulosa Cercaria caratinguensis andCercaria ocellifera were obtained from field snails Biom-phalaria
22 Molecular Techniques
221 DNA Extraction and PCR-RFLP Assay Total DNAfrom B glabrata B tenagophila and B straminea infectedby S mansoni B prona adult worms of S mansoni andC macrogranulosa C caratinguensis and C ocellifera wereextracted using Wizard Genomic Purification Kit (PromegaMadison USA) with some modifications The DNA of allsamples was used as template in the PCR-RFLP assay Theentire ITS was amplified using the primers ETTS2 (51015840TAACAAGGTTTCCGTAGGTGAA 31015840) and ETTS1 (51015840TGCTTAAGTTCAGCGGGT 31015840) anchored respectively inthe conserved extremities of the 18S and 28S ribosomal genes[10] The PCR amplification was undertaken in a volume of10 120583L consisting of 1ndash10 ng template DNA 10mM Tris-HClpH 85 200120583M of each DNTP 15mM MgCl
2 05 U of Taq
1358872603
310
72
1 2 3 4 5 6 7 8 9 10 11
Figure 1 6 silver stained polyacrylamide gel showing restrictionprofiles obtained by digestion of the ITS region of DNA ribosomalwith DdeI Lane 1 molecular size markers Phi X 174HaeIII Lane2 Biomphalaria glabrata Lane 3 Biomphalaria tenagophila Lane 4Biomphalaria straminea Lane 5 Biomphalaria prona Lane 6 adultworm of Schistosoma mansoni Lane 7 B glabrata infected by Smansoni Lane 8 B tenagophila infected by S mansoni Lane 9 Bstraminea infected by S mansoni Lane 10 DNA of B prona withDNA of S mansoni Lane 11 adult worm of S mansoniThe numberson the left of the gel represent the value in base pairs (bp)
DNA polymerase and 50mM KCl together with 10 pmolof each primer The reactions were covered with a drop ofmineral oil and subjected to the following thermal cyclingprogram initial denaturation step for 3min at 95∘C andthen 32 cycles with annealing at 54∘C for 1min extensionat 72∘C for 2min denaturation at 95∘C for 45 sec and afinal extension step at 72∘C for 5min A negative control(no template DNA) was included in all experiments Threemicroliters of the amplification products were visualized onsilver stained 6 polyacrylamide gels to check the qualityof amplification The remaining 7 120583L was mixed with waterand DdeI (10ndash12 units) enzyme was added together with10 120583L of the respective enzyme buffer The digestion wasperformed for 35 h at 37∘C and at 80∘C for 20min for enzymedenaturation and the digestion products were evaluated onsilver stained 6 polyacrylamide gels [3]
3 Results and Discussion
ThePCR amplification resulted in a product of approximately1200 pb for Biomphalaria one of 800 pb for S mansoni andboth fragments for infected molluscs (data not shown) TheRFLP profiles obtained by digesting rDNA ITS with DdeIin Figure 1 allow the following (1) to identify noninfectedB glabrata B tenagophila B straminea and B prona byobservation of species-specific fragments (Lanes 2 3 4 and5) (2) to establish the species-specific profile of S mansoni(Lanes 6 and 11) and (3) to detect by the presence ofoverlapping species-specific fragments the infection by Smansoni in B glabrata B tenagophila B straminea and Bprona (Lanes 7 8 9 and 10)
All 15 species and the subspecies of Biomphalaria weredissected and their identification confirmed by analysis ofspecific diagnostic characters established for each species Inassociation with morphological identification the profile ofPCR-RFLP was established for these species and is shown inFigure 2
4 BioMed Research International
1 2 3 4 5 6 7 8 9
603
310
72
10 11 12 13 14 15 16 17
Figure 2 6 silver stained polyacrylamide gel showing restrictionprofiles obtained by digestion of the ITS region of DNA ribosomalwith DdeI Lane 1 molecular size markers Phi X 174HaeIII Lane2 Biomphalaria glabrata Lane 3 Biomphalaria tenagophila Lane 4Biomphalaria tenagophila guaibensis Lane 5 Biomphalaria occiden-talis Lane 6 Biomphalaria schrammi Lane 7 Biomphalaria oligozaLane 8 Biomphalaria peregrina Lane 9 Biomphalaria intermediaLane 10 Biomphalaria straminea Lane 11 Biomphalaria kuhnianaLane 12 Biomphalaria amazonica Lane 13 Biomphalaria cousiniLane 14 Biomphalaria prona Lane 15 Biomphalaria edisoni Lane16 Biomphalaria havanensis Lane 17 Biomphalaria orbignyi Thenumbers on the left of the gel represent the value in base pairs (bp)
Studies that incorporate morphological and moleculartechniques in taxonomic analysis can generate data that allowa better interpretation and understanding of the biologicaldiversity of the organisms under study In fact both themolecular and morphological taxonomy if properly appliedsuccessfully achieve the same goal [11] In previous studiesthe diagnosis of S mansoni in molluscs has been performedusing the LS-PCR [12] the conventional PCR assays foramplification of the Sm1ndash7 repeated sequence [13] andLoop-Mediated Isothermal Amplification [14] and otherwisethe most frequent technique used to the identification ofBiomphalaria is the PCR-RFLP
This study has demonstrated the usefulness of the PCR-RFLP technique in the diagnosis of infection by S mansoniin molluscs concurrently with identification of the fourintermediate hosts B glabrata B tenagophila B stramineaand B prona (Figure 1) In addition it was possible to identifya unique profile for the cercariae of S mansoni C macro-granulosa C caratinguensis and C ocellifera obtained fromsnails Biomphalaria collected in the field after amplificationof the ITS region of the rDNA digestion individually with theenzymes DdeI AluI HaeIII RsaI and HpaII (data not pub-lished)
Thus this molecular biology technique has great utilityfor generating new knowledge about the taxonomy of mol-luscs of the genus Biomphalaria Further from the geneticanalysis of various species of Schistosoma and Biomphalariait was observed that intraspecific genetic polymorphism ofthe parasite is limited while in the mollusc it is very pro-nounced showing the higher relevance of molluscan geneticsover parasite genetics in determining the epidemiology of thedisease [15] For example in adult B glabrata resistance toS mansoni has been shown to be a dominant single-genetrait that is inherited by Mendelian genetics In contrast injuveniles the genetics of resistance has been shown to involve
5 to 6 genes each with multiple alleles [16] AdditionallyIttiprasert and Knight report reversing the resistance pheno-type of resistant BS-90 B glabrata by applying stress in theform of a mild heat pulse before they were exposed to Smansoni rendering these snails susceptible [17]
Competing Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
This work was partially supported by grants from FAPEMIGCNPq (3041212014-2) and Fiocruz The authors would liketo thank the ldquoLobato ParaenserdquoMollusc Rearing theMedicalMalacological Collection (Fiocruz-CMM) of Rene RachouResearch Center to the support for this research and theProgram for Technological Development in Tools for Health-PDTISFiocruz for use of its facilities
References
[1] D Engels L Chitsulo A Montresor and L Savioli ldquoTheglobal epidemiological situation of schistosomiasis and newapproaches to control and researchrdquo Acta Tropica vol 82 no2 pp 139ndash146 2002
[2] W L Paraense ldquoEstado atual da sistematica dos planorbıdeosbrasileirosrdquo Arquivos do Museu Nacional vol 55 pp 105ndash1281975
[3] T H D A Vidigal R L Caldeira A J G Simpson and O SCarvalho ldquoFurther studies on the molecular systematics of Bio-mphalaria snails from Brazilrdquo Memorias do Instituto OswaldoCruz vol 95 no 1-2 pp 57ndash66 2000
[4] J-P Pointier R J DeJong L A Tchuem Tchuente T KKristensen and E S Loker ldquoA neotropical snail host ofSchistosoma mansoni introduced into Africa and consequencesfor the Schistosomiasis transmission Biomphalaria tenagophilainKinshasa (Democratic Republic of Congo)rdquoActaTropica vol93 no 2 pp 191ndash199 2005
[5] R J Dejong J A T Morgan W Lobato Paraense et al ldquoEvolu-tionary relationships and biogeography of Biomphalaria (Gas-tropoda Planorbidae) with implications regarding its role ashost of the human bloodfluke SchistosomamansonirdquoMolecularBiology and Evolution vol 18 no 12 pp 2225ndash2239 2001
[6] J P Pointier W L Paraense R J Dejong E S Loker M DBargues and S Mas-Coma ldquoA potential snail host of schisto-somiasis in Bolivia Biomphalaria amazonica Paraense 1966rdquoMemorias do Instituto Oswaldo Cruz vol 97 no 6 pp 793ndash7962002
[7] W M Lotfy R J DeJong B S Black and E S Loker ldquoSpecificidentification of Egyptian Biomphalaria species and possiblehybrids using the polymerase chain reaction based on nuclearand mitochondrial locirdquoMolecular and Cellular Probes vol 19no 1 pp 21ndash25 2005
[8] I F Abou-El-Naga S M F El-Nassery S R Allam E A Shaatand R F M Mady ldquoBiomphalaria species in Alexandria waterchannelsrdquo Parasitology International vol 60 no 3 pp 247ndash2542011
[9] L K Jannotti-Passos R L Caldeira and O S CarvalholdquoTecnicas utilizadas no estudo dos moluscos do genero Biom-phalaria e na manutencao do ciclo de Schistosoma mansonirdquo in
BioMed Research International 5
Schistosoma Mansoni e Esquistossomose Uma Visao Multidisci-plinar O S Carvalho P M Z Coelho and H L Lenzi Edspp 531ndash544 Rio de Janeiro Brazil 2008
[10] R A Kane and D Rollinson ldquoRepetitive sequences in the ribo-somal DNA internal transcribed spacer of Schistosoma haema-tobium Schistosoma intercalatum and Schistosoma mattheeirdquoMolecular and Biochemical Parasitology vol 63 no 1 pp 153ndash156 1994
[11] C Moritz and D M Hillis ldquoMolecular systematics context andcontroversiesrdquo inMolecular Systematics D M Hillis C Moritzand B KMable Eds pp 11ndash16 Sinauer Associates SunderlandMass USA 1996
[12] L K Jannotti-Passos T H D A Vidigal E Dias-Neto et alldquoPCR amplification of the mitochondrial DNA minisatelliteregion to detect Schistosomamansoni infection in Biomphalariaglabrata snailsrdquo Journal of Parasitology vol 83 no 3 pp 395ndash399 1997
[13] J Hamburger N He Y X Xu R M Ramzy J Jourdane and ARuppel ldquoA polymerase chain reaction assay for detecting snailsinfected with Bilharzia parasites (Schistosoma mansoni) fromvery early prepatencyrdquo American Journal of Tropical Medicineand Hygiene vol 59 no 6 pp 872ndash876 1998
[14] I Abbasi C H King E MMuchiri and J Hamburger ldquoDetec-tion of Schistosoma mansoni and Schistosoma haematobiumDNA by loop-mediated isothermal amplification identificationof infected snails from early prepatencyrdquoThe American Journalof Tropical Medicine and Hygiene vol 83 no 2 pp 427ndash4322010
[15] A J Simpson E Dias Neto T H Vidigal H B Pena O SCarvalho and S D Pena ldquoDNApolymorphismof schistosomesand their snail hostsrdquoMemorias do Instituto Oswaldo Cruz vol90 no 2 pp 211ndash213 1995
[16] C S Richards M Knight and F A Lewis ldquoGenetics of Biom-phalaria glabrata and its effect on the outcome of Schistosomamansoni infectionrdquo Parasitology Today vol 8 no 5 pp 171ndash1741992
[17] W Ittiprasert and M Knight ldquoReversing the resistance pheno-type of the Biomphalaria glabrata snail host Schistosoma man-soni infection by temperaturemodulationrdquo PLoS Pathogens vol8 no 4 Article ID e1002677 2012
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
2 BioMed Research International
Table 1 Molluscs of the genus Biomphalaria present in Latin America
Species Geographical distribution aSusceptibility to Schistosoma mansoniBiomphalaria amazonica Paraense1966 Brazil Bolivia Colombia EI
Biomphalaria andecola (Orbigny 1835) Bolivia Peru Chile NIBiomphalaria cousini Paraense 1966 Brazil Ecuador EIBiomphalaria edisoni (Estrada et al2006) Colombia NI
Biomphalaria equatoria (Cousin 1887) Ecuador NI
Biomphalaria glabrata (Say 1818)
Antigua Brazil Curacao Dominica GuadeloupeFrench Guiana Haiti Saint Kitts and Nevis
Martinique Montserrat Puerto Rico DominicanRepublic Saint Lucia Suriname Venezuela
S
Biomphalaria havanensis (Pfeiffer1839) Haiti Mexico Puerto Rico Cuba Venezuela EI
Biomphalaria helophila (Orbigny 1835)Peru Cuba Costa Rica Guatemala Belize HaitiMexico Saint Thomas El Salvador DominicanRepublic Puerto Rico Barbados Nicaragua
EI
Biomphalaria intermedia (Paraense ampDeslandes 1962) Brazil Argentine NS
Biomphalaria kuhniana (Clessin 1883) Suriname Brazil Venezuela Panama Colombia NSBiomphalaria nicaraguana (Morelet1851) Nicaragua NI
Biomphalaria occidentalis Paraense1981 Brazil Paraguay Argentine NS
Biomphalaria oligoza Paraense 1974 Bolivia Brazil Argentine EIBiomphalaria orbignyi Paraense 1975 Argentine Uruguay EI
Biomphalaria obstructa (Morelet 1849) Mexico Puerto Rico Guatemala El Salvador BelizeCuba NS
Biomphalaria pallida (Adams 1846) Jamaica Cuba NIBiomphalaria peregrina (Orbigny1835)
Ecuador Bolivia Chile Brazil Paraguay PeruUruguay Argentine Colombia EI
Biomphalaria prona (Martens 1873) Venezuela SBiomphalaria schrammi (Crosse 1864) French Guiana Guadeloupe Brazil NSBiomphalaria sericea (Dunker 1848) Ecuador EI
Biomphalaria straminea (Dunker1848)
Venezuela Suriname French Guiana Guyana PeruBrazil Paraguay Argentine Dominica GrenadaGuadeloupe Martinique Dominican Republic
Trinidad Uruguay Costa Rica
S
Biomphalaria subprona (Martens1899) Mexico Guatemala NI
Biomphalaria tenagophila (Orbigny1835) Argentine Paraguay Uruguay Brazil Peru Bolivia S
Biomphalaria tenagophila guaibensisParaense 1984 Brazil Uruguay Paraguay Argentine NS
Biomphalaria trigyra (Philippi 1869) Peru Ecuador NSa susceptible = S not susceptible = NS experimental infection = EI not information = NI
the internal transcribed spacer (ITS) region of the rDNAgene has been used with success to resolve these casesThe molecular profile of Brazilian species of the genusBiomphalaria using this method has been established [3]Thus the specific profile of all these species together willbe useful to facilitate interspecific identification in the genus
Biomphalaria Besides the specific identification could bedone by comparing the sequences between closely relatedspecies [4ndash6] aswell as using themorphology associatedwiththe species-specific PCR [7 8]
Furthermore the snails which were collected in the fieldmay be infected with S mansoni during the prepatent period
BioMed Research International 3
and when they are submitted to the molecular identificationtheir DNA is simultaneously amplified with the DNA fromthe parasite In this case themolecular profile differs from theprofile established for the snail alone
The aim of the present work is to present the previouslyspecies-specific profiles established by PCR-RFLP of ITS-rDNA with DdeI and to establish the profiles for B glabrataB tenagophila B straminea and B prona infected by Smansoni
2 Material and Methods
21 Samples Of the 24 species registered for Latin Americathe Medical Malacological Collection (Fiocruz-CMM) hasfifteen species and a subspecies B glabrata B tenagophilaB occidentalis B schrammi B oligoza B peregrina B inter-media B straminea B kuhniana B amazonica B cousiniB prona B edisoni B havanensis B orbignyi and B tena-gophila guaibensis The molluscs were dissected to permitmorphological identification DNA of specimens of the Fio-cruz-CMM collection was cryopreserved
Biomphalaria glabrata B tenagophila and B stramineamolluscs and AL SJ and LE strains of S mansoni usedin this study were maintained and raised in the ldquoLobatoParaenserdquo Mollusc Rearing of Rene Rachou Research CenterCPqRRFiocruz in Belo Horizonte MG Brazil The LEstrain was isolated in 1968 from a patient residing in BeloHorizonte MG (Brazil) The SJ strain was isolated in 1975from naturally infected snails from Sao Jose dos Campos SaoPaulo (Brazil) The AL strain was isolated in 1980 from Bglabrata that originated fromAlagoas state (Brazil) To obtainspecimens of B glabrata B tenagophila and B stramineashedding S mansoni cercariae experimental infection withLE SJ and AL strains respectively was carried out [9]However there was no population of B prona in the ldquoLobatoParaenserdquo Mollusc Rearing so the DNA of the snails andthe parasite (LE strain) was mixed and amplified togetherto obtain the profile of this infected species DNA of adultworms of S mansoni was used for control of amplification
Cercaria macrogranulosa Cercaria caratinguensis andCercaria ocellifera were obtained from field snails Biom-phalaria
22 Molecular Techniques
221 DNA Extraction and PCR-RFLP Assay Total DNAfrom B glabrata B tenagophila and B straminea infectedby S mansoni B prona adult worms of S mansoni andC macrogranulosa C caratinguensis and C ocellifera wereextracted using Wizard Genomic Purification Kit (PromegaMadison USA) with some modifications The DNA of allsamples was used as template in the PCR-RFLP assay Theentire ITS was amplified using the primers ETTS2 (51015840TAACAAGGTTTCCGTAGGTGAA 31015840) and ETTS1 (51015840TGCTTAAGTTCAGCGGGT 31015840) anchored respectively inthe conserved extremities of the 18S and 28S ribosomal genes[10] The PCR amplification was undertaken in a volume of10 120583L consisting of 1ndash10 ng template DNA 10mM Tris-HClpH 85 200120583M of each DNTP 15mM MgCl
2 05 U of Taq
1358872603
310
72
1 2 3 4 5 6 7 8 9 10 11
Figure 1 6 silver stained polyacrylamide gel showing restrictionprofiles obtained by digestion of the ITS region of DNA ribosomalwith DdeI Lane 1 molecular size markers Phi X 174HaeIII Lane2 Biomphalaria glabrata Lane 3 Biomphalaria tenagophila Lane 4Biomphalaria straminea Lane 5 Biomphalaria prona Lane 6 adultworm of Schistosoma mansoni Lane 7 B glabrata infected by Smansoni Lane 8 B tenagophila infected by S mansoni Lane 9 Bstraminea infected by S mansoni Lane 10 DNA of B prona withDNA of S mansoni Lane 11 adult worm of S mansoniThe numberson the left of the gel represent the value in base pairs (bp)
DNA polymerase and 50mM KCl together with 10 pmolof each primer The reactions were covered with a drop ofmineral oil and subjected to the following thermal cyclingprogram initial denaturation step for 3min at 95∘C andthen 32 cycles with annealing at 54∘C for 1min extensionat 72∘C for 2min denaturation at 95∘C for 45 sec and afinal extension step at 72∘C for 5min A negative control(no template DNA) was included in all experiments Threemicroliters of the amplification products were visualized onsilver stained 6 polyacrylamide gels to check the qualityof amplification The remaining 7 120583L was mixed with waterand DdeI (10ndash12 units) enzyme was added together with10 120583L of the respective enzyme buffer The digestion wasperformed for 35 h at 37∘C and at 80∘C for 20min for enzymedenaturation and the digestion products were evaluated onsilver stained 6 polyacrylamide gels [3]
3 Results and Discussion
ThePCR amplification resulted in a product of approximately1200 pb for Biomphalaria one of 800 pb for S mansoni andboth fragments for infected molluscs (data not shown) TheRFLP profiles obtained by digesting rDNA ITS with DdeIin Figure 1 allow the following (1) to identify noninfectedB glabrata B tenagophila B straminea and B prona byobservation of species-specific fragments (Lanes 2 3 4 and5) (2) to establish the species-specific profile of S mansoni(Lanes 6 and 11) and (3) to detect by the presence ofoverlapping species-specific fragments the infection by Smansoni in B glabrata B tenagophila B straminea and Bprona (Lanes 7 8 9 and 10)
All 15 species and the subspecies of Biomphalaria weredissected and their identification confirmed by analysis ofspecific diagnostic characters established for each species Inassociation with morphological identification the profile ofPCR-RFLP was established for these species and is shown inFigure 2
4 BioMed Research International
1 2 3 4 5 6 7 8 9
603
310
72
10 11 12 13 14 15 16 17
Figure 2 6 silver stained polyacrylamide gel showing restrictionprofiles obtained by digestion of the ITS region of DNA ribosomalwith DdeI Lane 1 molecular size markers Phi X 174HaeIII Lane2 Biomphalaria glabrata Lane 3 Biomphalaria tenagophila Lane 4Biomphalaria tenagophila guaibensis Lane 5 Biomphalaria occiden-talis Lane 6 Biomphalaria schrammi Lane 7 Biomphalaria oligozaLane 8 Biomphalaria peregrina Lane 9 Biomphalaria intermediaLane 10 Biomphalaria straminea Lane 11 Biomphalaria kuhnianaLane 12 Biomphalaria amazonica Lane 13 Biomphalaria cousiniLane 14 Biomphalaria prona Lane 15 Biomphalaria edisoni Lane16 Biomphalaria havanensis Lane 17 Biomphalaria orbignyi Thenumbers on the left of the gel represent the value in base pairs (bp)
Studies that incorporate morphological and moleculartechniques in taxonomic analysis can generate data that allowa better interpretation and understanding of the biologicaldiversity of the organisms under study In fact both themolecular and morphological taxonomy if properly appliedsuccessfully achieve the same goal [11] In previous studiesthe diagnosis of S mansoni in molluscs has been performedusing the LS-PCR [12] the conventional PCR assays foramplification of the Sm1ndash7 repeated sequence [13] andLoop-Mediated Isothermal Amplification [14] and otherwisethe most frequent technique used to the identification ofBiomphalaria is the PCR-RFLP
This study has demonstrated the usefulness of the PCR-RFLP technique in the diagnosis of infection by S mansoniin molluscs concurrently with identification of the fourintermediate hosts B glabrata B tenagophila B stramineaand B prona (Figure 1) In addition it was possible to identifya unique profile for the cercariae of S mansoni C macro-granulosa C caratinguensis and C ocellifera obtained fromsnails Biomphalaria collected in the field after amplificationof the ITS region of the rDNA digestion individually with theenzymes DdeI AluI HaeIII RsaI and HpaII (data not pub-lished)
Thus this molecular biology technique has great utilityfor generating new knowledge about the taxonomy of mol-luscs of the genus Biomphalaria Further from the geneticanalysis of various species of Schistosoma and Biomphalariait was observed that intraspecific genetic polymorphism ofthe parasite is limited while in the mollusc it is very pro-nounced showing the higher relevance of molluscan geneticsover parasite genetics in determining the epidemiology of thedisease [15] For example in adult B glabrata resistance toS mansoni has been shown to be a dominant single-genetrait that is inherited by Mendelian genetics In contrast injuveniles the genetics of resistance has been shown to involve
5 to 6 genes each with multiple alleles [16] AdditionallyIttiprasert and Knight report reversing the resistance pheno-type of resistant BS-90 B glabrata by applying stress in theform of a mild heat pulse before they were exposed to Smansoni rendering these snails susceptible [17]
Competing Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
This work was partially supported by grants from FAPEMIGCNPq (3041212014-2) and Fiocruz The authors would liketo thank the ldquoLobato ParaenserdquoMollusc Rearing theMedicalMalacological Collection (Fiocruz-CMM) of Rene RachouResearch Center to the support for this research and theProgram for Technological Development in Tools for Health-PDTISFiocruz for use of its facilities
References
[1] D Engels L Chitsulo A Montresor and L Savioli ldquoTheglobal epidemiological situation of schistosomiasis and newapproaches to control and researchrdquo Acta Tropica vol 82 no2 pp 139ndash146 2002
[2] W L Paraense ldquoEstado atual da sistematica dos planorbıdeosbrasileirosrdquo Arquivos do Museu Nacional vol 55 pp 105ndash1281975
[3] T H D A Vidigal R L Caldeira A J G Simpson and O SCarvalho ldquoFurther studies on the molecular systematics of Bio-mphalaria snails from Brazilrdquo Memorias do Instituto OswaldoCruz vol 95 no 1-2 pp 57ndash66 2000
[4] J-P Pointier R J DeJong L A Tchuem Tchuente T KKristensen and E S Loker ldquoA neotropical snail host ofSchistosoma mansoni introduced into Africa and consequencesfor the Schistosomiasis transmission Biomphalaria tenagophilainKinshasa (Democratic Republic of Congo)rdquoActaTropica vol93 no 2 pp 191ndash199 2005
[5] R J Dejong J A T Morgan W Lobato Paraense et al ldquoEvolu-tionary relationships and biogeography of Biomphalaria (Gas-tropoda Planorbidae) with implications regarding its role ashost of the human bloodfluke SchistosomamansonirdquoMolecularBiology and Evolution vol 18 no 12 pp 2225ndash2239 2001
[6] J P Pointier W L Paraense R J Dejong E S Loker M DBargues and S Mas-Coma ldquoA potential snail host of schisto-somiasis in Bolivia Biomphalaria amazonica Paraense 1966rdquoMemorias do Instituto Oswaldo Cruz vol 97 no 6 pp 793ndash7962002
[7] W M Lotfy R J DeJong B S Black and E S Loker ldquoSpecificidentification of Egyptian Biomphalaria species and possiblehybrids using the polymerase chain reaction based on nuclearand mitochondrial locirdquoMolecular and Cellular Probes vol 19no 1 pp 21ndash25 2005
[8] I F Abou-El-Naga S M F El-Nassery S R Allam E A Shaatand R F M Mady ldquoBiomphalaria species in Alexandria waterchannelsrdquo Parasitology International vol 60 no 3 pp 247ndash2542011
[9] L K Jannotti-Passos R L Caldeira and O S CarvalholdquoTecnicas utilizadas no estudo dos moluscos do genero Biom-phalaria e na manutencao do ciclo de Schistosoma mansonirdquo in
BioMed Research International 5
Schistosoma Mansoni e Esquistossomose Uma Visao Multidisci-plinar O S Carvalho P M Z Coelho and H L Lenzi Edspp 531ndash544 Rio de Janeiro Brazil 2008
[10] R A Kane and D Rollinson ldquoRepetitive sequences in the ribo-somal DNA internal transcribed spacer of Schistosoma haema-tobium Schistosoma intercalatum and Schistosoma mattheeirdquoMolecular and Biochemical Parasitology vol 63 no 1 pp 153ndash156 1994
[11] C Moritz and D M Hillis ldquoMolecular systematics context andcontroversiesrdquo inMolecular Systematics D M Hillis C Moritzand B KMable Eds pp 11ndash16 Sinauer Associates SunderlandMass USA 1996
[12] L K Jannotti-Passos T H D A Vidigal E Dias-Neto et alldquoPCR amplification of the mitochondrial DNA minisatelliteregion to detect Schistosomamansoni infection in Biomphalariaglabrata snailsrdquo Journal of Parasitology vol 83 no 3 pp 395ndash399 1997
[13] J Hamburger N He Y X Xu R M Ramzy J Jourdane and ARuppel ldquoA polymerase chain reaction assay for detecting snailsinfected with Bilharzia parasites (Schistosoma mansoni) fromvery early prepatencyrdquo American Journal of Tropical Medicineand Hygiene vol 59 no 6 pp 872ndash876 1998
[14] I Abbasi C H King E MMuchiri and J Hamburger ldquoDetec-tion of Schistosoma mansoni and Schistosoma haematobiumDNA by loop-mediated isothermal amplification identificationof infected snails from early prepatencyrdquoThe American Journalof Tropical Medicine and Hygiene vol 83 no 2 pp 427ndash4322010
[15] A J Simpson E Dias Neto T H Vidigal H B Pena O SCarvalho and S D Pena ldquoDNApolymorphismof schistosomesand their snail hostsrdquoMemorias do Instituto Oswaldo Cruz vol90 no 2 pp 211ndash213 1995
[16] C S Richards M Knight and F A Lewis ldquoGenetics of Biom-phalaria glabrata and its effect on the outcome of Schistosomamansoni infectionrdquo Parasitology Today vol 8 no 5 pp 171ndash1741992
[17] W Ittiprasert and M Knight ldquoReversing the resistance pheno-type of the Biomphalaria glabrata snail host Schistosoma man-soni infection by temperaturemodulationrdquo PLoS Pathogens vol8 no 4 Article ID e1002677 2012
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
BioMed Research International 3
and when they are submitted to the molecular identificationtheir DNA is simultaneously amplified with the DNA fromthe parasite In this case themolecular profile differs from theprofile established for the snail alone
The aim of the present work is to present the previouslyspecies-specific profiles established by PCR-RFLP of ITS-rDNA with DdeI and to establish the profiles for B glabrataB tenagophila B straminea and B prona infected by Smansoni
2 Material and Methods
21 Samples Of the 24 species registered for Latin Americathe Medical Malacological Collection (Fiocruz-CMM) hasfifteen species and a subspecies B glabrata B tenagophilaB occidentalis B schrammi B oligoza B peregrina B inter-media B straminea B kuhniana B amazonica B cousiniB prona B edisoni B havanensis B orbignyi and B tena-gophila guaibensis The molluscs were dissected to permitmorphological identification DNA of specimens of the Fio-cruz-CMM collection was cryopreserved
Biomphalaria glabrata B tenagophila and B stramineamolluscs and AL SJ and LE strains of S mansoni usedin this study were maintained and raised in the ldquoLobatoParaenserdquo Mollusc Rearing of Rene Rachou Research CenterCPqRRFiocruz in Belo Horizonte MG Brazil The LEstrain was isolated in 1968 from a patient residing in BeloHorizonte MG (Brazil) The SJ strain was isolated in 1975from naturally infected snails from Sao Jose dos Campos SaoPaulo (Brazil) The AL strain was isolated in 1980 from Bglabrata that originated fromAlagoas state (Brazil) To obtainspecimens of B glabrata B tenagophila and B stramineashedding S mansoni cercariae experimental infection withLE SJ and AL strains respectively was carried out [9]However there was no population of B prona in the ldquoLobatoParaenserdquo Mollusc Rearing so the DNA of the snails andthe parasite (LE strain) was mixed and amplified togetherto obtain the profile of this infected species DNA of adultworms of S mansoni was used for control of amplification
Cercaria macrogranulosa Cercaria caratinguensis andCercaria ocellifera were obtained from field snails Biom-phalaria
22 Molecular Techniques
221 DNA Extraction and PCR-RFLP Assay Total DNAfrom B glabrata B tenagophila and B straminea infectedby S mansoni B prona adult worms of S mansoni andC macrogranulosa C caratinguensis and C ocellifera wereextracted using Wizard Genomic Purification Kit (PromegaMadison USA) with some modifications The DNA of allsamples was used as template in the PCR-RFLP assay Theentire ITS was amplified using the primers ETTS2 (51015840TAACAAGGTTTCCGTAGGTGAA 31015840) and ETTS1 (51015840TGCTTAAGTTCAGCGGGT 31015840) anchored respectively inthe conserved extremities of the 18S and 28S ribosomal genes[10] The PCR amplification was undertaken in a volume of10 120583L consisting of 1ndash10 ng template DNA 10mM Tris-HClpH 85 200120583M of each DNTP 15mM MgCl
2 05 U of Taq
1358872603
310
72
1 2 3 4 5 6 7 8 9 10 11
Figure 1 6 silver stained polyacrylamide gel showing restrictionprofiles obtained by digestion of the ITS region of DNA ribosomalwith DdeI Lane 1 molecular size markers Phi X 174HaeIII Lane2 Biomphalaria glabrata Lane 3 Biomphalaria tenagophila Lane 4Biomphalaria straminea Lane 5 Biomphalaria prona Lane 6 adultworm of Schistosoma mansoni Lane 7 B glabrata infected by Smansoni Lane 8 B tenagophila infected by S mansoni Lane 9 Bstraminea infected by S mansoni Lane 10 DNA of B prona withDNA of S mansoni Lane 11 adult worm of S mansoniThe numberson the left of the gel represent the value in base pairs (bp)
DNA polymerase and 50mM KCl together with 10 pmolof each primer The reactions were covered with a drop ofmineral oil and subjected to the following thermal cyclingprogram initial denaturation step for 3min at 95∘C andthen 32 cycles with annealing at 54∘C for 1min extensionat 72∘C for 2min denaturation at 95∘C for 45 sec and afinal extension step at 72∘C for 5min A negative control(no template DNA) was included in all experiments Threemicroliters of the amplification products were visualized onsilver stained 6 polyacrylamide gels to check the qualityof amplification The remaining 7 120583L was mixed with waterand DdeI (10ndash12 units) enzyme was added together with10 120583L of the respective enzyme buffer The digestion wasperformed for 35 h at 37∘C and at 80∘C for 20min for enzymedenaturation and the digestion products were evaluated onsilver stained 6 polyacrylamide gels [3]
3 Results and Discussion
ThePCR amplification resulted in a product of approximately1200 pb for Biomphalaria one of 800 pb for S mansoni andboth fragments for infected molluscs (data not shown) TheRFLP profiles obtained by digesting rDNA ITS with DdeIin Figure 1 allow the following (1) to identify noninfectedB glabrata B tenagophila B straminea and B prona byobservation of species-specific fragments (Lanes 2 3 4 and5) (2) to establish the species-specific profile of S mansoni(Lanes 6 and 11) and (3) to detect by the presence ofoverlapping species-specific fragments the infection by Smansoni in B glabrata B tenagophila B straminea and Bprona (Lanes 7 8 9 and 10)
All 15 species and the subspecies of Biomphalaria weredissected and their identification confirmed by analysis ofspecific diagnostic characters established for each species Inassociation with morphological identification the profile ofPCR-RFLP was established for these species and is shown inFigure 2
4 BioMed Research International
1 2 3 4 5 6 7 8 9
603
310
72
10 11 12 13 14 15 16 17
Figure 2 6 silver stained polyacrylamide gel showing restrictionprofiles obtained by digestion of the ITS region of DNA ribosomalwith DdeI Lane 1 molecular size markers Phi X 174HaeIII Lane2 Biomphalaria glabrata Lane 3 Biomphalaria tenagophila Lane 4Biomphalaria tenagophila guaibensis Lane 5 Biomphalaria occiden-talis Lane 6 Biomphalaria schrammi Lane 7 Biomphalaria oligozaLane 8 Biomphalaria peregrina Lane 9 Biomphalaria intermediaLane 10 Biomphalaria straminea Lane 11 Biomphalaria kuhnianaLane 12 Biomphalaria amazonica Lane 13 Biomphalaria cousiniLane 14 Biomphalaria prona Lane 15 Biomphalaria edisoni Lane16 Biomphalaria havanensis Lane 17 Biomphalaria orbignyi Thenumbers on the left of the gel represent the value in base pairs (bp)
Studies that incorporate morphological and moleculartechniques in taxonomic analysis can generate data that allowa better interpretation and understanding of the biologicaldiversity of the organisms under study In fact both themolecular and morphological taxonomy if properly appliedsuccessfully achieve the same goal [11] In previous studiesthe diagnosis of S mansoni in molluscs has been performedusing the LS-PCR [12] the conventional PCR assays foramplification of the Sm1ndash7 repeated sequence [13] andLoop-Mediated Isothermal Amplification [14] and otherwisethe most frequent technique used to the identification ofBiomphalaria is the PCR-RFLP
This study has demonstrated the usefulness of the PCR-RFLP technique in the diagnosis of infection by S mansoniin molluscs concurrently with identification of the fourintermediate hosts B glabrata B tenagophila B stramineaand B prona (Figure 1) In addition it was possible to identifya unique profile for the cercariae of S mansoni C macro-granulosa C caratinguensis and C ocellifera obtained fromsnails Biomphalaria collected in the field after amplificationof the ITS region of the rDNA digestion individually with theenzymes DdeI AluI HaeIII RsaI and HpaII (data not pub-lished)
Thus this molecular biology technique has great utilityfor generating new knowledge about the taxonomy of mol-luscs of the genus Biomphalaria Further from the geneticanalysis of various species of Schistosoma and Biomphalariait was observed that intraspecific genetic polymorphism ofthe parasite is limited while in the mollusc it is very pro-nounced showing the higher relevance of molluscan geneticsover parasite genetics in determining the epidemiology of thedisease [15] For example in adult B glabrata resistance toS mansoni has been shown to be a dominant single-genetrait that is inherited by Mendelian genetics In contrast injuveniles the genetics of resistance has been shown to involve
5 to 6 genes each with multiple alleles [16] AdditionallyIttiprasert and Knight report reversing the resistance pheno-type of resistant BS-90 B glabrata by applying stress in theform of a mild heat pulse before they were exposed to Smansoni rendering these snails susceptible [17]
Competing Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
This work was partially supported by grants from FAPEMIGCNPq (3041212014-2) and Fiocruz The authors would liketo thank the ldquoLobato ParaenserdquoMollusc Rearing theMedicalMalacological Collection (Fiocruz-CMM) of Rene RachouResearch Center to the support for this research and theProgram for Technological Development in Tools for Health-PDTISFiocruz for use of its facilities
References
[1] D Engels L Chitsulo A Montresor and L Savioli ldquoTheglobal epidemiological situation of schistosomiasis and newapproaches to control and researchrdquo Acta Tropica vol 82 no2 pp 139ndash146 2002
[2] W L Paraense ldquoEstado atual da sistematica dos planorbıdeosbrasileirosrdquo Arquivos do Museu Nacional vol 55 pp 105ndash1281975
[3] T H D A Vidigal R L Caldeira A J G Simpson and O SCarvalho ldquoFurther studies on the molecular systematics of Bio-mphalaria snails from Brazilrdquo Memorias do Instituto OswaldoCruz vol 95 no 1-2 pp 57ndash66 2000
[4] J-P Pointier R J DeJong L A Tchuem Tchuente T KKristensen and E S Loker ldquoA neotropical snail host ofSchistosoma mansoni introduced into Africa and consequencesfor the Schistosomiasis transmission Biomphalaria tenagophilainKinshasa (Democratic Republic of Congo)rdquoActaTropica vol93 no 2 pp 191ndash199 2005
[5] R J Dejong J A T Morgan W Lobato Paraense et al ldquoEvolu-tionary relationships and biogeography of Biomphalaria (Gas-tropoda Planorbidae) with implications regarding its role ashost of the human bloodfluke SchistosomamansonirdquoMolecularBiology and Evolution vol 18 no 12 pp 2225ndash2239 2001
[6] J P Pointier W L Paraense R J Dejong E S Loker M DBargues and S Mas-Coma ldquoA potential snail host of schisto-somiasis in Bolivia Biomphalaria amazonica Paraense 1966rdquoMemorias do Instituto Oswaldo Cruz vol 97 no 6 pp 793ndash7962002
[7] W M Lotfy R J DeJong B S Black and E S Loker ldquoSpecificidentification of Egyptian Biomphalaria species and possiblehybrids using the polymerase chain reaction based on nuclearand mitochondrial locirdquoMolecular and Cellular Probes vol 19no 1 pp 21ndash25 2005
[8] I F Abou-El-Naga S M F El-Nassery S R Allam E A Shaatand R F M Mady ldquoBiomphalaria species in Alexandria waterchannelsrdquo Parasitology International vol 60 no 3 pp 247ndash2542011
[9] L K Jannotti-Passos R L Caldeira and O S CarvalholdquoTecnicas utilizadas no estudo dos moluscos do genero Biom-phalaria e na manutencao do ciclo de Schistosoma mansonirdquo in
BioMed Research International 5
Schistosoma Mansoni e Esquistossomose Uma Visao Multidisci-plinar O S Carvalho P M Z Coelho and H L Lenzi Edspp 531ndash544 Rio de Janeiro Brazil 2008
[10] R A Kane and D Rollinson ldquoRepetitive sequences in the ribo-somal DNA internal transcribed spacer of Schistosoma haema-tobium Schistosoma intercalatum and Schistosoma mattheeirdquoMolecular and Biochemical Parasitology vol 63 no 1 pp 153ndash156 1994
[11] C Moritz and D M Hillis ldquoMolecular systematics context andcontroversiesrdquo inMolecular Systematics D M Hillis C Moritzand B KMable Eds pp 11ndash16 Sinauer Associates SunderlandMass USA 1996
[12] L K Jannotti-Passos T H D A Vidigal E Dias-Neto et alldquoPCR amplification of the mitochondrial DNA minisatelliteregion to detect Schistosomamansoni infection in Biomphalariaglabrata snailsrdquo Journal of Parasitology vol 83 no 3 pp 395ndash399 1997
[13] J Hamburger N He Y X Xu R M Ramzy J Jourdane and ARuppel ldquoA polymerase chain reaction assay for detecting snailsinfected with Bilharzia parasites (Schistosoma mansoni) fromvery early prepatencyrdquo American Journal of Tropical Medicineand Hygiene vol 59 no 6 pp 872ndash876 1998
[14] I Abbasi C H King E MMuchiri and J Hamburger ldquoDetec-tion of Schistosoma mansoni and Schistosoma haematobiumDNA by loop-mediated isothermal amplification identificationof infected snails from early prepatencyrdquoThe American Journalof Tropical Medicine and Hygiene vol 83 no 2 pp 427ndash4322010
[15] A J Simpson E Dias Neto T H Vidigal H B Pena O SCarvalho and S D Pena ldquoDNApolymorphismof schistosomesand their snail hostsrdquoMemorias do Instituto Oswaldo Cruz vol90 no 2 pp 211ndash213 1995
[16] C S Richards M Knight and F A Lewis ldquoGenetics of Biom-phalaria glabrata and its effect on the outcome of Schistosomamansoni infectionrdquo Parasitology Today vol 8 no 5 pp 171ndash1741992
[17] W Ittiprasert and M Knight ldquoReversing the resistance pheno-type of the Biomphalaria glabrata snail host Schistosoma man-soni infection by temperaturemodulationrdquo PLoS Pathogens vol8 no 4 Article ID e1002677 2012
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
4 BioMed Research International
1 2 3 4 5 6 7 8 9
603
310
72
10 11 12 13 14 15 16 17
Figure 2 6 silver stained polyacrylamide gel showing restrictionprofiles obtained by digestion of the ITS region of DNA ribosomalwith DdeI Lane 1 molecular size markers Phi X 174HaeIII Lane2 Biomphalaria glabrata Lane 3 Biomphalaria tenagophila Lane 4Biomphalaria tenagophila guaibensis Lane 5 Biomphalaria occiden-talis Lane 6 Biomphalaria schrammi Lane 7 Biomphalaria oligozaLane 8 Biomphalaria peregrina Lane 9 Biomphalaria intermediaLane 10 Biomphalaria straminea Lane 11 Biomphalaria kuhnianaLane 12 Biomphalaria amazonica Lane 13 Biomphalaria cousiniLane 14 Biomphalaria prona Lane 15 Biomphalaria edisoni Lane16 Biomphalaria havanensis Lane 17 Biomphalaria orbignyi Thenumbers on the left of the gel represent the value in base pairs (bp)
Studies that incorporate morphological and moleculartechniques in taxonomic analysis can generate data that allowa better interpretation and understanding of the biologicaldiversity of the organisms under study In fact both themolecular and morphological taxonomy if properly appliedsuccessfully achieve the same goal [11] In previous studiesthe diagnosis of S mansoni in molluscs has been performedusing the LS-PCR [12] the conventional PCR assays foramplification of the Sm1ndash7 repeated sequence [13] andLoop-Mediated Isothermal Amplification [14] and otherwisethe most frequent technique used to the identification ofBiomphalaria is the PCR-RFLP
This study has demonstrated the usefulness of the PCR-RFLP technique in the diagnosis of infection by S mansoniin molluscs concurrently with identification of the fourintermediate hosts B glabrata B tenagophila B stramineaand B prona (Figure 1) In addition it was possible to identifya unique profile for the cercariae of S mansoni C macro-granulosa C caratinguensis and C ocellifera obtained fromsnails Biomphalaria collected in the field after amplificationof the ITS region of the rDNA digestion individually with theenzymes DdeI AluI HaeIII RsaI and HpaII (data not pub-lished)
Thus this molecular biology technique has great utilityfor generating new knowledge about the taxonomy of mol-luscs of the genus Biomphalaria Further from the geneticanalysis of various species of Schistosoma and Biomphalariait was observed that intraspecific genetic polymorphism ofthe parasite is limited while in the mollusc it is very pro-nounced showing the higher relevance of molluscan geneticsover parasite genetics in determining the epidemiology of thedisease [15] For example in adult B glabrata resistance toS mansoni has been shown to be a dominant single-genetrait that is inherited by Mendelian genetics In contrast injuveniles the genetics of resistance has been shown to involve
5 to 6 genes each with multiple alleles [16] AdditionallyIttiprasert and Knight report reversing the resistance pheno-type of resistant BS-90 B glabrata by applying stress in theform of a mild heat pulse before they were exposed to Smansoni rendering these snails susceptible [17]
Competing Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
This work was partially supported by grants from FAPEMIGCNPq (3041212014-2) and Fiocruz The authors would liketo thank the ldquoLobato ParaenserdquoMollusc Rearing theMedicalMalacological Collection (Fiocruz-CMM) of Rene RachouResearch Center to the support for this research and theProgram for Technological Development in Tools for Health-PDTISFiocruz for use of its facilities
References
[1] D Engels L Chitsulo A Montresor and L Savioli ldquoTheglobal epidemiological situation of schistosomiasis and newapproaches to control and researchrdquo Acta Tropica vol 82 no2 pp 139ndash146 2002
[2] W L Paraense ldquoEstado atual da sistematica dos planorbıdeosbrasileirosrdquo Arquivos do Museu Nacional vol 55 pp 105ndash1281975
[3] T H D A Vidigal R L Caldeira A J G Simpson and O SCarvalho ldquoFurther studies on the molecular systematics of Bio-mphalaria snails from Brazilrdquo Memorias do Instituto OswaldoCruz vol 95 no 1-2 pp 57ndash66 2000
[4] J-P Pointier R J DeJong L A Tchuem Tchuente T KKristensen and E S Loker ldquoA neotropical snail host ofSchistosoma mansoni introduced into Africa and consequencesfor the Schistosomiasis transmission Biomphalaria tenagophilainKinshasa (Democratic Republic of Congo)rdquoActaTropica vol93 no 2 pp 191ndash199 2005
[5] R J Dejong J A T Morgan W Lobato Paraense et al ldquoEvolu-tionary relationships and biogeography of Biomphalaria (Gas-tropoda Planorbidae) with implications regarding its role ashost of the human bloodfluke SchistosomamansonirdquoMolecularBiology and Evolution vol 18 no 12 pp 2225ndash2239 2001
[6] J P Pointier W L Paraense R J Dejong E S Loker M DBargues and S Mas-Coma ldquoA potential snail host of schisto-somiasis in Bolivia Biomphalaria amazonica Paraense 1966rdquoMemorias do Instituto Oswaldo Cruz vol 97 no 6 pp 793ndash7962002
[7] W M Lotfy R J DeJong B S Black and E S Loker ldquoSpecificidentification of Egyptian Biomphalaria species and possiblehybrids using the polymerase chain reaction based on nuclearand mitochondrial locirdquoMolecular and Cellular Probes vol 19no 1 pp 21ndash25 2005
[8] I F Abou-El-Naga S M F El-Nassery S R Allam E A Shaatand R F M Mady ldquoBiomphalaria species in Alexandria waterchannelsrdquo Parasitology International vol 60 no 3 pp 247ndash2542011
[9] L K Jannotti-Passos R L Caldeira and O S CarvalholdquoTecnicas utilizadas no estudo dos moluscos do genero Biom-phalaria e na manutencao do ciclo de Schistosoma mansonirdquo in
BioMed Research International 5
Schistosoma Mansoni e Esquistossomose Uma Visao Multidisci-plinar O S Carvalho P M Z Coelho and H L Lenzi Edspp 531ndash544 Rio de Janeiro Brazil 2008
[10] R A Kane and D Rollinson ldquoRepetitive sequences in the ribo-somal DNA internal transcribed spacer of Schistosoma haema-tobium Schistosoma intercalatum and Schistosoma mattheeirdquoMolecular and Biochemical Parasitology vol 63 no 1 pp 153ndash156 1994
[11] C Moritz and D M Hillis ldquoMolecular systematics context andcontroversiesrdquo inMolecular Systematics D M Hillis C Moritzand B KMable Eds pp 11ndash16 Sinauer Associates SunderlandMass USA 1996
[12] L K Jannotti-Passos T H D A Vidigal E Dias-Neto et alldquoPCR amplification of the mitochondrial DNA minisatelliteregion to detect Schistosomamansoni infection in Biomphalariaglabrata snailsrdquo Journal of Parasitology vol 83 no 3 pp 395ndash399 1997
[13] J Hamburger N He Y X Xu R M Ramzy J Jourdane and ARuppel ldquoA polymerase chain reaction assay for detecting snailsinfected with Bilharzia parasites (Schistosoma mansoni) fromvery early prepatencyrdquo American Journal of Tropical Medicineand Hygiene vol 59 no 6 pp 872ndash876 1998
[14] I Abbasi C H King E MMuchiri and J Hamburger ldquoDetec-tion of Schistosoma mansoni and Schistosoma haematobiumDNA by loop-mediated isothermal amplification identificationof infected snails from early prepatencyrdquoThe American Journalof Tropical Medicine and Hygiene vol 83 no 2 pp 427ndash4322010
[15] A J Simpson E Dias Neto T H Vidigal H B Pena O SCarvalho and S D Pena ldquoDNApolymorphismof schistosomesand their snail hostsrdquoMemorias do Instituto Oswaldo Cruz vol90 no 2 pp 211ndash213 1995
[16] C S Richards M Knight and F A Lewis ldquoGenetics of Biom-phalaria glabrata and its effect on the outcome of Schistosomamansoni infectionrdquo Parasitology Today vol 8 no 5 pp 171ndash1741992
[17] W Ittiprasert and M Knight ldquoReversing the resistance pheno-type of the Biomphalaria glabrata snail host Schistosoma man-soni infection by temperaturemodulationrdquo PLoS Pathogens vol8 no 4 Article ID e1002677 2012
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
BioMed Research International 5
Schistosoma Mansoni e Esquistossomose Uma Visao Multidisci-plinar O S Carvalho P M Z Coelho and H L Lenzi Edspp 531ndash544 Rio de Janeiro Brazil 2008
[10] R A Kane and D Rollinson ldquoRepetitive sequences in the ribo-somal DNA internal transcribed spacer of Schistosoma haema-tobium Schistosoma intercalatum and Schistosoma mattheeirdquoMolecular and Biochemical Parasitology vol 63 no 1 pp 153ndash156 1994
[11] C Moritz and D M Hillis ldquoMolecular systematics context andcontroversiesrdquo inMolecular Systematics D M Hillis C Moritzand B KMable Eds pp 11ndash16 Sinauer Associates SunderlandMass USA 1996
[12] L K Jannotti-Passos T H D A Vidigal E Dias-Neto et alldquoPCR amplification of the mitochondrial DNA minisatelliteregion to detect Schistosomamansoni infection in Biomphalariaglabrata snailsrdquo Journal of Parasitology vol 83 no 3 pp 395ndash399 1997
[13] J Hamburger N He Y X Xu R M Ramzy J Jourdane and ARuppel ldquoA polymerase chain reaction assay for detecting snailsinfected with Bilharzia parasites (Schistosoma mansoni) fromvery early prepatencyrdquo American Journal of Tropical Medicineand Hygiene vol 59 no 6 pp 872ndash876 1998
[14] I Abbasi C H King E MMuchiri and J Hamburger ldquoDetec-tion of Schistosoma mansoni and Schistosoma haematobiumDNA by loop-mediated isothermal amplification identificationof infected snails from early prepatencyrdquoThe American Journalof Tropical Medicine and Hygiene vol 83 no 2 pp 427ndash4322010
[15] A J Simpson E Dias Neto T H Vidigal H B Pena O SCarvalho and S D Pena ldquoDNApolymorphismof schistosomesand their snail hostsrdquoMemorias do Instituto Oswaldo Cruz vol90 no 2 pp 211ndash213 1995
[16] C S Richards M Knight and F A Lewis ldquoGenetics of Biom-phalaria glabrata and its effect on the outcome of Schistosomamansoni infectionrdquo Parasitology Today vol 8 no 5 pp 171ndash1741992
[17] W Ittiprasert and M Knight ldquoReversing the resistance pheno-type of the Biomphalaria glabrata snail host Schistosoma man-soni infection by temperaturemodulationrdquo PLoS Pathogens vol8 no 4 Article ID e1002677 2012
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology