Post on 23-Jul-2020
Expression and Recombinase Activity of RAG 1 and Two Splice Variants of RAG 2 in Mature Human Primary Tonsilar B Lymphocytes
L. Jane Gillis
A thesis submitted with the requirements of the degree of Master of Science Graduate Department of Immunology. in the University of Toronto.
O Copyright by Lisa Jane Gillis, 1999
National Library BS.1 of Canada Bi bliotheque nationale du Canada
Acquisitions and Acquisitions et Bibliographic Services services bibliographiques
395 Wellingîon Street 395. rue Wellington OttawaON K l A û N 4 OttawaON K 1 A M Canada CaMda
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, dishibute or sell copies of this thesis in microform, paper or electronic formats.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la fome de microfiche/film, de reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts f?om it Ni la thèse ni des extraits substantiels may be printed or othenvise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.
ABSTRACT
Expression and Recombinasse Activity of RAG 1 and Two Splice Variants of RAG 2 in Mature Hurnan Primaiy Tonsilar 6 Lymphocytes
Degree of Master of Science, 1999. Lisa Jane Gitlis
Graduate Department of Imrnunology, in the University of Toronto.
RAG 1 and RAG 2 are required for the reanangernent of both the
immuno~~lobulin (lg) and T cell receptor genes. Their expression was first thought
only to occur during the immature stages of B and T cell development. Studies in
oui lab using a human mature B ce11 line OC[ LYS and a unique set of its variants
demonstrated variation in expression of both the BCR and the RAG 1 and RAG 2
genes. Evidence employing mouse rnodels dernonstrated an unexpected re-
expression of the RAG genes in mature mouse B cells activated in vitro and in
peripheral lymph node germinal centres of immunized mice, indicating the
potential for further lg gene rearrangements. In this thesis, 1 describe
experiments aimed at establishing whether re-expression of the RAG genes
occurs in humans. A Reverse Transcriptase - Polymerase Chain Reaction (RT-
PCR) assay was developed and optimized to determine expressicn of the RAG
genes in human peripheral lymphoid tissue. I found that RAG 1 transcripts, as
well as transcripts of two RAG 2 splice variants were detectable in human
tonsilar B lymphocytes and are considered to be responsible for the dsDNA
breaks observed in these cells under linker-mediated PCR (LM-PCR) analysis.
ACKNOWLEDGEMENTS:
I am grateful to my supervisor, Dr. Neil Berinstein, for his support and encouragement and to the memben of my supervisory cornmittee, Dr. Gillian Wu and Dr. Susanna Lewis, for their sound scientific criticism and advice. I would also like to thank Laurent Verkoczy and Ali Zarrin, not only for their valuable advice in the laboratory, but also for their ptevious work on the RAG genes, which helped to pave the way for this project. t wish to extend an especially wann thank you to ail of the members of Dr. Berinstein's laboratory for their assistance and friendship. Finally, I dedicate this thesis to my son Alexander, who has been my greatest source of inspiration.
PUBLICATION:
An abridged version of this thesis has been submitted for publication to the Journal of Immunology. The paper is entitled, Expression and Recombinase Activity of RAG -1 and Two Splice Variants of RAG -2 in Mature Human Primary Tonsilar B Lymphocytes by L. Jane Gillis, Ali A. Zarrin, Laurent K. Verkoczy, Gillian Wu and Neil L. Berinstein.
TABLE OF CONTENTS
CHAPTER 1 : INTRODUCïïON
I .I lntroductory overview and rationale
1.2 V(D)3 recombination
1.2.i The cis elements required for V(D)J recombination
1.2.ii The trans elements required for V(D)J recombination
1.2.iia RAG 1 and RAG 2 are necessary for V(D)J Cleavage to Occur
1.2.iib The 12/23 rule
I.2.iic V(D)J Cieavage: A transposable event?
1.2.iid OS8 Repair
1.3 General organization of the RAG locus
1.4 Functional characten'zation of the RAG locus
1.5 RAG expression
1.5.i B cell development
1.5.i The B cell receptor
1.5.iii RAG expression and its role in the regulation of B and T lymphopoiesis
1.5.iv The classic model of RAG expression
1.6 Receptor editing: The "third wave' of RAG expression
1.6.i A model for receptor editing
1 -6.ii Receptor editing vs. deletion
1.6.iii The RS in receptor editing
1.7 Re-expression of RAG 1 and RAG 2 in peripheral lymphoid tissues
1.7.i Peripheral lymphoid organs and the germinal centre reaction
1.7.ii Somatic hypemutation
1.8 RAG expression in mature B cells, the "fourth" wave
1.8.i Re-expression of RAG 1 and RAG 2 and evidence for secondary rearrangements in human GC 6 cells
1.9 The mechanisms of RAG regulation
1.9.i Transcriptional regulation
1.9.ii Post-transcriptional regulation
I.9.iii Post-translational reg ulation
1.1 0 The LM-PCR assay
1.1 0.i LM-PCR demonstrates RAG functionality in the germinal centre
CHAPTER 2: MATERIALS AND METHODS
2.1 Cell lines and culture conditions
2.2 Flow cytometric analysis
2.3 Tonsil tissue manipulation and 6 cell extraction
RNA extraction
Analysis of RAG-1 and M G - 2 splice variant transcripts
DNA extraction and LM-PCR
LM-PCR oligonucleotide sequences
CHAPTER 3: RESULTS
3.1 Sensitivity and specificity of PCR assays for RAG 1 and RAG 2
3.2 PCR assay sensitivity demonstrated in vitro
3.3 PhenotypicanalysisofpurifiedhumanBlymphocytes
3.4 Expression of RAG genes in human tonsil tissue and purifi ed B lymphocyte populations
3.5 Functional evidence of RAG re-expression
CHAPTER 4: DISCUSSION
4.1 Discussion of results
4.2 RAG expression in mature B cells -models and implications for RAG activity
4.3 Implications in disease
4.4 Future studies
References
VI l
LIST OF FlGUFlES
Figure 1 V(D)J Recombination and Coupled Cleavage by RAG
Figure 2 RAG Genomic Organization
Figure 3 The B Cell Receptor
Figure 4 Antigen lndependent and Dependent B Cell Development
and Transcription Factors Essential for Development
Figure 5 Receptor Editing
Figure 6 The Germinal Centre Reaction and a Role for RAG
Figure 7A Assay to Detect RAG -1 and RAG -2 Gene Expression
Figure 78 Sensitivity of RAG -1 PCR Assays
Figure 7C Sensitivity of RAG -2 PCR Assays
Figure 7D RT-PCR - Assay Sensitivity Dernonstrated in Vitro using
a RAGhi Mature B Cell Line
Figure 8 Phenotypic Analysis of Purified Tonsilar Germinal
Centre B Cells
Figure 9A RT-PCR Analysis of Human Whole Tonsil Tissue
amplified with RAG -1 specific primers
Figure 96 RT - PCR Analysis of Human tonsil Tissue
Amptified with RAG -2 Specific Primers
Figure 9C RT-PCR Analysis of Enriched Human tonsilar B
Lymphocytes amplified with RAG -1 and RAG -2
Figure 1 OA Assay to Detect Kappa Locus dsDNA -Breaks
Figure 106 Assay to Detect Lambda Locus dsDNA -Breaks
Figure IOC LM- PCR Analysis of Whole Tonsil and Enriched Human tonsilar 6 Lymphocytes
Figure 11 Receptor Editing vs. Receptor Selection
LIST OF TABLES
Table 1 Phenotypic Screening Demonstrates Specimen
Heterogeneity
Table I I Screen of Human Tonsil Samples for RAG Expression
Table III Summary of Tonsil Samples and their Degree of RAG
Signal
LIST OF ABREVlAlïONS
Ag
BCR
bp
BM
cDNA
DSB
dsDNA
EtBr
FDC
FlTC
GC
1 g
1 L-2
11-3
11-4
I L-6
1 L-7
IL-1 0
American Type Culture Collection
antigen
B cell receptor
base pair
bone marrow
complementary DNA
double strand break repair
double stranded deoxyribonucleic acid
Ethidium Bromide
Follicular Dendritic cell
Fluorescein Isothiocyanate
Germinal centre (s)
lmmunoglobulin
Interleukin -2
Interleukin-3
Interieukin -4
Interleukin-6
Interleukin -7
Interleukin-10
IL-13
INF-y
ITAM
LM-PCR
LPS
PALS
PBS
PCR
PE
pre-BCR
RACE
RAG
RS
RNA
RNAse
RSS
RT
SDS
slg
SSC
Interleukin -1 3
Interferon -gamma
lmmunoreceptor tyrosine-based motif
Linker - Mediated PCR
Lipopolysaccharide
Periarteriolar lymphoid sheath
phosphate-buffered saline
Polymerase Chain Reaction
Phycolerythrin
pre-B cell receptor
Rapid Amplification cDNA ends
Recombinase Activating Gene
Recombination Sequence
ribonucleic acid
ri bonuclease
Recombination Signal Sequence
Reverse Transcriptase
sodium dodecyl sulphate
Surface lmmunoglobulin
sodium chloride/sodium citrate
XII
T. E Tris - EDTA
TdT Terminal deoxynucleotidyl Transferase
Tg Transgen ic
UV ultraviolet
CHAPTER 1: lNTRODUCTlON
1.1 Introductory overview and rationale:
Expression of both RAG 1 and RAG 2 is required for the assembly of the
immunoglobulin (lg) and thymocyte receptors (1, 2) and defines principal
developmental stages of B and T lymphopoiesis (3-5). Expression of a
functional mature lg or T cell receptor was initially thought to preclude further
V(D)J rearrangements by terminating RAG expression. However. our lab and
other groups have encountered 8 cell lines, which CO-express RAG and surface
lg (dg) recepton (6-8). Recent evidence of RAG expression in mature B cells
cornes from both in vitro and in vivo studies in murine model systems. Taken
together, these reports imply that the RAG genes have some until now,
unforeseen function in mature B cells. Therefore, I set out to establish whether
RAG is expressed in human germinal centre (GC) 6 cells. I used human whole
tonsil and extracted tonsilar B cells recovered post tonsillectomy in the study.
Using RT-PCR, the experimental system was optimized to detect RAG 1 and the
two splice variants of RAG 2. To establish whether the expressed RAG genes
were functional in these peripherai lymph tissues, LM-PCR was subsequently
carried out, kindly by the Wu laboratory.
1.2 V(D)J Recombination:
The immLne system is capable of specifically recognizing and
responding to an enormous number of antigens. The generation of antibody
and T cell receptor diversity occurs through a somatic DNA rearrangement
process known as V(D)J recombination. In this process, genes that encode
variable regions are assembled during the early stages of 6 and T lymphocyte
differentiation from germline variable, diversity and joining gene segments. This
recombinatorial process is carried out in the bone marrow, thymus and
secondary lymph organs of adult vertebrates, and aids in the generation of a
continuous new source of differentiating lymphocytes (9).
1.2.i The cis elements required for V(D)J recombination:
The process of V(D)J recombination is a specialized form of site-directed
ds-DNA breakage and repair essential for the physiological developmental
program of lymphocytes. V(D)J recombination occurs early in 6 and T
lymphocyte development and involves unique cis and trans acting elements.
Cis elements mediating the site-specificity of the recombination reaction have
been well characterized and are referred to as Recombination Signal
Sequences (RSS) (9-12). These sequences flank the V, D and J gene coding
segments and consist of a highly conserved palindromic heptarner separated
from an NT -rich nonamer by s spacer length of either 12 or 23 base pair (bp)
(9). A functional recombination event requires efficient recombination between
gene segments- flanked by one 12bp signal and one 23bp signal. This
recombination process restriction is referred to as the 12/23 rule. A precisely
fused heptamer-heptamer signal joint and an imprecise coding joint consisting
of flanking DNA coding regions are the resutting products of recombination
generated by these events (9. 10, 13) ( 14). The RSS is critical for directing the
recombination machinery to the proper site of recombination and regulates
which gene segments may be recombined.
1.2.i The trans elements required for V(D)J recombination:
V(D)J recombination in essence, is the evolutionary combination of two
unrelated systems involved in DNA metabolism. Together, these two
independent mechanisms, that of site-specific, lymphoid restricted
recombination and general ds-DNA repair, provide Ag-specific mammalian
immunity, in addition to the innate immunity common to al1 multi-cellular
organisms. Recombination occurs in two well-defined steps. The initial phase
has now been shown to be carried out by the lymphoid-specific RAG proteins
(1, 15, 16) and involves the introduction of a double-strand break between the
RSS and the flanking coding sequence (17-19). This DNA cleavage phase
occurs in two ordered and sequential steps (1).
In the first step, a nick is introduced at the signakoding border of the
upper 5' strand of DNA. The resulting 3' free hydroxyf group then carries out a
nucleophilic attack at the phosphodiester bond on the antiparallel DNA strand.
The resulting two products of this cleavage reaction consist of a covalently
closed hairpinned coding end and a blunt, 5' phosphorylated signal end. These
intermediate species have been the subject of many in vitro and biochemical
studies (17-19), although they were first detected and characterized in vivo in
the SClD mouse model (1, 17, 20).
l.2.iia RAG 1 and RAG 2 aie necessary for the first step in V(D)J
Cleavage:
It has been shown that RAG 1 and RAG 2 are the only two lyrnphoid-
specific gene products that are necessary and sufficient to confer V(D)J
recombination of reporter substrates in non-lymphoid cells (15, 21). lt has also
been well documented that mice lacking either of the RAG genes do not
rearrange their lg or TCR loci (22, 23).
RAG functionality was partially elucidated through experiments carried
out by van Gent et al., who reproduced the eariiest steps of V(D)J recombination
using a cell free system. V(D)J cleavage products were assayed using nuclear
extracts of a pre-6 cell line (20). lmproved cleavage efficiency was observed
only upon the addition of extracts containing recombinant RAG 1 protein, which
was also capable of restoring cutting activity in inactive RAG 1" extracts. These
observations recealed that the RAG 1 protein was necessary for cleavage to
occur. A direct role for RAG 2 in this reaction was also demonstrated. However,
precise function of these proteins proved difficult to assess, since other cellular
factors were also present in the extracts.
These studies helped to augment results previously obtained by Chen et
al., in which broken ends were shown to be the precursors to signal ends in a
temperature sensitive transfomed pre-6 cell line (24). it also aided to support
work by other groups, who observed that the kinetics of end resolution differed
for the different interrnediates. Coding ends were reasoned to be difficult to
detect in wild type mice, versus SClD mutants, because efficient coding joint
formation was found to occur much faster than signal joint formation. Under
normal physiological circumstances, hairpin coding ends are rapidly opened,
processed and joined, while signal ends are typically ligated together ât a much
slower rate (25, 26).
Not long after, McBlane et al., (1) reported that this same cleavage
reaction could be carried out using only purified RAG 1 and RAG 2 proteins .
This group also demonstrated that these two proteins were the only proteins
required for both recognition and cutting at RSSs and that cleavage actually
occurred in two steps. Using an experimental system employing RAG 1 and
RAG 2 fusion proteins CO-expressed in insect cells (which do not carry out V(D)J
recom bination) and oligonucleotide substrates. this group successfully
demonstrated that together, RAG 1 and RAG 2 initiate V(D)J recombination by
introducing a nick in substrate DNA at the 5' end of the heptamer creating a 3'-
OH group. This group subsequently links covalently to the phosphate group of
the opposite strand in a direct trans-esterification reaction. This reaction creates
a hairpin intermediate at the coding end and a blunt 5'-phosphorylated signal
end. This study was the first to document the requirement for the RSS element,
as interestingly, pre-nicked substrates lacking an RSS were not converted to
hairpin structures, even in the presence ûf both RAG proteins. This indicated
that both proteins and both RSS sequences are required for this site-specific
intramolecular reaction to proceed (1).
1 .Z.iib The 12/23 rule:
The 12/23 rule was first realized as a mechanism of limiting DNA
rearrangement to the appropriate coding segments (V-J or V-D-J) (9). The
12/23 rule imposes the restriction that recombination must take place between
segments flanked by RSSs of different spacer lengths, so that rearrangements
occur only between elements that can potentially create a functional receptor
gene (14, 27, 28). it has been shown however, that this restriction can be
manipulated in vitro. For example, studies carried out by van Gent et al., (1 4)
demonstrated that when Mn2+ is used in conjunction with purified RAG proteins,
hairpin formation proceeds in the presence of only a single RSS, breaking the
12/23 rule. However, only nicking takes place, when the more physiologically
relevant divalent metal ion Mg2+ is used under similar conditions. Two RSS
elernents are required for proper hairpin formation to proceed under Mg2+
conditions, indicating that the 12/23 restriction must be adhered to under these
biological conditions ( 14).
Following these initial experiments, both Schatz's and Gellert's groups
confirmed in vitro, that the initial cleavage reaction was indeed strictly
dependent on the presence of two RSS elernents and adhered to the 12/23 rule
as was known to take place in vivo (14, 29).
Recent work by Kim and Oettinger, using a novel V(D)J cleavage
substrate, has shown that while the RAG proteins alone establish a preference
for the 12/23 rule, a much stricter dependence of cleavage on the 12/23 nile is
enforced in the presence of HMG1 and competitor ds-DNA (30). The authors
suggest that the 12/23 mle can be generalized to a requirement for spacers that
differ frorn each other by a single helical tum and that falhful recreation in vitro
of 12/23 coupled cleavage requires only RAG 1, RAG 2 and HMG 1 (30).
1.2.iic V(D)J Cleavage: A Transposition Event?:
The bioch-emical mechanisms underlying V(D)J recombination and the
role of the RAG genes is very similar to transposable element integration
obsewed in prokaryotes and retrotransposon activity seen in eukaryotes (31)
(32). Not surprisingly, studies have identified a region of RAG 1 that shares
homology to the bacterial Hin recombinase and is essential for RAG 1 binding
to the nonamer of the RSS. However, RAG 2 DNA binding activity has not yet
been detected (33).
More recently, scientists have begun to suggest that the human RAG
genes are a result of one transposable event occurring over 450 million years
ago. As a result of this RAG transposition (perhaps by the interruption of a
membrane -spanning -receptor gene expressed in lymphocytes) the repertoire
of somatic immunoglobulin genes can far exceed the number of lg genes in the
gerrnline. This gives rise to an immune defense system whose repertoire is
capable of responding to a vast number of invading viruses, microorganisms
and other infectious agents.
ViD)J recombination occurs in the absence of additional ATP or other
high energy cofactors, similar to transposition events ( 1). However, V(D)J
cleavage differs from a transposition event, such that the cleavage reaction
must be of an intramolecular nature. whereby nucleophilic attack and a
transesterification reaction occurs and is crucial for the formation of hairpin
intemediates. Transposition reactions in contrast, can involve either a strand
transfer event between different DNA molecules, or locations in the same
molecule.
l.2.iid The Rejoining of Broken Ends Requires ds-DNA Repair and
is the second step in V(D)J Recombination:
Although the various factors involved in V(D)J recornbination and ds-
DN A repair are rapidly being identified and characterized, the interaction
between the RAG synaptic complex and the ds-DNA repair cornplex rernains to
be better understood. A summary of V(D)J recombination is depicted in figure 1.
In contrast to the cleavage reaction, the later stages of V(D)J
recombination are quite non-specific and are carried out by ubiquitous factors
involved in general ds-DNA break repair which occurs in al1 somatic cells. At
this stage, hairpinned coding ends must be opened and the ends processed.
Genetic studies have identified the catalytic domain of DNA-protein
kinase (DNA-PK) and the heterodimeric protein complex Ku (Ku70/Ku86) as
the factors responsible for both general ds-DNA break repair and the resolution
of coding ends in V(D)J recombination (34-36). Cells with the SClD genotype
lack active DNA-PK protein as a result of a carboxy-terminal truncation (37).
Analysis of V(D)J intennediates in SClD mice has shown that these mice are
capable of signal joint formation. However, they resolve hairpinned coding ends
with a very low efficiency at their Ag-receptor loci (17).
Both the Ku70 and Ku86-deficient models have demonstrated that the
Ku70/86 heterodimer is important for the formation of both coding and signal
joints, as mutations in either subunit affect formation of both joints (36). One
function of the Ku subunits is to bind DNA ends or DNA abnonnalities, such as
nicks. Ku is the DNA -binding component of DNA-PK and is thought to activate
the DNA-PK (35).
Signal joints typically have a precise head to head Iinkage at the RSS
(27). However, once opened coding ends may be processed in many ways.
Nucleotides complementary to the end of the coding sequence, known as P
nucleotides, may be either added to the asymmetric coding ends, or deleted by
as yet unidentified nucleases. Furthemore, additional non-tempfated
nucleotides (N nucleotides) may be inserted by Terminal deoxynucleotidyl
transferase (TdT), a lymphoid-specific component which is responsible for
creating much of the junctional diversity crucial in expanding the combinatorial
diversity of Ag-receptor generation (27). Each of these imprecise end
processing mechanisrns confers added specificities to the immune repertoire by
increasing Ag-receptor diversity, rendering a more flexible immune system (27,
38).
V(D)J Recomtination and Coupkd Cieavage by RAG
Step 1 I
cleavage rd
transesterification reaction bindstoRSSakmgwith
+ cieavage complete
V(D)J intemdhtes genented
attacb the phos-ïcr bond on the oppositestrand form'ng the hairpin structure
hairpin formation at coding ends
J 2
Step 2 Ku binds to DNA ends and stimulates ONA-PK and hairpin wening
pairing of signai ends
Iigation by XRCC4:DNA Ggase IV
Signal joint Figure 1:
bluntcut signal ends
4 nuckotide addition by G TdTat codimgends
/ F d n d , ,,of coding en&
I( ligation by XRCC4:ONA i i i N
Coding joint
The likely scenario of the componerits and neps of V@)J recombination: Although combinatorid diversity is achieved using multiple V and J segments, a single V and J are depiaed here for simplicity. Triangles rcpresuit RSS.
Finally, one mernber of the X-ray cross complementation group XRCW, should
be rnentioned. Grawunder et al., demonstrated that DNA ligase IV co-
irnmunoprecipitates with XRCC4. The authors suggest that this interaction
impiicates DNA ligase IV as the marnmalian ligase responsible for the final
Iigation step in V(D)J recombination (39).
1.3 General Organization of the RAG locus:
RAG 1 and RAG 2 genomic organization has been strongly consewed
throughout evolution. The genes have been identified not only in humans (40),
but also in mouse, (15, 2 1) rabbit, (42) and xenopus (43). In mammais the genes
exist closely juxtaposed in a tail to tail orientation (15). Strikingly, they have
been shown to be concordantly and precisely expressed (15). However, each
employs different promoters (44) and is active in developing lymphocytes in the
bone marrow. thymus, and fetal liver. while not in any other cell types (30).
While the overall genomic structure of the RAG locus is highly consewed across
species, variations in the size and sequence of the intergenic regions has been
observed. This would suggest that there has not been a significant evolutionary
pressure to maintain these ragions of the locus and that perhaps regulatory
regions reside elsewhere (16).
Moreover, RAG 1 and RAG 2 share no sequence similarity and therefore
are unlikely to have arisen by gene duplication. It is unusual to find such closely
linked genes present in the mammalian genome possessing related functions,
yet lacking sequence homology ( 15, 16). Along with species consoivation, many
believe that the genes arose as part of a viral or fungal recombination system
which CO-evolved to play its current role in vertebrate V(D)J recombination (15).
Recent reports now provide evidence to support the theory that the RAG genes
are actually the result of a transposable element that integrated into the DNA of
jawed vertebrates many millions of years ago (45-47).
Recent studies performed in our laboratory have led to the detailed
characterization of the genomic organization of the human RAG 1 and RAG 2
locus, including the transcriptional start site and promoter regions (44). Figure 2
summarizes features of the genomic organization of the human RAG locus. The
human RAG 1 locus consists of two exons separated by an intron of 5.2kb. The
RAG 1 coding exon generates a transcript of approximately 6.6kb and the
resulting 119kDa protein is encoded in one large open reading frame contained
within a single exon.
RAG 2 contains three exons and spans approximately 7kb of the
genome. Exons 1A or 1 6 splice into exon 2 (coding exon) of RAG 2, indicating
that two alternative promoten drive transcription of the RAG 2 gene (44). Exon
1A has been shown to be the major start site and is located approximately 3.9kb
upstream of the coding exon. Exon 18 sits approximately 0.7kb upstream of
exon 2 and is the minor start site. The resulting RAG 2 protein is 56 kDa and is
RAG Genomic Organization
Figure 2: Genomic organization of RAG-1 and RAG-2 The RAG genes directly initiate V(D)J recombination of both TCR and lg receptor genes. Highly conserved across jawed vertebrate species, the RAG genes sit closely juxtaposed in a taii -to -tail transcriptional orientation. RAG -1 and RAG-2 are concordantly and precisely expressed in lymphocytes, but not in other cell types.
also encoded in one large open reading frame. Consistent with previous
studies, our lab has found the intergenic region between the two RAG genes to
be approximately 16kb (44).
Yoshikazu lchihara et al. (40) isolated the hurnan RAG 2 gene and
deterrnined its nucleotide sequence. Mapping analysis of RAG 1 and RAG 2
genes on human chromosomes by fluorescence in situ hybridization positioned
the genes on chromosome 1 1 p l 3-p 12 (40).
1.4 Functional Characterization of the RAG Locus
The RAG 1 and RAG 2 genes were fint isolated by Oettinger and Schatz
(21) in an early experiment in which they demonstrated that the introduction of
RAG 1 and RAG 2 activated V(D)J recombinase activity in nonlymphoid cells.
Worù by Oettinger and Yancopoulous further dernonstrated that the RAG genes
are adjacent genes which synergistically activate V(D)J recombination in both B
and T lymphocytes in a developmentally regulated fashion (1 5, 48. 49).
In further studies, Mombaerts (RAG 1) and Shinkai (RAG 2) using knock
out mouse models, demonstrated in vivo that mice deficient in either RAG 1 or
RAG 2 lack mature lymphocytes due to the inability ta initiate V(D)J
recombination. This provided the first in vivo evidence of the RAG gene protein
function (22. 23).
1.5 RAG expression
It has been shown that V(D)J recombination is a thousand fold more
efficient when both RAG 1 and RAG 2 are present and active, than with either
gene atone. Furtherrnore, V(D)J recombination in the complete absence of
either gene has not been demonstrated (16). Surprisingly, instances of
independent RAG expression have been shown. For example, low levels of
RAG 1 transcript have been detected in the fetal and post-natal murine central
nervous system with the transcnpt rnost strongly associated with post mitotic
neurons. However, RAG 2 transcripts were not detectable (50). In contrast, RAG
2 expression in the absence of RAG 1 has been documented to occur in the
chicken bursa of Fabricus. In this instance, RAG expression correlates with the
gene conversion process which bursal B cells undergo in attempts to diversify
both rearranged heavy and Iight lg chains (41). One might suspect that the
genes rnay function independently in other processes such as neural
development and differentiation or Ig-gene conversion (41, 50).
1.5.i B Cell Development :
Expressioii of both RAG 1 and RAG 2 is required for the assembly of the
lg receptor, and defines specific stages of B cell development. Therefore, it is
appropriate to outline the processes of 6 cell development.
The process by which hernatopoietic stem ceils differentiate into mature
B cells involves multiple stages of lineage commitment and differentiation. This
can be defined by the sequential rearrangement of the lg heavy and light chain
loci, as well as with the phenotypic expression of various cell surface molecules
resulting from the expression of lineage and stage specific genes. Expression of
these stage specific genes orders 6 cell development during embryogenesis
(51). Precursors are first detected in placenta and embryonic blood, then in fetal
liver, and finally in the spleen and bone marrow compartrnents (51, 52). B cell
lymphogenesis remains a continual process throughout the life span of an
organisrn. It is estirnated that 5 x 1 O7 6 cell progeniton are generated daily in
the adult mouse and human, with only 2-3 x I O 6 cornpetent to enter the
peripheral pool of mature, Ag-sensitive B cells circulating within the secondary
lymph organs (52).
Traditionally. B cell development has been divided into two phases: an
Ag-independent and Ag-dependent development, as depicted in figure 3. The
first phase occurs in the bone marrow independent of foreign Ag, and is
considered to teninate when slg is expressed after heavy and light chain gene
RAG -/- lkaros -1- E2A 4- pax-5 (BSAP)
RAG - RAG + RAG - RAG + RAG -
RAG - Watum n- 8 d
U n r y - A
R A G 1
Figure 3: Antigen independant and dependant devdoprnent: Vertical lines mark stage of development dimpted by absence or improper expression of critical transcription factors fkaros, E2A and PAX4 (BSAP). RAG nuIl bbck is also depicted for cornparism.
rearrangement has taken place in the immature ceIl. At this stage, cells
possessing receptors specific for self-antigens are either deleted (53) or
anergized (54). During the second phase, slg' B cells are positively selected for
their capacity to recognize foreign Ag while circulating in the periphery. Once a
naive slgM+ 6 lymphocyte reacts with Ag, 1 will enter and colonire a secondary
lymph organ. Colonization results in a specific immune response characterized
by clonal expansion and differentiation into antibody secreting plasma cells and
the formation of immunological memory by the selective expansion of
specialized memory 6 cells (55).
1.5.ii The 6 Cell Receptor:
Bumet's clonal selection theory predicted that cells express their
antibody as a surface receptor, which is selected by the appropriate antigen
(56). Molecular and protein biology have demonstrated that the B cell receptor
(BCR) is a complex of Ag-binding slg with the membrane- spanning, signal-
transducing heterodimer IgdlgB (57). Signal transduction by the BCR is
triggered by receptor cross-linking, and relies upon an immunoreceptor
tyrosine-based activation motif (ITAM) in the cytoplasmic portion of Igdlgp
which transmits signals through the BCR to appropriate intracellular signaling
components (57). Proper B cell responses require both engagement of the BCR
The 0 ail Receptor
Pre 8 ceIl Receptor -
Mature B ce11 Receptor
N-terminus N-t erminus
Figure 4: The pre-8 cell receptor and the mature B cell receptor: The matue immunoglobufin molecule is made up of two identical heavy chains and two identical light chains joined by disulfide bddges which links a light chain to a heavy chah and the two heavy chains together. Each of the heavy and light chains consist of a variable region (V) (depicted in red) and a constant region (C) (depicted in Mue). The variable region contains the amino acids primariiy responsible for antigen recognition and is subject to somatic hypemutation. The constant region is responsible for a variety of effector functions. A light chain can be of either r or A phenotype. The constant heavy chain defines the class of antibody. Constant heavy chain regions can be a or y. Each receptor is a complex containing Ag-binding dg with membrane spanning, signal - transducing associated Iga and 1gf3 heterodimer pmteins, wtiose cytoplasmic tails contain ITAM motifs (Y), which transmits signais fmm the K R to intracellular signalling components. The pre-6 celt receptor is an immature version of the final ex- product. The pre-6 receptor consists of a p heavy dain paired with the v-pre 6 and M conserveci chains. Once a (unknown) signal is received through this earty receptor, the pre-B cell commences light chah gene reamngements.
by Ag paired with an appropriate signal through other cell surface recepton
responsible for regulation.
Early in development, B lymphocytes have not yet generated a mature
BCR, but rather express a pre-BCR (57,58) during the pre-B stage of ontogeny.
The pre-BCR is similar to the BCR, but is cornposed of the lgp heavy chain
associated with the surrogate Iight chains A5 and V-preB (59, 60). The Vpre-8
genetic sequence is highly conserved in mammals (61) with little evolutionary
divergence. The pre-BCR is also made up of the Igdlgf3 signaling sub-units and
signals in a similar manner. Signaling through the pre-BCR is crucial for
continued 8 cell development. Together, the expression of the pre-BCR and the
BCR are considered to mark two checkpoints in 6-cell development (62).
I.5.iii RAG Expression and its Role in the Regulation of 6 and T
Lymphopoiesis:
A key characteristic of lymphocyte development is the somatic assembly
of germline variable (V), diversity (D) and joining (J) gene segments of the T cell
receptor and immunoglobulin gene loci in the generation of a unique receptor
structure on individual developing T and B cells (63). Development of the T and
B cell lineages takes place in separate specialized anatomic cornpartments and
involves genetically distinct pathways (49, 64). Overall, T and B lymphocyte
developmental programs however, share a large degree of similarity. For
instance, antigen receptor gene assembly is carried out in a strict. orderly
fashion in both B and T lineages. These genetic events delineate specific
phenotypic diffetentiation stages and are inliated by a common, lymphoid
specific V(D)J recombinase, which consists of RAG 1 and RAG 2 (15, 65, 66).
1.5.iv The Model of RAG Expression:
The classic model of RAG expression predicts two distinct waves of
concordant and tissue-specific RAG 1 and RAG 2 expression, which temporally
distinguish the two waves of lg and TCR gene rearrangements (5, 16, 67). The
first wave of RAG expression has been shown to coincide with D-J, followed by
V,-DJ, rearrangements in rearranging pro and pre-6 (C045'OCD19+HSA+) cells
in the generation of a BCR heavy chain (4). In T cells the first wave of
expression marks the initial appearance of fully rearranged TCR b, y and 6
genes of CD25+CD4'CD8CD3'T cells (3, 5).
Following these initial reanangements, RAG expression is believed to be
suppressed at the large pre-B cell stage. At this time, the cell is expressing the
membrane bound pre-6 receptor, which consists of rearranged chains in
association with surrogate light chains. Likewise, RAG expression is
downregulated in CD44CD25' double negative thymocytes following B, y or 6
heavy chain expression. It has been postulated that the downregulation of RAG
1 and RAG 2 expression after the completion of a productive rearrangement at
one heavy chah allele. may prevent fuaher heavy chah rearrangements from
occurring on the other available allele. The downregulation of RAG expression
is thought to enforce allelic-exclusion via feedback inhibition (4, 5), while
allowing for further differentiation of IgM+ or TCR P' cells prior to light chain gene
rearrangements.
In the subsequent small pre-B ceIl stage of development, RAG
expression is re-induced along with the disappearance of the pre-6 cell
receptor. This second wave of RAG expression corresponds to V,-J,
rearrangements and the generation of a productive Iight chain, which will pair
with the previously generated heavy chain to fom a complete and functional 6
cell antigen receptor. RAG is then downregulated once again, in the immature B
cell, with expression thought to be completely lost in mature 8 cells (4, 64, 66).
Further light chain rearrangement. is believed to be blocked, by the expression
of membrane slgM, which results from the assembly of heavy and light 1g chain
proteins. However, it has been shown that circular DNAs excised by nested
gene rearrangements frequently contain rearranged VJs that are in frame and
potentially functional, suggesting that light chah gene rearrangement often
continues in IgM' cells (68, 69).
A second wave of RAG expression is also known to occur in T cells
undergoing a Iight chain gene rearrangernents at the double positive stage of
development. At this point, it has been shown that engagement of the newly
formed TCR by self-Ag/MHC ligands tums off RAG expression (3,5).
To date, evidence of V(D)J recombination in the absence of elher RAG 1
or RAG 2 has yet to be demonstrated (15). In fact, studies camed out in
transgenic mice defcient in either RAG 1 or RAG 2 (23, 70) and in reciprocal
transgene complëmentation studies (71, 72) have confinned the requirement for
both genes and their timely expression, in the generation of mature B and T
lymphocytes expressing functional antigen receptors.
1.6 Receptor Editing of Ig Loci: The "third wave" of RAG Expression:
Each B lymphocyte possesses a unique Ag-receptor composed of a
single light chain (LC) paired with a single heavy chain (HC), as a result of
V(D)J rearrangements and the allelic exclusion of other chain alleles. Although
each B cell has the potential to produce two different heavy chains and six
different light chains ( 2 ~ and 4A), generally it does not, because of allelic
exclusion. Allelic exclusion confers a unique and highly specific degree of Ag -
specificity to individual B c e k and is critical for the process of clonal selection
(68). The traditional school of thought perceived that immature lymphocytes,
which have successfully undergone rearrangements and express a functional
Ag-receptor, go forth into the periphery to face three possible fates once
selected by antigen; they may become activated, inactivated (anerg ized or
tolerized) or eliminated (deleted).
In previous years. many had noted a slgM' pool of autoreactive B celle
present in the bone marrow that appeared to be developmentally blocked at the
IgM+/IgD- stage (73, 74). This led many to question how these cells were being
controlled by the immune system, if they are not being deleted. Early studies
can-ied out by Nemazee and Wiegert's groups were the first to address this
question and later dispute the proposed model of clonal selection and RAG
expression in lyrnphopoiesis. These papers will be discussed presently.
Tiegs et al., (68) challenged the paradigm of clonal selection
hypothesizing that a mechanism of "receptor selection' may be possible. They
questioned whether immature B cells could revise their Ag-receptor if
autoreactive, in response to self-Ag. To test this revised hypothesis of tolerance,
the y created mice with transgenic receptors (functional H and L-chains) specific
for self-Ag (anti-H-2-Kkb Ab 3-83). They introduced these 6 cells into non-
deleting (H-2') and centrally deleting (H-2Ku or H-2@) mice and assessed the
number of autoreactive Tg-B cells circulating and in the bone marrow of these
animals. From these studies. they established that slg' autoreactive B cells upon
encountefing self-Ag. may undergo secondary light chain gene
rearrangements. In order to escape deletion or inactivation, these cells may
express endogenously encoded light chain protein, thereby altenng their
specificity (68). In summary, this group observed that the non-deleting mice
were >95% monoclonal for the Tg-8 cells. In contrast, virtually al1 Tg-6 cells
were deleted from the spleen and lymph nodes of centrally deleting mice, but
were still present in the bone marrow. Along with these observations, elevated
levels of M G mRNA in bone manow B cells of centrally deleting mice with Tg-
IgM+ was also evident (similar levels to non-transgenic mice bone marrow 6
cells undergoing rearrangements), in contrast to low levels of RAG expression
in the non-delefing population. An increase in Iight chain rearrangement
excision products, was also observed in these mice by PCR assay, correlating
with an increase in Lchain recombination activity. These expenments sewed to
demonstrate that 6 cells expressing intact IgM' Ag-receptors can express RAG
and undergo further V(D)J recombination. It also appeared that lg receptor
generation could be influenced by 6 ceIl selection by Ag. While reinforcing the
paradigm of clonal selection, these data also introduced the concept of receptor
editing as a mechanisrn for correcting autoreactive receptors and revealed that
B cells are capable of experiencing a "third wave" of RAG expression, in order
to cany out further V-J rearrangements.
In similar expenments. Gay et al. (69) generated transgenic mice bearing
a well characterized anti-double-stranded DNA (ds-DNA) antibody receptor.
capable of binding both ss-DNA and ds-DNA. When analyzed, the B cell lg
receptors in adult mice consisted of the Tg heavy chain, not in association with
the Tg-light chain, but rather with endogenous light chain. Endogenous light
chains however. should have been allelically excluded by the transgene. Both
endogenous and Tg 4ght chain transcripts were detectable, indicating that B
cells which expressed the Tg-autoreactive receptor could further rearrange
endogenous light chain genes to create non-autoreactive receptors via the
process of receptor edling and escape deletion (69).
Further studies camed out by these same groups and othen confined
these conclusions (75-77) and demonstrated that Tg heavy chain genes could
also be eliminated by intrachromosomal recombination, followed by the
rearrangement and expression of endogenous VH genes. Furthemore,
ongoing endogenous K and rare Vh rearrangements could also occur (24.77)-
Although these studies present fim evidence for receptor alteration as
another mechanism of tolerance, especially significant for salvaging
autoreactive B cells. several questions anse which may undermine the concept
itself. For instance, the Tg-constnict used in these expenments may itself hinder
normal allelic exclusion. thereby pemitting ongoing light chain rearrangements.
Although Tg-gene transcription was demonstrated. the Tg-H chain and Tg-L
chain pairing may not be viable and also encourage further reanangements. K
deletion and even RAG induction, may result from Tg-gene interference. Gay et
al. (69) suggest that the absence of an enhancer in the Tg-construct may either
allow endogenous L-chain protein to out compete Tg-L-chain or that perhaps
only endogenous A chains are capable of pairing with Tg-H-chains. explaining
the observed increase in IC excision products and frequent Â. expressing cells
(69) -
In other work, Chen et al., demonstrated that transgene deletion is
another mechanism of receptor editing (77). These studies employed the use of
a Tg-Hthain which was found to be deleted and replaced by an innocuous
endogenous Hthain under the "classical' V(D)J process. Moreover, Chen et al.
(78) in further studies, detailed the site and stage of anti-DNA 6 cell deletion.
This mode1 showed that normal mice expressing the anti-DNA Ab (same as
used in studies carried out by Gay et a1.J 993). deleted their autoreactive 6 cells
in the bone marrow during the pre-8 to immature 8 transitional stage
(B220+/CD43+, just after 19-receptor expression). The introduction of a
rearranged H-chain allowed cell development to proceed to the mature
B220+/C D43' stage, further supporting their findings (78).
Recent work by Nemazee's group, has shown receptor editing to play an
important role in normal 8 cell development and, that BCR Iigation can induce
receptor editing in non-dividing, lgM+/lgD'/B220M bone marrow cells, rather
than celi death (79. 80). BCR cross-linking of 19-Tg bone marrow cultures (with
anti-3-83 mAb) consistently exhibited a 3-3.5-fold increase in RAG 2 mRNA
levers, peaking at 24 hrs, which was not seen with control mAb. The authors
concluded that slg' B cells at this stage were either upregulating RAG
expression, or maintaining RAG 2 expression and initiating secondary L-chain
rearrangements in response to BCR-ligation. These results also indicated that
Tg-K L-chains were replaced by endogenous h Lchains (from 20%-65%).
Interestingly, the authon report that peripheral slg' B cells were unable to
undergo receptor editing when their BCRs were cross-linked with mAb, which
will be discussed in more detail. in the following sections (8 1).
1.6.i A Model tor Receptor Editing:
Based up6n their results, Tiegs et ai., (68) proposed the following model,
as outlined in figure 5. Pre-B cells undergoing K L-chain rearrangements in the
bone marrow teminate further recombination once a functional IgM appears on
the cell surface. However, if this slg can be cross-linked by self-Ag, then RAG
expression is either maintained or upregulated, and accessible L-chain, but not
H-chain reanangements can occur at the K locus. Rearrangements occur until a
non-autoreactive receptor is generated. Cells with activated RS recombination
(deleting C,), will commence h loci reanangements and expression.
Similady, in another model for receptor editing, Herh and Nernazee (80)
suggest that BCR Iigation in the bone marrow could promote receptor editing by
two separate pathways. Pathway #1 includes the existence of pre-B cells which
CO-express slgM and RAG which have been documented (6. 68). BCR ligation
may block these cells at the RAG+ stage, thereby preventing the temination of
V(D)J recombination and allowing secondary rearrangements to occur. The
second pathway involves a selection event whereby, Ag or autoreactivity could
cause the slg4/RAG- cell to upregulate RAG expression and reinitiate L-chain
reanangements (80). Our laboratory has previously demonstrated that slg cross-
linking can upregulate RAG expression in a human mature B cell lyrnphoma,
providing evidence for the latter model (82).
NOK
Figure 5: Model for Receptor Editing: A pre-B cell generates a hinctional lg receptor and expresses IgM on its cell surface. In the absence of stmng Ag crwilinking, the ce!! will mature and migrate to the penphery. However, if strong crosslinking occurs, further light chain reaangement is induced. If the eamngement is successful and alter4 antigenk specificity is conferred and the ai will pmcccd to rnaturity. If specificity is not aitered by the rearrangement, the cell will be eliminated via awptosis.
Essentially, Hertz and Nemazee argue that receptor editing, rather than
cell death, may be the mechanism dictating tolerance in bone marrow B celis. In
a 1996 report, Nemazee, through theoretical rnodeling, predicted the number of
B cells undergoing receptor editing as a means of tolerance to be significant
(79). In a more recent report, the authon strongly assert that "receptor selection'
(based upon receptor editing). rather than 'clonal selection' K the major
mechanism of B celt immune tolerance (80).
1.6.ii Receptor Editing vs. Deletion:
Many studies have implicated apoptosis as an important tolerance
mechanism. By inducing the deletion of autoreactive or cells detnmental to the
organism, apoptosis aids in regulating the immune system. In opposition. Bcl-2
promotes ce11 survival. Previous studies have shown that Bcl-2 deficient mice
manifest a severe loss of mature lymphocytes (83).
In further experiments, again taking advantage of the mono-clonal anti 3-
83 centrally deleting mice, Lang et al., (84) set out to examine whether the over-
expression of Bcl-2 would confer a protective effect over immature, autoreactive
bone marrow-derived lymphocytes. In generating the 3-83pWBcl-2 Tg rnouse
which over-expresses Bcl-2, this group demonstrated that deletion by apoptosis
is significant in peripheral 6 cell tolerance. Through demonstrating an increase
in receptor editing in immature B lymphocytes and a complete block of clona1
elimination in penpheral compartments, they concluded that enforced Bcl-2
expression promotes receptor editing in immature B cells. This extended the
lifespan of these cells. thereby allowing h rearrangements to occur, which
otherwise would not. These observations suggest that apoptosis depends on
the Ag-stimulus and the B cell stage of development (84).
1.6.iii The RS Sequence in Receptor Editing:
In their most recent work, Retter and Nemazee (85), atternpt to determine
the extent of receptor editing in a normal, non-1g transgenic immune system.
For this undertaking, they analyzed the K loci in IgMh' 6 cells to determine how
frequently in-frame K genes fail to suppress ic gene rearrangements. By
isolating VKJK joins from lgA+ cells, they analyzed recombined VKJK genes
inactivated by subsequent recombining sequence (RS) rearrangements for
functional, in-frame rearrangements. The RS is of interest because of its ability
to delete a portion of the K locus by a V(D)J recombinase (RAG)-dependent
rnechanism, which implicates this specific and cryptic sequence in receptor
editing. The authon' finding that -47% of V J K joins were in-frame, led hem to
strongly suggest that receptor editing occurs at a high frequency in normal 6
cells. They also conclude that the RS (referred to as the K deleting elernent in
humans) plays an important physiological role in normal 6 cell development to
inactivate, or silence rearrangod u genes, as yet another mechanism of
tolerance (85). -
1.7 Re-expression of RAG 1 and RAG 2 in Peripheral Lymphoid
1 issues:
Recently, there has appeared a plethora of data demonstrating RAG
expression in mature murine and human B cells, which will be discussed in
detail in the section to follow. However, secondary lymph sites where this
"fourth" wave of expression occurs will first be outlined.
1.7.i Peripheral Lymphoid Organs and the Germinal Centre
Reaction:
Germinal centres form in the 6 cell follicles of secondary lymphoid tissue
during T cell-dependent immune responses. and are crucial for the
development of memory B cells (86, 87). OC formation occurs approxirnately 4-5
days post-imrnunization in a primary response and tends to wane after about
three weeks (55, 88, 89). At the macroscopic level, the secondary lymphoid
organ (spleen, tonsil, lymph node or peyer's patch) can be divided into red and
white pulps, separating the erythroid and lymphoid compartments of these
organs. In the spleen, the white pulp can be further divided into three sub-
compartments; the marginal zone, the periarteriolar lymphoid sheath (PALS)
and the follicles.Following immunization, circulating T and B celk are recruited
to secondary lymph tissues. The lymphocytes enter via the marginal zone and
continue on to the PALS where specialized interdigitating dendritic cells
present the foreign antigen to the lymphocytes. With T cell help, activated
antigen-specific B cells undergo a proliferative burst, leave the T cell rich PALS,
and either differentiate into antibody-forming cells or migrate, along with
selected CD4' T cells. to the follicle area. In the absence of antigenic
stimulation. both B and T cells re-enter the circulation through the marginal
sinus (55, 90).
The follicle is the B cell area of the white pulp where follicular dendritic
cells (FDCs) capture and present antigen and specifically act as antigen depots
which aid in sustaining the immune reaction (88. 89, 91). Newly arriving B
lymphocytes rapidly proliferate, serving to fom a follicle, while undergoing
radical phenotypic changes. For instance, murine GC B cells have been shown
to express the activation marker GI-7 (a GC marker), the pre-B A5 and bind
peanut agglutinin (PNA) (92, 93). Both mouse and human GC B cells have
been shown to re-express RAG 1 and RAG 2 (92-96). This step of the reaction
compresses surrounding follicular cells, forming the follicular mantle zone,
which encompasses the nascent GC and is comprised of naïve B cells.
Subsequently, the GC polarizes to form a dark zone (DZ) which contains rapidly
Germinal Cenm Reaction and a Rob for RAG
RAG - KL-2 10 zone lgD+
RAG - BCL-2 hi CD38+ 100- CO1 9+
Figure 6: The germinal centre reaction: The thme anatomical divisions; the follicular mantle, the dark zone, the Iight zone and the path of cell migration are depicted. Following immunization, circulating T and B lymphocytes are recruited to secondary lymph tissue where they encounter antigen expresseci on professional antigen-presenting œlls. Appropriate B lymphocytes become activated in response to the antigen and undergo a proliferative burst, followed by a round of somatic hypermutation. Re-expressing a mutated lg receptor, the œlls progress to the light zone checkpoint where their affinity for the imrnunizing antigen is sampled. Cells with adeqwte aff inity for Ag s u ~ ' v e and differentiate into effector or memory cells with further T cell help. Those with decreased affinity or incompetent receptors die in the light zone via apoptosis. Recent reports and data presented in this thesis predict yet another possibility, that B œlls acquiring mutations which reduce aff inity, or generate incornpetent receptors, may prompt further light chain gene rearrangements with the re-expression of RAG, in a physiologically frugal attempt to spare the ceIl.
dividing slg negative cells called centroblasts and a light zone (LZ) that consists
of nondividing slg+ centrocytes, as well as, FDCs and the majority of T helper
cells (55, 88). -
The basic function of the GC is to improve B lymphocyte affinity for the
immunizing antigen and generate a clonal population of effector cells and
mernory cells, with the capacity to guard the organism from ham. This result is
achieved through the positive selection of 6 lymphocyte variants, which have
through the process of somatic hypemutation, gained improved affinity for the
Ag and negative sefection of those cells with unchanged or lost affinity. The
nascent GC is oligoclonal, while the mature GC is derived from just 1-3 B cell
clones. As the GC reaction progresses, clonal divenity is reduced and the
frequency of point mutations increased in an act of active clonal evolution in situ
(55, 90, 97).
1.7.ii Somatic Hypermutation:
Somatic hypemutation is a 6 cell specific mechanism responsible for
introducing point mutations into rearranged Ig variable region genes. Somatic
hypemutation of lg variable region genes is carried out in the dark zone
centroblast population, which is thought to divicle every 6-7 hr (88).
In an elegant study, Pascual et al., 1994, using several different
monoclonal antibodies, described the phenotypic characterization of fwe B cell
subsets (Bml -Bm5) in human tonsil, representing different stages of B cell
maturation and differentiation. Cells were initially sorted using two colour FACS
for IgD and CD38 populations. IgD' cells (which are also lgM+) were further
sorted into CD23' and CD23- subfractions (Bml and Bm2 respectively).
CD38+lIgD- cells were further sorted and separated into GC centroblast and
centrocyte subfractions using CD77 mAb. The CD38+/lgD-/CDï7* subfraction
(Bm3) represents the cycling da& zone centroblasts undergoing somatic
hypermutation. CD38+/lgD~ICD77 (Bm4) cells comprise the light zone
centrocyte population, which has stopped cycling and will re-encounter Ab-Ag
complexes on FDC. Finally, the remaining lgD'lCD38- subfraction (Bm5)
represents the memory population. Hence, this group detailed B cell migration
from the naive IgD' state, through the CD38' GC stage to the memory IgD-
/CD38- B cell.
Furthenore, analysis by this group of lg heavy chain variable region
gene transcripts from these subfractions clearly demonstrated that somatic
mutation correlates with the phenotypic characteristics of the GC centroblast
population (slgD', CD38+, CD77'). Moreover, this study showed that the
pathway of B cell differentiation from virgin B cell through the GC and to the
mernory cornpartment can be traced with phenotypic markers (88).
Using this same subfraction scheme, recent studies carried out in human
GC 6 cells has shown that RAG is expressed at levels comparable to bone
marrow B cells, in the Bm4 lgDœ/CD38+/CD77- centrocytes, but not in any of the
other subfractions (95). Figure 6 outlines RAG expression in the human GC.
Work by Zheng et al., 1998, using mice with a transgenic K-light chain in -
a RAG 1" genetic background demonstrates indirectly that somatic mutation
occurs in the DZ centroblast compaiùnent and that lg gene hypermutation in the
GC is independent of the RAG 1 V(D)J recombinase, as these mice acquired a
number of mutations in the absence of RAG 1 protein product. These
observations also suggest that further rearrangements obseived in GC were the
product of V(D)J recombination and not hyperrnutation (87).
Following a round of mutation, centroblasts exit the DZ and migrate to the
L i , where they subsequently re-express slg. At this checkpoint. cells are tested
for their ability to bind antigen presented on FOCS. Cells with adequate affinity
for Ag survive and differentiate into effector cells or memory cells, with further T
cell help, while those which have lost affinity undergo apoptosis (55, 90, 98). A
third option proposed by two groups; Papavasiliou and colleges and Han et al.,
1997 predicts that B cells acquiring a mutation which reduces Ag affin*, or
renders the Ag wreceptor incompetent, re-express RAG in an atternpt to Save
themselves (86, 99). Eventually, the GC reaction terminates, however the
signals controlling this have yet to be elucidated.
1.8 RAG Expression in mature 6 cells, the " Fourth" Wave:
Expressioh of a functional mature lg or T cell receptor was initially
thought to preclude further V(D)J rearrangements by teminating RAG
expression. However, Our lab and other groups have identified and
characterized mature B cell lines which CO-express RAG and slg receptors (6, 7,
100).
By Noithem analysis, Ma et al., (6) identified and characterized six
separate slg' 8 cell tumour lines established from Ep-N-myc transgenic mice
which expressed significant levels of RAG 1 and RAG 2. RAG mRNA expression
was found to be substantially reduced (>IO fold) when the cells were treated
with an anti-p antibody, demonstrating that cross-linking of slg molecules on
these mature B cells resulted in a specific, yet revenible down-regulation of
RAG expression levels. Vsing a recombination construct to assay for V(D)J
recombinase activity, the authors were able to correlate this unexpected RAG
expression with continued V(D)J recombinase activity. This group also showed
via in situ hybridization analyses, that 3.5-5% of slgM' B cells sorted from bone
marrow expressed RAG 1 in the absence of tumor formation or rnyc transgenes.
Based on these findings, the authors concluded that this seemingly novel RAG
expression might reflect a normal, previously uncharacterized stage of 6 cell
development.
Conversely, work previously camed out in our lab has provided evidence
that some mature slg' human 6 cell lines can actually be induced to upregulate
RAG expression by either slg cross-linking or PMA and ionomycin stimulation
(7) (8). To elucidate whether a signal transduced through the lymphocyte Ag
receptor regulated RAG gene expression Verkoczy et al., 1995, used a unique
set of cell variants isolated from a patient with a B lymphoid large cell lymphoma
(100). These variants differed in their expression of slg, RAG 1 and RAG 2
genes. Cross-linking analyses of these variants resulted in a reversible
increase in RAG expression, accompanied by an increase in transcription and
transcnpt stabilization (8).
Furthermore, studies carried out by Hertz and Nernazee have also
demonstrated that BCR ligation stimulated RAG 2 expression leading to further
lg rearrangements in IgM+/lgD- bone marrow B cells in vitro, measured by light
chain gene rearrangernents (K to h editing) in both transgenic and non-
transgenic B cells (80). A 3-3.5 fold increase in RAG 2 mRNA levels was
consistently seen, accompanied by the expression of A-light chain protein in
cells w h ich had previously expressed K protein, providing further evidence that
B cell Ag-receptor ligation can stimulate furthei RAG induced rearrangements.
More recent evidence of RAG expression in mature 6 cells cornes from
both in vitro and in vivo studies in murine models. For instance, Hikida et al.,
(1996) described a fourth wave of RAG 1 and RAG 2 expression induced in
activated mature 6 cells both in primary culture and in the peripheral lymphoid
tissues of immunized animals (93). Using RT-PCR and Southem Blot analysis,
they demonstrated expression of RAG in splenic 6 cells from C3WHeN mice
cultured for two days with lipopolysaccharide (LPS) and interleukin 4 (11-4).
RAG transcripts were not detectable in the cells prior to culture with LPS and IL-
4, or in cells stimulated with either LPS or I L 4 alone. RAG transcripts were also
undetectable in cells CO-cultured with LPS and 11-2, 11-3 or 11-5. Panned IgD+
cells were also CO-cultured with LPS and IL-4 to confirm that IgD+ cells
specificaliy expressed RAG in response to LPS and IL4. Moreover, a CD40
monoclonal antibody , or anti-p heavy chain were as effective as LPS in eliciting
RAG expression in these mature B cells (93).
Draining lymph nodes of immunized mice were also examined for RAG
expression in these studies. RAG transcripts were detected by RT-PCR and
confirmed by Immunofluorescence microscopy in the germinal centres of both
inguinal and popliteal lymph nodes of immunized animals, eight days post-
immunization. RAG positive cells however, were not detectable in unimmunized
controls (93).
Taking yet another approach, Han et al., (92) used affinity-purified
antibodies specific for active RAG 1 and RAG 2 proteins to label histologic
sections of spleen and Peyets patches from immunized and normal mice. They
found that PNA+/GL-Tc B cells present in mature germinal centres in spleen 16
days after immunization. or in Peyets patches of unimmunized mice expressed
substantial arnounts of immunoreactive RAG 1 and RAG 2 protein. This
expression coincided with 87-2 expression, suggesting that the RAG proteins
are expressed in the germinal centre centrocyte sub-population. These findings
were fuNier confimed by RT-PCR assay for RAG mRNA in B220+/GL-7+ B cells
purified by FACS (92).
In further experiments, Hikida et al., (101) confirmed that RAG transcripts
and their were expressed in parallel with the formation of geninal
centres in popliteal lymph nodes of immunized mice and that the majority of
8220' RAG expressing cells, were present within apoptotic tingible bodies of
germinal centres. They demonstrated however, that RAG expression at this
irnrnunoiogical site is not a nonspecific result of apoptosis. since RAG
transcripts were not evident in apoptotic B cells generated by surface Ig-cross-
linking (with either anti-p or anti-â immobilized Ab). The authors suggested that
RAG expression therefore, represents a controlled process that may be involved
in the revision of unfavorable slg receptors that are generated in the germinal
centre, as a result of somatic hypermutation and isotype class switching (101).
To determine whether the RAG products induced in mature B cells were
functional, Papavasiliou et al., (99) and Han et al., (86) assayed for de novo,
RAG- specific DNA double-stranded breaks by LM-PCR assay. In a transgenic
rnouse modal containing targeted p and r replacement alleles (pu+ U'+ mice)
which allelically exclude the endogenous heavy and light chain alleles (leaving
them unrecombined and available for cleavage by induced RAG), Papavasiliou
et al., (99) observed both J, and J, signal breaks in pu+ Y' B cells cultured in
LPS and IL4. Signal breaks were not detected in unstimulated cells. Signal
breaks in wild-type 6 cells treated with LPS and 11-4 compared to only 10-20%
of those found in pu+ #+ mice, due to reduced availability of RSSs, as predicted
by the authors (86,99).
To verify these in vitro results, density centrifugation enriched GL-ï+ -
germinal centre B cells from immunized if+ K"+ mice were tested for RAG
activiiy. RSS breaks were not present in resting B cell fractions however, de
novo JK breaks were found one week post-immunization in activated fractions,
corresponding to reported temporal GC RAG expression (99).
Employing similar techniques Han et a/., (86) sorted GC B cells from the
spleens of immunized C57BU6 mice into 8220" and 8220" subfractions and
used RT-?CR to determine the presence of RAG 1, RAG 2 and A 5 mRNA in
each of these populations. RAG and M gene transcripts correlated with the
8220" GC cell phenotype. To determine RAG activity, I ~ K locus de novo dsDNA
RSS breaks were assayed by a LM-PCR assay. Observed JK breaks were
predominantly contained in the B220M GC cell phenotype (86).
In support of their earlier findings which strongly suggested that GC B
cells undergo receptor editing in parallel with RAG gene expression, Hikida et
al., (1 02) reported de novo h-light chah gene rearrangements both in vitro and
in immunized wild-type mice. Enhanced A-light chain expression was detected
in mature B220+ spleen B cells stimulated with LPS and 11-4. Prior to culturing,
cl % of the fraction was A+, but increased to 24.5% after stimulation. Purified K
cells were similarly stimulated with LPS and 11-4. Interestingly, 34% of this
purified cell population became positive for tlight chains. To confimi that
expressed klight chains were indeed produced by newly rearranged I genes,
a PCR assay was used to detect circular DNA excision products derived as a -
result of VA-Jh rearrangements. As predicted, LPS/IL-4 stimulated 6 cells and
lymph nodes of immunized mice, which expressed RAG, exhibited higher levels
of DNA excision product reflecting MG-dependent de novo rearrangements
(102).
To rule out the possibility of preferential clonal expansion, [3H] TdR
uptake experiments were carried out, revealing comparable results in both h+
and K+ B cells. lndicating that the LPSAL-4 increase in A+ B cells, could not be
due to the preferential expansion of a small number of these cells in the original
B cell preparation during the culture.
ln their most recent studies using IL-4 deficient mice, Hikida et al., (103)
reported that an I L 4 deficiency did not impair RAG expression in draining
lymph nodes of immunized mice. Furthemore, they demonstrated using a panel
of cytokines including 11-2, IL-3, IL-5, IL-6, 11-1 0, 11-13 and INFnl, that only 11-7,
a critical growth factor, thought only to be required by immature lymphocytes in
the bone marrow, can induce RAG expression and subsequent V(D)J
recombination in mouse splenic B cells in vitro, ppaired with a monoclonal CD40
antibody and in GC B cells of immunized mice. This report also showed induced
IL-7 receptor expression in peripheral B cells activated both in vitro and in vivo.
Suggesting that 11-7 and the I L 7 receptor may participate in the diversification
and selection of B cells in GC. These sfudies also hint that the GC and BM
microenvironment may provide similar environrnents for B cell differentiation.
except that FDCs rnay provide the 11-7 required in the GC venus stroma! cells -
in the BM (103).
Furthemore, 11-7 RAG induction produced functional RAG products
assessed by the observation of Vhl-Ji, reanangements by PCR assay, in a
>99% pure lgD+ B cells stirnulated in vitro. LPS alone controls, which allow for
cell cycle progression, but do not permit RAG re-expression, did not produce
any V(D)J excision products under the same conditions. Moreover, mice
immunized with anti-IL-7R mAb, to block IL-7 signaling, showed dramatic
suppression of RAG 2 expression and Vh,-Jh, rearrangements versus control
animals. These results therefore, reveal a critical role for IL-7 and the IL-7R in
receptor editing in GC 8 cells (103).
In a study demonstrating that BCR signaling regulates V(D)J
recombination, Hertz et aL, (R I ) induced V(D)J recombination in 3-83 p8 Tg
splenic 6 cells treated with LPS and IL-4, then assayed the effect of BCR
ligation on this induction. In vivo, mice were imrnunized with Ag. Under both in
vitro and in vivo conditions, ligands with varying avidities for for the Tg-BCR
were generated in Ml3 phage. The three ligands included a non-binding, a low
avidtty and a high avidity anti 3-83 ligand. klight chain rearrangements were
assayed for, which should be suppressed in these Tg mice. In vitro findings
showed that only the high avidity ligand suppressed the generation of 7L' B cells
in culture. However, in vivo resuits showed that GC formation occuned only in
response to the low avidity ligand (-100x versus high avidity) paired with an
increase in
The
X+ B cells, which represented new rearrangements (81). -
authors claim that their data support three important conclusions
about V(D)J recombination in peripheral B cells. First, these results confimi RAG
re-expression and the ability for peripheral cells to undergo further
rearrangements, and that BCR ligation can tum off RAG expression. This
implies that cells undergoing V(D)J recombination have the potential to express
slg and therefore, do not represent a pre-B cell contaminating population.
Finally, the finding that BCR ligation can terminate RAG activity suggests that it
is not a mechanism of tolerance at this site, as in the BM, but rather a
mechanism of immunity (8 1).
The authors concluded the V(D)J recombination is invoked to rescue
cells with improved receptor afFinity by modifying the receptors of B cells with
weak reactivity to Ag. In this way, BCR signaling inhibits receptor revision and
stimulates expansion of high affinity clones, while allowing lower affinity cells to
improve their affinity (8 1).
1.8.i Re-expression of RAG 1 and RAG 2 and Evidence for
Secondary Rearrangements in human OC B CeIIs: -
The data reviewed above demonstrate that re-expression of RAG 1 and
RAG 2 is possible in murine GC. Moreover, the products of this fourth wave of
RAG gene expression are functional and mediate secondary L-chain
rearrangements as previously discussed (86, 92, 93, 99, 101-103). In an attempt
to decipher whether human GC B cells also experience RAG re-expression and
subsequent additional rearrangements, we and others have assayed for the
presence of RAG mRNA transcripts and their functionality, in the hope of
detemining what physiological role RAG re-expression and these
rearrangernents may play.
Giachino et al., (94) were the first to publish human results from three
tonsil specimens. They sorted GC B celfs, mature 6 cells, as well as non-B cells
and assessed RAG expression by RT-PCR. RAG was found in al1 three samples
and was confirmed by sequencing analysis. Using a monoclonal anti-CD77,
they found that the centrocytes of the GC population expressed RAG. Further
analysis showed that these cells did not express surface lg. Although their
studies are problematic, in that only one tonsil was assessed for slg- RAG
expression and results were not reproducible, the authors provide the argument
for RAG expression in the slg- population. They daim that this subfraction of
centrocytes re-expresses RAG in an attempt to generate a new receptor due to
the accumulation of a negative mutation during hypermutation. These findings
demonstrate that, as in mouse, a specific and defined population of human GC
B cells reactivate the recombination machinery during a certain stage of the
affinrty maturation process. The phenotype of this subfraction is CD38+/CD77,
dg', RAG+ (94).
In similar studies, Meffre et aL, (95) using a LM-PCR assay to detect
signal breaks in human GC 8 cells (also from tonsil sarnples) at the Igx L-chain
locus, found breaks in GC lgD7CD38' tonsil centrocytes. lgD+/CD38- cells were
also assessed, but were negative. Subsequent semiquantitative PCR was
canied out and levels of RAG 1, RAG 2, T f l , V-pre-B. and h-like mRNAs in
these cells were comparable to levels expressed in unfractionated adutt BM
samples. From these observations, the authors postulate that receptor revision
by secondary V(D)J recombination is restricted to B cells which have already
undergone somatic hypemutation and have exited the centroblast stage (95).
Furthemore, in contrast to previous results in munne studies, addition of
11-2, IL-4, or IL-10 to cultures did not induce RAG expression in human GC B
cells cultured in CD40L (95). Perhaps providing confirmation, that 11-7 is a key
cytokine required for the induction of RAG expression in the GC, as has been
suggested by Hikida et ai., in their murine studies (103). Additionally, in contrast
to previous IgM+/lgD- BM B ceIl studies (80), self-Ag (anti-K and anti- A) inhibited
RAG expression in lgD-/CD38+ GC B cells (95).
Moreover, this group characterized the suppressive effect of anti-BCR
Abs on RAG expression, by performing dose-response experirnents with intact
anti-K and anti-b Abs and Fab'2 fragments. They observed 6-8 fold RAG
downregulation when both Abs were used; however, no significant effect was
obsewed when either Ab was used alone. The authors propose that BCR cross- -
linking is a mechanism of positive selection for B cells that produce high affinity
receptors, as both RAG and TdT expression are terrninated upon cross-linking.
The authors suggest that the mature B cell response to Ag-receptor
engagement is opposite to the response of developing, BM 6 cells to the same
stimulus. They further suggest that receptor revision is a mechanism for receptor
diversification, in the periphery, which is shut down when the Ag-receptor is
cross-linked by the cognate Ag. Therefore, recornbination is regulated by Ag-
receptor (BCR) cross-linking, at the different stages of 6 cell development (95).
In consideration of the data reviewed above and previous findings in our
lab, we designed a carefully optimized PCR assay, in an attempt to elucidate
RAG re-expression in mature human B cells in vivo. Recently, we have reported
that RAG 1 transcripts, as well as transcripts corresponding to two RAG 2 splice
variants, were detectable in human tonsilar B lymphocytes (96). Functionality of
the RAG gene products was demonstrated by the presence of ds-DNA signal
end breaks, obsewed in these cells using LM-PCR analysis (96).
1.9 The Mechanisms of RAG Regulation:
The precke mechanisms regulating RAG expression remain unclear.
However, different studies to date suggest RAG regulation may occur on three
levels; transcriptional, translational, and the post-translational level. Evidence
pertaining to each of these will be addressed individually.
1.9.i Transcriptional Regulation
Both our laboratory and Kurioka et al., have recently characterized the
RAG 1 core promoter (44, 104). Zamn et ai., (44) using S'-RACE, RNase
protection and primer extension studies defined the transcription initiation sites
and promoter regions for both RAG 1 and RAG 2. The human RAG 1 and RAG 2
intron/exon 2 boundary is located 14 and 27 nucleotides upstream of the ATG
translational start site respectively (44). The major transcriptional initiation site
of human RAG 1, is located 110 bp upstream of the splice junction and contains
a 5' untranslated region of 124 bp. RAG 2 contains a major transcriptional
initiation site 135 bp upstrearn of the splice junction site, which corresponds to
exon 1A and was confirmed by both 5' RACE and RNase protection assay, in
both B and T lymphocytes. Exon 1B seems to be the minor transcription
initiation site and was more difficult to deted (44). Zamn et al., also reported
that 1 B appean to be used infrequently. This was particuiarîy evident in pre-B
and mature 6 cell studies. The significance of the two independent transcription
initiation sites remains as yet unclear (44).
The 5' region of RAG 1 does not posses a typical TATA box consensus
sequence. However. an rich sequence is present and contains a GATA cis-
element and has been characterized as a weak TATA box sequence (44). 8
lymphocyte-restricted transcription factor binding sites were also confinned for
Ikaros, E2A and Myc (44)- Although the NF-Y transcription factor has been
shown to interact with the rnouse RAG 1 CCAAT element (105), it remains
unclear exactly which transcriptions factors drive RAG 1 transcription. The
immediate 5' ffanking regions of both exon 1 A and 1 B of the human RAG 2 core
promoter were found to be TATA-les. Multiple E2A and lkaros binding
consensus sequences were also characterized, as well as two repressor
element consensus and transcription factor binding sites for other
rnultifunctional transcription regulaton. Interestingly, several other lymphocyte
specific genes such as V-pre B, Lck, TdT, A 5 and CD19 also lack the canonical
TATA box (44). Furthemore, the human RAG 2 core promoter region does not
contain a CCAAT box, which is present and essential for the basal transcription
of RAG 1. Hence, one may speculate that transcriptional regulation of RAG 1
differs from that of RAG 2 (44).
Interestingly, RAG promoter activity was dernonstrated in nonlymphoid
cell lines, in which the RAG genes are not expressed (44). These obseivations
suggest that tissue- specific expression of the RAG 1 and RAG 2 requires other
mechanisms such as enhancer or repressor cis-elements that act in tandem
with the core promoters. However, tissue -specific regulatory elements still
remain to be characterized and the molecular basis for the transcriptional
regulation of RAG genes has yet to be elucidated.
1.9.ii Post-Transcriptional Regulation:
Presently, little is known about the mechanisms goveming the molecular
regulation of RAG 1 and RAG 2 at the post-transcriptional level. The RAG 1
transcript has a half-life of approximately 30 minutes in the C3A11 N mature B
cell line (studied in our laboratory) and the Ep-myc transforrned cell lines (6, 8).
Ma et al., (6) have previously shown that PMMonomycin treatment or cross-
linking slg receptors, decreases the RNA half-life of RAG l in their cell lines.
Conversely, our lab has demonstrated the opposite effect, with an increase in
RNA half-life accompanied by a 5-foid increase in inducible RAG 1 expression
(82). To date, there is no data on the effects of these treatments on RAG 2.
Sequencing of RAG 1 has revealed that the transcript does in fact contain
a conserved, AU element rich (13 copies), 3.4kb untranslated region. These
elements are known to code for RNA instability and lead to rapid RNA turnover
(1 06) as expected, in keeping with the short half-life of RAG 1 mRNA.
9 Post -Translational Regulation:
Studies afthe protein level have shown that there is rapid turnover of the
RAG 1 protein in both normal thymocytes and transfected fibroblasts, in which
the protein half-life is a mere fifteen minutes, indicating significant protein
instability (107). Post-translational phosphorylation of the RAG 2 protein at
threonine-490 is thought to be one of the key regulatory mechanisms which
aliows for the accumulation of RAG 2 at the GO to G1 stage cycle at which tirne
V(D)J recombination takes place, followed by at least a 20-fold dedine in
protein levels pnor to the cells entering S and G2/M phases of the cell cycle
(108, 109).
1 . I O The LM-PCR Assay:
LM-PCR is a sensitive PCR-based linker-ligation assay for locus-specific
broken-ended DNA. This technique has been instrumental in demonstrating
RAG functionality in both murine, as well as, human germinal centres. The
technique devised by Schlissel et al., (19) is based on the ligation-rnediated
PCR approach first developed by Mueller and Woid in 1989 (1 10). The
technique, which was originally used for genomic footpnnting studies, involved
mapping via primer extension, single stranded DNA generated by chemical
agents or nucleases. A linker was then ligated to the genomic DNA and
subsequent rounds of PCR camed out to amplify the DNA of interest. Schlissel
et al., designed their modified assay to map the precise ds-DNA broken-ended
RSSs that are Gsociated with each reananging immunoglobulin locus in cells
undergoing V(D)J recombination (19). Essentially, any sample of purified
genomic DNA can be assayed for breaks at any genetic locus for which primers
are available. Moreover, this modif ied assay requires less DNA starting
template than other detection methods (Southem blotting) and led Schlissel
and his colleges to determine that detectable broken-ended RSSs are RAG 1
and RAG 2 dependent, blunt, 5'-phosphorylated and cell cycle dependent (19).
This assay provides advantages over previously limited PCR
approac hes, in that previous assays detected rearranged products of V(D) J
recombination, reflecting only indirect rearrangements resulting from V(D)J
recombinase targeting. Schlissel and colleges argue that the presence of locus-
specific, broken-ended RSS DNA indicates de novo V(D)J recombinase activity
at that particular locus (1 9).
1 .10 .i Application of LM-PCR to demonstrate RAG functionality in
the germinal centre:
A partially double stranded oligonucleotide linker is ligated to purified
genomic DNA with T4 DNA ligase. The linker is blunt, non-phosphorylated and
asymmetncal in structure allowing 1 to ligate in only one orientation to blunt, 5'
phosphorylated genomic DNA. Broken DNA ends in association with a
particular locus are then detected by a pair of nested PCR assays employing a
5' sense-locus specific primer and an antisense linker specific primer. Expected
hybridizing fragments corresponding in size to locus specific ds-DNA breaks
are then determined and if present, indicate loci undergoing RAG-dependent.
de novo rearrangements (19). Therefore, if RAG is present and functional in B
cells of the germinal centre, then this assay will detect the broken ends
generated by RAG coupled cleavage.
CHAPTER 2: MATERIALS and METHODS
Materials and Methods: -
2.1 Cell Lines and culture conditions:
The human diffuse large ceIl6 lymphoma cell line OCI-LYSAI 1 N RAG"
variant was used to optimize FIT-PCR assays under in vitro conditions (26).
K562, a nonlymphoid cell line was used in Our studies as a negative control.
This line was obtained from the American Type Culture Collection (ATCC)
Rockville, MD. All cells were cultured in RPMl 1640 (Wisent, Que)
supplernented with 2mM L-glutamine, 100UIml penicillin, 100pg/ml
streptomycin and 15% bovine calf senim (Wisent) at 37°C and 5% C02.
2.2 Flow Cytometric Analysis:
Extracted cells and control cell lines were washed with PBS (5.4 mM KCI,
2.8 mM Na2 HP04, 2.9 mM and 0.3M NaCl, pH 7.3) and centrifuged at 1000
rpm for 7 min followed by a 30 min incubation with 1 pg of antibody 11x1 06 cells,
or appropriate isotype controls at 4OC. The kllowing panel of antibodies were
used for phenotypic analysis: FITC-anti human CD38; PE-anti -human IgD.
FITC-anti-human IgM (Pharmingen, Mississauga, ON), FlTG anti-human CD1 9,
PE- anti-human C03, FlTC-anti -human lgG (Becton and Dickinson, San Jose.
CA) and anti -human h5 (kindly provided by Max Cooper). Subsequently, cells -
were fixed in 0.5ml of fixative (2% paraformaldehyde in PBS, pH7.2) and two
color analysis was carried out using a FACSCaliburGD flow cytometer.
2.3 Tonsil Tissue Manipulation and 6 cell Extraction:
Juvenile tonsils were recovered post tonsillectomy. Tonsilar tissue was
homogenized manual ly and su bsequently strained through a 70pm nylon cell
strainer (Falcon, Franklin Lakes, New Jersey). The strained cells in the flow-
through were then centrifuged in a Ficoll-Paque (Phannacia Biotech, Sweden)
density gradient. lsolated lymphocytes were washed in RPMl 1640 and 8 cells
were isolated by negative selection using neuraminidase treated sheep red
blood cells (Cedarlane. ON.) to rosette T lymphocytes, as per the
manufacturer's protocol. All B cell enriched preparations were analyzed by flow
cytornetry for percent 6 lymphocyte punty. 1x1 07 CD19+ or CD19+/CD38+
purified cells were then pelleted and either cryopreserved at 80°C. or mixed
with TRIzol reagent (GibcoBRL, Grand Island, NY) for immediate RNA
extraction.
2.4 RNA Extraction:
Total RNA was extracted from 1 x107 cells, or directly from 50-1 00mg of
homogenized tonsilar tissue using TRlzol RNA Isolation reagent as per the
manufacturer's protocof. Samples from RNA preparations were electrophoresed
under denaturing conditions and visualized with EtBr staining to ensure RNA
quality and integrity.
2.5 Analysis of RAG 1 and RAG 2 splice variant transcripts:
From whole tonsilar tissue or B cell enriched preparations, 4pg of RNA
were reverse transcribed into double stranded cDNAs with Superscript II RNAse
H-Reverse transcriptase (GibcoBRL, Burlington ON) as per the manufacturer's
protocol. 1 pl of cDNA was subsequently arnpiified by PCR using one of the
following sets of sense and antisense primers: RAG 1 (F29) 5'-
G AGCAG AGAACACACïT-3' and (R38) 5'-CAAGGTGGGTGGG AAAGA-3',
RAG 2 1 A (F5 1 1 ) 5'-TTA GCGGCAAAGATTCAGAG-3' RAG 2 1 B (FS07) 5'-
ACAGGCAGGACACCGTAACG-3' and for both RAG 2 1A and I B (R542) 5'-
TGTCTCTGCCAGATGGTAAC-3' and GAPOH (FI ) 5'-
AAGGTGAAGGTCGGAGTC-3' and (R2) 5' -TCAGCAGAGGGGGCAGAG-3'. Al1
primer pain span an intron to avoid amplifying contaminating genomic DNA.
Taq DNA polymerase (Boehringer Mannheim, Laval. Que) was used for al1
amplifications as per the manufacturer's protocol. PCR conditions were
optimized using- RAG 1 and RAG 2 1 A and 1 B 5' RACE clones (25). PCR
conditions were carried out as follows: RAG 1, RAG 2 and GAPDH samples
were initially denatured for Smin at 94OC, followed by repeated cycles including
94°C for 1 min, 48°C for 40 s and 72°C for 40 S. RAG 1 was amplified for 35
cycles and RAG 2 for 38 cycles with a final extension reaction of 72°C for 10
min. The amplified products were electrophoresed on a 2% agarose gel and
visualized with EtBr staining. The amplified PCR products were transfened ont0
a Zeta-probe nylon membrane (Bio Rad, Hercules, CA.) by ovemight capillary
transfer in 0.4M NaOH. DNA was cross-linked to the membrane using a UV
Stratalin ker apparatus (Statagene, LaJolla, CA). Membranes were probed
using [+2~]-ATP labeled oligonucleotide probes, generated by labeling
oligonucleotide sequences specific to intemal regions of the RAG 1 or RAG 2
genes. The oligo labeling reaction- 2 0 ~ 1 dH,O, 20 pmoles oligonucleotide, 3pl
10x T, Kinase reaction buffer, 0.5 pl T, Kinase (Gibco, BRL) and 25- 30pCi
@2~] (Dupont NEN Boston, Mass.) -was carried out at 37O for 45 min. An exon
6 intemal probe was used to detect GAPDH control hybridization products.
Southern analysis was carried out as per the Zeta Probe (Bio-Rad)
Manufacturer's protocol at 37OC for both pre-hybridization and hybridization
steps. Washes were perforrned at 40°C for 20 min in 2 x SSC/1% SDS.
Membranes were then exposed to Kodak X-Omat film (Eastman Kodak
Company, Rochester, N.Y) at room temperature for a minimum of 1 hr.
2.6 DNA Extraction and LM-PCR:
Enriched 6 cells, whoie tonsii tissue and control cell tine pellets were
washed 3 x in cold Mg '* free PBS, and then pelleted at 1000 rpm at 4°C for
7min. and resuspended in lysis buffer [IOrnM Tris pH 8.3 (ICN Biomedical,
Aurora); 2mM MgCl2 ( Fisher Scientific), 50rnM KCI (Fisher Scientific), 0.45%
Nonidet P40 (BDH Chernical, Poole, Dorset, UK), 0.45% Tween 20 (Fisher
Scientific) and 60 pg /mi Proteinase K ( BMH, Indianapolis, IN)]. Cells and buffer
were mixed thoroughly by pipetting. A 1 hr incubation at 56OC, followed by 15
min at 90°C was carried out using the GeneAmp PCR 2400 (Perkin Elmer, CA).
Extracted cellular DNA was then stored at -86OC prior to ligation. 20p1 of lysis
buffer was added to the ligation reaction containing O.5pM of BW-linker (Gibco -
BRL) 5' - CCGGGAGATCTGAATCCAC - 3' as descnbed in (27). The mixture
was then incubated at 90°C for 15 min to inactivate the ligase. 10pl of the above
mixture was then used to cary out LM-PCR. Subsequent PCR steps were
camed out using locus sequence specific primers as previously described (19.
1 1 1).
2.7 LM-PCR Oligonucleotide sequencecl:
Two human JK primers were designed to detect dsDNA signal end
breaks in RAG positive whole tonsil and tonsilar B cell samples. 60th primers
sequences; (JK~) 5'-GCCAGGGACTCTAACAAA-3' and (Je) 5' -
llTACTTTGTGTTCCClTGT-3' were designed to detect signal end dsDNA
breaks occurring between JiO and the J K ~ coding region of the locus. J K ~ was
used as the intemal probe for JiO amplified hybridization products. A third oligo,
( J K ~ ) 5' - GlTAGGTACAGAGGAGGGGAAAT-3' was generated to detect
corresponding hybridization products amplified w l h Jrl under Southern
analysis. Considering that both lambda and kappa loci rearrange with
equivalent frequency in human cells, a human JÂ. primer was designed to detect
signal end dsDNA breaks possibly occumng upstream of the Jh7 coding region.
( J I ) 5' - TCCTCCCTCTCCCCTCTCCCTCTG -3' amplified products were
detected using (J&, ) 5'-GAACGGGTCGGGTGTGTCAGGAG-3'. All LM -PCR
products were analyzed as previously dexribed (1 11).
CHAPTER 3: RESULTS
Results:
- 3.1 Sensitivity and Specificity of PCR Assays for RAG 1 end RAG 2:
An assay was developed to detect RAG 1 and RAG 2 RNA expression.
The sensitivity of the primer pairs used in the assays was optimized using RAG
5' RACE clones previously described (44). Assays were designed to detect RAG
1 transcripts as well as the two splice variants of RAG 2; RAG 2 1A and RAG 2
1B, described previously (44). Figure 7A denotes the position of the primers
used to detect the three RAG transcripts. The primer pairs were designed to
span an intron to avoid arnplifying contaminating genomic DNA.
Employing the RAG 1 5' RACE clone, the primer pair used to detect
RAG 1 was optimized reproducibly to detect approximately 1 Oz copies of the 5'
RACE clone DNA ternplate (figure 7B). In the case of RAG 2 1A, I O 3 copies of
the 5' RACE clone template could be detected with primers for RAG 2 1A, while
the primers for the M G 2 1 B assay could detect as little as 102 copies of
RAG 2 16 5' RACE clone DNA (figure 7C). As shown in figures 1B and 1 C, al1
primers specifically amplified the control 5' RACE clone and not the 5' RACE
clones containing other RAG transcripts.
3.2 PCR assay sensitivity demonstrated in vitro:
The sensitivity and specificity of the RT-PCR assay was demonstrated
using the RAGN variant of a mature B cell line OCI-LYû-A1 IN. cDNAs were
synthesized from the high RAG expressing daughter clone C3-A11 N. A chronic
myeloid leukemia cell Iine K562 was used as a negative control. cDNA dilutions
of C3-A11 N were amplified by PCR under the same conditions found optimal for
amplification of the 5' RACE clones. Primer specificity was demonstrated by the
appropriate amplification of the expected 135 bp RAG 1 amplicon, which was
easily detectable at 1/100 cDNA dilution (figure 7D). The expected 96 base pair
RAG 2-1A product was also confirmed by Southern analysis. However, the
expected RAG 2-1 B amplicon was only detected at cDNA concentrations of 1/10
(Data for M G 2 not shown).
3.3 Phenotypic Analysis of Purified human B lymphocytes:
Figure 8 shows representative flow cytometnc data from one pufified
germinal centre B cell preparation purified by density centrifugation. Although 6
cell purity in this particular preparation was 96%, as detennined by CD1 9lCD3
cell staining, not al1 samples used for RT-PCR analysis were assessed to be this
pure. The enrichment method used for these studies does not yield the punty
that can be obtained by other methods such as subfractionation by cell sorting
procedure, or affinity purification. Further analysis of phenotypic rnarker
expression ( l g ~ ; CD38 and IgM) demonstrated heterogeneity of 6 cell subsets
in these B cell preparations: 39% of these B cells were CD38+, 65% were IgD+
and 5% were IgM'. This low level of slgM expression is not unexpected, as GC
B cells consistently express low levels of slgM by FACS analysis (97). These
results suggest to us that the fractionated cells are making cytoplasmic p that is
not reaching the cell surface and is therefore not detectable by FACS cell
surface staining analysis. The percent of B cell subsets varied from sample to
sample as shown in Table 1.
3.4 Expression of RAG genes in human tonsil tissue and purified
mature B lymphocyte Populations:
1 assayed both whole tonsil tissue and purified B lymphocyte
preparations for expression of RAG 1 and RAG 2. Tonsils were obtained from
surgica; specimens from children undergoing tonsillectomy for repetitive
episodes of tonsillitis. After Ficoll-Paque centrifugation. 6 cell preparations were
further purified by T cell rosetting. The percentage of 6 cells in the whole tonsil
tissue ranged from 50 -80 O h and increased to 90 -95% in some cases, after T
cell rosetting. RAG 1 and M G 2 transcripts were detected in both whole tonsilar
tissue and purified B cell samples. Figure 9A shows a representative RT-PCR
analysis carried out on whole tonsilar tissue employing RAG 1 specific primers.
RAG 1 transcripts were demonstrated by RT-PCR and quantitated at
approximately 1&103 copies per O.lpg of starting RNA. Figure 96 shows the
results from the same tonsil sample using RAG 2 1A and 1 B specific primers.
Again I was able to detect transcripts from both RAG 2 1A and RAG 2 1B at
approximately IO2- IO3 copies respectively, in this whole tonsilar tissue
preparation.
I also assessed RAG expression in B cell enriched preparations from the
tonsil specimens. 60th RAG 1 and RAG 2 1A transcripts were observed in
several samples analyzed. An example of results obtained from one enriched B
cell preparation is shown in figure 9C. A summary of RT-PCR amplifications for
RAG 1 and RAG 2 from whole tonsilar tissue andfor enriched B celf preparations
is shown in table II. Ten different tonsil tissues were screened for these studies.
In one sample, only whole tonsilar tissue was assessed, in five others, only
enriched 8 cell populations were assessed, and in the other four, both whole
tonsil tissue and enriched B cell populations were assessed. RAG 1 and RAG 2
expression were demonstrated by RT-PCR analysis in five different samples.
3.5 Functional Evidence of RAG Re-expression:
To show that RAG expression in our mature 8 cell preparations had
functional significance, I designed a locus-specific, ligation mediated PCR
assay. I chose this assay for its ability to detect V(D)J recombination
intermediates whose generation rely solely on the combined unique and
specific enzymatic activity of the RAG genes. This particular assay was carried
out in the Wu laboratory and detected de novo dsDNA breaks at recornbination
signal sequence (RSS) sites at both the Igr and l g l loci. B cell samples
expressing RAG transcripts were subjected to LM-PCR. The human pre-B ceII
line 697 which is actively undergoing V(D)J rearrangements was chosen as the
positive control for these experiments. (For a negative control we had originally
employed the myeloid cell line K562, however this proved problematic and
subsequently RAG 2 expression was demonstrated in this line by RT-PCR
assay in the lab. DH,O was chosen as the negative control in these
experiments. I report here that PCR fragments of sizes consistent with the
presence of signal ends were detected demonstrating targeted de novo, RAG-
specific dsDNA signal end breaks occurring between the JiO and J K ~ region of
the JK locus, as detennined by the expected 206bp size product (figure 1 OC).
Using the J,-, - J, primer and intemal probe pair, JX signal end intemediates
were also detectable, resuiting in the expected PCR product of 233 base pain
(figure 1 OC).
Figure Legends:
(Figure 7) ~etection of RAG 1 and RAG 2 Gene Expression. A)
Primer and probe locations for RT-PCR assays to detect RAG 1 and both RAG 2
isofonn transcripts in human mature 6 lymphocytes. Open boxes indkate
exons. B) Detemination of RAG 1 PCR assay sensitivtty using a RAG 1 5'
RACE clone. Southem analysis shows dilutions (camed out in T.E ) of the RAG
1, 5' RACE clone containing exon 1 and a portion of exon 2 amplified with RAG
1 specific primers. Controls include RAG 2 5' RACE clones, which are not
amplified by RAG 1 specific pnmen and a dH,O control for reagent
contamination. C) Determination of RAG 2 PCR assay sensitivity for both RAG 2
isoforms using RAG 2 1A and 16 5' RACE clones. Southem blot anaiysis
demoristrates serial dilutions of RAG 2 I A 5' RACE clone and RAG 2 1 B 5'
RACE clone with correlating PCR sensitivity. Controls for primer specificity
include plasmids containing other RAG transcripts. dH,O is a control for reagent
contamination. D) Detemination of the RAG RT-PCR assay sensitiwty
demonstrated in vitro using a RAGMmature B cell line. cDNA was synthesized
from the OCI-LY8 -C3P variant C3-A11 N, a high RAG expressor. Parallel PCRs
were camed out on cDNA dilutions with M G 1 and GAPDH çpecific primers.
RAG 1 5' RACE clone titrations demonstrate assay sensitivity. Undiluted RT - negative lanes and dH,O serve as negative controls for cDNA synthesis and
PCR.
(Figure 8) Phenotypic Analysis of Purified Tonsilar Germinal
Centre B Cdk. A representationai flow cytometric analysis of human
tonsilar GC B ceils purified by density centrifugation (sample JGTON004). Open
histograms represent fluorescence of FlTC and PE conjugated cell surface
markers, while shaded histograms represent isotype controls.
(Figure 9) RT-PCR Analysis of Human Whole Tonsilar Tissue
and Enriched B cells amplified with RAG 1 and RAG 2
Specific Primers. A) Analysis of RAG 1 expression in whole tonsilar tissue
(JGTON001, trial 4). cDNA dilutions were amplified with RAG 1 and GAPDH
specific primers. RAG 1 5' RACE clone dilutions are included for semi-
quantitative comparison and assay sensitivity. GAPDH demonstrates cDNA
quality. Undiluted RT- negative lanes and dH,O seive as negative controls for
non-specific amplification and reagent contamination. 6) Analysis of RAG 2
expression in whole tonsilar tissue (JGTONOOi- trial 4). cDNAs were diluted
and amplified with RAG 2 1 A, 1 B and GAPDH specific primers. RAG 2 5' RACE
clone dilutions are included for semi-quantitative comparison and to indicate
assay sensitivity. GAPDH demonstrates cDNA quality. Undiluted RT-negative
lanes and dH,O serve as negative controls for non-specific amplification and
reagent contamination. C) Analysis of RAG -1 and RAG -2 expression in
enriched mature human GC B cells isolated from JGTON003- trial 3. cDNA
dilutions of tonsil GC B cells were amplified with RAG 1, RAG 2 1 A and GAPDH
specific primers. RACE clone dilutions are included for semi-quantitative
comparison and to demonstrate assay sensitivity. GAPDH demonstrates cDNA
quality. Undiluted RT -negative lanes and dH,O serve as negative controls for
non-specific amplification and reagent contamination. D) A demonstration of
tonsil heterogeneity for RAG expression. Analysis of RAG -1 expression in
enriched human GC B cells isolated from JGTONOOG - trial 2 shows this tonsil
does not express RAG mRNA, cDNA dilutions of tonsii GC 6 cells were
amplified with RAG -1 and GAPDH specific primers. RACE clone dilutions are
included for semi-quantitative comparison and to demonstrate assay sensitivity.
GAPDH demonstrates cDNA quality. Undiluted RT -negative lanes and dH,O
serve as negative controls for non-specific amplification and reagent
contamination. E) Analysis of RAG -1 expression in enriched human GC B cells
isolated from JGTON004 - trial 1 showing difficulties encountered with titrations.
cDNA dilutions of tonsil GC B cells were amplified with RAG -1 and GAPDH
specific primers. RACE clone dilutions are included for semi-quantitative
comparison and to demonstrate assay sensitivity. GAPDH demonstrates cDNA
quality. Undiluted RT wnegative lanes and dH,O serve as negative controls for
non-specific amplification and reagent contamination.
(Figure IO) Detection of dsDNA Signal End Breaks at the
Kappa and Lambda Loci. A) Schematic diagrarn of the LM-PCR
strategy for detecting secondary rearrangements at the K locus. In attempts to
detect secondary rearrangements occumng at the JK locus, a LM-PCR assay
was designed to amplify dsDNA signal end breaks occurring between the JiO
and J K ~ coding regions of the locus. Locus specific primer is denoted by JK,,
while the intemal probe used for detection is designated J K ~ . The Iinker and its
primer are called BW. The recombination signal sequences are represented by
closed triangles. A previous loci rearrangement involving VK and JK, is shown
here for convenience. 6 ) Schematic diagram of the LM-PCR strategy for
detecting secondary rearrangements at the ic locus. In attempts to detect
secondary rearrangements occurnng at the J i locus, a LM-PCR assay was
designed to amplify signal end dsDNA breaks occurring between the Jh6 and
Jh7 coding regions of the locus. The locus specific primer used is denoted by
JA,, while the intemal probe used for detection is designated J&. The M e r and
its primer are called BW. The recombination signal sequences are represented
by closed triangles. A previous loci rearrangement involving V I and JA, is
shown here for convenience. C) LM-PCR analysis provided by the Wu
laboratory, of human GC B cell DNA extracted from RAG expressing cells. Three
ennched human GC B cell sainples show RAG functionality. Both the 206 and
the 233 bp PCR fragments are consistent with expected JK and JL amplified
signal end intermediate products. A human pre-6 cell line is the positive control,
while dH,O controls for reagent contamination.
(Table 1) Phenotypic Screening of Enriched B cells
Demonstrates Lymphocyte Subset Heterogeneity.
Characteristic B&II phenotypic rnarker expression was obsewed in al1
specirnens. However, expression levels of these markers varied from lymph
node to lymph node.
(Table II) Expression of RAG 1 and RAG 2 lsoforms in Whole
Human Tonsil Tissue and Enriched Tonsilar B Cell
Preparations. Ten human tonsil samples were recovered post tonsillectomy
from children with re-occurring tonsillitis due to chronic pathogenic bacterial or
viral infection. Samples were subsequently screened for both RAG 1 and RAG 2
expression. Seven of the ten lymph nodes screened were positive for RAG
expression, demonstrating heterogeneity of RAG expression in human tonsilar
tissues.
(Table III) Summary of Tonsil Samples and Their Degree of
RAG Signal. Analysis of each individual tonsil sample screened for
RAG expression. Whole tonsil andlor enriched B cell subfractions
were assessed as indicated by the "x'. For each sample such as
JGTON001, each separate trial is given a number. Each trial
represents a separate PCR experiment. In some cases two separate
cDNA preparations from the indicated tonsil were tested. All trials that
gave a positive signal with the GAPDH control are shown. Numerical
values ("signal over background") represent fold signal demonstrated
over background ("no RT' lane see Figure 9). For example, the
number 1 means that a signal (band) was seen only in the undiluted
lane and that this band was darker than the no RT lane, while 10
means that detectable signal from a 1/10 dilution is equivalent to ten
fold over background. Zero denotes that a signal band was not visible
on the autoradiograph and the sample was considered to be negative
for RAG expression. NA denotes no data available. Care was taken
that numbers represent minimum values. In some cases, as
illustrated in Figure 9C or 9E the titration was clearly not linear. When
this occurred, the signal value was assessed to be the signal pfior to
where the titration stopped (e.g. 1 as in Figure 9E ).
(Figure 7A)
(Figure 7 6 )
,! ,Q
.@ ..$ 8 .@ ..$+ @ .ia5 \V ffi - 1 eC %b,ai& .@ 5 $ o& w'
5- RaCE cbne 4Q 4Q 40 4Q 40 40 4r0 @9 0."
(Figure 7C) (Figure 7 0 ) RAG -1
(Figure 8)
unstained B cells
(Figure 9A)
4- K* RAG-1 ', ,aa @ B ,P@ $89
P û SRACE clone 9 3 \O 4P 40
(Figure 9C)
(Figure 98) RAG -2 1A / GAPDH/'
K i RAG -2 1A P'" 4- p"" $8 s MC€ clone b
6 4% ,P +fQ .$@ dl& '3 plasmid DNA 4 40
RAG -2 1 6 5' RACE clone plasmid DNA 84bP
373 bp 96 bp
+ K !
RAG -1 -#' - 5' HACE clone
+.lir~~re-? W.- --* -.-- *++ , ,- . - 73 . . . . .
S- 4% plasmid DNA
373 bp 135 bp
a PDH
(Figure 90)
RAG -1
(Figure 9E)
RAG -1
GAPDH
STRATEGY FOR LM-PCR
(Figure 10A) J Kappa light chain locus
R A G u
(Figure 108) J Lambda right chah locus
(Table 1)
Sample
JGTONOOZ
JGTONOO4
JGTONOOS
JGTONOO6
JGTON008
JGTONOOS
JGTONO 1 0
Analysis not amilable for JGTONOO 1 (whole tonsil prepared only), JGTON003 and JGTON007.
(Table II) Expression of RAG -1 and RAG -2 lsoforms in Whole Human Tonsil Tissue and Enriched Tonsilar B Cell Preparations
Tvpe of Sample le
Whole tonsil tissue JG TON 001 + + + Tonsilar B cells JG TON 002 Arnbiguous Tonsilar B cells Tonsilar B cells Tonsilar B cells Tonsilar B cells Whole tonsil tissue Tonsilar B cells Whole tonsil tissue Tonsilar B cells Whole tonsil tissue Tonsilar B cells Whole tonsil tissue Tonsiiar 6 cells
JG TON 003 JG TON 004 JG TON 005 JG TON 006 JG TON 007 JG TON 007 JG TON 008 JG-TON 008 JG TON 009 JG TON 009 JG TON 01 0 JG TON 010
+ Positive for RAG expression - Negative for RAG expression ND Not determined (could not see consistent signal)
Table III Surnmary of Tonsif Samples and their Degree of RAG Signal
over background Whole t o n s i l RAG 2 1~ 1 RAG 218 Sample Trial
I N A
TABLE III Sumrnary of Tonsil Samples and their Degree of RAG Signal
Sample Trial
background
RAG 218
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
5
1
5
Whole t o n s i i
NA
NA
NA
NA
NA
NA
NA
NA
NA
x
over
RAG 2 1A
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
5
10
NA
enriched B cells
x
x
x
X
X
X
X
x
x
x
X
X
X
signai
RAG 1
O
1
1
1
O
O
O
O
O
O
1 O
1
O
TABLE III Surnmary of Tonsil Samples and their Degree of RAG Signal
signal over background
RAG 216
CHAPTER 4: DISCUSSION
4.1 Discussion of Results
In carrying out this project, I have demonstrated the expression of RAG 1
and RAG 2 mRNA in human lymph node tissue. I have screened a total of ten
human lymph nodes and found six of these to be positive for RAG 1 expression.
It was also determined that five of the six RAG positive tissues demonstrated
concomitant expression of RAG 1 and both isoforms of RAG 2. Further, this
concomitant RAG expression was seen in both whole tonsilar as well as
enriched B cell preparations.
These results are consistent with recent findings from murine studies
similariy employing RT-PCR to demonstrate RAG expression in murine germinal
centres (86, 92. 93, 99, 101). Using in situ -PCR and immunophenotypic analysis,
previous studies showed the expression of RAG 1 and RAG 2 messenger RNA
and protein in the germinal centre microenvironment (102). Additionally,
germinal centre RAG gene products have been shown to be functional by LM-
PCR assay for de novo RAG-specific dsDNA breaks (86.99, 101).
Interestingly, all murine reports concluded that functional GC RAG
expression requires prior 6 cell activation either in vitro or in vivo (86.92, 93. 99,
101-103). We have extended these studies to tonsilar tissue obtained from
children undergoing tonsillectomies for repetitive episodes of tonsillitis. We
consider these 6 cells to have likely been activated by various pathogenic
bacteria or vinises. More importantly, these results are consistent with recent
reports published by Giachino and colleagues and Meffre et al., both working
with tonsil samples, who report functional RAG expression in these GC sites (94,
- 95).
Although in most sarnples where RAG expression was detectable, we
documented expression of both isoforrns of RAG 2, RAG 1 alone was found in
one B ceIl preparation (JGTON004). There are several possible explanations
for this. Although 1 is possible that these are unique examples of discordant
RAG 1 and RAG 2 expression, we think the more likely explanation is related to
technical difficulties with these particular samples and assays. Technical
problems in RAG 2 PCR efficiency were also encountered by Giachino and his
group (94). Moreover, we found that both RAG 2 splice variants were expressed
concomitantly. The significance of expression of RAG 2 from these different
splice variants containing different promoter regions is as yet unclear. While
other groups have not yet addressed both RAG 2 splice variants, clearly
however, we see that there is no differential utilization of these splice variants in
RAG expressing germinal centre B cells.
In order to detect de novo dsDNA breaks resulting from secondary K or ii
light chain gene rearrangements and RAG activity, as previously detected in
murine GC (86, 99, 102), 1 designed sequence specific JA and JK
oligonucleotides to amplify secondary lg gene rearrangement intermediates by
ligation mediated PCR. In agreement with others' recent findings (94. 99, we (in
collaboration with the Wu laboratory) demonstrated that the RAG expressed in
mature human GC 8 cells is indeed functional, as evidenced by the de novo
dsDNA breaks consistent with signal end intermediates found in V(D)J
recornbination. Although we were only capable of detecting RAG function in two
of our four tested RAG expressing samples. we are confident that RAG specific
breaks would be detectable with other locus specific primers.
In further observations, we found M G expression to be heterogeneous
from sampie to sample. In four of the ten lymph nodes screened RAG
expression was not detectable (Table II). Previous reports in munne 6 cells
have determined that only a particular murine B cell subset (?NA+, GL-7')
residing within germinal centres expresses RAG (92, 93). In fact. al1 reports of
RAG expression in mature mouse B cells have shown that RAG re-expression
and further recombination has occurred in a smali subset of mature GC B cells
(86, 92. 93, 99, 101403). This murine population of GC B cells corresponds to the
human. light zone centrocyte subfraction (CD38+/lgD-/CD77-) Bm4, originally
described by Pascual et a/., 1994 (97). Furthemore, recent work in human
tonsilar tissue confinned the presence of RAG mRNA transcrïpts in the GC
centrocyte subfraction (94, 95).
By performing extensive flowcytometiy analyses, we detemined that the
lymph node derived B cells used in these experiments, were compnsed of
heterogeneous B cell subsets which varied from sample to sample. both in
number and in degree of cell surface marker expression. This subset
heterogeneity may be one explanation for the heterogeneity of RAG expression
noted from lymph node to lyrnph node. Another explanation for the
heterogeneity of RAG expression may be due to the type of B cell activation
experienced (bacterial or viral) prior to tonsillectomy. We believe this to be a
salient point, since al1 reports of RAG expression in mouse peripheral 8 cells
have required B cell activation by LPS and IL-4 CO-culture conditions, or
immunization with a bacteria derived adjuvent such as trinitrophenyl- keyhole
hemocyanin (86, 92, 93, 99, 10 1- 103).
Sirnilar to our studies, experiments perforrned by other groups carried out
in human tonsillar B cells, did not use LPS or IL-4/IL-7 to induce RAG
expression (94. 95). Meffre and colleagues however, did perfonn CO-culture
using CD40 ligand and saw induced RAG expression, along with h-like, V-preB,
and TdT mRNA expression after 3 days in culture. Nonetheless, in contrast to
previous results in mouse studies, addition of 11-2, IL4, or IL-1 0 to cultures did
not induce RAG expression (95). This data further supports our assumption that
extracted tonsilar 6 lymphocytes have previously been activated in vivo.
It is unlikely that a low frequency of pre-6 cell contamination accounts for
this 'fourth waven of RAG expression seen in germinal centres for several
reasons. First, by making use of surgically excised lymph node tissue we dealt
only with tissue containing mature, differentiated B cells. Additionally,
phenotypic analysis demonstrated that these lymph nodes were enriched for
mature B or T lymphocytes and pre B cells expressing Â5 were not detected
(data not shown). Others have documented the expression of early B cell
markers, such as Â5 and TdT (95, 99)in the GC. However, to test for immature,
RAG expressing, contaminating B cells, Hertz et al., (81) set out to distinguish
whether a subset of immature, or pre-B cells present at these peripheral sites
were responsible for the recombinase activity. By inducing V(D)J recombination
in 3-83p6 Tg- splenic B cells, they assayed for A -light chain rearrangements -
which are suppressed in these animals. As discussed earlier, an increase in X-
light chain expressing cells was observed. paired with RAG induction and
significantly , RAG downregulation, upon BCR cross-linking. In keeping with ou r
expectations, the authors maintain that the cells undergoing V(D)J
recombination can express slg and therefore, do not represent pre-B cell
contamination (8 1 ).
4.2 RAG Expression in mature B cells: Models and Implications for
RAG activity
The results of this project suggest that a subset of human GC B
lymphocytes express RAG. This finding, taken together with recent observations
made by investigators using murine models (86. 92, 93, 99, 101-103), provides
new insight into B cell differentiation and V(D)J recombination in a
microenvironment previously thought to be excluded from such events. These
findings also support the notion proposed by Nemazee, Weigert and others. that
new rearrangements are potentially being undertaken in order to edit pre-
existing lg receptors, once exposed to antigen at this peripheral site (86, 94, 95,
99).
Very recent data using a sorted CD77- subset (non-dividing centrocytes)
of human germinal centre B lymphocytes, provided by Lanzavecchia and his
group, has also confimed RAG 1 and RAG 2 expression by PCR assay (94).
Moreover, findings by Meffre et al.. show that mature human tonsillar 6 cells co-
express slg and RAG (95). However, in the later study, both RAG and TdT
expression is shut off upon BCR cross-linking with Ag. These observations
suggest that the mechanisrn driving RAG expression in the periphery may serve
an opposite purpose to that in developing 6 cells responding to the same Ag
stimulus, in that, receptor revision occurs in mature peripheral B cells and
functions as a mechanism for receptor diversification, which is terrninated once
the BCR is cross-linked by the appropriate cognate antigen (95).
In support of this hypothesis, Hertz et al., (81) have demonstrated that
V(D)J recombination in mature B cells is not a mechanism of immune tolerance.
Rather, they found that BCR Iigation inhibited V(D)J recombination induced by
IL-4 and LPS. Moreover, when lg transgenic mice were imrnunized with a range
of ligands varying in avidity for the Tg BCR, only fow-avidity Ag could induce
strong V(D)J recombination. Conversely, high-avidity ligands and non-binding
ligands were unable to induce recombination. Based upon their data, the
authors suggest that V(D)J recombination induced during the immune response
(in GC) alters only the Ag-receptors of B cells with weak reactivity to Ag, in
order to rescue cells with improved receptor affinity and promotes their
contribution to the immune response. Tharefore, this group conclude that BCR
signaling regulates V(D)J recombination in both tolerance and immunity, but in
strikingly different ways (8 1).
Hence, a general model describing M G activity would suggest, that
revision may b e induced by diminished, or lost Ag-binding at the light zone
check-point in the GC. This is where the B cell re-encounters antigen expressed
on FDCs post hypermutation, along the road to affinity maturation (55, 86, 99,
102). Replacement rearrangements rnay serve to rescue failing GC 6 cells, by
editing low affinity receptors, or those debilitated by mutation, perhaps even
allowing for receptor-Ag affinities that could not otherwise be achieved by
somatic mutation alone (8 1, 94, 95, 103). 6 cells which have acquired mutations
resulting in their inability to express a competent slg, even afier further attempts
at recombination, face the fate of deletion by apoptosis.
In support of this, it has been shown that RAG expressing B cells
localized within GC following immunization, were present as apoptotic cells
confined within tingible bodies (102). Re-expressed RAG gene products may
therefore play a role in the revision of unfavorable, or dysfunctional lg receptors
generated in the GC during somatic hypemutation and switch recombination by
giving the cell a 'second chance" to express a new Ag receptor and possibly
averting apoptosis (98).
In essence, a fourth wave of RAG expression in peripheral GC would
provide a frugal mechanism by which the body could preserve cells that would
otherwise be lost to the immune response, or perhaps contribute to the
diversification of the peripheral B ceIl repertoire (81, 94, 95). However, it still has
Figure 1 1. Receptor Editing versus Receptor Selection. In the bone marrow an immature 6 cell encounters one of three fates upon BCR cross-linking. (1) If the BCR demonstrates little or no avidity for presented antigen, the cell is positively selected and will then exit the bone marrow to survey the periphery as a mature naive B cell. However, if the immature 6 cell exhibits a strong avidity for Ag, then the cell will either undergo (2) deletion via apoptosis, or (3) initiate a third wave of RAG expression, known as Receptor editing, leading to secondary light chain gene rearrangements and the expression of an edited receptor which no longer cross reacts with setf-Ag. At this stage of development. this third wave of RAG expression is considered to be a mechanism of immune tolerance designed to delete any potentially deleterious cells which may cross react with self-Ag, while first giving cells a "second chance" to generate an non-autoreactive receptor. Receptor selection, in contrast to receptor editing, serves as a mechanism to rescue mature 6 cells which have undergone hypermutation resulting in Me generation of a BCR with low or decreased avidity for Me specific Ag. A presently unknown signal, perhaps thought to be 11-4 or IL-7, induces a fourth wave of RAG expression in this pst-hypemutation cellular subpopulation in the germinal centre allowing further V(D)J rearrangements to occur. This fourth wave of RAG expression is hypothesized to be a mechanism of receptor diversification which ailows the Ag to select the best cognate receptor. While cells possessing BCRs with high avidity for foreign Ag continue to differentiate into memory or plasma B cells, celts having no avidity die by apoptosis.
yet to be detennined, which of the various signals post antigen stimulation,
induces RAG expression in GC B cells, which are either non-functional or
autoreactive and whether the nature of this expression is a mechanism of B cell
tolerance, affinity maturation, or enhanced diversification.
4.3 Implications in Disease:
It has been reported that a mutation in either of the RAG genes (nul1
mutation or missence) renders the genes able to maintain partial recombinase
activity, but leads to V(D)J deficiencies and manifests in a severe
immunodeficiency characterized as Ornenn Syndrome (112). Structural
mutations of the RAG genes have also been shown to be responsible for
approximately half of the number of human B cell-negative severe combined
immunodeficiency (B- SCID) cases, which results in a complete lack of B and T
lymphocytes, due to loss or dramatic reduction in V(D)J recombination activity
( 113). Inappropriate expression has previously been implicated in chromosomal
translocations and lymphoid malignancies in hurnans (46). Recent data has
shown that the RAG genes are able to mediate transposon activity. Therefore,
RAG may play a significant role in these translocations due to this capacity (3 1,
45-47). Future studies revealing the molecular mechanisms responsible for
proper RAG expression will hopefully elucidate how this fourîh wave of
expression is regulated in peripheral lymphoid organs. As well as its implication
in human disease and grant a better understanding of whether this re-
expression of RAG is indeed a mechanism of receptor editing, or receptor
selection.
4.4 Future Studies:
Several studies carried out in both human and mouse have described a
specific subset of germinal centre 6 lymphocytes which expresses RAG (92-95,
99). Although most groups (including ourselves) are in agreement as to the
phenotype of these cells (slg'), one group daims to have pin pointed RAG
expression to a slg- centrocyte population (94). However, this study was
performed using only one sample and was problematic.
Recent studies carried out by Meffre et al., and Hertz et al., provide
evidence that antigens varying in affinity for the B cell receptor induce
differential 6 cell responses at different stages of 6 cell differentiation (81, 95).
Contrary to data obtained from immature IgM+/lgD- BM cell studies, in which slg
cross-linking with self-Ag rapidly initiated receptor editing, indicated by
increased recombinase (RAG) mRNA levels (68, 69, 80). Mature B cells have
been shown to shut off RAG expression upon BCR cross-linking with self-Ag
(81) (95) in a process of receptor selection, not receptor editing. RAG expression
was inhibited in human lgD-/CD38+/RAG+ GC B cells with the addition of anti-A
and anti-K mAbs to culture (95). As weil, these suppressive effects were
characterized in dose-response experiments in wh ich intact anti-K, anti-3c and
Fab'2 fragments were employed. Together, both Abs demonstrated a dramatic
downregulation of both FiAG 1 and RAG 2, suggesting that strong cross-linking
is a mechanism of positive selection for B cells that produce high affinity
receptors, by receptor revision in the periphery.
Similar findings by Nemazee's group, using Ml3 phage-display in a
murine system, demonstrated that immunization with ligands of varying avidities
for the BCR had various effects on recombinase activity. tt was determined that
low-avidity Ag could induce strong V(D)J recombination, while high-avidity
ligands and those lacking avidity, could not induce new h rearrangements
characteristic of further recombination events (8 1). Taken together, these data
support the modef that BCR cross-linking by high affinity ligand will inhibit
receptor revision and stimulate the expansion of high affinity clones.
Meanwhile, centrocytes with a lower affinity will undergo further recombination
events and therefore revision, in attempts to improve their affinity for Ag.
ln consideration of these observations, it would be of interest to extend
studies to test the effects of various Ag-stimuli on RAG induction in the GC, in
order to better assess the type of Ag required to achieve this effect. It is also of
interest to sumise whether soluble antibody yields a different effect in RAG
expression, as compared to bound antibody resembling the Ag/Ab complexes
presented on FDCs. Results from proposed studies such as these, may help us
to better understand the signals necessary to control the regulation of RAG
expression in the periphery, as well as the origin of such signals. Moreover,
such data may elucidate whether a threshold effect, as observed in T cells, has
a role in RAG induction and regulation at this peripheral site.
Furthemore, studies should be perfomied to clarify whether a single
stimuius, such as Ag alone, is enough to induce RAG expression, or whether a
fourth wave of RAG expression is the result of multiple stimuli. Cytokines such
as IL-4 and IL-7 have already been shown to be a required pre-requisite for
RAG expression in murine mature 8 cell studies. In contrast, human data to
date, indicates that the addition of IL-2, 11-4, or IL40 has no effect on RAG
expression in mature GC 6 cells CO-cultured with anti-CD40 ligand (95).
l ndicating that different cytokines, or even distinct pathways are required for
RAG reactivation. Cell-to-cell signaling between light zone 6 cells and T
lymphocytes is another proposed mechanisrn of M G regulation in GC (103).
which has yet to be explored.
RAG regulation, in al1 probabiiity, requires multiple signals and may be
regulated at more than just the transcriptional level. Although several
transcription factors have recently been implicated in the transcriptional controi
of the RAG genes and include C/Ebp and Ets ( 1 14). Future work shoutd also
address translational and post-translational regulation of peripheral RAG
expression. Perhaps by first defining the factors involved in providing the tissue
specificity of RAG expression, the factors involved in regulating this expression
will become evident.
References
1. McBlane, J. F., D. C. van Gent, O. A. Ramsden, C. Romeo, C. A. Cuomo, M. Gellert, and M. A. Oettinger. 1995. Cleavage at a V(D)J recombination signal requires only RAG-1 and RAG-2 proteins and occurs in two steps. Cell83:387.
2. Ramsden, O. A., T. T. Paull, and M. Gellert. 1997. Cell-free V(D)J recombination. Nature 388:488.
3. Turka, L. A., D. G. Schatz, M. A. Oettinger, J. J. M. Chun, C. Gorka, K. Lee, W. T. McConack, and C. B. Thompson. 1991. Thymocyte expression of RAG-1 and RAG-2: Termination by T cell receptor cross-linking. Science 253.778.
4. Grawunder, U., T. M. Leu, O. Schatz, A. Werner, A. G. Rolink, F. Melchers, and T. H. Winkler. 1995. Downregulation of expression of Rag-1 and Rag-2 in preB cells aeer functional immunoglobulin p-heavy chain rearrangernent. lmmunity 3:6O 1.
5. Wilson, A., W. Held, and H. R. MacDonald. 1994. Two waves of recombinase gene expression in developing thymocytes. J. Exp. Med. 1 79: 1355.
6. Ma, A., P. Fischer, R. Dildrop, E. Oltz, G. Rathbum, P. Achacoso, A. Stall, and F. W. Alt. 1992. Surface IgM rnediated regulation of RAG gene expression in Ep-N-myc 6 cell lines. EMBO J. 11:2727.
7. Stiernholm, B. J. N., and N. L. Berinstein. 1993. Upregulated RAG expression in slg- variants of a human mature 6 cell line undergoing secondary Igh rearrangements in cell culture. Eur. J. Immunol. 23:1501.
8. Verkoczy, L. K., N. B. J. Stiernholm, and N. L. Berinstein. 1995. Up- regulation of recombination activating gene expression by signal transduction through the slg receptor. J. Immunol. 1545136.
9. Tonegawa, S. 1 983. Somatic generation of antibody diversity. Nature 302:575.
10. Sakano, H.. K. Huppi, G. Heinrich, and S. Tonegawa. 1979. Sequences at the somatic recombination sites of immunoglobulin light chah genes. Nature 280:288.
11. Hesse, J., M. R. Lieber, M. Gellert, and K. Mizuuchi. 1987. Extra- chromosomal DNA substrates in pre-6 cells undergoe inversion or deletion at immunoglobulin V-D-J joining signals. Ce11 49775.
12. Akira, S., Okazaki, K. and Sakano, H. 1987. Two pairs of recombination signals are sufficient to cause immunoglobulin V(D)J joining. Science 238: 1 134.
13. Sakano, H., R. Maki, Y. Kurosawa, W. Roeder, and S. Tonegawa. 1980. Two types of somatic recombination are necessary for the generation of complete immunoglobulin heavy chain genes. Nature 286:676.
14. van Gent, D. C., D. A. Ramsden, and M. Gellert. 1996. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination. Ce11 85: 107.
15. Oettinger, M., D. Schatz, C. Gorka, and 0. Baltimore. 1990. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 248: 15 1 7.
16. Schatz, D., M. Oettinger, and M. Schlissel. 1992. V(D)J recombination: molecular biology and regulation. Annu. Rev.lmmunol. 1 Or359.
17. Roth, D. B., J. P. Menetski, P. B. Nakajirna, M. J. Bosma, and M. Gellert. 1992. V(D)J recombination: broken DNA molecules with covalently sealed (hairpin) coding ends in scid mouse thyrnocytes. Ce11 70:983.
18. Roth, D. B., P. B. Nakajima, J. P. Menetski, M. J. Bosma, and M. Gellert. 1992. V(D)J recombination in mouse thymocytes: double-strand breaks near T cell receptor 6 rearrangement signals. Ce11 69:4 1.
19. Schlissel, M., A. Constantinescu, T. Morrow, M. Baxter, and A. Peng. 1993. Double-strand signal sequence breaks in V(D)J recombination are blunt 5'-phosphorylated, RAG-dependent, and cell cycle regulated. Gen. Devel. 7:2520.
20. van Gent, D. C., J. F. McBlane, D. A. Ramsden, M. J. Sadofsky, J. E. Hesse, and M. Gellert. 1995. initiation of V(D)J recombination in a cell-free system. Ce11 81:925.
21. Schatz, D., M. Oettinger, and D. Baltimore. 1989. The V(D)J recombination activating gene (RAG-1). Ce11 59: 1035.
22. Mombaeits, P., J. lacomini, R. Johnson, K. Hemp, S. Tonegawa, and V. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Ce11 68:869.
23. Shinkai, Y., G. Rathbun, K. Lam, E. Ob, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. Stall, and F. Alt. 1992. RAG-2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Ce11 68.855.
24. Chen, Y. Y., L. C. Wang, M. S. Huang, and N. Rosenberg. 1994. An active v-ab1 protein tyrosine kinase blocks immunoglobuiin light-chain gene rearrangement. Gen. Develop. 8:688.
25. Ramsden, D. A., and M. Gellert. 1995. Formation and resolution of double-strand break intenediates in V(D)J rearrangement. Genes Devel. 9:24 09.
26. Zhu, C., and D. B. Roth. 1995. Characterization of coding ends in thymocytes of scid rnice: implications for the mechanism of V(D)J recornbination. Ce11 2: 101.
27. Lewis, S. M. 1994. The mechanisms of V(D)J joining: lessons from molecular, immunological, and comparative analysis. Adv. Immunol. 56:27.
28. Hiom, K. and M. Gellert. 1998. Assembly of a 12/23 Paired Signal Complex: A Critical Point in V(D) J Recombination. Molecuiar Cell 1: 101 1.
29. Eastman, Q. M., T. M. Leu, and D. G. Schatz. 1996. Initiation of V(D)J recombination in vitro obeying the 12/23 rule. Nature 380:85.
30. Kim. D. R., and M. A. Oettinger. 1998. Functional analysis of coordinated cleavage in V(D)J recombination [In Process Citation]. Mol Ce11 Bi01 18:4679.
31 . Craig, N. L. 1 996. V(D)J recombination and transposition:closer than expected. Science 277:1512.
32. Agrawal, A., and D. G. Schatz. 1997. RAG1 and RAG2 fom a stable postcleavage synaptic complex with DNA containing signal ends in V(D)J recombination. Ce11 89:43.
33. Spanopoulou, E., F. Zaitseva, F. H. Wang, S. Santagata, D. Baltimore, and G. Panayotou. 1996. The homeodomain region of RAG-1 Reveals the parallel mechanisms of bacterial and V(D)J recombination. Cell87:263.
34. Blunt, T., N. J. Finnie, G. E. Taccioli, G. C. M. Smith, J. Demengeot, T. M. Gottlieb, R. Mizuta, A. J. Varghese, F- W. Ait, P. A. Jeggo, and S. P. Jackson. 1995. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80:813.
35. Gottlieb, T. M., and S. P. Jackson. 1993. The DNA-dependent protein kinase: requirement for DNA ends and association with Ku antigen. Cefl 72:131.
36. Zhu Cl B. M., Lim DS, Hasty P and 0. Roth. 1996. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intemediates. Ce11 86:379.
37. Danska, J., D. Holland, S. Mariathasan, K. Williams and C. J. Guidos. 1 996. Biochemîcal and genetic defects in the DNA-dependent protein kinase in murine scid lymphocytes. Mol Cell Bio 16.5507.
38. Ramsden, D. A., van Gent, and M. Gellert. 1997. Specificity in V(D)J recombination: new lessons from biochemistry and genetics. Curr. Opin. Immunol. 9: 1 14.
39. Grawunder, U., M. Wilm, X. Wu, P. Kulesza, T. E. Wilson, M. Mann, and M. R. Lieber. 1997. Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature 388:492.
40. Ichihara, Y., M. Hirai, and Y. Kurosawa. 1992. Sequence and chromosome assignment to 1 1 p l 3-pl 2 of human RAG genes. lmmunol Lett 33:Z 77.
41. Carlson, L., M. Oettinger, D. Schatz, E. Masteller, E. Hurley, W. McComack, D. Baltimore, and C. Thompson. 1991. Selective expression of RAG-2 in chicken 6 cells undergoing immunoglobulin gene conversion. Ce11 64:ZO 1.
42. Fuschiotti, P., N. Harindranath, R S. Mage, W. T. McCorrnack. P. Dhanarajan, and K. H. Roux. 1993. Recombination activating genes-1 and -2 of the rabbit: cloning and characteriration of gemline expressed genes. Mol. lmmunol. 30: 102 1.
43. Greenhalgh, P., and C. E. M. Olesen. 1993. Characterization and expression of recombination activating genes (RAG-1 and RAGP) in Xenopus la e vis. J. lmmunol. 15 1 :3 1 00.
44. Zamn, A. A.. 1. Fong, L. Malkin, P. A. Manden, and N. L. Berinstein. 1997. Cloning and characterization of the human recombination activating gene 1 (RAG I ) and RAG2 promoter regions. J. Immunol. 1 W438Z.
45. Roth, D.B. and N. L. Craig. 1998. V(D)J Recornbination: A Transposase Goes to work. Ce11 94:411.
46. Hiom, K., M. Melek and M. Geller?. 1998. DNA Transposition by the RAG 1 and RAG2 Proteins: A Possible Source of Oncogenic Translocations. Ce11 94:463.
47. Agrawal A., Q. M., Eastman and 0. Schatz. t 998. Transposition mediated by RAG 1 and RAG 2 and its implications for the evolution of the immune system. Nature 394:744.
48. Yancopoulos, G., T. Blackwell, H. Suh, L. Hood, and F. Alt. 1986. lntroduced T cell receptor variable region gene segments recombine in pre-B cells: evidence that B and T cells use a common recombinase. CeIl #:Z5l.
49. Yancopoulos. G. D.. and F. W. Ait. 1986. Regulation of the assembly and expression of the variable region genes. Annu Rev Immun01 4:339.
50. Chun. J.D. Schatz, M. Oettinger, R. Jaenisch, and D. Baltimore. 1991. The recombination activating gene-1 (RAG-1) transcript is present in the murine central nentous system. Cell64: 189.
51. Melchers, F. 1979. Three Waves of Lymphocyte Developrnent during ernbryonic development in the mouse. INSERM Symp. 10:281.
52. Rolink, A., and F. Melchers. 1991. Molecular and cellular origins of B lymphocyte diversity. CeIl 66: 1087.
53. Nemazee D., and K. Bijrki. 1989. Clonal Deletion of 6 Lymphocytes in a Transgenic mouse bearing anti-MHC classl antibody genes. Nature 337.562-
54. Goodnow C.. H. Jorgensen, R.A Brink and A. Basten. 1989. Induction of Self-tolerence in mature peripheral B Lymphocytes. Nature 342:385.
55. MacLennan I., K. Toellner, M. Casamayor-Palleja, E. Chan, D. Sze, S. Luther and H. A. Orbea. 1997. The Changing preference of T and B cells for partners as T-dependent antibody and responses develop. lmmunological Revie ws l56:S3.
56. Bumet, F. M. 1959. The Clonal Selection Theory of Aquired Imrnunity. The University Press, Cambridge.
57. Reth. M. 1 992. Antigen receptors on B lymphocytes. Annu. Rev. Immunol. 1 O:9 7.
58. Melchers. F., A. Rolink, U. Grawunder, T. H. Winkler, H. Karasuyama, and J. Andersson. 1995. Positive and negative selection events during 6 lyrnphopoiesis. Curr. Opin. lmmunol. 7:214.
59. Sakaguchi, N., and F. Melchers. 1986. Lambda 5, a new light-chain- related locus selectively expressed in pre- B lymphocytes. Nature 324r579.
60. Kudo, A., and F. Melchers. 1987. A second gene. VpreB in the lambda 5 locus of the mouse, which appears to be selectively expressed in pre-B lymphocytes. Emba J 6:2267.
61. Bauer, S.. R. Kudo and F. Melchers. 1988. Structure and pre-6 lymphocyte -restricted expression of the VpreB gene in Humans ans consewation of its structure in other rnammalian species. EMBO J. 7:l II.
62. Melchers, F., D. Haasner, U. Grawunder, C. Kalberer, H. Karasuyama, T. Winkler, and A. G. Rolink. 1994. Roles of IgH and L chains and of surrogate H and L chains in the development of cells of the B lymphocyte Iineage. Annu. Rev. Immunol. lZ:ZO9.
63. Desiderio, S. 1994. The B cell antigen receptor in 6-cell development. Curr. Opin. Irnmunol. 6:248.
64. Hagman, Je, and R. Grosschedl. 1994. Regulation of gene expression at early stages of B-cell differentiation. Curr. Opin. lmmunol. 6:222.
65. Aitl F. W., G. Rathbun, E. O b , G. Taccioli, and Y. Shinkai. 1992. Function and control of recornbination-activating gene activity. Ann. N Y Acad. Sei. 652:Z 77.
66. Yoncopoulos, G. D., T. K. Blackwell, H. Suh, L. Hood, and F. W. Alt. 1986. lntroduced Tte l l receptor variable region gene segments recombine in pre-6 cells: Evidence that 6 and T cells use a common recombinase. Cell44:251.
67. Brandle, D., C. Muller, T. Rulicke, H. Hengartener, and H. Pircher. 1992. Engagement of the T-cell receptor during positive selection in the thymus down- reg ulates RAG- 1 expression. Proc. Natl. Acad. Sci. USA 89:9529.
68. Tiegs, S. L., O. M. Russell, and D. Nemazee. 1993. Receptor Editing in Self-reactive Bone Marrow B Cells. J. Exp. Med. 177:1009.
69. Gay, D., T. Saunders, S. Camper, and M. Weigert. 1993. Receptor Editing: An Approach by Autoreactive B Cells to Escape Tolerance. J. Exp. Med. 1 77:999.
70. Mombaerts, P., A. R. Clarke, M. A. Rudnicki, J. lacomini, S. Itohara, J. J. LaFaille, L. Wang, Y. Ichikawa, R. Jaenisch, M. L. Hooper, and S. Tonegawa. 1992. Mutations in T-cell antigen receptor genes a and P block thmocyte development at different stages. Nature 360:225.
71. Shinkai, Y., S. Koyasu, K. Nakayama, K. M. Murphy, D. Y. Loh. E. L. Reinhertz, and F. W. Alt. 1993. Restoration of T cell development in RAG-2- deficient mice by functional TCR transgenes. Science 259:822.
72. Spanopoulou, E., C. A. J. Roman, L. M. Corcoran, M. S. Schlissel, D. P. Silver, D. Nemazee, M. C. Nussenzweig, S. A. Shinton, R. R. Hardy, and D. Baltimore. 1 994. Functional immunoglobuiin transgenes guide ordered B-cell differentiation in RAG-1 deficient mice. Gen. Develop. 8: 1030.
73. Nemazee, 0. and K. Burki. 1989. Clonal Deletion of autoreactive B lymphocytes in bone manow chimeras. Proc-NatLAcad. Sci üSA 86:8039.
74. Hartley, S. B., J. Crosbie, R. Brink, A B . Kantor, A. Basren, and C.C. Goodnow. 1991. Elimination from peripheral lymphoid tissues of self-reactive B- lymphocytes recognizing membrane-bound antigens. Nature 353:765.
75. Ghia P., G. A., Signer E., Winkier T., Melchers F. and A. G. Rolink. 1995. Immature B Cells from Human and mouse bone marrow can change their surface Iight chain expression. Eur. J. lmmunol25:3 108.
76. Prak, E. L., M. Trounstine, D. Huszar, and M. Weigert. 1994. Light chain editing in K-deficient animals: a potential mechanism of B cell tolerance. J. Exp. Med. 180: 1805.
77. Chen, C., Z Nagy, E. L. Prak, and M. Weigert. 1995. lmmunoglobulin heavy chah replacement: a mechanism of receptor editing. Immunity 3:747.
78. Chen C., N. 2.. Radic M., Hardy R., Huszar D., Camper S. and M. Weigert. 1995. The Site and Stage of anti-DNA B cell deletion. Nature 373:252.
79. Nemazee, O. 1996. Can receptor editing play an important role in normal 6-cell development ? J. Autolmmun. 9:259.
80. Hertz, M., and D. Nernazee. 1997. BCR ligation induces receptor editing in IgM+lgD- bone marrow 6 cells in vitro. lmmunify 6:429.
81. Hertz, M., V. Kouskoff, T. Nakamura and D. Nemazee. 1998. V(D)J recombinase induction in splenic 8 lymphocytes is inhibited by antigen-receptor signalling. Nature 394:292.
82. Verkoczy, L. K. 1995. Regulation studies of the human recombination activating genes (RAG-1 and RAG-2). In Immunology. University of Toronto, Toronto, p. 95.
83. Nakayama, K., 1. Negishi, K. Kuida, Y. Shinkai, M.C. Louie, L.E. Fields, P.J. Lucas, V. Stewart, F.W. Alt. 1993. Disappearance of the lymphoid system in Bcl-2 homozygous mutant chimeric mice. Science 5128:1584.
84. Lang, J., B. Arnold, G. Hamrnerling, A. Harris, S. Korsmeyer, D. Russell, A. Strasser and D. Nemazee. 1997. Enforced Bci-2 Expression Inhibits Antigen- mediated Clona1 Elimination of Peripheral 6 Cells in an Antigen Dose- dependent Manner and promotes Receptor Editing in Autoreactive, Immature 6 cells. J. Exp. Med 186:1513.
85. Retter, M. and D. Nemazee. 1998. Receptor Editing Occurs Frequently during Normal B cell development. J. Exp. Med 188:1231.
86. Han, S., S. R. Dillon, B. Zheng, M. Shimoda, M. S. Schlissel, and G. Kelsoe. 1997. V(D)J recombinase activity in a subset of germinal center 8 lymphocytes. Science 278:30 1.
87. Zheng, B., S. Han, E. Spanopoulou, and G. Kelsoe. 1998. lmmunoglobulin gene hyperrnutation in germinal centres is independent of the RAG V(D)J recombinase. lmmunological Reviews 162: 133.
88. Berek, C. 1993. Somatic mutation and memory. Curr. Opin. Immunol. 5:Z 18.
89. Tarlinton, D. 1998. Germinal centres:form and function. Current Opinion in lmm unology 1 O:245.
90. MacLennan, 1. 1991. The centre of hypennutation. Nature 354:352.
91. Berek, C., A. Berger, and M. Apel. 1991. Maturation of the immune response in germinal centers. CeIl 67:1121.
92. Han, S., B. Zheng, D. G. Schatz, E. Spanopoulou, and G. Kelsoe. 1996. Neoteny in lymphocytes: RAG-1 and MG-2 expression in germinal centre B ce1 l S. Science 274:2094.
93. Hikida, M., M. Mon, T. Takai, K. Tomochika, K. Hamatani, and H. Ohmori. 1996. Reexpression of RAG-1 and M G - 2 genes in activated mature mouse B ce l l S. Science 274:2092.
94. Giachino, C., E. Padovan and A. Lanzavecchia. 1998. Re-expression of RAG-1 and RAG-2 genes and evidence for Secondary rearrangements in human germinal centre B Lymphocytes. Eur. J. lmmunol28:3506.
95. Meffre, E., F. Papavasiliou, P. Cohen, O. de Bouteiller, D. Bell, H. Karasuyama, C. Schiff, J. Banchereau, Y. Liu and M. Nussenzweig. 1998. Antigen Receptor Engagement Tums off the V(D)J Recombination Machinery in Human Tonsil 6 cells. J. Exp. Med. 188:765.
96. Gillis, J., A. Zarrin, L. Verkoczy, E. lakhnina, 1. Fong, G. Wu and N. Berinstein. 1999. Expression and Recombinase Activity of RAG 1 and Two Splice Variants of RAG 2 in Mature Human Prirnary Tonsilar B Lymphocytes. J. of lrnmunoi. Manuscript under review.
97. Pascual, V., Y. J. Liu, A. Magalski, O. de Bouteiller, J. Banchereau, and D. J. Capra. 1994. Analysis of somatic mutations in five B cell subsets of human tonsil. J. Exp. Med. 180:329.
98. Kelsoe, G. 1997. Life and death in germinal centres. Immunity 4:107.
99. Papavasiliou, F., R. Casellas, H. Sun, X. F. Qin, E. Besmer, R. Pelanda, O. Nemazee, K. Rajewsky, and M. C. Nussenzweig. 1997. V(D)J recombination in mature B cells: a mechanism for altering antibody responses. Science 2 78:298.
100. Tweedale, M. E., B. Lim, N. Jamal, J. Robinson, J. Zalcberg, G. Lockwood, M. Minden, and H. A. Messner. 1987. The presence of clonogeneic cells in high-grade lymphorna: a prognostic factor. Blood 69:7307.
101. Hikida, M., M. Mon', T. Kawabata, T. Takai, and H. Ohmori. 1997. Characterization of B cells expressing recombination activating genes in germinal centers of irnmunized mouse lymph nodes. J. Immunol. 158:2509.
102. Hikida, M., and H. Ohmori. 1998. Rearrangement of lambda light chain genes in mature B cells in vitro and in vivo. Function of reexpressed recombination-activating gene (RAG) products. J Exp Med 187:795.
103. Hikida, M., Y. Nakayama, Y. Yamashita, Y. Kumazawa, S. 1. Nishikawa, and H. Ohmori. 1998. Expression of recombination activating genes in germinal center B cells: involvement of inteileukin 7 (11-7) and the IL-7 receptor. J Exp Med 188:365.
104. Kurioka, H., H. Kishi, H. Isshiki, H. Tagoh, K. Mon, T. Kitagawa, T. Nagata, K. Dohi, and A. Muraguchi. 1996. Isolation and characteriration of a TATA-less promoter for the human RAG-1 gene. Mol. Immunol. 33:1059.
105. Brown, S. T., G. A. Miranda, Z Galic, 1. 2. Hartman, C. J. Lyon, and R. J. Aguilera. 1997. Regulation of the RAG-1 promoter by the NF-Y transcription factor. J. Immunol.:5U71.
106. Neale, G., T. Fitzgerald, and R. Goorha. 1992. Expression of the V(D)J recombinase gene RAG-1 is tightly regulated and involves both transcriptional and post-transcriptional controls. Mal.lmmunol. 29: 1457.
107. Spanopoulou, E-, P. Cortes, C. Shih, C. M. Huang, D. P. Silver, P. Svec, and D. Baltimore. 1995. Localization, Interaction, and RNA binding properties of the V(D)J recombination-activating proteins RAGl and RAG2. lmmunity 3:715.
108. Lin, W. C., and S. Desiderio. 1994. Cell cycle regulation of V(D)J recom bination-activating protein RAG-2. Proc. Natl. Acad. Sci. USA 972733.
109. Li, Z., 0. 1. Dordai, J. Lee, and S. Desiderio. 1996. A conserved degradation signal regulates RAG-2 accumulation during cell division and links V(D)J recornbination to the cell cycle. Immunity 5-575.
11 0. Mueller, P. R. and B. Wold. 1989. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science 246:780.
11 1 . Pennycook, J. L. M. H., A. Marshall and G.E. Wu. 1997. PCR Assays for Endogenous lg Gene Rearrangement. lmmunology Methods ManuaL-239.
1 12. Villa, A., S. Santagata. F. Boui, S. Giliani, A. Frattini, L. Imberti, L. B. Gatta. H. D. Ochs, K. Schwarz, L. D. Notarangelo, P. Veuoni, and E. Spanopoulou. 1 998. Partial V(D)J recombination activity leads to Omenn syndrome. Cell93:885.
11 3. Schwarz, K., G. H. Gauss, L. Ludwig, U. Pannicke, Z Li, D. Lindner, W. Friedrich, R. A. Seger, T. E. Hansen-Hagge, S. Desiderio, M. R. Lieber, and C. R. Bartram. 1996. RAG mutations in human B cell-negative SCID. Science 274:97.
1 1 4. Fong, 1.. Zamn A., and N. Berinstein. 1999. CEBP Contributes to the Regulation of the Human Recombination Activating Gene 2 Promoter. in press.