Expression and Recombinase Activity of RAG 1 and Two Splice Variants of RAG 2 in Mature Human Primary Tonsilar B Lymphocytes

L. Jane Gillis

A thesis submitted with the requirements of the degree of Master of Science Graduate Department of Immunology. in the University of Toronto.

O Copyright by Lisa Jane Gillis, 1999

National Library BS.1 of Canada Bi bliotheque nationale du Canada

Acquisitions and Acquisitions et Bibliographic Services services bibliographiques

395 Wellingîon Street 395. rue Wellington OttawaON K l A û N 4 OttawaON K 1 A M Canada CaMda

The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, dishibute or sell copies of this thesis in microform, paper or electronic formats.

L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la fome de microfiche/film, de reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts f?om it Ni la thèse ni des extraits substantiels may be printed or othenvise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

ABSTRACT

Expression and Recombinasse Activity of RAG 1 and Two Splice Variants of RAG 2 in Mature Hurnan Primaiy Tonsilar 6 Lymphocytes

Degree of Master of Science, 1999. Lisa Jane Gitlis

Graduate Department of Imrnunology, in the University of Toronto.

RAG 1 and RAG 2 are required for the reanangernent of both the

immuno~~lobulin (lg) and T cell receptor genes. Their expression was first thought

only to occur during the immature stages of B and T cell development. Studies in

oui lab using a human mature B ce11 line OC[ LYS and a unique set of its variants

demonstrated variation in expression of both the BCR and the RAG 1 and RAG 2

genes. Evidence employing mouse rnodels dernonstrated an unexpected re-

expression of the RAG genes in mature mouse B cells activated in vitro and in

peripheral lymph node germinal centres of immunized mice, indicating the

potential for further lg gene rearrangements. In this thesis, 1 describe

experiments aimed at establishing whether re-expression of the RAG genes

occurs in humans. A Reverse Transcriptase - Polymerase Chain Reaction (RT-

PCR) assay was developed and optimized to determine expressicn of the RAG

genes in human peripheral lymphoid tissue. I found that RAG 1 transcripts, as

well as transcripts of two RAG 2 splice variants were detectable in human

tonsilar B lymphocytes and are considered to be responsible for the dsDNA

breaks observed in these cells under linker-mediated PCR (LM-PCR) analysis.

ACKNOWLEDGEMENTS:

I am grateful to my supervisor, Dr. Neil Berinstein, for his support and encouragement and to the memben of my supervisory cornmittee, Dr. Gillian Wu and Dr. Susanna Lewis, for their sound scientific criticism and advice. I would also like to thank Laurent Verkoczy and Ali Zarrin, not only for their valuable advice in the laboratory, but also for their ptevious work on the RAG genes, which helped to pave the way for this project. t wish to extend an especially wann thank you to ail of the members of Dr. Berinstein's laboratory for their assistance and friendship. Finally, I dedicate this thesis to my son Alexander, who has been my greatest source of inspiration.

PUBLICATION:

An abridged version of this thesis has been submitted for publication to the Journal of Immunology. The paper is entitled, Expression and Recombinase Activity of RAG -1 and Two Splice Variants of RAG -2 in Mature Human Primary Tonsilar B Lymphocytes by L. Jane Gillis, Ali A. Zarrin, Laurent K. Verkoczy, Gillian Wu and Neil L. Berinstein.

TABLE OF CONTENTS

CHAPTER 1 : INTRODUCïïON

I .I lntroductory overview and rationale

1.2 V(D)3 recombination

1.2.i The cis elements required for V(D)J recombination

1.2.ii The trans elements required for V(D)J recombination

1.2.iia RAG 1 and RAG 2 are necessary for V(D)J Cleavage to Occur

1.2.iib The 12/23 rule

I.2.iic V(D)J Cieavage: A transposable event?

1.2.iid OS8 Repair

1.3 General organization of the RAG locus

1.4 Functional characten'zation of the RAG locus

1.5 RAG expression

1.5.i B cell development

1.5.i The B cell receptor

1.5.iii RAG expression and its role in the regulation of B and T lymphopoiesis

1.5.iv The classic model of RAG expression

1.6 Receptor editing: The "third wave' of RAG expression

1.6.i A model for receptor editing

1 -6.ii Receptor editing vs. deletion

1.6.iii The RS in receptor editing

1.7 Re-expression of RAG 1 and RAG 2 in peripheral lymphoid tissues

1.7.i Peripheral lymphoid organs and the germinal centre reaction

1.7.ii Somatic hypemutation

1.8 RAG expression in mature B cells, the "fourth" wave

1.8.i Re-expression of RAG 1 and RAG 2 and evidence for secondary rearrangements in human GC 6 cells

1.9 The mechanisms of RAG regulation

1.9.i Transcriptional regulation

1.9.ii Post-transcriptional regulation

I.9.iii Post-translational reg ulation

1.1 0 The LM-PCR assay

1.1 0.i LM-PCR demonstrates RAG functionality in the germinal centre

CHAPTER 2: MATERIALS AND METHODS

2.1 Cell lines and culture conditions

2.2 Flow cytometric analysis

2.3 Tonsil tissue manipulation and 6 cell extraction

RNA extraction

Analysis of RAG-1 and M G - 2 splice variant transcripts

DNA extraction and LM-PCR

LM-PCR oligonucleotide sequences

CHAPTER 3: RESULTS

3.1 Sensitivity and specificity of PCR assays for RAG 1 and RAG 2

3.2 PCR assay sensitivity demonstrated in vitro

3.3 PhenotypicanalysisofpurifiedhumanBlymphocytes

3.4 Expression of RAG genes in human tonsil tissue and purifi ed B lymphocyte populations

3.5 Functional evidence of RAG re-expression

CHAPTER 4: DISCUSSION

4.1 Discussion of results

4.2 RAG expression in mature B cells -models and implications for RAG activity

4.3 Implications in disease

4.4 Future studies

References

VI l

LIST OF FlGUFlES

Figure 1 V(D)J Recombination and Coupled Cleavage by RAG

Figure 2 RAG Genomic Organization

Figure 3 The B Cell Receptor

Figure 4 Antigen lndependent and Dependent B Cell Development

and Transcription Factors Essential for Development

Figure 5 Receptor Editing

Figure 6 The Germinal Centre Reaction and a Role for RAG

Figure 7A Assay to Detect RAG -1 and RAG -2 Gene Expression

Figure 78 Sensitivity of RAG -1 PCR Assays

Figure 7C Sensitivity of RAG -2 PCR Assays

Figure 7D RT-PCR - Assay Sensitivity Dernonstrated in Vitro using

a RAGhi Mature B Cell Line

Figure 8 Phenotypic Analysis of Purified Tonsilar Germinal

Centre B Cells

Figure 9A RT-PCR Analysis of Human Whole Tonsil Tissue

amplified with RAG -1 specific primers

Figure 96 RT - PCR Analysis of Human tonsil Tissue

Amptified with RAG -2 Specific Primers

Figure 9C RT-PCR Analysis of Enriched Human tonsilar B

Lymphocytes amplified with RAG -1 and RAG -2

Figure 1 OA Assay to Detect Kappa Locus dsDNA -Breaks

Figure 106 Assay to Detect Lambda Locus dsDNA -Breaks

Figure IOC LM- PCR Analysis of Whole Tonsil and Enriched Human tonsilar 6 Lymphocytes

Figure 11 Receptor Editing vs. Receptor Selection

LIST OF TABLES

Table 1 Phenotypic Screening Demonstrates Specimen

Heterogeneity

Table I I Screen of Human Tonsil Samples for RAG Expression

Table III Summary of Tonsil Samples and their Degree of RAG

Signal

LIST OF ABREVlAlïONS

Ag

BCR

bp

BM

cDNA

DSB

dsDNA

EtBr

FDC

FlTC

GC

1 g

1 L-2

11-3

11-4

I L-6

1 L-7

IL-1 0

American Type Culture Collection

antigen

B cell receptor

base pair

bone marrow

complementary DNA

double strand break repair

double stranded deoxyribonucleic acid

Ethidium Bromide

Follicular Dendritic cell

Fluorescein Isothiocyanate

Germinal centre (s)

lmmunoglobulin

Interleukin -2

Interleukin-3

Interieukin -4

Interleukin-6

Interleukin -7

Interleukin-10

IL-13

INF-y

ITAM

LM-PCR

LPS

PALS

PBS

PCR

PE

pre-BCR

RACE

RAG

RS

RNA

RNAse

RSS

RT

SDS

slg

SSC

Interleukin -1 3

Interferon -gamma

lmmunoreceptor tyrosine-based motif

Linker - Mediated PCR

Lipopolysaccharide

Periarteriolar lymphoid sheath

phosphate-buffered saline

Polymerase Chain Reaction

Phycolerythrin

pre-B cell receptor

Rapid Amplification cDNA ends

Recombinase Activating Gene

Recombination Sequence

ribonucleic acid

ri bonuclease

Recombination Signal Sequence

Reverse Transcriptase

sodium dodecyl sulphate

Surface lmmunoglobulin

sodium chloride/sodium citrate

XII

T. E Tris - EDTA

TdT Terminal deoxynucleotidyl Transferase

Tg Transgen ic

UV ultraviolet

CHAPTER 1: lNTRODUCTlON

1.1 Introductory overview and rationale:

Expression of both RAG 1 and RAG 2 is required for the assembly of the

immunoglobulin (lg) and thymocyte receptors (1, 2) and defines principal

developmental stages of B and T lymphopoiesis (3-5). Expression of a

functional mature lg or T cell receptor was initially thought to preclude further

V(D)J rearrangements by terminating RAG expression. However. our lab and

other groups have encountered 8 cell lines, which CO-express RAG and surface

lg (dg) recepton (6-8). Recent evidence of RAG expression in mature B cells

cornes from both in vitro and in vivo studies in murine model systems. Taken

together, these reports imply that the RAG genes have some until now,

unforeseen function in mature B cells. Therefore, I set out to establish whether

RAG is expressed in human germinal centre (GC) 6 cells. I used human whole

tonsil and extracted tonsilar B cells recovered post tonsillectomy in the study.

Using RT-PCR, the experimental system was optimized to detect RAG 1 and the

two splice variants of RAG 2. To establish whether the expressed RAG genes

were functional in these peripherai lymph tissues, LM-PCR was subsequently

carried out, kindly by the Wu laboratory.

1.2 V(D)J Recombination:

The immLne system is capable of specifically recognizing and

responding to an enormous number of antigens. The generation of antibody

and T cell receptor diversity occurs through a somatic DNA rearrangement

process known as V(D)J recombination. In this process, genes that encode

variable regions are assembled during the early stages of 6 and T lymphocyte

differentiation from germline variable, diversity and joining gene segments. This

recombinatorial process is carried out in the bone marrow, thymus and

secondary lymph organs of adult vertebrates, and aids in the generation of a

continuous new source of differentiating lymphocytes (9).

1.2.i The cis elements required for V(D)J recombination:

The process of V(D)J recombination is a specialized form of site-directed

ds-DNA breakage and repair essential for the physiological developmental

program of lymphocytes. V(D)J recombination occurs early in 6 and T

lymphocyte development and involves unique cis and trans acting elements.

Cis elements mediating the site-specificity of the recombination reaction have

been well characterized and are referred to as Recombination Signal

Sequences (RSS) (9-12). These sequences flank the V, D and J gene coding

segments and consist of a highly conserved palindromic heptarner separated

from an NT -rich nonamer by s spacer length of either 12 or 23 base pair (bp)

(9). A functional recombination event requires efficient recombination between

gene segments- flanked by one 12bp signal and one 23bp signal. This

recombination process restriction is referred to as the 12/23 rule. A precisely

fused heptamer-heptamer signal joint and an imprecise coding joint consisting

of flanking DNA coding regions are the resutting products of recombination

generated by these events (9. 10, 13) ( 14). The RSS is critical for directing the

recombination machinery to the proper site of recombination and regulates

which gene segments may be recombined.

1.2.i The trans elements required for V(D)J recombination:

V(D)J recombination in essence, is the evolutionary combination of two

unrelated systems involved in DNA metabolism. Together, these two

independent mechanisms, that of site-specific, lymphoid restricted

recombination and general ds-DNA repair, provide Ag-specific mammalian

immunity, in addition to the innate immunity common to al1 multi-cellular

organisms. Recombination occurs in two well-defined steps. The initial phase

has now been shown to be carried out by the lymphoid-specific RAG proteins

(1, 15, 16) and involves the introduction of a double-strand break between the

RSS and the flanking coding sequence (17-19). This DNA cleavage phase

occurs in two ordered and sequential steps (1).

In the first step, a nick is introduced at the signakoding border of the

upper 5' strand of DNA. The resulting 3' free hydroxyf group then carries out a

nucleophilic attack at the phosphodiester bond on the antiparallel DNA strand.

The resulting two products of this cleavage reaction consist of a covalently

closed hairpinned coding end and a blunt, 5' phosphorylated signal end. These

intermediate species have been the subject of many in vitro and biochemical

studies (17-19), although they were first detected and characterized in vivo in

the SClD mouse model (1, 17, 20).

l.2.iia RAG 1 and RAG 2 aie necessary for the first step in V(D)J

Cleavage:

It has been shown that RAG 1 and RAG 2 are the only two lyrnphoid-

specific gene products that are necessary and sufficient to confer V(D)J

recombination of reporter substrates in non-lymphoid cells (15, 21). lt has also

been well documented that mice lacking either of the RAG genes do not

rearrange their lg or TCR loci (22, 23).

RAG functionality was partially elucidated through experiments carried

out by van Gent et al., who reproduced the eariiest steps of V(D)J recombination

using a cell free system. V(D)J cleavage products were assayed using nuclear

extracts of a pre-6 cell line (20). lmproved cleavage efficiency was observed

only upon the addition of extracts containing recombinant RAG 1 protein, which

was also capable of restoring cutting activity in inactive RAG 1" extracts. These

observations recealed that the RAG 1 protein was necessary for cleavage to

occur. A direct role for RAG 2 in this reaction was also demonstrated. However,

precise function of these proteins proved difficult to assess, since other cellular

factors were also present in the extracts.

These studies helped to augment results previously obtained by Chen et

al., in which broken ends were shown to be the precursors to signal ends in a

temperature sensitive transfomed pre-6 cell line (24). it also aided to support

work by other groups, who observed that the kinetics of end resolution differed

for the different interrnediates. Coding ends were reasoned to be difficult to

detect in wild type mice, versus SClD mutants, because efficient coding joint

formation was found to occur much faster than signal joint formation. Under

normal physiological circumstances, hairpin coding ends are rapidly opened,

processed and joined, while signal ends are typically ligated together ât a much

slower rate (25, 26).

Not long after, McBlane et al., (1) reported that this same cleavage

reaction could be carried out using only purified RAG 1 and RAG 2 proteins .

This group also demonstrated that these two proteins were the only proteins

required for both recognition and cutting at RSSs and that cleavage actually

occurred in two steps. Using an experimental system employing RAG 1 and

RAG 2 fusion proteins CO-expressed in insect cells (which do not carry out V(D)J

recom bination) and oligonucleotide substrates. this group successfully

demonstrated that together, RAG 1 and RAG 2 initiate V(D)J recombination by

introducing a nick in substrate DNA at the 5' end of the heptamer creating a 3'-

OH group. This group subsequently links covalently to the phosphate group of

the opposite strand in a direct trans-esterification reaction. This reaction creates

a hairpin intermediate at the coding end and a blunt 5'-phosphorylated signal

end. This study was the first to document the requirement for the RSS element,

as interestingly, pre-nicked substrates lacking an RSS were not converted to

hairpin structures, even in the presence ûf both RAG proteins. This indicated

that both proteins and both RSS sequences are required for this site-specific

intramolecular reaction to proceed (1).

1 .Z.iib The 12/23 rule:

The 12/23 rule was first realized as a mechanism of limiting DNA

rearrangement to the appropriate coding segments (V-J or V-D-J) (9). The

12/23 rule imposes the restriction that recombination must take place between

segments flanked by RSSs of different spacer lengths, so that rearrangements

occur only between elements that can potentially create a functional receptor

gene (14, 27, 28). it has been shown however, that this restriction can be

manipulated in vitro. For example, studies carried out by van Gent et al., (1 4)

demonstrated that when Mn2+ is used in conjunction with purified RAG proteins,

hairpin formation proceeds in the presence of only a single RSS, breaking the

12/23 rule. However, only nicking takes place, when the more physiologically

relevant divalent metal ion Mg2+ is used under similar conditions. Two RSS

elernents are required for proper hairpin formation to proceed under Mg2+

conditions, indicating that the 12/23 restriction must be adhered to under these

biological conditions ( 14).

Following these initial experiments, both Schatz's and Gellert's groups

confirmed in vitro, that the initial cleavage reaction was indeed strictly

dependent on the presence of two RSS elernents and adhered to the 12/23 rule

as was known to take place in vivo (14, 29).

Recent work by Kim and Oettinger, using a novel V(D)J cleavage

substrate, has shown that while the RAG proteins alone establish a preference

for the 12/23 rule, a much stricter dependence of cleavage on the 12/23 nile is

enforced in the presence of HMG1 and competitor ds-DNA (30). The authors

suggest that the 12/23 mle can be generalized to a requirement for spacers that

differ frorn each other by a single helical tum and that falhful recreation in vitro

of 12/23 coupled cleavage requires only RAG 1, RAG 2 and HMG 1 (30).

1.2.iic V(D)J Cleavage: A Transposition Event?:

The bioch-emical mechanisms underlying V(D)J recombination and the

role of the RAG genes is very similar to transposable element integration

obsewed in prokaryotes and retrotransposon activity seen in eukaryotes (31)

(32). Not surprisingly, studies have identified a region of RAG 1 that shares

homology to the bacterial Hin recombinase and is essential for RAG 1 binding

to the nonamer of the RSS. However, RAG 2 DNA binding activity has not yet

been detected (33).

More recently, scientists have begun to suggest that the human RAG

genes are a result of one transposable event occurring over 450 million years

ago. As a result of this RAG transposition (perhaps by the interruption of a

membrane -spanning -receptor gene expressed in lymphocytes) the repertoire

of somatic immunoglobulin genes can far exceed the number of lg genes in the

gerrnline. This gives rise to an immune defense system whose repertoire is

capable of responding to a vast number of invading viruses, microorganisms

and other infectious agents.

ViD)J recombination occurs in the absence of additional ATP or other

high energy cofactors, similar to transposition events ( 1). However, V(D)J

cleavage differs from a transposition event, such that the cleavage reaction

must be of an intramolecular nature. whereby nucleophilic attack and a

transesterification reaction occurs and is crucial for the formation of hairpin

intemediates. Transposition reactions in contrast, can involve either a strand

transfer event between different DNA molecules, or locations in the same

molecule.

l.2.iid The Rejoining of Broken Ends Requires ds-DNA Repair and

is the second step in V(D)J Recombination:

Although the various factors involved in V(D)J recornbination and ds-

DN A repair are rapidly being identified and characterized, the interaction

between the RAG synaptic complex and the ds-DNA repair cornplex rernains to

be better understood. A summary of V(D)J recombination is depicted in figure 1.

In contrast to the cleavage reaction, the later stages of V(D)J

recombination are quite non-specific and are carried out by ubiquitous factors

involved in general ds-DNA break repair which occurs in al1 somatic cells. At

this stage, hairpinned coding ends must be opened and the ends processed.

Genetic studies have identified the catalytic domain of DNA-protein

kinase (DNA-PK) and the heterodimeric protein complex Ku (Ku70/Ku86) as

the factors responsible for both general ds-DNA break repair and the resolution

of coding ends in V(D)J recombination (34-36). Cells with the SClD genotype

lack active DNA-PK protein as a result of a carboxy-terminal truncation (37).

Analysis of V(D)J intennediates in SClD mice has shown that these mice are

capable of signal joint formation. However, they resolve hairpinned coding ends

with a very low efficiency at their Ag-receptor loci (17).

Both the Ku70 and Ku86-deficient models have demonstrated that the

Ku70/86 heterodimer is important for the formation of both coding and signal

joints, as mutations in either subunit affect formation of both joints (36). One

function of the Ku subunits is to bind DNA ends or DNA abnonnalities, such as

nicks. Ku is the DNA -binding component of DNA-PK and is thought to activate

the DNA-PK (35).

Signal joints typically have a precise head to head Iinkage at the RSS

(27). However, once opened coding ends may be processed in many ways.

Nucleotides complementary to the end of the coding sequence, known as P

nucleotides, may be either added to the asymmetric coding ends, or deleted by

as yet unidentified nucleases. Furthemore, additional non-tempfated

nucleotides (N nucleotides) may be inserted by Terminal deoxynucleotidyl

transferase (TdT), a lymphoid-specific component which is responsible for

creating much of the junctional diversity crucial in expanding the combinatorial

diversity of Ag-receptor generation (27). Each of these imprecise end

processing mechanisrns confers added specificities to the immune repertoire by

increasing Ag-receptor diversity, rendering a more flexible immune system (27,

38).

V(D)J Recomtination and Coupkd Cieavage by RAG

Step 1 I

cleavage rd

transesterification reaction bindstoRSSakmgwith

+ cieavage complete

V(D)J intemdhtes genented

attacb the phos-ïcr bond on the oppositestrand form'ng the hairpin structure

hairpin formation at coding ends

J 2

Step 2 Ku binds to DNA ends and stimulates ONA-PK and hairpin wening

pairing of signai ends

Iigation by XRCC4:DNA Ggase IV

Signal joint Figure 1:

bluntcut signal ends

4 nuckotide addition by G TdTat codimgends

/ F d n d , ,,of coding en&

I( ligation by XRCC4:ONA i i i N

Coding joint

The likely scenario of the componerits and neps of V@)J recombination: Although combinatorid diversity is achieved using multiple V and J segments, a single V and J are depiaed here for simplicity. Triangles rcpresuit RSS.

Finally, one mernber of the X-ray cross complementation group XRCW, should

be rnentioned. Grawunder et al., demonstrated that DNA ligase IV co-

irnmunoprecipitates with XRCC4. The authors suggest that this interaction

impiicates DNA ligase IV as the marnmalian ligase responsible for the final

Iigation step in V(D)J recombination (39).

1.3 General Organization of the RAG locus:

RAG 1 and RAG 2 genomic organization has been strongly consewed

throughout evolution. The genes have been identified not only in humans (40),

but also in mouse, (15, 2 1) rabbit, (42) and xenopus (43). In mammais the genes

exist closely juxtaposed in a tail to tail orientation (15). Strikingly, they have

been shown to be concordantly and precisely expressed (15). However, each

employs different promoters (44) and is active in developing lymphocytes in the

bone marrow. thymus, and fetal liver. while not in any other cell types (30).

While the overall genomic structure of the RAG locus is highly consewed across

species, variations in the size and sequence of the intergenic regions has been

observed. This would suggest that there has not been a significant evolutionary

pressure to maintain these ragions of the locus and that perhaps regulatory

regions reside elsewhere (16).

Moreover, RAG 1 and RAG 2 share no sequence similarity and therefore

are unlikely to have arisen by gene duplication. It is unusual to find such closely

linked genes present in the mammalian genome possessing related functions,

yet lacking sequence homology ( 15, 16). Along with species consoivation, many

believe that the genes arose as part of a viral or fungal recombination system

which CO-evolved to play its current role in vertebrate V(D)J recombination (15).

Recent reports now provide evidence to support the theory that the RAG genes

are actually the result of a transposable element that integrated into the DNA of

jawed vertebrates many millions of years ago (45-47).

Recent studies performed in our laboratory have led to the detailed

characterization of the genomic organization of the human RAG 1 and RAG 2

locus, including the transcriptional start site and promoter regions (44). Figure 2

summarizes features of the genomic organization of the human RAG locus. The

human RAG 1 locus consists of two exons separated by an intron of 5.2kb. The

RAG 1 coding exon generates a transcript of approximately 6.6kb and the

resulting 119kDa protein is encoded in one large open reading frame contained

within a single exon.

RAG 2 contains three exons and spans approximately 7kb of the

genome. Exons 1A or 1 6 splice into exon 2 (coding exon) of RAG 2, indicating

that two alternative promoten drive transcription of the RAG 2 gene (44). Exon

1A has been shown to be the major start site and is located approximately 3.9kb

upstream of the coding exon. Exon 18 sits approximately 0.7kb upstream of

exon 2 and is the minor start site. The resulting RAG 2 protein is 56 kDa and is

RAG Genomic Organization

Figure 2: Genomic organization of RAG-1 and RAG-2 The RAG genes directly initiate V(D)J recombination of both TCR and lg receptor genes. Highly conserved across jawed vertebrate species, the RAG genes sit closely juxtaposed in a taii -to -tail transcriptional orientation. RAG -1 and RAG-2 are concordantly and precisely expressed in lymphocytes, but not in other cell types.

also encoded in one large open reading frame. Consistent with previous

studies, our lab has found the intergenic region between the two RAG genes to

be approximately 16kb (44).

Yoshikazu lchihara et al. (40) isolated the hurnan RAG 2 gene and

deterrnined its nucleotide sequence. Mapping analysis of RAG 1 and RAG 2

genes on human chromosomes by fluorescence in situ hybridization positioned

the genes on chromosome 1 1 p l 3-p 12 (40).

1.4 Functional Characterization of the RAG Locus

The RAG 1 and RAG 2 genes were fint isolated by Oettinger and Schatz

(21) in an early experiment in which they demonstrated that the introduction of

RAG 1 and RAG 2 activated V(D)J recombinase activity in nonlymphoid cells.

Worù by Oettinger and Yancopoulous further dernonstrated that the RAG genes

are adjacent genes which synergistically activate V(D)J recombination in both B

and T lymphocytes in a developmentally regulated fashion (1 5, 48. 49).

In further studies, Mombaerts (RAG 1) and Shinkai (RAG 2) using knock

out mouse models, demonstrated in vivo that mice deficient in either RAG 1 or

RAG 2 lack mature lymphocytes due to the inability ta initiate V(D)J

recombination. This provided the first in vivo evidence of the RAG gene protein

function (22. 23).

1.5 RAG expression

It has been shown that V(D)J recombination is a thousand fold more

efficient when both RAG 1 and RAG 2 are present and active, than with either

gene atone. Furtherrnore, V(D)J recombination in the complete absence of

either gene has not been demonstrated (16). Surprisingly, instances of

independent RAG expression have been shown. For example, low levels of

RAG 1 transcript have been detected in the fetal and post-natal murine central

nervous system with the transcnpt rnost strongly associated with post mitotic

neurons. However, RAG 2 transcripts were not detectable (50). In contrast, RAG

2 expression in the absence of RAG 1 has been documented to occur in the

chicken bursa of Fabricus. In this instance, RAG expression correlates with the

gene conversion process which bursal B cells undergo in attempts to diversify

both rearranged heavy and Iight lg chains (41). One might suspect that the

genes rnay function independently in other processes such as neural

development and differentiation or Ig-gene conversion (41, 50).

1.5.i B Cell Development :

Expressioii of both RAG 1 and RAG 2 is required for the assembly of the

lg receptor, and defines specific stages of B cell development. Therefore, it is

appropriate to outline the processes of 6 cell development.

The process by which hernatopoietic stem ceils differentiate into mature

B cells involves multiple stages of lineage commitment and differentiation. This

can be defined by the sequential rearrangement of the lg heavy and light chain

loci, as well as with the phenotypic expression of various cell surface molecules

resulting from the expression of lineage and stage specific genes. Expression of

these stage specific genes orders 6 cell development during embryogenesis

(51). Precursors are first detected in placenta and embryonic blood, then in fetal

liver, and finally in the spleen and bone marrow compartrnents (51, 52). B cell

lymphogenesis remains a continual process throughout the life span of an

organisrn. It is estirnated that 5 x 1 O7 6 cell progeniton are generated daily in

the adult mouse and human, with only 2-3 x I O 6 cornpetent to enter the

peripheral pool of mature, Ag-sensitive B cells circulating within the secondary

lymph organs (52).

Traditionally. B cell development has been divided into two phases: an

Ag-independent and Ag-dependent development, as depicted in figure 3. The

first phase occurs in the bone marrow independent of foreign Ag, and is

considered to teninate when slg is expressed after heavy and light chain gene

RAG -/- lkaros -1- E2A 4- pax-5 (BSAP)

RAG - RAG + RAG - RAG + RAG -

RAG - Watum n- 8 d

U n r y - A

R A G 1

Figure 3: Antigen independant and dependant devdoprnent: Vertical lines mark stage of development dimpted by absence or improper expression of critical transcription factors fkaros, E2A and PAX4 (BSAP). RAG nuIl bbck is also depicted for cornparism.

rearrangement has taken place in the immature ceIl. At this stage, cells

possessing receptors specific for self-antigens are either deleted (53) or

anergized (54). During the second phase, slg' B cells are positively selected for

their capacity to recognize foreign Ag while circulating in the periphery. Once a

naive slgM+ 6 lymphocyte reacts with Ag, 1 will enter and colonire a secondary

lymph organ. Colonization results in a specific immune response characterized

by clonal expansion and differentiation into antibody secreting plasma cells and

the formation of immunological memory by the selective expansion of

specialized memory 6 cells (55).

1.5.ii The 6 Cell Receptor:

Bumet's clonal selection theory predicted that cells express their

antibody as a surface receptor, which is selected by the appropriate antigen

(56). Molecular and protein biology have demonstrated that the B cell receptor

(BCR) is a complex of Ag-binding slg with the membrane- spanning, signal-

transducing heterodimer IgdlgB (57). Signal transduction by the BCR is

triggered by receptor cross-linking, and relies upon an immunoreceptor

tyrosine-based activation motif (ITAM) in the cytoplasmic portion of Igdlgp

which transmits signals through the BCR to appropriate intracellular signaling

components (57). Proper B cell responses require both engagement of the BCR

The 0 ail Receptor

Pre 8 ceIl Receptor -

Mature B ce11 Receptor

N-terminus N-t erminus

Figure 4: The pre-8 cell receptor and the mature B cell receptor: The matue immunoglobufin molecule is made up of two identical heavy chains and two identical light chains joined by disulfide bddges which links a light chain to a heavy chah and the two heavy chains together. Each of the heavy and light chains consist of a variable region (V) (depicted in red) and a constant region (C) (depicted in Mue). The variable region contains the amino acids primariiy responsible for antigen recognition and is subject to somatic hypemutation. The constant region is responsible for a variety of effector functions. A light chain can be of either r or A phenotype. The constant heavy chain defines the class of antibody. Constant heavy chain regions can be a or y. Each receptor is a complex containing Ag-binding dg with membrane spanning, signal - transducing associated Iga and 1gf3 heterodimer pmteins, wtiose cytoplasmic tails contain ITAM motifs (Y), which transmits signais fmm the K R to intracellular signalling components. The pre-6 celt receptor is an immature version of the final ex- product. The pre-6 receptor consists of a p heavy dain paired with the v-pre 6 and M conserveci chains. Once a (unknown) signal is received through this earty receptor, the pre-B cell commences light chah gene reamngements.

by Ag paired with an appropriate signal through other cell surface recepton

responsible for regulation.

Early in development, B lymphocytes have not yet generated a mature

BCR, but rather express a pre-BCR (57,58) during the pre-B stage of ontogeny.

The pre-BCR is similar to the BCR, but is cornposed of the lgp heavy chain

associated with the surrogate Iight chains A5 and V-preB (59, 60). The Vpre-8

genetic sequence is highly conserved in mammals (61) with little evolutionary

divergence. The pre-BCR is also made up of the Igdlgf3 signaling sub-units and

signals in a similar manner. Signaling through the pre-BCR is crucial for

continued 8 cell development. Together, the expression of the pre-BCR and the

BCR are considered to mark two checkpoints in 6-cell development (62).

I.5.iii RAG Expression and its Role in the Regulation of 6 and T

Lymphopoiesis:

A key characteristic of lymphocyte development is the somatic assembly

of germline variable (V), diversity (D) and joining (J) gene segments of the T cell

receptor and immunoglobulin gene loci in the generation of a unique receptor

structure on individual developing T and B cells (63). Development of the T and

B cell lineages takes place in separate specialized anatomic cornpartments and

involves genetically distinct pathways (49, 64). Overall, T and B lymphocyte

developmental programs however, share a large degree of similarity. For

instance, antigen receptor gene assembly is carried out in a strict. orderly

fashion in both B and T lineages. These genetic events delineate specific

phenotypic diffetentiation stages and are inliated by a common, lymphoid

specific V(D)J recombinase, which consists of RAG 1 and RAG 2 (15, 65, 66).

1.5.iv The Model of RAG Expression:

The classic model of RAG expression predicts two distinct waves of

concordant and tissue-specific RAG 1 and RAG 2 expression, which temporally

distinguish the two waves of lg and TCR gene rearrangements (5, 16, 67). The

first wave of RAG expression has been shown to coincide with D-J, followed by

V,-DJ, rearrangements in rearranging pro and pre-6 (C045'OCD19+HSA+) cells

in the generation of a BCR heavy chain (4). In T cells the first wave of

expression marks the initial appearance of fully rearranged TCR b, y and 6

genes of CD25+CD4'CD8CD3'T cells (3, 5).

Following these initial reanangements, RAG expression is believed to be

suppressed at the large pre-B cell stage. At this time, the cell is expressing the

membrane bound pre-6 receptor, which consists of rearranged chains in

association with surrogate light chains. Likewise, RAG expression is

downregulated in CD44CD25' double negative thymocytes following B, y or 6

heavy chain expression. It has been postulated that the downregulation of RAG

1 and RAG 2 expression after the completion of a productive rearrangement at

one heavy chah allele. may prevent fuaher heavy chah rearrangements from

occurring on the other available allele. The downregulation of RAG expression

is thought to enforce allelic-exclusion via feedback inhibition (4, 5), while

allowing for further differentiation of IgM+ or TCR P' cells prior to light chain gene

rearrangements.

In the subsequent small pre-B ceIl stage of development, RAG

expression is re-induced along with the disappearance of the pre-6 cell

receptor. This second wave of RAG expression corresponds to V,-J,

rearrangements and the generation of a productive Iight chain, which will pair

with the previously generated heavy chain to fom a complete and functional 6

cell antigen receptor. RAG is then downregulated once again, in the immature B

cell, with expression thought to be completely lost in mature 8 cells (4, 64, 66).

Further light chain rearrangement. is believed to be blocked, by the expression

of membrane slgM, which results from the assembly of heavy and light 1g chain

proteins. However, it has been shown that circular DNAs excised by nested

gene rearrangements frequently contain rearranged VJs that are in frame and

potentially functional, suggesting that light chah gene rearrangement often

continues in IgM' cells (68, 69).

A second wave of RAG expression is also known to occur in T cells

undergoing a Iight chain gene rearrangernents at the double positive stage of

development. At this point, it has been shown that engagement of the newly

formed TCR by self-Ag/MHC ligands tums off RAG expression (3,5).

To date, evidence of V(D)J recombination in the absence of elher RAG 1

or RAG 2 has yet to be demonstrated (15). In fact, studies camed out in

transgenic mice defcient in either RAG 1 or RAG 2 (23, 70) and in reciprocal

transgene complëmentation studies (71, 72) have confinned the requirement for

both genes and their timely expression, in the generation of mature B and T

lymphocytes expressing functional antigen receptors.

1.6 Receptor Editing of Ig Loci: The "third wave" of RAG Expression:

Each B lymphocyte possesses a unique Ag-receptor composed of a

single light chain (LC) paired with a single heavy chain (HC), as a result of

V(D)J rearrangements and the allelic exclusion of other chain alleles. Although

each B cell has the potential to produce two different heavy chains and six

different light chains ( 2 ~ and 4A), generally it does not, because of allelic

exclusion. Allelic exclusion confers a unique and highly specific degree of Ag -

specificity to individual B c e k and is critical for the process of clonal selection

(68). The traditional school of thought perceived that immature lymphocytes,

which have successfully undergone rearrangements and express a functional

Ag-receptor, go forth into the periphery to face three possible fates once

selected by antigen; they may become activated, inactivated (anerg ized or

tolerized) or eliminated (deleted).

In previous years. many had noted a slgM' pool of autoreactive B celle

present in the bone marrow that appeared to be developmentally blocked at the

IgM+/IgD- stage (73, 74). This led many to question how these cells were being

controlled by the immune system, if they are not being deleted. Early studies

can-ied out by Nemazee and Wiegert's groups were the first to address this

question and later dispute the proposed model of clonal selection and RAG

expression in lyrnphopoiesis. These papers will be discussed presently.

Tiegs et al., (68) challenged the paradigm of clonal selection

hypothesizing that a mechanism of "receptor selection' may be possible. They

questioned whether immature B cells could revise their Ag-receptor if

autoreactive, in response to self-Ag. To test this revised hypothesis of tolerance,

the y created mice with transgenic receptors (functional H and L-chains) specific

for self-Ag (anti-H-2-Kkb Ab 3-83). They introduced these 6 cells into non-

deleting (H-2') and centrally deleting (H-2Ku or H-2@) mice and assessed the

number of autoreactive Tg-B cells circulating and in the bone marrow of these

animals. From these studies. they established that slg' autoreactive B cells upon

encountefing self-Ag. may undergo secondary light chain gene

rearrangements. In order to escape deletion or inactivation, these cells may

express endogenously encoded light chain protein, thereby altenng their

specificity (68). In summary, this group observed that the non-deleting mice

were >95% monoclonal for the Tg-8 cells. In contrast, virtually al1 Tg-6 cells

were deleted from the spleen and lymph nodes of centrally deleting mice, but

were still present in the bone marrow. Along with these observations, elevated

levels of M G mRNA in bone manow B cells of centrally deleting mice with Tg-

IgM+ was also evident (similar levels to non-transgenic mice bone marrow 6

cells undergoing rearrangements), in contrast to low levels of RAG expression

in the non-delefing population. An increase in Iight chain rearrangement

excision products, was also observed in these mice by PCR assay, correlating

with an increase in Lchain recombination activity. These expenments sewed to

demonstrate that 6 cells expressing intact IgM' Ag-receptors can express RAG

and undergo further V(D)J recombination. It also appeared that lg receptor

generation could be influenced by 6 ceIl selection by Ag. While reinforcing the

paradigm of clonal selection, these data also introduced the concept of receptor

editing as a mechanisrn for correcting autoreactive receptors and revealed that

B cells are capable of experiencing a "third wave" of RAG expression, in order

to cany out further V-J rearrangements.

In similar expenments. Gay et al. (69) generated transgenic mice bearing

a well characterized anti-double-stranded DNA (ds-DNA) antibody receptor.

capable of binding both ss-DNA and ds-DNA. When analyzed, the B cell lg

receptors in adult mice consisted of the Tg heavy chain, not in association with

the Tg-light chain, but rather with endogenous light chain. Endogenous light

chains however. should have been allelically excluded by the transgene. Both

endogenous and Tg 4ght chain transcripts were detectable, indicating that B

cells which expressed the Tg-autoreactive receptor could further rearrange

endogenous light chain genes to create non-autoreactive receptors via the

process of receptor edling and escape deletion (69).

Further studies camed out by these same groups and othen confined

these conclusions (75-77) and demonstrated that Tg heavy chain genes could

also be eliminated by intrachromosomal recombination, followed by the

rearrangement and expression of endogenous VH genes. Furthemore,

ongoing endogenous K and rare Vh rearrangements could also occur (24.77)-

Although these studies present fim evidence for receptor alteration as

another mechanism of tolerance, especially significant for salvaging

autoreactive B cells. several questions anse which may undermine the concept

itself. For instance, the Tg-constnict used in these expenments may itself hinder

normal allelic exclusion. thereby pemitting ongoing light chain rearrangements.

Although Tg-gene transcription was demonstrated. the Tg-H chain and Tg-L

chain pairing may not be viable and also encourage further reanangements. K

deletion and even RAG induction, may result from Tg-gene interference. Gay et

al. (69) suggest that the absence of an enhancer in the Tg-construct may either

allow endogenous L-chain protein to out compete Tg-L-chain or that perhaps

only endogenous A chains are capable of pairing with Tg-H-chains. explaining

the observed increase in IC excision products and frequent Â. expressing cells

(69) -

In other work, Chen et al., demonstrated that transgene deletion is

another mechanism of receptor editing (77). These studies employed the use of

a Tg-Hthain which was found to be deleted and replaced by an innocuous

endogenous Hthain under the "classical' V(D)J process. Moreover, Chen et al.

(78) in further studies, detailed the site and stage of anti-DNA 6 cell deletion.

This mode1 showed that normal mice expressing the anti-DNA Ab (same as

used in studies carried out by Gay et a1.J 993). deleted their autoreactive 6 cells

in the bone marrow during the pre-8 to immature 8 transitional stage

(B220+/CD43+, just after 19-receptor expression). The introduction of a

rearranged H-chain allowed cell development to proceed to the mature

B220+/C D43' stage, further supporting their findings (78).

Recent work by Nemazee's group, has shown receptor editing to play an

important role in normal 8 cell development and, that BCR Iigation can induce

receptor editing in non-dividing, lgM+/lgD'/B220M bone marrow cells, rather

than celi death (79. 80). BCR cross-linking of 19-Tg bone marrow cultures (with

anti-3-83 mAb) consistently exhibited a 3-3.5-fold increase in RAG 2 mRNA

levers, peaking at 24 hrs, which was not seen with control mAb. The authors

concluded that slg' B cells at this stage were either upregulating RAG

expression, or maintaining RAG 2 expression and initiating secondary L-chain

rearrangements in response to BCR-ligation. These results also indicated that

Tg-K L-chains were replaced by endogenous h Lchains (from 20%-65%).

Interestingly, the authon report that peripheral slg' B cells were unable to

undergo receptor editing when their BCRs were cross-linked with mAb, which

will be discussed in more detail. in the following sections (8 1).

1.6.i A Model tor Receptor Editing:

Based up6n their results, Tiegs et ai., (68) proposed the following model,

as outlined in figure 5. Pre-B cells undergoing K L-chain rearrangements in the

bone marrow teminate further recombination once a functional IgM appears on

the cell surface. However, if this slg can be cross-linked by self-Ag, then RAG

expression is either maintained or upregulated, and accessible L-chain, but not

H-chain reanangements can occur at the K locus. Rearrangements occur until a

non-autoreactive receptor is generated. Cells with activated RS recombination

(deleting C,), will commence h loci reanangements and expression.

Similady, in another model for receptor editing, Herh and Nernazee (80)

suggest that BCR Iigation in the bone marrow could promote receptor editing by

two separate pathways. Pathway #1 includes the existence of pre-B cells which

CO-express slgM and RAG which have been documented (6. 68). BCR ligation

may block these cells at the RAG+ stage, thereby preventing the temination of

V(D)J recombination and allowing secondary rearrangements to occur. The

second pathway involves a selection event whereby, Ag or autoreactivity could

cause the slg4/RAG- cell to upregulate RAG expression and reinitiate L-chain

reanangements (80). Our laboratory has previously demonstrated that slg cross-

linking can upregulate RAG expression in a human mature B cell lyrnphoma,

providing evidence for the latter model (82).

NOK

Figure 5: Model for Receptor Editing: A pre-B cell generates a hinctional lg receptor and expresses IgM on its cell surface. In the absence of stmng Ag crwilinking, the ce!! will mature and migrate to the penphery. However, if strong crosslinking occurs, further light chain reaangement is induced. If the eamngement is successful and alter4 antigenk specificity is conferred and the ai will pmcccd to rnaturity. If specificity is not aitered by the rearrangement, the cell will be eliminated via awptosis.

Essentially, Hertz and Nemazee argue that receptor editing, rather than

cell death, may be the mechanism dictating tolerance in bone marrow B celis. In

a 1996 report, Nemazee, through theoretical rnodeling, predicted the number of

B cells undergoing receptor editing as a means of tolerance to be significant

(79). In a more recent report, the authon strongly assert that "receptor selection'

(based upon receptor editing). rather than 'clonal selection' K the major

mechanism of B celt immune tolerance (80).

1.6.ii Receptor Editing vs. Deletion:

Many studies have implicated apoptosis as an important tolerance

mechanism. By inducing the deletion of autoreactive or cells detnmental to the

organism, apoptosis aids in regulating the immune system. In opposition. Bcl-2

promotes ce11 survival. Previous studies have shown that Bcl-2 deficient mice

manifest a severe loss of mature lymphocytes (83).

In further experiments, again taking advantage of the mono-clonal anti 3-

83 centrally deleting mice, Lang et al., (84) set out to examine whether the over-

expression of Bcl-2 would confer a protective effect over immature, autoreactive

bone marrow-derived lymphocytes. In generating the 3-83pWBcl-2 Tg rnouse

which over-expresses Bcl-2, this group demonstrated that deletion by apoptosis

is significant in peripheral 6 cell tolerance. Through demonstrating an increase

in receptor editing in immature B lymphocytes and a complete block of clona1

elimination in penpheral compartments, they concluded that enforced Bcl-2

expression promotes receptor editing in immature B cells. This extended the

lifespan of these cells. thereby allowing h rearrangements to occur, which

otherwise would not. These observations suggest that apoptosis depends on

the Ag-stimulus and the B cell stage of development (84).

1.6.iii The RS Sequence in Receptor Editing:

In their most recent work, Retter and Nemazee (85), atternpt to determine

the extent of receptor editing in a normal, non-1g transgenic immune system.

For this undertaking, they analyzed the K loci in IgMh' 6 cells to determine how

frequently in-frame K genes fail to suppress ic gene rearrangements. By

isolating VKJK joins from lgA+ cells, they analyzed recombined VKJK genes

inactivated by subsequent recombining sequence (RS) rearrangements for

functional, in-frame rearrangements. The RS is of interest because of its ability

to delete a portion of the K locus by a V(D)J recombinase (RAG)-dependent

rnechanism, which implicates this specific and cryptic sequence in receptor

editing. The authon' finding that -47% of V J K joins were in-frame, led hem to

strongly suggest that receptor editing occurs at a high frequency in normal 6

cells. They also conclude that the RS (referred to as the K deleting elernent in

humans) plays an important physiological role in normal 6 cell development to

inactivate, or silence rearrangod u genes, as yet another mechanism of

tolerance (85). -

1.7 Re-expression of RAG 1 and RAG 2 in Peripheral Lymphoid

1 issues:

Recently, there has appeared a plethora of data demonstrating RAG

expression in mature murine and human B cells, which will be discussed in

detail in the section to follow. However, secondary lymph sites where this

"fourth" wave of expression occurs will first be outlined.

1.7.i Peripheral Lymphoid Organs and the Germinal Centre

Reaction:

Germinal centres form in the 6 cell follicles of secondary lymphoid tissue

during T cell-dependent immune responses. and are crucial for the

development of memory B cells (86, 87). OC formation occurs approxirnately 4-5

days post-imrnunization in a primary response and tends to wane after about

three weeks (55, 88, 89). At the macroscopic level, the secondary lymphoid

organ (spleen, tonsil, lymph node or peyer's patch) can be divided into red and

white pulps, separating the erythroid and lymphoid compartments of these

organs. In the spleen, the white pulp can be further divided into three sub-

compartments; the marginal zone, the periarteriolar lymphoid sheath (PALS)

and the follicles.Following immunization, circulating T and B celk are recruited

to secondary lymph tissues. The lymphocytes enter via the marginal zone and

continue on to the PALS where specialized interdigitating dendritic cells

present the foreign antigen to the lymphocytes. With T cell help, activated

antigen-specific B cells undergo a proliferative burst, leave the T cell rich PALS,

and either differentiate into antibody-forming cells or migrate, along with

selected CD4' T cells. to the follicle area. In the absence of antigenic

stimulation. both B and T cells re-enter the circulation through the marginal

sinus (55, 90).

The follicle is the B cell area of the white pulp where follicular dendritic

cells (FDCs) capture and present antigen and specifically act as antigen depots

which aid in sustaining the immune reaction (88. 89, 91). Newly arriving B

lymphocytes rapidly proliferate, serving to fom a follicle, while undergoing

radical phenotypic changes. For instance, murine GC B cells have been shown

to express the activation marker GI-7 (a GC marker), the pre-B A5 and bind

peanut agglutinin (PNA) (92, 93). Both mouse and human GC B cells have

been shown to re-express RAG 1 and RAG 2 (92-96). This step of the reaction

compresses surrounding follicular cells, forming the follicular mantle zone,

which encompasses the nascent GC and is comprised of naïve B cells.

Subsequently, the GC polarizes to form a dark zone (DZ) which contains rapidly

Germinal Cenm Reaction and a Rob for RAG

RAG - KL-2 10 zone lgD+

RAG - BCL-2 hi CD38+ 100- CO1 9+

Figure 6: The germinal centre reaction: The thme anatomical divisions; the follicular mantle, the dark zone, the Iight zone and the path of cell migration are depicted. Following immunization, circulating T and B lymphocytes are recruited to secondary lymph tissue where they encounter antigen expresseci on professional antigen-presenting œlls. Appropriate B lymphocytes become activated in response to the antigen and undergo a proliferative burst, followed by a round of somatic hypermutation. Re-expressing a mutated lg receptor, the œlls progress to the light zone checkpoint where their affinity for the imrnunizing antigen is sampled. Cells with adeqwte aff inity for Ag s u ~ ' v e and differentiate into effector or memory cells with further T cell help. Those with decreased affinity or incompetent receptors die in the light zone via apoptosis. Recent reports and data presented in this thesis predict yet another possibility, that B œlls acquiring mutations which reduce aff inity, or generate incornpetent receptors, may prompt further light chain gene rearrangements with the re-expression of RAG, in a physiologically frugal attempt to spare the ceIl.

dividing slg negative cells called centroblasts and a light zone (LZ) that consists

of nondividing slg+ centrocytes, as well as, FDCs and the majority of T helper

cells (55, 88). -

The basic function of the GC is to improve B lymphocyte affinity for the

immunizing antigen and generate a clonal population of effector cells and

mernory cells, with the capacity to guard the organism from ham. This result is

achieved through the positive selection of 6 lymphocyte variants, which have

through the process of somatic hypemutation, gained improved affinity for the

Ag and negative sefection of those cells with unchanged or lost affinity. The

nascent GC is oligoclonal, while the mature GC is derived from just 1-3 B cell

clones. As the GC reaction progresses, clonal divenity is reduced and the

frequency of point mutations increased in an act of active clonal evolution in situ

(55, 90, 97).

1.7.ii Somatic Hypermutation:

Somatic hypemutation is a 6 cell specific mechanism responsible for

introducing point mutations into rearranged Ig variable region genes. Somatic

hypemutation of lg variable region genes is carried out in the dark zone

centroblast population, which is thought to divicle every 6-7 hr (88).

In an elegant study, Pascual et al., 1994, using several different

monoclonal antibodies, described the phenotypic characterization of fwe B cell

subsets (Bml -Bm5) in human tonsil, representing different stages of B cell

maturation and differentiation. Cells were initially sorted using two colour FACS

for IgD and CD38 populations. IgD' cells (which are also lgM+) were further

sorted into CD23' and CD23- subfractions (Bml and Bm2 respectively).

CD38+lIgD- cells were further sorted and separated into GC centroblast and

centrocyte subfractions using CD77 mAb. The CD38+/lgD-/CDï7* subfraction

(Bm3) represents the cycling da& zone centroblasts undergoing somatic

hypermutation. CD38+/lgD~ICD77 (Bm4) cells comprise the light zone

centrocyte population, which has stopped cycling and will re-encounter Ab-Ag

complexes on FDC. Finally, the remaining lgD'lCD38- subfraction (Bm5)

represents the memory population. Hence, this group detailed B cell migration

from the naive IgD' state, through the CD38' GC stage to the memory IgD-

/CD38- B cell.

Furthenore, analysis by this group of lg heavy chain variable region

gene transcripts from these subfractions clearly demonstrated that somatic

mutation correlates with the phenotypic characteristics of the GC centroblast

population (slgD', CD38+, CD77'). Moreover, this study showed that the

pathway of B cell differentiation from virgin B cell through the GC and to the

mernory cornpartment can be traced with phenotypic markers (88).

Using this same subfraction scheme, recent studies carried out in human

GC 6 cells has shown that RAG is expressed at levels comparable to bone

marrow B cells, in the Bm4 lgDœ/CD38+/CD77- centrocytes, but not in any of the

other subfractions (95). Figure 6 outlines RAG expression in the human GC.

Work by Zheng et al., 1998, using mice with a transgenic K-light chain in -

a RAG 1" genetic background demonstrates indirectly that somatic mutation

occurs in the DZ centroblast compaiùnent and that lg gene hypermutation in the

GC is independent of the RAG 1 V(D)J recombinase, as these mice acquired a

number of mutations in the absence of RAG 1 protein product. These

observations also suggest that further rearrangements obseived in GC were the

product of V(D)J recombination and not hyperrnutation (87).

Following a round of mutation, centroblasts exit the DZ and migrate to the

L i , where they subsequently re-express slg. At this checkpoint. cells are tested

for their ability to bind antigen presented on FOCS. Cells with adequate affinity

for Ag survive and differentiate into effector cells or memory cells, with further T

cell help, while those which have lost affinity undergo apoptosis (55, 90, 98). A

third option proposed by two groups; Papavasiliou and colleges and Han et al.,

1997 predicts that B cells acquiring a mutation which reduces Ag affin*, or

renders the Ag wreceptor incompetent, re-express RAG in an atternpt to Save

themselves (86, 99). Eventually, the GC reaction terminates, however the

signals controlling this have yet to be elucidated.

1.8 RAG Expression in mature 6 cells, the " Fourth" Wave:

Expressioh of a functional mature lg or T cell receptor was initially

thought to preclude further V(D)J rearrangements by teminating RAG

expression. However, Our lab and other groups have identified and

characterized mature B cell lines which CO-express RAG and slg receptors (6, 7,

100).

By Noithem analysis, Ma et al., (6) identified and characterized six

separate slg' 8 cell tumour lines established from Ep-N-myc transgenic mice

which expressed significant levels of RAG 1 and RAG 2. RAG mRNA expression

was found to be substantially reduced (>IO fold) when the cells were treated

with an anti-p antibody, demonstrating that cross-linking of slg molecules on

these mature B cells resulted in a specific, yet revenible down-regulation of

RAG expression levels. Vsing a recombination construct to assay for V(D)J

recombinase activity, the authors were able to correlate this unexpected RAG

expression with continued V(D)J recombinase activity. This group also showed

via in situ hybridization analyses, that 3.5-5% of slgM' B cells sorted from bone

marrow expressed RAG 1 in the absence of tumor formation or rnyc transgenes.

Based on these findings, the authors concluded that this seemingly novel RAG

expression might reflect a normal, previously uncharacterized stage of 6 cell

development.

Conversely, work previously camed out in our lab has provided evidence

that some mature slg' human 6 cell lines can actually be induced to upregulate

RAG expression by either slg cross-linking or PMA and ionomycin stimulation

(7) (8). To elucidate whether a signal transduced through the lymphocyte Ag

receptor regulated RAG gene expression Verkoczy et al., 1995, used a unique

set of cell variants isolated from a patient with a B lymphoid large cell lymphoma

(100). These variants differed in their expression of slg, RAG 1 and RAG 2

genes. Cross-linking analyses of these variants resulted in a reversible

increase in RAG expression, accompanied by an increase in transcription and

transcnpt stabilization (8).

Furthermore, studies carried out by Hertz and Nernazee have also

demonstrated that BCR ligation stimulated RAG 2 expression leading to further

lg rearrangements in IgM+/lgD- bone marrow B cells in vitro, measured by light

chain gene rearrangernents (K to h editing) in both transgenic and non-

transgenic B cells (80). A 3-3.5 fold increase in RAG 2 mRNA levels was

consistently seen, accompanied by the expression of A-light chain protein in

cells w h ich had previously expressed K protein, providing further evidence that

B cell Ag-receptor ligation can stimulate furthei RAG induced rearrangements.

More recent evidence of RAG expression in mature 6 cells cornes from

both in vitro and in vivo studies in murine models. For instance, Hikida et al.,

(1996) described a fourth wave of RAG 1 and RAG 2 expression induced in

activated mature 6 cells both in primary culture and in the peripheral lymphoid

tissues of immunized animals (93). Using RT-PCR and Southem Blot analysis,

they demonstrated expression of RAG in splenic 6 cells from C3WHeN mice

cultured for two days with lipopolysaccharide (LPS) and interleukin 4 (11-4).

RAG transcripts were not detectable in the cells prior to culture with LPS and IL-

4, or in cells stimulated with either LPS or I L 4 alone. RAG transcripts were also

undetectable in cells CO-cultured with LPS and 11-2, 11-3 or 11-5. Panned IgD+

cells were also CO-cultured with LPS and IL-4 to confirm that IgD+ cells

specificaliy expressed RAG in response to LPS and IL4. Moreover, a CD40

monoclonal antibody , or anti-p heavy chain were as effective as LPS in eliciting

RAG expression in these mature B cells (93).

Draining lymph nodes of immunized mice were also examined for RAG

expression in these studies. RAG transcripts were detected by RT-PCR and

confirmed by Immunofluorescence microscopy in the germinal centres of both

inguinal and popliteal lymph nodes of immunized animals, eight days post-

immunization. RAG positive cells however, were not detectable in unimmunized

controls (93).

Taking yet another approach, Han et al., (92) used affinity-purified

antibodies specific for active RAG 1 and RAG 2 proteins to label histologic

sections of spleen and Peyets patches from immunized and normal mice. They

found that PNA+/GL-Tc B cells present in mature germinal centres in spleen 16

days after immunization. or in Peyets patches of unimmunized mice expressed

substantial arnounts of immunoreactive RAG 1 and RAG 2 protein. This

expression coincided with 87-2 expression, suggesting that the RAG proteins

are expressed in the germinal centre centrocyte sub-population. These findings

were fuNier confimed by RT-PCR assay for RAG mRNA in B220+/GL-7+ B cells

purified by FACS (92).

In further experiments, Hikida et al., (101) confirmed that RAG transcripts

and their were expressed in parallel with the formation of geninal

centres in popliteal lymph nodes of immunized mice and that the majority of

8220' RAG expressing cells, were present within apoptotic tingible bodies of

germinal centres. They demonstrated however, that RAG expression at this

irnrnunoiogical site is not a nonspecific result of apoptosis. since RAG

transcripts were not evident in apoptotic B cells generated by surface Ig-cross-

linking (with either anti-p or anti-â immobilized Ab). The authors suggested that

RAG expression therefore, represents a controlled process that may be involved

in the revision of unfavorable slg receptors that are generated in the germinal

centre, as a result of somatic hypermutation and isotype class switching (101).

To determine whether the RAG products induced in mature B cells were

functional, Papavasiliou et al., (99) and Han et al., (86) assayed for de novo,

RAG- specific DNA double-stranded breaks by LM-PCR assay. In a transgenic

rnouse modal containing targeted p and r replacement alleles (pu+ U'+ mice)

which allelically exclude the endogenous heavy and light chain alleles (leaving

them unrecombined and available for cleavage by induced RAG), Papavasiliou

et al., (99) observed both J, and J, signal breaks in pu+ Y' B cells cultured in

LPS and IL4. Signal breaks were not detected in unstimulated cells. Signal

breaks in wild-type 6 cells treated with LPS and 11-4 compared to only 10-20%

of those found in pu+ #+ mice, due to reduced availability of RSSs, as predicted

by the authors (86,99).

To verify these in vitro results, density centrifugation enriched GL-ï+ -

germinal centre B cells from immunized if+ K"+ mice were tested for RAG

activiiy. RSS breaks were not present in resting B cell fractions however, de

novo JK breaks were found one week post-immunization in activated fractions,

corresponding to reported temporal GC RAG expression (99).

Employing similar techniques Han et a/., (86) sorted GC B cells from the

spleens of immunized C57BU6 mice into 8220" and 8220" subfractions and

used RT-?CR to determine the presence of RAG 1, RAG 2 and A 5 mRNA in

each of these populations. RAG and M gene transcripts correlated with the

8220" GC cell phenotype. To determine RAG activity, I ~ K locus de novo dsDNA

RSS breaks were assayed by a LM-PCR assay. Observed JK breaks were

predominantly contained in the B220M GC cell phenotype (86).

In support of their earlier findings which strongly suggested that GC B

cells undergo receptor editing in parallel with RAG gene expression, Hikida et

al., (1 02) reported de novo h-light chah gene rearrangements both in vitro and

in immunized wild-type mice. Enhanced A-light chain expression was detected

in mature B220+ spleen B cells stimulated with LPS and 11-4. Prior to culturing,

cl % of the fraction was A+, but increased to 24.5% after stimulation. Purified K

cells were similarly stimulated with LPS and 11-4. Interestingly, 34% of this

purified cell population became positive for tlight chains. To confimi that

expressed klight chains were indeed produced by newly rearranged I genes,

a PCR assay was used to detect circular DNA excision products derived as a -

result of VA-Jh rearrangements. As predicted, LPS/IL-4 stimulated 6 cells and

lymph nodes of immunized mice, which expressed RAG, exhibited higher levels

of DNA excision product reflecting MG-dependent de novo rearrangements

(102).

To rule out the possibility of preferential clonal expansion, [3H] TdR

uptake experiments were carried out, revealing comparable results in both h+

and K+ B cells. lndicating that the LPSAL-4 increase in A+ B cells, could not be

due to the preferential expansion of a small number of these cells in the original

B cell preparation during the culture.

ln their most recent studies using IL-4 deficient mice, Hikida et al., (103)

reported that an I L 4 deficiency did not impair RAG expression in draining

lymph nodes of immunized mice. Furthemore, they demonstrated using a panel

of cytokines including 11-2, IL-3, IL-5, IL-6, 11-1 0, 11-13 and INFnl, that only 11-7,

a critical growth factor, thought only to be required by immature lymphocytes in

the bone marrow, can induce RAG expression and subsequent V(D)J

recombination in mouse splenic B cells in vitro, ppaired with a monoclonal CD40

antibody and in GC B cells of immunized mice. This report also showed induced

IL-7 receptor expression in peripheral B cells activated both in vitro and in vivo.

Suggesting that 11-7 and the I L 7 receptor may participate in the diversification

and selection of B cells in GC. These sfudies also hint that the GC and BM

microenvironment may provide similar environrnents for B cell differentiation.

except that FDCs rnay provide the 11-7 required in the GC venus stroma! cells -

in the BM (103).

Furthemore, 11-7 RAG induction produced functional RAG products

assessed by the observation of Vhl-Ji, reanangements by PCR assay, in a

>99% pure lgD+ B cells stirnulated in vitro. LPS alone controls, which allow for

cell cycle progression, but do not permit RAG re-expression, did not produce

any V(D)J excision products under the same conditions. Moreover, mice

immunized with anti-IL-7R mAb, to block IL-7 signaling, showed dramatic

suppression of RAG 2 expression and Vh,-Jh, rearrangements versus control

animals. These results therefore, reveal a critical role for IL-7 and the IL-7R in

receptor editing in GC 8 cells (103).

In a study demonstrating that BCR signaling regulates V(D)J

recombination, Hertz et aL, (R I ) induced V(D)J recombination in 3-83 p8 Tg

splenic 6 cells treated with LPS and IL-4, then assayed the effect of BCR

ligation on this induction. In vivo, mice were imrnunized with Ag. Under both in

vitro and in vivo conditions, ligands with varying avidities for for the Tg-BCR

were generated in Ml3 phage. The three ligands included a non-binding, a low

avidtty and a high avidity anti 3-83 ligand. klight chain rearrangements were

assayed for, which should be suppressed in these Tg mice. In vitro findings

showed that only the high avidity ligand suppressed the generation of 7L' B cells

in culture. However, in vivo resuits showed that GC formation occuned only in

response to the low avidity ligand (-100x versus high avidity) paired with an

increase in

The

X+ B cells, which represented new rearrangements (81). -

authors claim that their data support three important conclusions

about V(D)J recombination in peripheral B cells. First, these results confimi RAG

re-expression and the ability for peripheral cells to undergo further

rearrangements, and that BCR ligation can tum off RAG expression. This

implies that cells undergoing V(D)J recombination have the potential to express

slg and therefore, do not represent a pre-B cell contaminating population.

Finally, the finding that BCR ligation can terminate RAG activity suggests that it

is not a mechanism of tolerance at this site, as in the BM, but rather a

mechanism of immunity (8 1).

The authors concluded the V(D)J recombination is invoked to rescue

cells with improved receptor afFinity by modifying the receptors of B cells with

weak reactivity to Ag. In this way, BCR signaling inhibits receptor revision and

stimulates expansion of high affinity clones, while allowing lower affinity cells to

improve their affinity (8 1).

1.8.i Re-expression of RAG 1 and RAG 2 and Evidence for

Secondary Rearrangements in human OC B CeIIs: -

The data reviewed above demonstrate that re-expression of RAG 1 and

RAG 2 is possible in murine GC. Moreover, the products of this fourth wave of

RAG gene expression are functional and mediate secondary L-chain

rearrangements as previously discussed (86, 92, 93, 99, 101-103). In an attempt

to decipher whether human GC B cells also experience RAG re-expression and

subsequent additional rearrangements, we and others have assayed for the

presence of RAG mRNA transcripts and their functionality, in the hope of

detemining what physiological role RAG re-expression and these

rearrangernents may play.

Giachino et al., (94) were the first to publish human results from three

tonsil specimens. They sorted GC B celfs, mature 6 cells, as well as non-B cells

and assessed RAG expression by RT-PCR. RAG was found in al1 three samples

and was confirmed by sequencing analysis. Using a monoclonal anti-CD77,

they found that the centrocytes of the GC population expressed RAG. Further

analysis showed that these cells did not express surface lg. Although their

studies are problematic, in that only one tonsil was assessed for slg- RAG

expression and results were not reproducible, the authors provide the argument

for RAG expression in the slg- population. They daim that this subfraction of

centrocytes re-expresses RAG in an attempt to generate a new receptor due to

the accumulation of a negative mutation during hypermutation. These findings

demonstrate that, as in mouse, a specific and defined population of human GC

B cells reactivate the recombination machinery during a certain stage of the

affinrty maturation process. The phenotype of this subfraction is CD38+/CD77,

dg', RAG+ (94).

In similar studies, Meffre et aL, (95) using a LM-PCR assay to detect

signal breaks in human GC 8 cells (also from tonsil sarnples) at the Igx L-chain

locus, found breaks in GC lgD7CD38' tonsil centrocytes. lgD+/CD38- cells were

also assessed, but were negative. Subsequent semiquantitative PCR was

canied out and levels of RAG 1, RAG 2, T f l , V-pre-B. and h-like mRNAs in

these cells were comparable to levels expressed in unfractionated adutt BM

samples. From these observations, the authors postulate that receptor revision

by secondary V(D)J recombination is restricted to B cells which have already

undergone somatic hypemutation and have exited the centroblast stage (95).

Furthemore, in contrast to previous results in munne studies, addition of

11-2, IL-4, or IL-10 to cultures did not induce RAG expression in human GC B

cells cultured in CD40L (95). Perhaps providing confirmation, that 11-7 is a key

cytokine required for the induction of RAG expression in the GC, as has been

suggested by Hikida et ai., in their murine studies (103). Additionally, in contrast

to previous IgM+/lgD- BM B ceIl studies (80), self-Ag (anti-K and anti- A) inhibited

RAG expression in lgD-/CD38+ GC B cells (95).

Moreover, this group characterized the suppressive effect of anti-BCR

Abs on RAG expression, by performing dose-response experirnents with intact

anti-K and anti-b Abs and Fab'2 fragments. They observed 6-8 fold RAG

downregulation when both Abs were used; however, no significant effect was

obsewed when either Ab was used alone. The authors propose that BCR cross- -

linking is a mechanism of positive selection for B cells that produce high affinity

receptors, as both RAG and TdT expression are terrninated upon cross-linking.

The authors suggest that the mature B cell response to Ag-receptor

engagement is opposite to the response of developing, BM 6 cells to the same

stimulus. They further suggest that receptor revision is a mechanism for receptor

diversification, in the periphery, which is shut down when the Ag-receptor is

cross-linked by the cognate Ag. Therefore, recornbination is regulated by Ag-

receptor (BCR) cross-linking, at the different stages of 6 cell development (95).

In consideration of the data reviewed above and previous findings in our

lab, we designed a carefully optimized PCR assay, in an attempt to elucidate

RAG re-expression in mature human B cells in vivo. Recently, we have reported

that RAG 1 transcripts, as well as transcripts corresponding to two RAG 2 splice

variants, were detectable in human tonsilar B lymphocytes (96). Functionality of

the RAG gene products was demonstrated by the presence of ds-DNA signal

end breaks, obsewed in these cells using LM-PCR analysis (96).

1.9 The Mechanisms of RAG Regulation:

The precke mechanisms regulating RAG expression remain unclear.

However, different studies to date suggest RAG regulation may occur on three

levels; transcriptional, translational, and the post-translational level. Evidence

pertaining to each of these will be addressed individually.

1.9.i Transcriptional Regulation

Both our laboratory and Kurioka et al., have recently characterized the

RAG 1 core promoter (44, 104). Zamn et ai., (44) using S'-RACE, RNase

protection and primer extension studies defined the transcription initiation sites

and promoter regions for both RAG 1 and RAG 2. The human RAG 1 and RAG 2

intron/exon 2 boundary is located 14 and 27 nucleotides upstream of the ATG

translational start site respectively (44). The major transcriptional initiation site

of human RAG 1, is located 110 bp upstream of the splice junction and contains

a 5' untranslated region of 124 bp. RAG 2 contains a major transcriptional

initiation site 135 bp upstrearn of the splice junction site, which corresponds to

exon 1A and was confirmed by both 5' RACE and RNase protection assay, in

both B and T lymphocytes. Exon 1B seems to be the minor transcription

initiation site and was more difficult to deted (44). Zamn et al., also reported

that 1 B appean to be used infrequently. This was particuiarîy evident in pre-B

and mature 6 cell studies. The significance of the two independent transcription

initiation sites remains as yet unclear (44).

The 5' region of RAG 1 does not posses a typical TATA box consensus

sequence. However. an rich sequence is present and contains a GATA cis-

element and has been characterized as a weak TATA box sequence (44). 8

lymphocyte-restricted transcription factor binding sites were also confinned for

Ikaros, E2A and Myc (44)- Although the NF-Y transcription factor has been

shown to interact with the rnouse RAG 1 CCAAT element (105), it remains

unclear exactly which transcriptions factors drive RAG 1 transcription. The

immediate 5' ffanking regions of both exon 1 A and 1 B of the human RAG 2 core

promoter were found to be TATA-les. Multiple E2A and lkaros binding

consensus sequences were also characterized, as well as two repressor

element consensus and transcription factor binding sites for other

rnultifunctional transcription regulaton. Interestingly, several other lymphocyte

specific genes such as V-pre B, Lck, TdT, A 5 and CD19 also lack the canonical

TATA box (44). Furthemore, the human RAG 2 core promoter region does not

contain a CCAAT box, which is present and essential for the basal transcription

of RAG 1. Hence, one may speculate that transcriptional regulation of RAG 1

differs from that of RAG 2 (44).

Interestingly, RAG promoter activity was dernonstrated in nonlymphoid

cell lines, in which the RAG genes are not expressed (44). These obseivations

suggest that tissue- specific expression of the RAG 1 and RAG 2 requires other

mechanisms such as enhancer or repressor cis-elements that act in tandem

with the core promoters. However, tissue -specific regulatory elements still

remain to be characterized and the molecular basis for the transcriptional

regulation of RAG genes has yet to be elucidated.

1.9.ii Post-Transcriptional Regulation:

Presently, little is known about the mechanisms goveming the molecular

regulation of RAG 1 and RAG 2 at the post-transcriptional level. The RAG 1

transcript has a half-life of approximately 30 minutes in the C3A11 N mature B

cell line (studied in our laboratory) and the Ep-myc transforrned cell lines (6, 8).

Ma et al., (6) have previously shown that PMMonomycin treatment or cross-

linking slg receptors, decreases the RNA half-life of RAG l in their cell lines.

Conversely, our lab has demonstrated the opposite effect, with an increase in

RNA half-life accompanied by a 5-foid increase in inducible RAG 1 expression

(82). To date, there is no data on the effects of these treatments on RAG 2.

Sequencing of RAG 1 has revealed that the transcript does in fact contain

a conserved, AU element rich (13 copies), 3.4kb untranslated region. These

elements are known to code for RNA instability and lead to rapid RNA turnover

(1 06) as expected, in keeping with the short half-life of RAG 1 mRNA.

9 Post -Translational Regulation:

Studies afthe protein level have shown that there is rapid turnover of the

RAG 1 protein in both normal thymocytes and transfected fibroblasts, in which

the protein half-life is a mere fifteen minutes, indicating significant protein

instability (107). Post-translational phosphorylation of the RAG 2 protein at

threonine-490 is thought to be one of the key regulatory mechanisms which

aliows for the accumulation of RAG 2 at the GO to G1 stage cycle at which tirne

V(D)J recombination takes place, followed by at least a 20-fold dedine in

protein levels pnor to the cells entering S and G2/M phases of the cell cycle

(108, 109).

1 . I O The LM-PCR Assay:

LM-PCR is a sensitive PCR-based linker-ligation assay for locus-specific

broken-ended DNA. This technique has been instrumental in demonstrating

RAG functionality in both murine, as well as, human germinal centres. The

technique devised by Schlissel et al., (19) is based on the ligation-rnediated

PCR approach first developed by Mueller and Woid in 1989 (1 10). The

technique, which was originally used for genomic footpnnting studies, involved

mapping via primer extension, single stranded DNA generated by chemical

agents or nucleases. A linker was then ligated to the genomic DNA and

subsequent rounds of PCR camed out to amplify the DNA of interest. Schlissel

et al., designed their modified assay to map the precise ds-DNA broken-ended

RSSs that are Gsociated with each reananging immunoglobulin locus in cells

undergoing V(D)J recombination (19). Essentially, any sample of purified

genomic DNA can be assayed for breaks at any genetic locus for which primers

are available. Moreover, this modif ied assay requires less DNA starting

template than other detection methods (Southem blotting) and led Schlissel

and his colleges to determine that detectable broken-ended RSSs are RAG 1

and RAG 2 dependent, blunt, 5'-phosphorylated and cell cycle dependent (19).

This assay provides advantages over previously limited PCR

approac hes, in that previous assays detected rearranged products of V(D) J

recombination, reflecting only indirect rearrangements resulting from V(D)J

recombinase targeting. Schlissel and colleges argue that the presence of locus-

specific, broken-ended RSS DNA indicates de novo V(D)J recombinase activity

at that particular locus (1 9).

1 .10 .i Application of LM-PCR to demonstrate RAG functionality in

the germinal centre:

A partially double stranded oligonucleotide linker is ligated to purified

genomic DNA with T4 DNA ligase. The linker is blunt, non-phosphorylated and

asymmetncal in structure allowing 1 to ligate in only one orientation to blunt, 5'

phosphorylated genomic DNA. Broken DNA ends in association with a

particular locus are then detected by a pair of nested PCR assays employing a

5' sense-locus specific primer and an antisense linker specific primer. Expected

hybridizing fragments corresponding in size to locus specific ds-DNA breaks

are then determined and if present, indicate loci undergoing RAG-dependent.

de novo rearrangements (19). Therefore, if RAG is present and functional in B

cells of the germinal centre, then this assay will detect the broken ends

generated by RAG coupled cleavage.

CHAPTER 2: MATERIALS and METHODS

Materials and Methods: -

2.1 Cell Lines and culture conditions:

The human diffuse large ceIl6 lymphoma cell line OCI-LYSAI 1 N RAG"

variant was used to optimize FIT-PCR assays under in vitro conditions (26).

K562, a nonlymphoid cell line was used in Our studies as a negative control.

This line was obtained from the American Type Culture Collection (ATCC)

Rockville, MD. All cells were cultured in RPMl 1640 (Wisent, Que)

supplernented with 2mM L-glutamine, 100UIml penicillin, 100pg/ml

streptomycin and 15% bovine calf senim (Wisent) at 37°C and 5% C02.

2.2 Flow Cytometric Analysis:

Extracted cells and control cell lines were washed with PBS (5.4 mM KCI,

2.8 mM Na2 HP04, 2.9 mM and 0.3M NaCl, pH 7.3) and centrifuged at 1000

rpm for 7 min followed by a 30 min incubation with 1 pg of antibody 11x1 06 cells,

or appropriate isotype controls at 4OC. The kllowing panel of antibodies were

used for phenotypic analysis: FITC-anti human CD38; PE-anti -human IgD.

FITC-anti-human IgM (Pharmingen, Mississauga, ON), FlTG anti-human CD1 9,

PE- anti-human C03, FlTC-anti -human lgG (Becton and Dickinson, San Jose.

CA) and anti -human h5 (kindly provided by Max Cooper). Subsequently, cells -

were fixed in 0.5ml of fixative (2% paraformaldehyde in PBS, pH7.2) and two

color analysis was carried out using a FACSCaliburGD flow cytometer.

2.3 Tonsil Tissue Manipulation and 6 cell Extraction:

Juvenile tonsils were recovered post tonsillectomy. Tonsilar tissue was

homogenized manual ly and su bsequently strained through a 70pm nylon cell

strainer (Falcon, Franklin Lakes, New Jersey). The strained cells in the flow-

through were then centrifuged in a Ficoll-Paque (Phannacia Biotech, Sweden)

density gradient. lsolated lymphocytes were washed in RPMl 1640 and 8 cells

were isolated by negative selection using neuraminidase treated sheep red

blood cells (Cedarlane. ON.) to rosette T lymphocytes, as per the

manufacturer's protocol. All B cell enriched preparations were analyzed by flow

cytornetry for percent 6 lymphocyte punty. 1x1 07 CD19+ or CD19+/CD38+

purified cells were then pelleted and either cryopreserved at 80°C. or mixed

with TRIzol reagent (GibcoBRL, Grand Island, NY) for immediate RNA

extraction.

2.4 RNA Extraction:

Total RNA was extracted from 1 x107 cells, or directly from 50-1 00mg of

homogenized tonsilar tissue using TRlzol RNA Isolation reagent as per the

manufacturer's protocof. Samples from RNA preparations were electrophoresed

under denaturing conditions and visualized with EtBr staining to ensure RNA

quality and integrity.

2.5 Analysis of RAG 1 and RAG 2 splice variant transcripts:

From whole tonsilar tissue or B cell enriched preparations, 4pg of RNA

were reverse transcribed into double stranded cDNAs with Superscript II RNAse

H-Reverse transcriptase (GibcoBRL, Burlington ON) as per the manufacturer's

protocol. 1 pl of cDNA was subsequently arnpiified by PCR using one of the

following sets of sense and antisense primers: RAG 1 (F29) 5'-

G AGCAG AGAACACACïT-3' and (R38) 5'-CAAGGTGGGTGGG AAAGA-3',

RAG 2 1 A (F5 1 1 ) 5'-TTA GCGGCAAAGATTCAGAG-3' RAG 2 1 B (FS07) 5'-

ACAGGCAGGACACCGTAACG-3' and for both RAG 2 1A and I B (R542) 5'-

TGTCTCTGCCAGATGGTAAC-3' and GAPOH (FI ) 5'-

AAGGTGAAGGTCGGAGTC-3' and (R2) 5' -TCAGCAGAGGGGGCAGAG-3'. Al1

primer pain span an intron to avoid amplifying contaminating genomic DNA.

Taq DNA polymerase (Boehringer Mannheim, Laval. Que) was used for al1

amplifications as per the manufacturer's protocol. PCR conditions were

optimized using- RAG 1 and RAG 2 1 A and 1 B 5' RACE clones (25). PCR

conditions were carried out as follows: RAG 1, RAG 2 and GAPDH samples

were initially denatured for Smin at 94OC, followed by repeated cycles including

94°C for 1 min, 48°C for 40 s and 72°C for 40 S. RAG 1 was amplified for 35

cycles and RAG 2 for 38 cycles with a final extension reaction of 72°C for 10

min. The amplified products were electrophoresed on a 2% agarose gel and

visualized with EtBr staining. The amplified PCR products were transfened ont0

a Zeta-probe nylon membrane (Bio Rad, Hercules, CA.) by ovemight capillary

transfer in 0.4M NaOH. DNA was cross-linked to the membrane using a UV

Stratalin ker apparatus (Statagene, LaJolla, CA). Membranes were probed

using [+2~]-ATP labeled oligonucleotide probes, generated by labeling

oligonucleotide sequences specific to intemal regions of the RAG 1 or RAG 2

genes. The oligo labeling reaction- 2 0 ~ 1 dH,O, 20 pmoles oligonucleotide, 3pl

10x T, Kinase reaction buffer, 0.5 pl T, Kinase (Gibco, BRL) and 25- 30pCi

@2~] (Dupont NEN Boston, Mass.) -was carried out at 37O for 45 min. An exon

6 intemal probe was used to detect GAPDH control hybridization products.

Southern analysis was carried out as per the Zeta Probe (Bio-Rad)

Manufacturer's protocol at 37OC for both pre-hybridization and hybridization

steps. Washes were perforrned at 40°C for 20 min in 2 x SSC/1% SDS.

Membranes were then exposed to Kodak X-Omat film (Eastman Kodak

Company, Rochester, N.Y) at room temperature for a minimum of 1 hr.

2.6 DNA Extraction and LM-PCR:

Enriched 6 cells, whoie tonsii tissue and control cell tine pellets were

washed 3 x in cold Mg '* free PBS, and then pelleted at 1000 rpm at 4°C for

7min. and resuspended in lysis buffer [IOrnM Tris pH 8.3 (ICN Biomedical,

Aurora); 2mM MgCl2 ( Fisher Scientific), 50rnM KCI (Fisher Scientific), 0.45%

Nonidet P40 (BDH Chernical, Poole, Dorset, UK), 0.45% Tween 20 (Fisher

Scientific) and 60 pg /mi Proteinase K ( BMH, Indianapolis, IN)]. Cells and buffer

were mixed thoroughly by pipetting. A 1 hr incubation at 56OC, followed by 15

min at 90°C was carried out using the GeneAmp PCR 2400 (Perkin Elmer, CA).

Extracted cellular DNA was then stored at -86OC prior to ligation. 20p1 of lysis

buffer was added to the ligation reaction containing O.5pM of BW-linker (Gibco -

BRL) 5' - CCGGGAGATCTGAATCCAC - 3' as descnbed in (27). The mixture

was then incubated at 90°C for 15 min to inactivate the ligase. 10pl of the above

mixture was then used to cary out LM-PCR. Subsequent PCR steps were

camed out using locus sequence specific primers as previously described (19.

1 1 1).

2.7 LM-PCR Oligonucleotide sequencecl:

Two human JK primers were designed to detect dsDNA signal end

breaks in RAG positive whole tonsil and tonsilar B cell samples. 60th primers

sequences; (JK~) 5'-GCCAGGGACTCTAACAAA-3' and (Je) 5' -

llTACTTTGTGTTCCClTGT-3' were designed to detect signal end dsDNA

breaks occurring between JiO and the J K ~ coding region of the locus. J K ~ was

used as the intemal probe for JiO amplified hybridization products. A third oligo,

( J K ~ ) 5' - GlTAGGTACAGAGGAGGGGAAAT-3' was generated to detect

corresponding hybridization products amplified w l h Jrl under Southern

analysis. Considering that both lambda and kappa loci rearrange with

equivalent frequency in human cells, a human JÂ. primer was designed to detect

signal end dsDNA breaks possibly occumng upstream of the Jh7 coding region.

( J I ) 5' - TCCTCCCTCTCCCCTCTCCCTCTG -3' amplified products were

detected using (J&, ) 5'-GAACGGGTCGGGTGTGTCAGGAG-3'. All LM -PCR

products were analyzed as previously dexribed (1 11).

CHAPTER 3: RESULTS

Results:

- 3.1 Sensitivity and Specificity of PCR Assays for RAG 1 end RAG 2:

An assay was developed to detect RAG 1 and RAG 2 RNA expression.

The sensitivity of the primer pairs used in the assays was optimized using RAG

5' RACE clones previously described (44). Assays were designed to detect RAG

1 transcripts as well as the two splice variants of RAG 2; RAG 2 1A and RAG 2

1B, described previously (44). Figure 7A denotes the position of the primers

used to detect the three RAG transcripts. The primer pairs were designed to

span an intron to avoid arnplifying contaminating genomic DNA.

Employing the RAG 1 5' RACE clone, the primer pair used to detect

RAG 1 was optimized reproducibly to detect approximately 1 Oz copies of the 5'

RACE clone DNA ternplate (figure 7B). In the case of RAG 2 1A, I O 3 copies of

the 5' RACE clone template could be detected with primers for RAG 2 1A, while

the primers for the M G 2 1 B assay could detect as little as 102 copies of

RAG 2 16 5' RACE clone DNA (figure 7C). As shown in figures 1B and 1 C, al1

primers specifically amplified the control 5' RACE clone and not the 5' RACE

clones containing other RAG transcripts.

3.2 PCR assay sensitivity demonstrated in vitro:

The sensitivity and specificity of the RT-PCR assay was demonstrated

using the RAGN variant of a mature B cell line OCI-LYû-A1 IN. cDNAs were

synthesized from the high RAG expressing daughter clone C3-A11 N. A chronic

myeloid leukemia cell Iine K562 was used as a negative control. cDNA dilutions

of C3-A11 N were amplified by PCR under the same conditions found optimal for

amplification of the 5' RACE clones. Primer specificity was demonstrated by the

appropriate amplification of the expected 135 bp RAG 1 amplicon, which was

easily detectable at 1/100 cDNA dilution (figure 7D). The expected 96 base pair

RAG 2-1A product was also confirmed by Southern analysis. However, the

expected RAG 2-1 B amplicon was only detected at cDNA concentrations of 1/10

(Data for M G 2 not shown).

3.3 Phenotypic Analysis of Purified human B lymphocytes:

Figure 8 shows representative flow cytometnc data from one pufified

germinal centre B cell preparation purified by density centrifugation. Although 6

cell purity in this particular preparation was 96%, as detennined by CD1 9lCD3

cell staining, not al1 samples used for RT-PCR analysis were assessed to be this

pure. The enrichment method used for these studies does not yield the punty

that can be obtained by other methods such as subfractionation by cell sorting

procedure, or affinity purification. Further analysis of phenotypic rnarker

expression ( l g ~ ; CD38 and IgM) demonstrated heterogeneity of 6 cell subsets

in these B cell preparations: 39% of these B cells were CD38+, 65% were IgD+

and 5% were IgM'. This low level of slgM expression is not unexpected, as GC

B cells consistently express low levels of slgM by FACS analysis (97). These

results suggest to us that the fractionated cells are making cytoplasmic p that is

not reaching the cell surface and is therefore not detectable by FACS cell

surface staining analysis. The percent of B cell subsets varied from sample to

sample as shown in Table 1.

3.4 Expression of RAG genes in human tonsil tissue and purified

mature B lymphocyte Populations:

1 assayed both whole tonsil tissue and purified B lymphocyte

preparations for expression of RAG 1 and RAG 2. Tonsils were obtained from

surgica; specimens from children undergoing tonsillectomy for repetitive

episodes of tonsillitis. After Ficoll-Paque centrifugation. 6 cell preparations were

further purified by T cell rosetting. The percentage of 6 cells in the whole tonsil

tissue ranged from 50 -80 O h and increased to 90 -95% in some cases, after T

cell rosetting. RAG 1 and M G 2 transcripts were detected in both whole tonsilar

tissue and purified B cell samples. Figure 9A shows a representative RT-PCR

analysis carried out on whole tonsilar tissue employing RAG 1 specific primers.

RAG 1 transcripts were demonstrated by RT-PCR and quantitated at

approximately 1&103 copies per O.lpg of starting RNA. Figure 96 shows the

results from the same tonsil sample using RAG 2 1A and 1 B specific primers.

Again I was able to detect transcripts from both RAG 2 1A and RAG 2 1B at

approximately IO2- IO3 copies respectively, in this whole tonsilar tissue

preparation.

I also assessed RAG expression in B cell enriched preparations from the

tonsil specimens. 60th RAG 1 and RAG 2 1A transcripts were observed in

several samples analyzed. An example of results obtained from one enriched B

cell preparation is shown in figure 9C. A summary of RT-PCR amplifications for

RAG 1 and RAG 2 from whole tonsilar tissue andfor enriched B celf preparations

is shown in table II. Ten different tonsil tissues were screened for these studies.

In one sample, only whole tonsilar tissue was assessed, in five others, only

enriched 8 cell populations were assessed, and in the other four, both whole

tonsil tissue and enriched B cell populations were assessed. RAG 1 and RAG 2

expression were demonstrated by RT-PCR analysis in five different samples.

3.5 Functional Evidence of RAG Re-expression:

To show that RAG expression in our mature 8 cell preparations had

functional significance, I designed a locus-specific, ligation mediated PCR

assay. I chose this assay for its ability to detect V(D)J recombination

intermediates whose generation rely solely on the combined unique and

specific enzymatic activity of the RAG genes. This particular assay was carried

out in the Wu laboratory and detected de novo dsDNA breaks at recornbination

signal sequence (RSS) sites at both the Igr and l g l loci. B cell samples

expressing RAG transcripts were subjected to LM-PCR. The human pre-B ceII

line 697 which is actively undergoing V(D)J rearrangements was chosen as the

positive control for these experiments. (For a negative control we had originally

employed the myeloid cell line K562, however this proved problematic and

subsequently RAG 2 expression was demonstrated in this line by RT-PCR

assay in the lab. DH,O was chosen as the negative control in these

experiments. I report here that PCR fragments of sizes consistent with the

presence of signal ends were detected demonstrating targeted de novo, RAG-

specific dsDNA signal end breaks occurring between the JiO and J K ~ region of

the JK locus, as detennined by the expected 206bp size product (figure 1 OC).

Using the J,-, - J, primer and intemal probe pair, JX signal end intemediates

were also detectable, resuiting in the expected PCR product of 233 base pain

(figure 1 OC).

Figure Legends:

(Figure 7) ~etection of RAG 1 and RAG 2 Gene Expression. A)

Primer and probe locations for RT-PCR assays to detect RAG 1 and both RAG 2

isofonn transcripts in human mature 6 lymphocytes. Open boxes indkate

exons. B) Detemination of RAG 1 PCR assay sensitivtty using a RAG 1 5'

RACE clone. Southem analysis shows dilutions (camed out in T.E ) of the RAG

1, 5' RACE clone containing exon 1 and a portion of exon 2 amplified with RAG

1 specific primers. Controls include RAG 2 5' RACE clones, which are not

amplified by RAG 1 specific pnmen and a dH,O control for reagent

contamination. C) Determination of RAG 2 PCR assay sensitivity for both RAG 2

isoforms using RAG 2 1A and 16 5' RACE clones. Southem blot anaiysis

demoristrates serial dilutions of RAG 2 I A 5' RACE clone and RAG 2 1 B 5'

RACE clone with correlating PCR sensitivity. Controls for primer specificity

include plasmids containing other RAG transcripts. dH,O is a control for reagent

contamination. D) Detemination of the RAG RT-PCR assay sensitiwty

demonstrated in vitro using a RAGMmature B cell line. cDNA was synthesized

from the OCI-LY8 -C3P variant C3-A11 N, a high RAG expressor. Parallel PCRs

were camed out on cDNA dilutions with M G 1 and GAPDH çpecific primers.

RAG 1 5' RACE clone titrations demonstrate assay sensitivity. Undiluted RT - negative lanes and dH,O serve as negative controls for cDNA synthesis and

PCR.

(Figure 8) Phenotypic Analysis of Purified Tonsilar Germinal

Centre B Cdk. A representationai flow cytometric analysis of human

tonsilar GC B ceils purified by density centrifugation (sample JGTON004). Open

histograms represent fluorescence of FlTC and PE conjugated cell surface

markers, while shaded histograms represent isotype controls.

(Figure 9) RT-PCR Analysis of Human Whole Tonsilar Tissue

and Enriched B cells amplified with RAG 1 and RAG 2

Specific Primers. A) Analysis of RAG 1 expression in whole tonsilar tissue

(JGTON001, trial 4). cDNA dilutions were amplified with RAG 1 and GAPDH

specific primers. RAG 1 5' RACE clone dilutions are included for semi-

quantitative comparison and assay sensitivity. GAPDH demonstrates cDNA

quality. Undiluted RT- negative lanes and dH,O seive as negative controls for

non-specific amplification and reagent contamination. 6) Analysis of RAG 2

expression in whole tonsilar tissue (JGTONOOi- trial 4). cDNAs were diluted

and amplified with RAG 2 1 A, 1 B and GAPDH specific primers. RAG 2 5' RACE

clone dilutions are included for semi-quantitative comparison and to indicate

assay sensitivity. GAPDH demonstrates cDNA quality. Undiluted RT-negative

lanes and dH,O serve as negative controls for non-specific amplification and

reagent contamination. C) Analysis of RAG -1 and RAG -2 expression in

enriched mature human GC B cells isolated from JGTON003- trial 3. cDNA

dilutions of tonsil GC B cells were amplified with RAG 1, RAG 2 1 A and GAPDH

specific primers. RACE clone dilutions are included for semi-quantitative

comparison and to demonstrate assay sensitivity. GAPDH demonstrates cDNA

quality. Undiluted RT -negative lanes and dH,O serve as negative controls for

non-specific amplification and reagent contamination. D) A demonstration of

tonsil heterogeneity for RAG expression. Analysis of RAG -1 expression in

enriched human GC B cells isolated from JGTONOOG - trial 2 shows this tonsil

does not express RAG mRNA, cDNA dilutions of tonsii GC 6 cells were

amplified with RAG -1 and GAPDH specific primers. RACE clone dilutions are

included for semi-quantitative comparison and to demonstrate assay sensitivity.

GAPDH demonstrates cDNA quality. Undiluted RT -negative lanes and dH,O

serve as negative controls for non-specific amplification and reagent

contamination. E) Analysis of RAG -1 expression in enriched human GC B cells

isolated from JGTON004 - trial 1 showing difficulties encountered with titrations.

cDNA dilutions of tonsil GC B cells were amplified with RAG -1 and GAPDH

specific primers. RACE clone dilutions are included for semi-quantitative

comparison and to demonstrate assay sensitivity. GAPDH demonstrates cDNA

quality. Undiluted RT wnegative lanes and dH,O serve as negative controls for

non-specific amplification and reagent contamination.

(Figure IO) Detection of dsDNA Signal End Breaks at the

Kappa and Lambda Loci. A) Schematic diagrarn of the LM-PCR

strategy for detecting secondary rearrangements at the K locus. In attempts to

detect secondary rearrangements occumng at the JK locus, a LM-PCR assay

was designed to amplify dsDNA signal end breaks occurring between the JiO

and J K ~ coding regions of the locus. Locus specific primer is denoted by JK,,

while the intemal probe used for detection is designated J K ~ . The Iinker and its

primer are called BW. The recombination signal sequences are represented by

closed triangles. A previous loci rearrangement involving VK and JK, is shown

here for convenience. 6 ) Schematic diagram of the LM-PCR strategy for

detecting secondary rearrangements at the ic locus. In attempts to detect

secondary rearrangements occurnng at the J i locus, a LM-PCR assay was

designed to amplify signal end dsDNA breaks occurring between the Jh6 and

Jh7 coding regions of the locus. The locus specific primer used is denoted by

JA,, while the intemal probe used for detection is designated J&. The M e r and

its primer are called BW. The recombination signal sequences are represented

by closed triangles. A previous loci rearrangement involving V I and JA, is

shown here for convenience. C) LM-PCR analysis provided by the Wu

laboratory, of human GC B cell DNA extracted from RAG expressing cells. Three

ennched human GC B cell sainples show RAG functionality. Both the 206 and

the 233 bp PCR fragments are consistent with expected JK and JL amplified

signal end intermediate products. A human pre-6 cell line is the positive control,

while dH,O controls for reagent contamination.

(Table 1) Phenotypic Screening of Enriched B cells

Demonstrates Lymphocyte Subset Heterogeneity.

Characteristic B&II phenotypic rnarker expression was obsewed in al1

specirnens. However, expression levels of these markers varied from lymph

node to lymph node.

(Table II) Expression of RAG 1 and RAG 2 lsoforms in Whole

Human Tonsil Tissue and Enriched Tonsilar B Cell

Preparations. Ten human tonsil samples were recovered post tonsillectomy

from children with re-occurring tonsillitis due to chronic pathogenic bacterial or

viral infection. Samples were subsequently screened for both RAG 1 and RAG 2

expression. Seven of the ten lymph nodes screened were positive for RAG

expression, demonstrating heterogeneity of RAG expression in human tonsilar

tissues.

(Table III) Summary of Tonsil Samples and Their Degree of

RAG Signal. Analysis of each individual tonsil sample screened for

RAG expression. Whole tonsil andlor enriched B cell subfractions

were assessed as indicated by the "x'. For each sample such as

JGTON001, each separate trial is given a number. Each trial

represents a separate PCR experiment. In some cases two separate

cDNA preparations from the indicated tonsil were tested. All trials that

gave a positive signal with the GAPDH control are shown. Numerical

values ("signal over background") represent fold signal demonstrated

over background ("no RT' lane see Figure 9). For example, the

number 1 means that a signal (band) was seen only in the undiluted

lane and that this band was darker than the no RT lane, while 10

means that detectable signal from a 1/10 dilution is equivalent to ten

fold over background. Zero denotes that a signal band was not visible

on the autoradiograph and the sample was considered to be negative

for RAG expression. NA denotes no data available. Care was taken

that numbers represent minimum values. In some cases, as

illustrated in Figure 9C or 9E the titration was clearly not linear. When

this occurred, the signal value was assessed to be the signal pfior to

where the titration stopped (e.g. 1 as in Figure 9E ).

(Figure 7A)

(Figure 7 6 )

,! ,Q

.@ ..$ 8 .@ ..$+ @ .ia5 \V ffi - 1 eC %b,ai& .@ 5 $ o& w'

5- RaCE cbne 4Q 4Q 40 4Q 40 40 4r0 @9 0."

(Figure 7C) (Figure 7 0 ) RAG -1

(Figure 8)

unstained B cells

(Figure 9A)

4- K* RAG-1 ', ,aa @ B ,P@ $89

P û SRACE clone 9 3 \O 4P 40

(Figure 9C)

(Figure 98) RAG -2 1A / GAPDH/'

K i RAG -2 1A P'" 4- p"" $8 s MC€ clone b

6 4% ,P +fQ .$@ dl& '3 plasmid DNA 4 40

RAG -2 1 6 5' RACE clone plasmid DNA 84bP

373 bp 96 bp

+ K !

RAG -1 -#' - 5' HACE clone

+.lir~~re-? W.- --* -.-- *++ , ,- . - 73 . . . . .

S- 4% plasmid DNA

373 bp 135 bp

a PDH

(Figure 90)

RAG -1

(Figure 9E)

RAG -1

GAPDH

STRATEGY FOR LM-PCR

(Figure 10A) J Kappa light chain locus

R A G u

(Figure 108) J Lambda right chah locus

(Table 1)

Sample

JGTONOOZ

JGTONOO4

JGTONOOS

JGTONOO6

JGTON008

JGTONOOS

JGTONO 1 0

Analysis not amilable for JGTONOO 1 (whole tonsil prepared only), JGTON003 and JGTON007.

(Table II) Expression of RAG -1 and RAG -2 lsoforms in Whole Human Tonsil Tissue and Enriched Tonsilar B Cell Preparations

Tvpe of Sample le

Whole tonsil tissue JG TON 001 + + + Tonsilar B cells JG TON 002 Arnbiguous Tonsilar B cells Tonsilar B cells Tonsilar B cells Tonsilar B cells Whole tonsil tissue Tonsilar B cells Whole tonsil tissue Tonsilar B cells Whole tonsil tissue Tonsilar B cells Whole tonsil tissue Tonsiiar 6 cells

JG TON 003 JG TON 004 JG TON 005 JG TON 006 JG TON 007 JG TON 007 JG TON 008 JG-TON 008 JG TON 009 JG TON 009 JG TON 01 0 JG TON 010

+ Positive for RAG expression - Negative for RAG expression ND Not determined (could not see consistent signal)

Table III Surnmary of Tonsif Samples and their Degree of RAG Signal

over background Whole t o n s i l RAG 2 1~ 1 RAG 218 Sample Trial

I N A

TABLE III Sumrnary of Tonsil Samples and their Degree of RAG Signal

Sample Trial

background

RAG 218

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

5

1

5

Whole t o n s i i

NA

NA

NA

NA

NA

NA

NA

NA

NA

x

over

RAG 2 1A

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

5

10

NA

enriched B cells

x

x

x

X

X

X

X

x

x

x

X

X

X

signai

RAG 1

O

1

1

1

O

O

O

O

O

O

1 O

1

O

TABLE III Surnmary of Tonsil Samples and their Degree of RAG Signal

signal over background

RAG 216

CHAPTER 4: DISCUSSION

4.1 Discussion of Results

In carrying out this project, I have demonstrated the expression of RAG 1

and RAG 2 mRNA in human lymph node tissue. I have screened a total of ten

human lymph nodes and found six of these to be positive for RAG 1 expression.

It was also determined that five of the six RAG positive tissues demonstrated

concomitant expression of RAG 1 and both isoforms of RAG 2. Further, this

concomitant RAG expression was seen in both whole tonsilar as well as

enriched B cell preparations.

These results are consistent with recent findings from murine studies

similariy employing RT-PCR to demonstrate RAG expression in murine germinal

centres (86, 92. 93, 99, 101). Using in situ -PCR and immunophenotypic analysis,

previous studies showed the expression of RAG 1 and RAG 2 messenger RNA

and protein in the germinal centre microenvironment (102). Additionally,

germinal centre RAG gene products have been shown to be functional by LM-

PCR assay for de novo RAG-specific dsDNA breaks (86.99, 101).

Interestingly, all murine reports concluded that functional GC RAG

expression requires prior 6 cell activation either in vitro or in vivo (86.92, 93. 99,

101-103). We have extended these studies to tonsilar tissue obtained from

children undergoing tonsillectomies for repetitive episodes of tonsillitis. We

consider these 6 cells to have likely been activated by various pathogenic

bacteria or vinises. More importantly, these results are consistent with recent

reports published by Giachino and colleagues and Meffre et al., both working

with tonsil samples, who report functional RAG expression in these GC sites (94,

- 95).

Although in most sarnples where RAG expression was detectable, we

documented expression of both isoforrns of RAG 2, RAG 1 alone was found in

one B ceIl preparation (JGTON004). There are several possible explanations

for this. Although 1 is possible that these are unique examples of discordant

RAG 1 and RAG 2 expression, we think the more likely explanation is related to

technical difficulties with these particular samples and assays. Technical

problems in RAG 2 PCR efficiency were also encountered by Giachino and his

group (94). Moreover, we found that both RAG 2 splice variants were expressed

concomitantly. The significance of expression of RAG 2 from these different

splice variants containing different promoter regions is as yet unclear. While

other groups have not yet addressed both RAG 2 splice variants, clearly

however, we see that there is no differential utilization of these splice variants in

RAG expressing germinal centre B cells.

In order to detect de novo dsDNA breaks resulting from secondary K or ii

light chain gene rearrangements and RAG activity, as previously detected in

murine GC (86, 99, 102), 1 designed sequence specific JA and JK

oligonucleotides to amplify secondary lg gene rearrangement intermediates by

ligation mediated PCR. In agreement with others' recent findings (94. 99, we (in

collaboration with the Wu laboratory) demonstrated that the RAG expressed in

mature human GC 8 cells is indeed functional, as evidenced by the de novo

dsDNA breaks consistent with signal end intermediates found in V(D)J

recornbination. Although we were only capable of detecting RAG function in two

of our four tested RAG expressing samples. we are confident that RAG specific

breaks would be detectable with other locus specific primers.

In further observations, we found M G expression to be heterogeneous

from sampie to sample. In four of the ten lymph nodes screened RAG

expression was not detectable (Table II). Previous reports in munne 6 cells

have determined that only a particular murine B cell subset (?NA+, GL-7')

residing within germinal centres expresses RAG (92, 93). In fact. al1 reports of

RAG expression in mature mouse B cells have shown that RAG re-expression

and further recombination has occurred in a smali subset of mature GC B cells

(86, 92. 93, 99, 101403). This murine population of GC B cells corresponds to the

human. light zone centrocyte subfraction (CD38+/lgD-/CD77-) Bm4, originally

described by Pascual et a/., 1994 (97). Furthemore, recent work in human

tonsilar tissue confinned the presence of RAG mRNA transcrïpts in the GC

centrocyte subfraction (94, 95).

By performing extensive flowcytometiy analyses, we detemined that the

lymph node derived B cells used in these experiments, were compnsed of

heterogeneous B cell subsets which varied from sample to sample. both in

number and in degree of cell surface marker expression. This subset

heterogeneity may be one explanation for the heterogeneity of RAG expression

noted from lymph node to lyrnph node. Another explanation for the

heterogeneity of RAG expression may be due to the type of B cell activation

experienced (bacterial or viral) prior to tonsillectomy. We believe this to be a

salient point, since al1 reports of RAG expression in mouse peripheral 8 cells

have required B cell activation by LPS and IL-4 CO-culture conditions, or

immunization with a bacteria derived adjuvent such as trinitrophenyl- keyhole

hemocyanin (86, 92, 93, 99, 10 1- 103).

Sirnilar to our studies, experiments perforrned by other groups carried out

in human tonsillar B cells, did not use LPS or IL-4/IL-7 to induce RAG

expression (94. 95). Meffre and colleagues however, did perfonn CO-culture

using CD40 ligand and saw induced RAG expression, along with h-like, V-preB,

and TdT mRNA expression after 3 days in culture. Nonetheless, in contrast to

previous results in mouse studies, addition of 11-2, IL4, or IL-1 0 to cultures did

not induce RAG expression (95). This data further supports our assumption that

extracted tonsilar 6 lymphocytes have previously been activated in vivo.

It is unlikely that a low frequency of pre-6 cell contamination accounts for

this 'fourth waven of RAG expression seen in germinal centres for several

reasons. First, by making use of surgically excised lymph node tissue we dealt

only with tissue containing mature, differentiated B cells. Additionally,

phenotypic analysis demonstrated that these lymph nodes were enriched for

mature B or T lymphocytes and pre B cells expressing Â5 were not detected

(data not shown). Others have documented the expression of early B cell

markers, such as Â5 and TdT (95, 99)in the GC. However, to test for immature,

RAG expressing, contaminating B cells, Hertz et al., (81) set out to distinguish

whether a subset of immature, or pre-B cells present at these peripheral sites

were responsible for the recombinase activity. By inducing V(D)J recombination

in 3-83p6 Tg- splenic B cells, they assayed for A -light chain rearrangements -

which are suppressed in these animals. As discussed earlier, an increase in X-

light chain expressing cells was observed. paired with RAG induction and

significantly , RAG downregulation, upon BCR cross-linking. In keeping with ou r

expectations, the authors maintain that the cells undergoing V(D)J

recombination can express slg and therefore, do not represent pre-B cell

contamination (8 1 ).

4.2 RAG Expression in mature B cells: Models and Implications for

RAG activity

The results of this project suggest that a subset of human GC B

lymphocytes express RAG. This finding, taken together with recent observations

made by investigators using murine models (86. 92, 93, 99, 101-103), provides

new insight into B cell differentiation and V(D)J recombination in a

microenvironment previously thought to be excluded from such events. These

findings also support the notion proposed by Nemazee, Weigert and others. that

new rearrangements are potentially being undertaken in order to edit pre-

existing lg receptors, once exposed to antigen at this peripheral site (86, 94, 95,

99).

Very recent data using a sorted CD77- subset (non-dividing centrocytes)

of human germinal centre B lymphocytes, provided by Lanzavecchia and his

group, has also confimed RAG 1 and RAG 2 expression by PCR assay (94).

Moreover, findings by Meffre et al.. show that mature human tonsillar 6 cells co-

express slg and RAG (95). However, in the later study, both RAG and TdT

expression is shut off upon BCR cross-linking with Ag. These observations

suggest that the mechanisrn driving RAG expression in the periphery may serve

an opposite purpose to that in developing 6 cells responding to the same Ag

stimulus, in that, receptor revision occurs in mature peripheral B cells and

functions as a mechanism for receptor diversification, which is terrninated once

the BCR is cross-linked by the appropriate cognate antigen (95).

In support of this hypothesis, Hertz et al., (81) have demonstrated that

V(D)J recombination in mature B cells is not a mechanism of immune tolerance.

Rather, they found that BCR Iigation inhibited V(D)J recombination induced by

IL-4 and LPS. Moreover, when lg transgenic mice were imrnunized with a range

of ligands varying in avidity for the Tg BCR, only fow-avidity Ag could induce

strong V(D)J recombination. Conversely, high-avidity ligands and non-binding

ligands were unable to induce recombination. Based upon their data, the

authors suggest that V(D)J recombination induced during the immune response

(in GC) alters only the Ag-receptors of B cells with weak reactivity to Ag, in

order to rescue cells with improved receptor affinity and promotes their

contribution to the immune response. Tharefore, this group conclude that BCR

signaling regulates V(D)J recombination in both tolerance and immunity, but in

strikingly different ways (8 1).

Hence, a general model describing M G activity would suggest, that

revision may b e induced by diminished, or lost Ag-binding at the light zone

check-point in the GC. This is where the B cell re-encounters antigen expressed

on FDCs post hypermutation, along the road to affinity maturation (55, 86, 99,

102). Replacement rearrangements rnay serve to rescue failing GC 6 cells, by

editing low affinity receptors, or those debilitated by mutation, perhaps even

allowing for receptor-Ag affinities that could not otherwise be achieved by

somatic mutation alone (8 1, 94, 95, 103). 6 cells which have acquired mutations

resulting in their inability to express a competent slg, even afier further attempts

at recombination, face the fate of deletion by apoptosis.

In support of this, it has been shown that RAG expressing B cells

localized within GC following immunization, were present as apoptotic cells

confined within tingible bodies (102). Re-expressed RAG gene products may

therefore play a role in the revision of unfavorable, or dysfunctional lg receptors

generated in the GC during somatic hypemutation and switch recombination by

giving the cell a 'second chance" to express a new Ag receptor and possibly

averting apoptosis (98).

In essence, a fourth wave of RAG expression in peripheral GC would

provide a frugal mechanism by which the body could preserve cells that would

otherwise be lost to the immune response, or perhaps contribute to the

diversification of the peripheral B ceIl repertoire (81, 94, 95). However, it still has

Figure 1 1. Receptor Editing versus Receptor Selection. In the bone marrow an immature 6 cell encounters one of three fates upon BCR cross-linking. (1) If the BCR demonstrates little or no avidity for presented antigen, the cell is positively selected and will then exit the bone marrow to survey the periphery as a mature naive B cell. However, if the immature 6 cell exhibits a strong avidity for Ag, then the cell will either undergo (2) deletion via apoptosis, or (3) initiate a third wave of RAG expression, known as Receptor editing, leading to secondary light chain gene rearrangements and the expression of an edited receptor which no longer cross reacts with setf-Ag. At this stage of development. this third wave of RAG expression is considered to be a mechanism of immune tolerance designed to delete any potentially deleterious cells which may cross react with self-Ag, while first giving cells a "second chance" to generate an non-autoreactive receptor. Receptor selection, in contrast to receptor editing, serves as a mechanism to rescue mature 6 cells which have undergone hypermutation resulting in Me generation of a BCR with low or decreased avidity for Me specific Ag. A presently unknown signal, perhaps thought to be 11-4 or IL-7, induces a fourth wave of RAG expression in this pst-hypemutation cellular subpopulation in the germinal centre allowing further V(D)J rearrangements to occur. This fourth wave of RAG expression is hypothesized to be a mechanism of receptor diversification which ailows the Ag to select the best cognate receptor. While cells possessing BCRs with high avidity for foreign Ag continue to differentiate into memory or plasma B cells, celts having no avidity die by apoptosis.

yet to be detennined, which of the various signals post antigen stimulation,

induces RAG expression in GC B cells, which are either non-functional or

autoreactive and whether the nature of this expression is a mechanism of B cell

tolerance, affinity maturation, or enhanced diversification.

4.3 Implications in Disease:

It has been reported that a mutation in either of the RAG genes (nul1

mutation or missence) renders the genes able to maintain partial recombinase

activity, but leads to V(D)J deficiencies and manifests in a severe

immunodeficiency characterized as Ornenn Syndrome (112). Structural

mutations of the RAG genes have also been shown to be responsible for

approximately half of the number of human B cell-negative severe combined

immunodeficiency (B- SCID) cases, which results in a complete lack of B and T

lymphocytes, due to loss or dramatic reduction in V(D)J recombination activity

( 113). Inappropriate expression has previously been implicated in chromosomal

translocations and lymphoid malignancies in hurnans (46). Recent data has

shown that the RAG genes are able to mediate transposon activity. Therefore,

RAG may play a significant role in these translocations due to this capacity (3 1,

45-47). Future studies revealing the molecular mechanisms responsible for

proper RAG expression will hopefully elucidate how this fourîh wave of

expression is regulated in peripheral lymphoid organs. As well as its implication

in human disease and grant a better understanding of whether this re-

expression of RAG is indeed a mechanism of receptor editing, or receptor

selection.

4.4 Future Studies:

Several studies carried out in both human and mouse have described a

specific subset of germinal centre 6 lymphocytes which expresses RAG (92-95,

99). Although most groups (including ourselves) are in agreement as to the

phenotype of these cells (slg'), one group daims to have pin pointed RAG

expression to a slg- centrocyte population (94). However, this study was

performed using only one sample and was problematic.

Recent studies carried out by Meffre et al., and Hertz et al., provide

evidence that antigens varying in affinity for the B cell receptor induce

differential 6 cell responses at different stages of 6 cell differentiation (81, 95).

Contrary to data obtained from immature IgM+/lgD- BM cell studies, in which slg

cross-linking with self-Ag rapidly initiated receptor editing, indicated by

increased recombinase (RAG) mRNA levels (68, 69, 80). Mature B cells have

been shown to shut off RAG expression upon BCR cross-linking with self-Ag

(81) (95) in a process of receptor selection, not receptor editing. RAG expression

was inhibited in human lgD-/CD38+/RAG+ GC B cells with the addition of anti-A

and anti-K mAbs to culture (95). As weil, these suppressive effects were

characterized in dose-response experiments in wh ich intact anti-K, anti-3c and

Fab'2 fragments were employed. Together, both Abs demonstrated a dramatic

downregulation of both FiAG 1 and RAG 2, suggesting that strong cross-linking

is a mechanism of positive selection for B cells that produce high affinity

receptors, by receptor revision in the periphery.

Similar findings by Nemazee's group, using Ml3 phage-display in a

murine system, demonstrated that immunization with ligands of varying avidities

for the BCR had various effects on recombinase activity. tt was determined that

low-avidity Ag could induce strong V(D)J recombination, while high-avidity

ligands and those lacking avidity, could not induce new h rearrangements

characteristic of further recombination events (8 1). Taken together, these data

support the modef that BCR cross-linking by high affinity ligand will inhibit

receptor revision and stimulate the expansion of high affinity clones.

Meanwhile, centrocytes with a lower affinity will undergo further recombination

events and therefore revision, in attempts to improve their affinity for Ag.

ln consideration of these observations, it would be of interest to extend

studies to test the effects of various Ag-stimuli on RAG induction in the GC, in

order to better assess the type of Ag required to achieve this effect. It is also of

interest to sumise whether soluble antibody yields a different effect in RAG

expression, as compared to bound antibody resembling the Ag/Ab complexes

presented on FDCs. Results from proposed studies such as these, may help us

to better understand the signals necessary to control the regulation of RAG

expression in the periphery, as well as the origin of such signals. Moreover,

such data may elucidate whether a threshold effect, as observed in T cells, has

a role in RAG induction and regulation at this peripheral site.

Furthemore, studies should be perfomied to clarify whether a single

stimuius, such as Ag alone, is enough to induce RAG expression, or whether a

fourth wave of RAG expression is the result of multiple stimuli. Cytokines such

as IL-4 and IL-7 have already been shown to be a required pre-requisite for

RAG expression in murine mature 8 cell studies. In contrast, human data to

date, indicates that the addition of IL-2, 11-4, or IL40 has no effect on RAG

expression in mature GC 6 cells CO-cultured with anti-CD40 ligand (95).

l ndicating that different cytokines, or even distinct pathways are required for

RAG reactivation. Cell-to-cell signaling between light zone 6 cells and T

lymphocytes is another proposed mechanisrn of M G regulation in GC (103).

which has yet to be explored.

RAG regulation, in al1 probabiiity, requires multiple signals and may be

regulated at more than just the transcriptional level. Although several

transcription factors have recently been implicated in the transcriptional controi

of the RAG genes and include C/Ebp and Ets ( 1 14). Future work shoutd also

address translational and post-translational regulation of peripheral RAG

expression. Perhaps by first defining the factors involved in providing the tissue

specificity of RAG expression, the factors involved in regulating this expression

will become evident.

References

1. McBlane, J. F., D. C. van Gent, O. A. Ramsden, C. Romeo, C. A. Cuomo, M. Gellert, and M. A. Oettinger. 1995. Cleavage at a V(D)J recombination signal requires only RAG-1 and RAG-2 proteins and occurs in two steps. Cell83:387.

2. Ramsden, O. A., T. T. Paull, and M. Gellert. 1997. Cell-free V(D)J recombination. Nature 388:488.

3. Turka, L. A., D. G. Schatz, M. A. Oettinger, J. J. M. Chun, C. Gorka, K. Lee, W. T. McConack, and C. B. Thompson. 1991. Thymocyte expression of RAG-1 and RAG-2: Termination by T cell receptor cross-linking. Science 253.778.

4. Grawunder, U., T. M. Leu, O. Schatz, A. Werner, A. G. Rolink, F. Melchers, and T. H. Winkler. 1995. Downregulation of expression of Rag-1 and Rag-2 in preB cells aeer functional immunoglobulin p-heavy chain rearrangernent. lmmunity 3:6O 1.

5. Wilson, A., W. Held, and H. R. MacDonald. 1994. Two waves of recombinase gene expression in developing thymocytes. J. Exp. Med. 1 79: 1355.

6. Ma, A., P. Fischer, R. Dildrop, E. Oltz, G. Rathbum, P. Achacoso, A. Stall, and F. W. Alt. 1992. Surface IgM rnediated regulation of RAG gene expression in Ep-N-myc 6 cell lines. EMBO J. 11:2727.

7. Stiernholm, B. J. N., and N. L. Berinstein. 1993. Upregulated RAG expression in slg- variants of a human mature 6 cell line undergoing secondary Igh rearrangements in cell culture. Eur. J. Immunol. 23:1501.

8. Verkoczy, L. K., N. B. J. Stiernholm, and N. L. Berinstein. 1995. Up- regulation of recombination activating gene expression by signal transduction through the slg receptor. J. Immunol. 1545136.

9. Tonegawa, S. 1 983. Somatic generation of antibody diversity. Nature 302:575.

10. Sakano, H.. K. Huppi, G. Heinrich, and S. Tonegawa. 1979. Sequences at the somatic recombination sites of immunoglobulin light chah genes. Nature 280:288.

11. Hesse, J., M. R. Lieber, M. Gellert, and K. Mizuuchi. 1987. Extra- chromosomal DNA substrates in pre-6 cells undergoe inversion or deletion at immunoglobulin V-D-J joining signals. Ce11 49775.

12. Akira, S., Okazaki, K. and Sakano, H. 1987. Two pairs of recombination signals are sufficient to cause immunoglobulin V(D)J joining. Science 238: 1 134.

13. Sakano, H., R. Maki, Y. Kurosawa, W. Roeder, and S. Tonegawa. 1980. Two types of somatic recombination are necessary for the generation of complete immunoglobulin heavy chain genes. Nature 286:676.

14. van Gent, D. C., D. A. Ramsden, and M. Gellert. 1996. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination. Ce11 85: 107.

15. Oettinger, M., D. Schatz, C. Gorka, and 0. Baltimore. 1990. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 248: 15 1 7.

16. Schatz, D., M. Oettinger, and M. Schlissel. 1992. V(D)J recombination: molecular biology and regulation. Annu. Rev.lmmunol. 1 Or359.

17. Roth, D. B., J. P. Menetski, P. B. Nakajirna, M. J. Bosma, and M. Gellert. 1992. V(D)J recombination: broken DNA molecules with covalently sealed (hairpin) coding ends in scid mouse thyrnocytes. Ce11 70:983.

18. Roth, D. B., P. B. Nakajima, J. P. Menetski, M. J. Bosma, and M. Gellert. 1992. V(D)J recombination in mouse thymocytes: double-strand breaks near T cell receptor 6 rearrangement signals. Ce11 69:4 1.

19. Schlissel, M., A. Constantinescu, T. Morrow, M. Baxter, and A. Peng. 1993. Double-strand signal sequence breaks in V(D)J recombination are blunt 5'-phosphorylated, RAG-dependent, and cell cycle regulated. Gen. Devel. 7:2520.

20. van Gent, D. C., J. F. McBlane, D. A. Ramsden, M. J. Sadofsky, J. E. Hesse, and M. Gellert. 1995. initiation of V(D)J recombination in a cell-free system. Ce11 81:925.

21. Schatz, D., M. Oettinger, and D. Baltimore. 1989. The V(D)J recombination activating gene (RAG-1). Ce11 59: 1035.

22. Mombaeits, P., J. lacomini, R. Johnson, K. Hemp, S. Tonegawa, and V. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Ce11 68:869.

23. Shinkai, Y., G. Rathbun, K. Lam, E. Ob, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. Stall, and F. Alt. 1992. RAG-2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Ce11 68.855.

24. Chen, Y. Y., L. C. Wang, M. S. Huang, and N. Rosenberg. 1994. An active v-ab1 protein tyrosine kinase blocks immunoglobuiin light-chain gene rearrangement. Gen. Develop. 8:688.

25. Ramsden, D. A., and M. Gellert. 1995. Formation and resolution of double-strand break intenediates in V(D)J rearrangement. Genes Devel. 9:24 09.

26. Zhu, C., and D. B. Roth. 1995. Characterization of coding ends in thymocytes of scid rnice: implications for the mechanism of V(D)J recornbination. Ce11 2: 101.

27. Lewis, S. M. 1994. The mechanisms of V(D)J joining: lessons from molecular, immunological, and comparative analysis. Adv. Immunol. 56:27.

28. Hiom, K. and M. Gellert. 1998. Assembly of a 12/23 Paired Signal Complex: A Critical Point in V(D) J Recombination. Molecuiar Cell 1: 101 1.

29. Eastman, Q. M., T. M. Leu, and D. G. Schatz. 1996. Initiation of V(D)J recombination in vitro obeying the 12/23 rule. Nature 380:85.

30. Kim. D. R., and M. A. Oettinger. 1998. Functional analysis of coordinated cleavage in V(D)J recombination [In Process Citation]. Mol Ce11 Bi01 18:4679.

31 . Craig, N. L. 1 996. V(D)J recombination and transposition:closer than expected. Science 277:1512.

32. Agrawal, A., and D. G. Schatz. 1997. RAG1 and RAG2 fom a stable postcleavage synaptic complex with DNA containing signal ends in V(D)J recombination. Ce11 89:43.

33. Spanopoulou, E., F. Zaitseva, F. H. Wang, S. Santagata, D. Baltimore, and G. Panayotou. 1996. The homeodomain region of RAG-1 Reveals the parallel mechanisms of bacterial and V(D)J recombination. Cell87:263.

34. Blunt, T., N. J. Finnie, G. E. Taccioli, G. C. M. Smith, J. Demengeot, T. M. Gottlieb, R. Mizuta, A. J. Varghese, F- W. Ait, P. A. Jeggo, and S. P. Jackson. 1995. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80:813.

35. Gottlieb, T. M., and S. P. Jackson. 1993. The DNA-dependent protein kinase: requirement for DNA ends and association with Ku antigen. Cefl 72:131.

36. Zhu Cl B. M., Lim DS, Hasty P and 0. Roth. 1996. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intemediates. Ce11 86:379.

37. Danska, J., D. Holland, S. Mariathasan, K. Williams and C. J. Guidos. 1 996. Biochemîcal and genetic defects in the DNA-dependent protein kinase in murine scid lymphocytes. Mol Cell Bio 16.5507.

38. Ramsden, D. A., van Gent, and M. Gellert. 1997. Specificity in V(D)J recombination: new lessons from biochemistry and genetics. Curr. Opin. Immunol. 9: 1 14.

39. Grawunder, U., M. Wilm, X. Wu, P. Kulesza, T. E. Wilson, M. Mann, and M. R. Lieber. 1997. Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature 388:492.

40. Ichihara, Y., M. Hirai, and Y. Kurosawa. 1992. Sequence and chromosome assignment to 1 1 p l 3-pl 2 of human RAG genes. lmmunol Lett 33:Z 77.

41. Carlson, L., M. Oettinger, D. Schatz, E. Masteller, E. Hurley, W. McComack, D. Baltimore, and C. Thompson. 1991. Selective expression of RAG-2 in chicken 6 cells undergoing immunoglobulin gene conversion. Ce11 64:ZO 1.

42. Fuschiotti, P., N. Harindranath, R S. Mage, W. T. McCorrnack. P. Dhanarajan, and K. H. Roux. 1993. Recombination activating genes-1 and -2 of the rabbit: cloning and characteriration of gemline expressed genes. Mol. lmmunol. 30: 102 1.

43. Greenhalgh, P., and C. E. M. Olesen. 1993. Characterization and expression of recombination activating genes (RAG-1 and RAGP) in Xenopus la e vis. J. lmmunol. 15 1 :3 1 00.

44. Zamn, A. A.. 1. Fong, L. Malkin, P. A. Manden, and N. L. Berinstein. 1997. Cloning and characterization of the human recombination activating gene 1 (RAG I ) and RAG2 promoter regions. J. Immunol. 1 W438Z.

45. Roth, D.B. and N. L. Craig. 1998. V(D)J Recornbination: A Transposase Goes to work. Ce11 94:411.

46. Hiom, K., M. Melek and M. Geller?. 1998. DNA Transposition by the RAG 1 and RAG2 Proteins: A Possible Source of Oncogenic Translocations. Ce11 94:463.

47. Agrawal A., Q. M., Eastman and 0. Schatz. t 998. Transposition mediated by RAG 1 and RAG 2 and its implications for the evolution of the immune system. Nature 394:744.

48. Yancopoulos, G., T. Blackwell, H. Suh, L. Hood, and F. Alt. 1986. lntroduced T cell receptor variable region gene segments recombine in pre-B cells: evidence that B and T cells use a common recombinase. CeIl #:Z5l.

49. Yancopoulos. G. D.. and F. W. Ait. 1986. Regulation of the assembly and expression of the variable region genes. Annu Rev Immun01 4:339.

50. Chun. J.D. Schatz, M. Oettinger, R. Jaenisch, and D. Baltimore. 1991. The recombination activating gene-1 (RAG-1) transcript is present in the murine central nentous system. Cell64: 189.

51. Melchers, F. 1979. Three Waves of Lymphocyte Developrnent during ernbryonic development in the mouse. INSERM Symp. 10:281.

52. Rolink, A., and F. Melchers. 1991. Molecular and cellular origins of B lymphocyte diversity. CeIl 66: 1087.

53. Nemazee D., and K. Bijrki. 1989. Clonal Deletion of 6 Lymphocytes in a Transgenic mouse bearing anti-MHC classl antibody genes. Nature 337.562-

54. Goodnow C.. H. Jorgensen, R.A Brink and A. Basten. 1989. Induction of Self-tolerence in mature peripheral B Lymphocytes. Nature 342:385.

55. MacLennan I., K. Toellner, M. Casamayor-Palleja, E. Chan, D. Sze, S. Luther and H. A. Orbea. 1997. The Changing preference of T and B cells for partners as T-dependent antibody and responses develop. lmmunological Revie ws l56:S3.

56. Bumet, F. M. 1959. The Clonal Selection Theory of Aquired Imrnunity. The University Press, Cambridge.

57. Reth. M. 1 992. Antigen receptors on B lymphocytes. Annu. Rev. Immunol. 1 O:9 7.

58. Melchers. F., A. Rolink, U. Grawunder, T. H. Winkler, H. Karasuyama, and J. Andersson. 1995. Positive and negative selection events during 6 lyrnphopoiesis. Curr. Opin. lmmunol. 7:214.

59. Sakaguchi, N., and F. Melchers. 1986. Lambda 5, a new light-chain- related locus selectively expressed in pre- B lymphocytes. Nature 324r579.

60. Kudo, A., and F. Melchers. 1987. A second gene. VpreB in the lambda 5 locus of the mouse, which appears to be selectively expressed in pre-B lymphocytes. Emba J 6:2267.

61. Bauer, S.. R. Kudo and F. Melchers. 1988. Structure and pre-6 lymphocyte -restricted expression of the VpreB gene in Humans ans consewation of its structure in other rnammalian species. EMBO J. 7:l II.

62. Melchers, F., D. Haasner, U. Grawunder, C. Kalberer, H. Karasuyama, T. Winkler, and A. G. Rolink. 1994. Roles of IgH and L chains and of surrogate H and L chains in the development of cells of the B lymphocyte Iineage. Annu. Rev. Immunol. lZ:ZO9.

63. Desiderio, S. 1994. The B cell antigen receptor in 6-cell development. Curr. Opin. Irnmunol. 6:248.

64. Hagman, Je, and R. Grosschedl. 1994. Regulation of gene expression at early stages of B-cell differentiation. Curr. Opin. lmmunol. 6:222.

65. Aitl F. W., G. Rathbun, E. O b , G. Taccioli, and Y. Shinkai. 1992. Function and control of recornbination-activating gene activity. Ann. N Y Acad. Sei. 652:Z 77.

66. Yoncopoulos, G. D., T. K. Blackwell, H. Suh, L. Hood, and F. W. Alt. 1986. lntroduced Tte l l receptor variable region gene segments recombine in pre-6 cells: Evidence that 6 and T cells use a common recombinase. Cell44:251.

67. Brandle, D., C. Muller, T. Rulicke, H. Hengartener, and H. Pircher. 1992. Engagement of the T-cell receptor during positive selection in the thymus down- reg ulates RAG- 1 expression. Proc. Natl. Acad. Sci. USA 89:9529.

68. Tiegs, S. L., O. M. Russell, and D. Nemazee. 1993. Receptor Editing in Self-reactive Bone Marrow B Cells. J. Exp. Med. 177:1009.

69. Gay, D., T. Saunders, S. Camper, and M. Weigert. 1993. Receptor Editing: An Approach by Autoreactive B Cells to Escape Tolerance. J. Exp. Med. 1 77:999.

70. Mombaerts, P., A. R. Clarke, M. A. Rudnicki, J. lacomini, S. Itohara, J. J. LaFaille, L. Wang, Y. Ichikawa, R. Jaenisch, M. L. Hooper, and S. Tonegawa. 1992. Mutations in T-cell antigen receptor genes a and P block thmocyte development at different stages. Nature 360:225.

71. Shinkai, Y., S. Koyasu, K. Nakayama, K. M. Murphy, D. Y. Loh. E. L. Reinhertz, and F. W. Alt. 1993. Restoration of T cell development in RAG-2- deficient mice by functional TCR transgenes. Science 259:822.

72. Spanopoulou, E., C. A. J. Roman, L. M. Corcoran, M. S. Schlissel, D. P. Silver, D. Nemazee, M. C. Nussenzweig, S. A. Shinton, R. R. Hardy, and D. Baltimore. 1 994. Functional immunoglobuiin transgenes guide ordered B-cell differentiation in RAG-1 deficient mice. Gen. Develop. 8: 1030.

73. Nemazee, 0. and K. Burki. 1989. Clonal Deletion of autoreactive B lymphocytes in bone manow chimeras. Proc-NatLAcad. Sci üSA 86:8039.

74. Hartley, S. B., J. Crosbie, R. Brink, A B . Kantor, A. Basren, and C.C. Goodnow. 1991. Elimination from peripheral lymphoid tissues of self-reactive B- lymphocytes recognizing membrane-bound antigens. Nature 353:765.

75. Ghia P., G. A., Signer E., Winkier T., Melchers F. and A. G. Rolink. 1995. Immature B Cells from Human and mouse bone marrow can change their surface Iight chain expression. Eur. J. lmmunol25:3 108.

76. Prak, E. L., M. Trounstine, D. Huszar, and M. Weigert. 1994. Light chain editing in K-deficient animals: a potential mechanism of B cell tolerance. J. Exp. Med. 180: 1805.

77. Chen, C., Z Nagy, E. L. Prak, and M. Weigert. 1995. lmmunoglobulin heavy chah replacement: a mechanism of receptor editing. Immunity 3:747.

78. Chen C., N. 2.. Radic M., Hardy R., Huszar D., Camper S. and M. Weigert. 1995. The Site and Stage of anti-DNA B cell deletion. Nature 373:252.

79. Nemazee, O. 1996. Can receptor editing play an important role in normal 6-cell development ? J. Autolmmun. 9:259.

80. Hertz, M., and D. Nernazee. 1997. BCR ligation induces receptor editing in IgM+lgD- bone marrow 6 cells in vitro. lmmunify 6:429.

81. Hertz, M., V. Kouskoff, T. Nakamura and D. Nemazee. 1998. V(D)J recombinase induction in splenic 8 lymphocytes is inhibited by antigen-receptor signalling. Nature 394:292.

82. Verkoczy, L. K. 1995. Regulation studies of the human recombination activating genes (RAG-1 and RAG-2). In Immunology. University of Toronto, Toronto, p. 95.

83. Nakayama, K., 1. Negishi, K. Kuida, Y. Shinkai, M.C. Louie, L.E. Fields, P.J. Lucas, V. Stewart, F.W. Alt. 1993. Disappearance of the lymphoid system in Bcl-2 homozygous mutant chimeric mice. Science 5128:1584.

84. Lang, J., B. Arnold, G. Hamrnerling, A. Harris, S. Korsmeyer, D. Russell, A. Strasser and D. Nemazee. 1997. Enforced Bci-2 Expression Inhibits Antigen- mediated Clona1 Elimination of Peripheral 6 Cells in an Antigen Dose- dependent Manner and promotes Receptor Editing in Autoreactive, Immature 6 cells. J. Exp. Med 186:1513.

85. Retter, M. and D. Nemazee. 1998. Receptor Editing Occurs Frequently during Normal B cell development. J. Exp. Med 188:1231.

86. Han, S., S. R. Dillon, B. Zheng, M. Shimoda, M. S. Schlissel, and G. Kelsoe. 1997. V(D)J recombinase activity in a subset of germinal center 8 lymphocytes. Science 278:30 1.

87. Zheng, B., S. Han, E. Spanopoulou, and G. Kelsoe. 1998. lmmunoglobulin gene hyperrnutation in germinal centres is independent of the RAG V(D)J recombinase. lmmunological Reviews 162: 133.

88. Berek, C. 1993. Somatic mutation and memory. Curr. Opin. Immunol. 5:Z 18.

89. Tarlinton, D. 1998. Germinal centres:form and function. Current Opinion in lmm unology 1 O:245.

90. MacLennan, 1. 1991. The centre of hypennutation. Nature 354:352.

91. Berek, C., A. Berger, and M. Apel. 1991. Maturation of the immune response in germinal centers. CeIl 67:1121.

92. Han, S., B. Zheng, D. G. Schatz, E. Spanopoulou, and G. Kelsoe. 1996. Neoteny in lymphocytes: RAG-1 and MG-2 expression in germinal centre B ce1 l S. Science 274:2094.

93. Hikida, M., M. Mon, T. Takai, K. Tomochika, K. Hamatani, and H. Ohmori. 1996. Reexpression of RAG-1 and M G - 2 genes in activated mature mouse B ce l l S. Science 274:2092.

94. Giachino, C., E. Padovan and A. Lanzavecchia. 1998. Re-expression of RAG-1 and RAG-2 genes and evidence for Secondary rearrangements in human germinal centre B Lymphocytes. Eur. J. lmmunol28:3506.

95. Meffre, E., F. Papavasiliou, P. Cohen, O. de Bouteiller, D. Bell, H. Karasuyama, C. Schiff, J. Banchereau, Y. Liu and M. Nussenzweig. 1998. Antigen Receptor Engagement Tums off the V(D)J Recombination Machinery in Human Tonsil 6 cells. J. Exp. Med. 188:765.

96. Gillis, J., A. Zarrin, L. Verkoczy, E. lakhnina, 1. Fong, G. Wu and N. Berinstein. 1999. Expression and Recombinase Activity of RAG 1 and Two Splice Variants of RAG 2 in Mature Human Prirnary Tonsilar B Lymphocytes. J. of lrnmunoi. Manuscript under review.

97. Pascual, V., Y. J. Liu, A. Magalski, O. de Bouteiller, J. Banchereau, and D. J. Capra. 1994. Analysis of somatic mutations in five B cell subsets of human tonsil. J. Exp. Med. 180:329.

98. Kelsoe, G. 1997. Life and death in germinal centres. Immunity 4:107.

99. Papavasiliou, F., R. Casellas, H. Sun, X. F. Qin, E. Besmer, R. Pelanda, O. Nemazee, K. Rajewsky, and M. C. Nussenzweig. 1997. V(D)J recombination in mature B cells: a mechanism for altering antibody responses. Science 2 78:298.

100. Tweedale, M. E., B. Lim, N. Jamal, J. Robinson, J. Zalcberg, G. Lockwood, M. Minden, and H. A. Messner. 1987. The presence of clonogeneic cells in high-grade lymphorna: a prognostic factor. Blood 69:7307.

101. Hikida, M., M. Mon', T. Kawabata, T. Takai, and H. Ohmori. 1997. Characterization of B cells expressing recombination activating genes in germinal centers of irnmunized mouse lymph nodes. J. Immunol. 158:2509.

102. Hikida, M., and H. Ohmori. 1998. Rearrangement of lambda light chain genes in mature B cells in vitro and in vivo. Function of reexpressed recombination-activating gene (RAG) products. J Exp Med 187:795.

103. Hikida, M., Y. Nakayama, Y. Yamashita, Y. Kumazawa, S. 1. Nishikawa, and H. Ohmori. 1998. Expression of recombination activating genes in germinal center B cells: involvement of inteileukin 7 (11-7) and the IL-7 receptor. J Exp Med 188:365.

104. Kurioka, H., H. Kishi, H. Isshiki, H. Tagoh, K. Mon, T. Kitagawa, T. Nagata, K. Dohi, and A. Muraguchi. 1996. Isolation and characteriration of a TATA-less promoter for the human RAG-1 gene. Mol. Immunol. 33:1059.

105. Brown, S. T., G. A. Miranda, Z Galic, 1. 2. Hartman, C. J. Lyon, and R. J. Aguilera. 1997. Regulation of the RAG-1 promoter by the NF-Y transcription factor. J. Immunol.:5U71.

106. Neale, G., T. Fitzgerald, and R. Goorha. 1992. Expression of the V(D)J recombinase gene RAG-1 is tightly regulated and involves both transcriptional and post-transcriptional controls. Mal.lmmunol. 29: 1457.

107. Spanopoulou, E-, P. Cortes, C. Shih, C. M. Huang, D. P. Silver, P. Svec, and D. Baltimore. 1995. Localization, Interaction, and RNA binding properties of the V(D)J recombination-activating proteins RAGl and RAG2. lmmunity 3:715.

108. Lin, W. C., and S. Desiderio. 1994. Cell cycle regulation of V(D)J recom bination-activating protein RAG-2. Proc. Natl. Acad. Sci. USA 972733.

109. Li, Z., 0. 1. Dordai, J. Lee, and S. Desiderio. 1996. A conserved degradation signal regulates RAG-2 accumulation during cell division and links V(D)J recornbination to the cell cycle. Immunity 5-575.

11 0. Mueller, P. R. and B. Wold. 1989. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science 246:780.

11 1 . Pennycook, J. L. M. H., A. Marshall and G.E. Wu. 1997. PCR Assays for Endogenous lg Gene Rearrangement. lmmunology Methods ManuaL-239.

1 12. Villa, A., S. Santagata. F. Boui, S. Giliani, A. Frattini, L. Imberti, L. B. Gatta. H. D. Ochs, K. Schwarz, L. D. Notarangelo, P. Veuoni, and E. Spanopoulou. 1 998. Partial V(D)J recombination activity leads to Omenn syndrome. Cell93:885.

11 3. Schwarz, K., G. H. Gauss, L. Ludwig, U. Pannicke, Z Li, D. Lindner, W. Friedrich, R. A. Seger, T. E. Hansen-Hagge, S. Desiderio, M. R. Lieber, and C. R. Bartram. 1996. RAG mutations in human B cell-negative SCID. Science 274:97.

1 1 4. Fong, 1.. Zamn A., and N. Berinstein. 1999. CEBP Contributes to the Regulation of the Human Recombination Activating Gene 2 Promoter. in press.