Post on 28-Dec-2015
DNA DNA TECHNOLOGYTECHNOLOGY• Transgenic organism
• Restriction Enzyme• GMO = genetically modified organism
• Gene therapy• Vector
• Recombinant DNA• PCR (polymerase chain reaction)
• Gel Electrophoresis• Cloning
• Stem cells
Transgenic Organisms
What are they?
Organisms that carry genes from another species
The first transgenic organisms were bacteria
First transgenic animal happened in 1975
A mouse carried an ape gene+
How in the world did that happen?!
First you find the gene that
you want to transfer over
Then you must cut that gene out of the parent DNA
The area you want to put the DNA
in the other organism has to be found
Cut the new DNA so you can insert into vector
Gene put into its new DNA home
How do you cut the DNA?
Use restriction enzymes: Bacterial proteins that have the ability to cut strands of DNA at a specific nucleotide sequence.
How does the cut piece of DNA get into the targeted organisms cells?
For animals:
Transgene put into a vector and then into a fertilized egg
For Plants:
Transgene put into vector which is put into a bacterium that infects plant cells.
GGAATTCCTTAAGTCAACCGCTTAAGG
Gene you want. Makes Human
insulin
GGAATTCCTTAAGTCAACCGCTTAAGG
Cut out by restriction enzymes
GTACTGACCCTTGGTA AGAGTACGTTTGT
DNA inside vector cut with restriction
enzymes
What the heck is a vector?
A Vector is a Virus that has been re-engineered
A new piece of DNA has been added to the virus and often times the part of DNA that infects you is removed.
Transgene
GTACTGACCCTTGGTA AGAGTACGTTTGT
TTAAGTCAA
Transgene put into vector DNA
Vector infects
egg
Vector puts Transgene
into egg DNA
Egg put into mother and when
baby cow is born it makes human
insulin
Vectors
• Example: plasmid (small ring of DNA in a bacterial cell
• May be biological (viruses or plasmids)• Or mechanical (micropipette or “bullet”
So why don’t we make all kinds of new animals and plants?
We don’t know how it will affect our environment
If something is wrong with them its not like we can just take them all back up
They can mutate
What other effects will it have besides the one intended
Examples of GMOs (genetically modified organisms) that we have now………
Sterile male crop pests
Plants that have an insecticide in them
Gene Therapy
What in the world is gene therapy?!?!
The treatment of certain disorders, especially genetic disorders, by introducing specific engineered genes into
a patient's cells
Several methods can be used when treating a genetic disorder:
A normal gene may be inserted into a nonspecific location within the genome to replace a nonfunctional gene. This approach is most common.
An abnormal gene could be swapped for a normal gene.
The abnormal gene could be repaired, which returns the gene to its normal function.
The regulation (the degree to which a gene is turned on or off) of a particular gene could be altered
So how do we do this?
A vector is used to deliver the DNA needed to fix the problem into the target cells……the ones that need to be fixed.
Just like in transgenic organisms the vector infects the cells and delivers the DNA into the cell to be put into the target cell’s DNA
This new DNA changes the target cells so that they are now normal.
What kind of disorders are we talking about here?
HemophiliaSickle Cell Anemia
Huntington’s Disease Thalassaemia
Cystic Fibrosis
So don’t we cure everybody?
FDA has not approved gene therapy because it has proven dangerous.
Not a permanent cure
Our bodies can have an immune response to the vector and DNA. Example of this is France.
Many diseases are caused by multi-gene problems
PCR: polymerase chain reaction
• Replicates DNA outside of living organisms
• Uses heat and enzymes to make lots of DNA very fast
• Used for crime investigations, diagnose diseases (like HIV) and cloning
Uses of Recombinant DNA
• Insect resistant crops• Growth hormones• Insulin for diabetics• Higher yielding food plants• Clotting factor for hemophiliacs• E. coli produces indigo dye to color jeans• Cheese, laundry detergents, and sewage
treatment are enhanced by recombinant DNA
Steps of Gel Electrophoresis:
• Restriction enzymes cut DNA into fragments. The fragmented DNA is injected into wells in the gel. A current is sent through the gel and the fragments will move at different speeds that appear as bands under UV light. Bands can be matched up to identify criminals, bodies or fossils or to determine parentage. Longer fragments move slower than short ones.
Stem Cells
• Undifferentiated cells that can be genetically engineered to express the genes for any desired type of tissue– Usually embryonic = controversial– But is there another way…?
• Often used in regenerative medicine– Current research hopes to treat diseases such
as Parkinson's disease, Alzheimer's disease, spinal cord injury, heart disease, diabetes and arthritis.
Plasmid Activity: p. 355 in textbook
• Write the letters on the LONG strip:• GGATCC GGATCC• CCTAGG CCTAGG• Write the letters on the SHORT strip:• GGATCC
CCTAGG
Make sure all letters are equally spaced
Plasmid activity p. 354-355
• Tape the ends of the shorter strip together.• This is the plasmid• Cut the longer strip of DNA in 2 places at
the palindrome GIGATCC. This is the foreign DNA. Cutting it represents restriction enzymes.
• Cut the plasmid in the same way.• Insert the foreign gene into the plasmid
and tape together.