Post on 11-Jan-2016
DNA Fingerprinting of Bacterial Communities
Overview• Targets gene for ribosomal RNA (16S rDNA)• Make many DNA copies of the gene for the entire
community DNA using modified PCR• Cut amplified DNA with restriction enzyme• Slight variations in 16S rDNA sequence among the
different organisms results in different fragment lengths
• When analyzed, only the first fragment (length varies for each type of organism) of the 16S rDNA is detected
• Gives a “fingerprint” of the number of different organisms in a sample (each a different peak) and relative abundance (height of peak)
• Identity of organism represented by each peak not known
T-RFLPT-RFLPTagged (or Terminal) Restriction Fragment Length Tagged (or Terminal) Restriction Fragment Length
PolymorphismPolymorphism
PCR 16s w/ 1 fluorescent fluorescent
primer
Mixed community DNA Digest PCR product with restriction enzyme
Labeled fragments of different taxa are different lengths
Separate fragments on sequencer
Fluorescence detector produces graph of fragments present
(Each peak a different type of organism)
Example Fingerprint• T-RFLP from control site County Brigde
Why 16S rDNA?• Not all (actually a small percentage)
microorganisms can be easily cultured– Culture-based studies are skewed
• All organisms have ribosomes• Function of small subunit RNA (16S in bacteria
and archaea) identical in all organisms• Regions of varying conservation
– Some so conserved they are “universal”– Some so variable they can be used to distinguish
between very closely related organisms (different strains of same species)
PCR
• Cool website tutorial
• Used to amplify a specified region of DNA– Region of DNA specified by “primers” which
bind to short sequences of DNA on either end– Primers are short (~18 nucleotide) DNA
oligomers
Restriction Enzymes• Enzymes from bacteria which cut DNA at specific
sequences• Naturally used by bacteria to protect themselves from
foreign DNA (i.e. viruses)• Used by biologists like DNA scissors
– Useful because you know the sequence where they cut– can differentiate sequences of DNA by different fragment lengths
Separating DNA• Agarose gel electrophoresis separates DNA
fragments by size• T-RFLP uses capillary electrophoresis
– Same principle but 1 nucleotide resolution
1 2
CATGGTGGTACCACTTAA
AATTCGAATTCTTGTGCTTAAGAACA
CATGGTGGTACCACTTAA
AATTCTTGTGAACA
AATTCGGCTTAA
Example Fingerprint(s)• What do these tell us about the bacterial
community?
• What can’t they tell us?
Control (County Bridge) AMD-impacted (DFB099)
Dendrogram of Community Similarities
More similar T-RFLP patterns on closer branches
Control: CBAMD:DFB099CCFB