DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make...

10
DNA Fingerprinting of Bacterial Communities

Transcript of DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make...

Page 1: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

DNA Fingerprinting of Bacterial Communities

Page 2: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

Overview• Targets gene for ribosomal RNA (16S rDNA)• Make many DNA copies of the gene for the entire

community DNA using modified PCR• Cut amplified DNA with restriction enzyme• Slight variations in 16S rDNA sequence among the

different organisms results in different fragment lengths

• When analyzed, only the first fragment (length varies for each type of organism) of the 16S rDNA is detected

• Gives a “fingerprint” of the number of different organisms in a sample (each a different peak) and relative abundance (height of peak)

• Identity of organism represented by each peak not known

Page 3: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

T-RFLPT-RFLPTagged (or Terminal) Restriction Fragment Length Tagged (or Terminal) Restriction Fragment Length

PolymorphismPolymorphism

PCR 16s w/ 1 fluorescent fluorescent

primer

Mixed community DNA Digest PCR product with restriction enzyme

Labeled fragments of different taxa are different lengths

Separate fragments on sequencer

Fluorescence detector produces graph of fragments present

(Each peak a different type of organism)

Page 4: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

Example Fingerprint• T-RFLP from control site County Brigde

Page 5: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

Why 16S rDNA?• Not all (actually a small percentage)

microorganisms can be easily cultured– Culture-based studies are skewed

• All organisms have ribosomes• Function of small subunit RNA (16S in bacteria

and archaea) identical in all organisms• Regions of varying conservation

– Some so conserved they are “universal”– Some so variable they can be used to distinguish

between very closely related organisms (different strains of same species)

Page 6: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

PCR

• Cool website tutorial

• Used to amplify a specified region of DNA– Region of DNA specified by “primers” which

bind to short sequences of DNA on either end– Primers are short (~18 nucleotide) DNA

oligomers

Page 7: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

Restriction Enzymes• Enzymes from bacteria which cut DNA at specific

sequences• Naturally used by bacteria to protect themselves from

foreign DNA (i.e. viruses)• Used by biologists like DNA scissors

– Useful because you know the sequence where they cut– can differentiate sequences of DNA by different fragment lengths

Page 8: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

Separating DNA• Agarose gel electrophoresis separates DNA

fragments by size• T-RFLP uses capillary electrophoresis

– Same principle but 1 nucleotide resolution

1 2

CATGGTGGTACCACTTAA

AATTCGAATTCTTGTGCTTAAGAACA

CATGGTGGTACCACTTAA

AATTCTTGTGAACA

AATTCGGCTTAA

Page 9: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

Example Fingerprint(s)• What do these tell us about the bacterial

community?

• What can’t they tell us?

Control (County Bridge) AMD-impacted (DFB099)

Page 10: DNA Fingerprinting of Bacterial Communities. Overview Targets gene for ribosomal RNA (16S rDNA) Make many DNA copies of the gene for the entire community.

Dendrogram of Community Similarities

More similar T-RFLP patterns on closer branches

Control: CBAMD:DFB099CCFB