Data warehouse Big data solutions · Microsoft SharePoint 2010 Enterprise: TeamSite, Publishing...

TMA Solutions 1

YOUR QUALITY PARTNER FOR SOFTWARE SOLUTIONS

www.tmasolutions.comTMA Solutions

BI-Big Data-Analytics

www.tmasolutions.comTMA Solutions

Skill Set

Big data & data analysis: Staging (ETL process) Data Warehousing (Storage structure: ROLAP, MOLAP, HOLAP) Data-mining: Classification/Regression, Clustering, Association, Sequence

Analysis Reporting: Cognos report, Jasper report, Qlikview report Hadoop platform

Microsoft Data Analytics tools: Microsoft Business Intelligence (Microsoft SQL Server Data Tools in 2012) :

Integration tool, Analysis tool, Reporting tool, SSRS, SSIS Microsoft Office 2010: Excel Pivot Table, Excel Pivot Chart. Microsoft SharePoint 2010 Enterprise: TeamSite, Publishing Portal.

Machine Learning Algorithms: Decision tree, SVM, Knn, Bayes theorem, Bayesian Network,

Neuron network Verification methods: ROC curve, t-test R language

Sample Projects

Traffic Data Analysis

Speed Profile Clustering

Sincerity Sentiment Mining

GENOME Alignment & Variant Callings

Imaging Mass Spectrometry

Traffic Data Analysis (1/2)

Real-time data report and analysis

Visualize data with chart and pivot table

Build up traffic data warehouse

User could analyze by filtering, rolling up and drilling down

Application

Geography

Device type

Report Type

Source Type

FactData

User share

Hotspot/Auto

Hotspot

Device

LiveSpeed

Traffic data warehouse

DIMENSIONAL DATA

Facts Dimensions

Traffic Data Analysis (2/2)

To support smart driving and navigation

Data collected from Navigation app

Billions of records in multidimensional manner

Road info

Vehicle speed with timestamp

Type of road

Unsupervised method used: SVM, Mean Shift

Sincerity Sentiment Mining

Analyzing & ranking sincerity sentiment of reviewers/commentators in an online community

Dealing with large historical data of reviews/comments

R language

Machine learning techniques

Natural Language Processing: POS, Tagger,…

Neuron network

Bayesian network

Sincerity Sentiment MiningA Typical Framework

-There's lots of cool stuff packed into espn's ultimate x!- There's suspension of disbelief and then there's bad screenwriting..!this film packs a wallop of the latter!....

Genome Alignment & Variant Callings

Features

DNA, Exom, RNA Alignment

Variant callings

Beta Result

Genome Alignment & Variant Callings

Next-Generation Sequencing Machine(e.g. Illumina machine)

ACGTGTACAAGGTCCGGTTCTGAAAGTTGACCATGGATAACCGGTTAATTTAAGGAT

…..................AGTCCTTTTACATTGAGTAG

Human genome has about 3 giga bases/letters

CEQEO System

Hundreds of million reads(30X coverage ~ 90GB)

Aligned reads and Variant callings

Imaging Mass Spectrometry (1/2)

Features

Analyzing ToF-SIM data (multiple dimension)

Imaging / visualizing the data

Techniques

PCA algorithm

Bayes theorem

R Language

Imaging Mass Spectrometry (2/2)

Raw data in multi-dimension

Visualization

TMA Solutions 14

THANK YOU !

+ 1 802-735-1392+ 61 414-734-277+81 3-6432-4994www.tmasolutions.com

North America number:Australia number:Japan number:Website:

+84 8 3997-8000+84 908-676-212+84 8 3990-3303sales@tma.com.vn

Tel:Mobile:Fax:Email:

Data warehouse Big data solutions · Microsoft SharePoint 2010 Enterprise: TeamSite, Publishing...

Documents

Transcript of Data warehouse Big data solutions · Microsoft SharePoint 2010 Enterprise: TeamSite, Publishing...

INTEGRATION OF FLUORESCENCE AND REFLECTANCE ......Least squares support vector machines (LS-SVM) and k-nearest neighbor (KNN) classifiers were used on the fluorescence PC, reflectance

ADMET evaluation in drug discovery: 15. Accurate ... · ity in rat, and was compared with the other six machine learning methods, including SVM, k-nearest-neighbor regression (kNN),

Performance Evaluation of KNN and SVM Algorithm in Object ... · A. KNN K-nearest neighbor algorithm is a well-known machine learn-ing algorithm for pattern recognition or classification.

kNN & Naïve Bayes

Final Report Plan Template - Purdue University · Web viewPerform clustering and classification techniques: SVM, KNN, RF, XGBOOST, and k-means clustering. Set up performance parameters

Nearest neighbors. Kernel functions, SVM. Decision trees. · Method of k nearest neighbors Nearest neighbors •kNN •Class. example •Regression example •k-NN Summary SVM Decision

KNN News 042715

Dynamic Multi-Resolution Data Storage › ~htseng › files › 2019MICRO-VS.pdfBFS Black-Scholes DWT2D HotSpot Inversek2j Jmeint KMeans kNN SC SVM-Train XGB CNN-Pred XGB-Pred average

OpenText TeamSite 16.4 Architecture Guide

3D Object Recognition using Multiclass SVM-KNNrazencot/MyWeb/docs/... · SVM-KNN For a query, 1.choose a proper distance function d(x,y) for the problem.Typically, d is the Euclidean

Sweet KNN: An Efﬁcient KNN on GPU through Reconciliation ... · show that Sweet KNN outperforms existing GPU implementations on KNN by up to 120X (11X on average). I. INTRODUCTION

TeamSite Guide

SVM-KNN: Discriminative Nearest Neighbor Classication for ... · SVM-KNN: Discriminative Nearest Neighbor Classication for Visual Category Recognition Hao Zhang Alexander C. Berg

Handwritten Digits Recognition Using SVM, KNN, RF and Deep …ceur-ws.org/Vol-2864/paper44.pdf · 2021. 5. 14. · further recognition has been devised. For handwritten digit recognition,

COSMOS - D6.2.1 Reliable and Smart Network of Things ... · We have used classification analysis methods such as support vector machine (SVM) and K-nearest neighbour (KNN) which are

Teamsite to Sharepoint Conversion

KNN Matting

An Intelligent Model for Online Recruitment Fraud …Naïve Bayes (NB), Support vector machine (SVM), Random forest and KNN were applied. Random forest showed fmeasure 93%. The re-

9.913 Pattern Recognition for Vision - MIT OpenCourseWare...Example: Utterance Classification Accuracy KNN 94.60% MCC 94.10% HMM 96.20% SVM 98.20% DynSVM 98.20% Japanese Vowel Set

3. Features and Character ClassifierBackground: Classical character classification Feature Extraction Classifier (SVM, NN, kNN etc) A Training Data Single n-dimensional Feature Vector