Post on 12-Dec-2016
ORIGINAL PAPER
Comparative biochemical characterization and in silico analysisof novel lipases Lip11 and Lip12 with Lip2 from Yarrowialipolytica
Arti Kumari • Ved Vrat Verma • Rani Gupta
Received: 15 March 2012 / Accepted: 26 June 2012 / Published online: 31 August 2012
� Springer Science+Business Media B.V. 2012
Abstract Novel lipases lip11 and lip12 from Yarrowia
lipolytica MSR80 were cloned and expressed in E. coli
HB101 pEZZ18 system along with lip2. These enzymes
were constitutively expressed as extracellular proteins with
IgG tag. The enzymes were purified by affinity chroma-
tography and analyzed by SDS-PAGE with specific activity
of 314, 352 and 198 U/mg for Lip2, Lip11 and Lip12,
respectively on olive oil. Biochemical characterization
showed that all were active over broad range of pH 4.0–9.0
and temperature 20–80 �C with optima at pH 7 and 40 �C.
All the three lipases were thermostable up to 80 �C with
varying t1/2. Activity on various substrates revealed that
they were most active on oils [ triacylglycerides [ p-np-
esters. Relatively Lip2 and Lip11 showed specificity for
mid to long chain fatty acids, while Lip12 was mid chain
specific. GC analysis of triolein hydrolysis by these lipases
revealed that Lip2 and Lip11 are regioselective, while
Lip12 is not. Effect of metal ions showed that Lip2 and
Lip12 were activated by Ca2? whereas Lip11 by Mg2?. All
were thiol activated and inhibited by PMSF and N-bro-
mosuccinimide. All were activated by non polar solvents
and inhibited by polar solvents. Detailed sequence analysis
and structural predictions revealed Lip11 and Lip12 shared
61 and 62 % homology with Lip2 (3O0D) and three
dimensional superimposition revealed Lip2 was closer to
Lip11 than to Lip12 as was observed during biochemical
characterization. Finally, thermostability and substrate
specificity has been explained on the basis of detailed
amino acid analysis.
Keywords Yarrowia lipolytica MSR80 � Lipase �Thermostable � Thiol-activation � Regioselectivity
Introduction
Lipases are triacylglycerol hydrolase EC (3.1.1.3), catalyse
synthetic as well as hydrolytic reactions (Jaeger et al.
1999). They are well known for their interfacial activation
which differentiates them from esterases (Brzozowski et al.
2000). They have wide range of substrate specificity; their
natural substrates are oils and triacylglycerides. They have
ability to catalyse regio, chemo and enantio selective
reactions (Arpigny and Jaeger 1999). Hence, they find
application in biotechnological sectors mainly pharma-
ceuticals. These properties of lipases make them increas-
ingly popular in industrial sectors.
Lipases are ubiquitous in nature and are produced by
animals, plants and microorganisms. However, microbial
lipases are known for their better stability and selectivity
(Vakhlu and Kour 2006). Many microorganisms including
bacteria, yeast and fungi are potential producers of lipases.
Among them yeast are of special interest as they produce
diverse isoforms of lipases as many as 3–10 in Candida
albicans, Candida rugosa and Geotricum candidum with
varying biochemical properties (Vakhlu and Kour 2006).
Lately genome survey of Yarrowia lipolytica has
revealed as many as 25 putative lipases (Kumari and Gupta
2010). It is non-conventional lipolytic yeast, of which Lip2
is a major extracellular lipase. Besides this, five more
lipases Lip7, Lip8, Lip9, Lip12 and Lip14 from Y. lipoly-
tica have also been purified and characterized (Ficker et al.
2005; Zhao et al. 2011; Kumari and Gupta 2010). How-
ever, several putative lipases from Y. lipolytica are yet to
A. Kumari � V. V. Verma � R. Gupta (&)
Department of Microbiology, University of Delhi,
South Campus, New Delhi 110021, India
e-mail: ranigupta15@yahoo.com; ranigupta15@rediffmail.com
123
World J Microbiol Biotechnol (2012) 28:3103–3111
DOI 10.1007/s11274-012-1120-4
be characterized to explore their useful properties for
commercial purposes (Ficker et al. 2011).
Therefore, an attempt was made to clone and express
two novel lipases viz. Lip11 and Lip12. Comparative
characterization of these lipases was carried out with
respect to Lip2. E. coli HB101 pEZZ18 system was used to
study extracellular expression of these lipases.
Materials and methods
pEZZ18 vector was purchased from GE Healthcare Bio-
Sciences. Taq DNA polymerase from Bangalore Genei; T4
DNA ligase and restriction enzymes from New England
Biolabs, plasmid extraction and gel elution kits were pur-
chased from Qiagen, Helden, Germany. IgG matrix was
purchased from GE healthcare. Solvents were purchased
from SRL.
Strains
Yarrowia lipolytica MSR80 was selected from laboratory
culture collection. This was previously isolated from
petroleum sludge and has been deposited at National cul-
ture collection MTCC Chandigarh India, with accession
number MTCC 9517.
The strain was revived from glycerol stock in YPD
(yeast extract 1 %, peptone 0.5 %, dextrose 1 %). Genomic
DNA was isolated by conventional method (Harju et al.
2004). E. coli DH5a and E. coli HB101 were available in
the laboratory.
Cloning and sequence analysis of lipases
Amplification of lipase genes lip2, lip11 and lip12 was
carried out by Thermal Cycler (Bio-rad Laboratories,
India) using a set of gene-specific primers on the genomic
DNA of Y. lipolytica MSR80 isolated by conventional
method as described earlier (Harju et al. 2004). The
primers were designed using the sequence of Y. lipolytica
CLIB122 available in Genolevures consortium. The primer
sequence for lip2 was lip2F: GAATTCGCCCATCACTC
CT, lip2R: GTCGACTTAGATACCACAGA with restric-
tion sites of EcoRI and SalI respectively; primer sequence
for lip11 was lip11F: GAATTCGCTTCTAATGTTA,
lip11R: AAGCTTTCAAATGGTGCC with restriction sites
EcoRI and HindIII respectively and for lip12 was lip12F:
GAATTCGGGTATCACTCAA, lip12R: GTCGACTCA
CTGCAAAGG with restriction site EcoRI and SalI
respectively. The restricted amplicon was ligated in
restricted pEZZ18 vector and was transformed into E. coli
DH5a. All the positive clones were sequenced at Central
Instrumental Facility (CIF), University of Delhi South
Campus, New Delhi. Thereafter, BLAST analysis was
done using BLASTx (available at http://www.ebi.
ac.uk/BLASTx) with default parameters.
Extracellular expression and purification
of recombinant lipases
Recombinant pEZZ18 vector was transformed into
expression host E. coli HB101 (Sharma and Gupta 2010).
Extracellular expression of recombinant lipases was carried
out constitutively by E. coli HB101 pEZZ18 system. The
E. coli HB101 containing recombinant plasmid were cul-
tivated in Luria–Bertani (LB) broth supplemented with
0.27 mM ampicillin using 2 % overnight grown culture as
inoculum at 37 �C and 300 rpm. E. coli HB101 pEZZ18
without insert was set as control. After 18 h of incubation,
the cells were separated by centrifugation at 7,4419g for
10 min. The extracellular cell free supernatant was
checked for lipase activity.
The recombinant enzymes were purified by affinity
chromatography using IgG-Sepharose column. The super-
natant from 1 l cultured broth was concentrated using an
ultrafiltration unit (Sartorius, Gottingen, Germany) and
purified by IgG-using 20 % 1, 4-dioxane solvent in TST
buffer as eluant (Kumari and Gupta 2010). Subsequently,
the solvent was removed by speed vac and purified protein
was checked for enzyme activity and protein concentration.
The purity of enzyme was checked by SDS-PAGE using
method of Laemmli (1970). Further zymogram analysis
was carried out according to Singh et al. (2006).
Lipase assay and protein estimation
Lipase activity was determined by spectrophotometric p-
nitrophenyl palmitate assay (Wrinkler and Stuckman 1979)
and confirmed by titrimetry (Naka and Nakamura 1992)
using 10 % (v/v) olive oil as substrate. One international
unit of lipase was defined as the amount of enzyme
required to release 1 lmol of p-nitrophenol or fatty acid,
respectively, per ml per min. The total protein was esti-
mated by Bradford assay using Bovine serum albumin
(BSA) as the standard protein.
Substrate specificity of lipases was studied using
p-nitrophenyl fatty acid esters (p-nitrophenyl esters), tria-
cylglycerides and oils. The Michaelis-Menton constant
(Km) and the maximum velocity for the reaction (Vmax)
were determined by Lineweaver–Burk plot of lipases
(Kumar and Gupta 2008). All the above experiments were
done in triplicate and the final values have been presented
as mean ± standard deviation.
To study regioselectivity of different lipases, triolein
(100 mM) was suspended in hexane (20 ml), and reaction
was started by adding 100 lg of lyophilised enzymes and
3104 World J Microbiol Biotechnol (2012) 28:3103–3111
123
was incubated at 40 �C and 100 rpm for 12 h. Reaction
was stopped by adding 5 ml of diethyl ether. The extracts
were filtered and later analysed by gas Chromatograhy.
The effect of different solvents (90 % v/v), metal ions
(10 mM) and inhibitors (10 mM) was studied by pre-
incubating the 100 lg of enzymes for 1 h. Residual activity
was determined as reported earlier (Kumar and Gupta
2008).
Sequence analysis and homology modelling
PSI-BLAST was used for homologues prediction (http://
blast.ncbi.nlm.nih.gov) (Altschul et al. 1997). Multiple
sequence alignment was done by clustalW2, Multalign and
Espript (http://www.ebi.ac.uk/Tools/msa/clustalw2/, http://
multalin.toulouse.inra.fr/multalin/ and http://espript.ibcp.
fr/ESPript/ESPript/). PSIPRED and VADAR server were
used for secondary structure prediction (Willard et al.
2003). Disulphide bonds formation predictions done by
DiANNA 1.1 server (http://clavius.bc.edu/clotelab/
DiANNA/). Sequential amino acids contents were ana-
lyzed by ProtParam tool (http://web.expasy.org/protparam/).
Structural analysis and superimposition was done by freely
available Pymol protein viewer.
Homology models were built for Lip11 and Lip12 using
MODELLER 9.10 (Eswar et al. 2006) and crystal structure
of Lip2 (3O0D) as a template. SCWRL was used for side-
chain modification (Canutescu et al. 2003). Energy mini-
mizations of final models were done by YASARA force
field (Krieger et al. 2009). Validation of models was done
by Procheck and Whatcheck programs (Colovos and
Yeates 1993).
Results
Cloning, expression and purification of Lip2, Lip11
and Lip12 from Y. lipolytica MSR80
The genes for lip2, lip11 and lip12 from Y. lipolytica
MSR80 were cloned in E. coli DH5a and sequenced.
Sequence analysis of these genes revealed that they shared
99, 98 and 96 % homology with the respective lipase
genes, lip2, lip11 and lip12 of Y. lipolytica CLIB122. The
translated protein sequences of these genes have been
submitted in NCBI Bankit under protein I.D AFH77825,
AFH77826 and AFH77827, respectively.
The recombinant pEZZ18 vector was subsequently
transformed into E. coli HB101 for extracellular expres-
sion. The enzymes were purified by IgG Sepharose with a
purification fold of 78, 82 and 73 for Lip2, Lip11 and
Lip12 with specific activity of 314, 352 and 198 U/mg,
respectively on olive oil. On SDS-PAGE purified Lip2,
Lip11 and Lip12 showed a band corresponding to 47, 51
and 48 kDa, which was 14 kDa higher than their respective
molecular weight indicating the presence of IgG tag
(Fig. 1a–c).
Biochemical characterisation of lipases
pH and temperature optima and stability
All the recombinant lipases were optimally active pH 7.0
(Fig. 2a) and were stable in broad pH range from pH 4.0–9.0
with[50 % residual activity (data not shown). All the three
lipases were active and stable within the range of 20–80 �C,
having temperature optima at 40 �C (Fig. 2b). Their varying
t1/2 at 50, 60, 70 and 80 �C, for Lip2 was t1/2 90, 55, 30 and
15 min; Lip11 120, 90, 50 and 20 min and Lip12 60, 35, 25
and 12 min, respectively. However, at 40 �C all the three
lipases has t1/2 more than 6 h (data not shown).
Substrate specificity of recombinant lipases
These recombinant lipases showed higher activity towards
oils followed by triacylglycerides and p-np-esters (Fig. 3a).
Among oils; Lip2, Lip11 and Lip12 showed highest
activity towards corn oil with 125, 126 and 135 % relative
activity, respectively as against olive oil and the lowest
activity on groundnut oil by Lip11 and on amla oil by Lip2
and Lip12. On triacylglycerides Lip2 and Lip11 exhibited
long chain specificity with increasing relative activity from
C10 to C18, while Lip12 showed highest activity on C10. It
suggested that Lip2 and Lip11 prefered long carbon chain
fatty acid glycerides, whereas Lip12 preferred mid carbon
chain fatty acid glycerides. Hydrolysis of p-np-esters by all
the three lipases showed maximum hydrolysis on p-np-
palmitate with Kcat of 46.0, 58.0, and 26.0 min-1 for Lip2,
Lip11 and Lip12, respectively. Further hydrolysis pattern
for other esters was p-np-laurate [ p-np-stearate [ p-np-
caproate for Lip2 and Lip11 and p-np-caproate [ p-np-
laurate [ p-np-stearate for Lip12.
The position specificity of lipases was studied from the
hydrolysis pattern of triolein by gas chromatography
(Fig. 3b). Four corresponding peaks were detected for
monoolein, diolein (1, 3-diolein; 1, 2-diolein and 2,
3-diolein) and oleic acid by Lip2 and Lip11; whereas only
two peaks of oleic acid and diolein was found corre-
sponding to hydrolysis of triolein by Lip12. It suggested
that Lip2 and Lip11 are 1,3-regioselective enzymes and
Lip12 is non regio-selective.
Effect of organic solvent on lipase activity
Ethanol and butanol inhibited all the lipases. Lip2 retained
16.16 and 12.6 %; Lip11 retained 4.42 and 0.7 %, whereas
World J Microbiol Biotechnol (2012) 28:3103–3111 3105
123
Lip12 retained 39.05 and 71.39 % of residual activity on
ethanol and butanol, respectively. 1, 4-dioxane, hexane and
diethyl ether enhanced the lipase activity of all the three
lipases by approximately 2.0-, 1.8- and 1.5-fold, respec-
tively for Lip2, Lip11 and Lip12.
Effect of metal ions and various inhibitors on lipases
Effect of various metal ions showed that activity of Lip2
and Lip12 was enhanced by Ca2? ions, while Lip11 was
enhanced by Mg2? ions (Fig. 4). Below 20 % residual
activity was observed in presence of Ni2? on Lip2 and by
Fe2? on Lip11 and Lip12. Moderate inhibition was found
in presence of Cu2? for all the three lipases.
All the enzymes are inhibited by EDTA, 1, 10-o-phen-
anthraline, DTNB, PMSF and N-bromosuccinimide and
enhanced in presence of ME (b-mercaptoethanol) and DTT
(dithiothreitol) (Fig. 4).
Sequence analysis and homology modelling
PSI-BLAST search for Lip11 and Lip12 against Protein
Data Bank revealed various fungal lipases (Rhizomucor
miehei, Rhizopus niveus) and feruloyl esterase (Aspergillus
niger) along with Lip2 from Y. lipolytica as closer homo-
logues of Lip 11 and Lip12. However, Lip11 and Lip12
shared highest sequence identity and homology with Lip2
(3O0D; 44 % sequence identity and 62 and 61 % sequence
homology for Lip11 and Lip12, respectively) from Y. li-
polytica. Thus, Lip2 (3O0D) selected as template for
homology modelling.
Multiple sequence alignment presented in Fig. 5
revealed conserved signature sequence as ‘‘GHSLG’’
except Lip12 where leucine was replaced by phenylalanine.
Catalytic triad residues serine, aspartic acid and histidine
were found to well conserved among all lipases. Oxyanion
hole residues (Thr and Leu) known for Lip2 (Bordes et al.
2010) were conserved in Lip11. However, leucine was
replaced by phenylalanine in Lip12. Further, lid containing
helix reported for Lip2 as Thr88-Leu105 (Bordes et al.
2010) was aligned to identify lid containing helices of
Lip11 (Leu162–Aps168) and Lip12 (Leu8–Arg89).
Procheck and Whatcheck analysis of Lip11 and Lip12
homology models showed 90.2 and 90.9 % residues
Fig. 1 SDS-PAGE (a), native-PAGE (b) and zymogram analysis (c) of Lip11, Lip2 and Lip12
(a)
(b)
Temperature °C
Rel
ativ
e ac
tivi
ty (
%)
0
20
40
60
80
100
120
pH
20 30 40 50 60 70 80 90
2 4 6 8 10 12
Rel
ativ
e a
ctiv
ity
(%)
0
20
40
60
80
100
120
Fig. 2 Lipase activity as a function of pH (a) and temperature (b).
Citrate–phosphate buffer from pH 3.0–7.0; potassium phosphate
buffer pH 8.0; tris-chloride buffer pH 9.0; sodium carbonate-
bicarbonate buffer pH 10.0 and glycine–sodium hydroxide-sodium
chloride buffer pH 11.0 (50 mM each), 100 % activity = 314, 352
and 198 U/mg for Lip2 (filled circle), Lip11 (open circle) and Lip12
(inverted triangle), respectively on olive oil at 40 �C and pH 7
3106 World J Microbiol Biotechnol (2012) 28:3103–3111
123
Fig. 3 a Substrate specificity of
lipases Lip2, Lip11 and Lip12
from Yarrowia lipolyticaMSR80. The reaction mixture
contained 80 mM of various p-
nitro phenyl fatty acids, 50 mM
triacylglycerides and 10 % oil
emulsion in 0.05 M pH 7.0
phosphate buffer using 2 %
gum acacia. 100 % activity for
Lip2 (black bars), Lip11 (lightgrey bars) and Lip12 (dark greybars) corresponds to 19.5, 18.9
and 7.6 U/mg; 250, 263 and
89 U/mg; 314, 352 and 198 U/
mg on p-np-palmitate,
tripalmitate and olive oil,
respectively. b Analysis of
hydrolytic product of triolein by
Gas chromatography. The
triolein hydrolysis was
determined by Gas
Chromatography (SHIMADZU
2014) by Stabil wax�—DA
column having FID detector
column with following
conditions: Injector and FID
temperature were set at
250–260 �C, injection volume
1 ll, oven temperature
100–250 �C in split mode,
Helium was used as carrier gas.
In the chromatogram peak a, b,
c and d stands for monolein,
diolein, oleic acid and triolein
respectively, as per standards
World J Microbiol Biotechnol (2012) 28:3103–3111 3107
123
positioned in most favourable region of Ramchandran plot
for Lip11 and Lip12, respectively. Root mean square
deviation (rmsd) value in the Ca positions between mod-
elled structure and template were observed lower for Lip11
(0.783 A) as compared to Lip12 and Lip2 (0.930 A).
Active site structural alignment of Lip11 and Lip12 with
Lip2 showed that Lip11 perfectly aligned with Lip2 as
compared to Lip12 (Fig. 6a, b). Root mean square devia-
tion between catalytic active site residues of Lip11 and
Lip12 with Lip2 was observed as 0.219 and 0.877 A,
respectively.
Thermostability of Lip11, Lip12 and Lip2
Sequences analysis of Y. lipolytica revealed that they are
cysteine rich with 11, 8 and 9 cysteine residues in Lip11,
Lip12 and Lip2, respectively. Likewise disulphide bonds
predicted by DiNNA1.1 tool were found to be as five for
Lip11 (Cys20–Cys367, Cys50–Cys113, Cys54–Cys100,
Cys117–Cys186, Cys330–Cys338) and four for Lip12
(Cys19–Cys105, Cys32–Cys108, Cys36–Cys249, Cys257–
Cys287) and four for Lip2 (Cys30–Cys299, Cys43–Cys47,
Cys120–Cys123, Cys265–Cys273) in addition to this one
free cysteine Cys189 for Lip11 and Cys244 was predicted
for Lip2 (Bordes et al. 2010). Besides this Arg/Lys ratios
for all the lipases was close to 1 and uncharged polar
residues were more than 50 in all the three. Further these
lipases were also found to be rich in proline content as 25,
20 and 15 residues in Lip11, Lip12 and Lip2, respectively.
In addition to this, predicted average hydrophobicity,
accessible surface area (ASA), volume and molecular mass
revealed average hydrophobicity 0.3 for Lip11 and Lip12
and 0.2 for Lip2. ASA was [12,000.00 A2 for Lip11 and
Lip12 and near about 12,000.00 A2 for Lip2 where volume
was [40,000.00 A3 for Lip11 and Lip2 and near about
40,000.00 A3 for Lip12. Further molecular mass was pre-
dicted as 43,466.3 Da for Lip11 and[33,000 Da for Lip12
and Lip2 (Table 1).
Discussion
Yarrowia lipolytica is known to possess 25 putative lipases
(Kumari and Gupta 2010). Of these only six lipases Lip2,
Lip7, Lip8, Lip9, Lip14 and Lip18 have been heterolo-
gously expressed and characterized (Ficker et al. 2005; Yu
et al. 2007a, b; Zhao et al. 2011). Here, two different
lipases Lip11 and Lip12 are described and compared with
well described Lip2, which has lot of biotechnological
impetus (Ficker et al. 2011).
These lipases were extracellularly expressed as IgG
fused protein in E. coli, indicating that prosequence is not
essential for lipase activity, as reported earlier (Ficker et al.
2011). It further suggests that extracellular expression may
be a way to obtain functional expression of lipases. This is
in contrast to earlier report where 18 putative lipases from
Y. lipolytica were cloned using pET 28 ? a vector and only
single lipase was expressed functionally (Zhao et al. 2011).
The present system has already been reported for extra-
cellular expression for other lipases Lip14 and Lip18 from
Y. lipolytica MSR80 (Kumari and Gupta 2010).
Lip2, Lip11 and Lip12 from Y. lipolytica MSR80 has
optima pH 7.0 and 40 �C whereas, Lip2 from Y. lipolytica
CLIB122 has been reported to function in pH range of
5.5–9.0 with optima at pH 8.0 (Mingrui et al. 2007). All the
three lipases were thermostable up to 80 �C and amino acid
analysis revealed that they are cystein protein and are rich
in arginine/lysine ratio, proline content and uncharged
polar residues which are known to be responsible for high
thermostability (Szilagyi and Zavodsky 2000). Further,
according to Vendittis et al. (2008), all the three lipases
satisfy requirement of large protein volume, surface area,
hydrophobicity and molecular weight for thermostability.
In addition to this Lip2 and Lip12 were Ca2? activated and
Lip11 was Mg2? activated likewise inhibited by metal
chelaters and 1, 10-o-phenanthroline. Similar results have
been reported for Lip2 from Y. lipolytica CLIB 122 where
lipase activity was enhanced by Ca2? ions (Mingrui et al.
2007). Inhibition by PMSF shows that lipases are serine
hydrolases and inhibition by N-bromosuccinimide (NBS)
shows that tryptophan residues may be located near the
active site of the enzyme.
These lipases have different substrate specificity with
highest activity on oils followed by triacyglycerides and p-
np-esters. Such differences are often reported for lipases,
where some lipases prefer triacylglycerides over p-np-
esters and vice versa. However, with respect to fatty acids
esters Lip2 and Lip11 had mid to long chain specificity;
Metal ions and Inhibitors (10mM)
CaCl2
MgCl2
CuSO4
NiCl2
FeCl2M
EDTT
EDTA
1,10-p
henan
thra
line
DTNB
PMSF
N-bro
mosu
ccin
amid
e
Rel
ativ
e ac
tivi
ty (
%)
0
50
100
150
200
250
300
350
%
Fig. 4 Effect of metal ions and inhibitors on activity of Lip2, Lip11
and Lip12. Lip2, Lip11 and Lip12 correspond to black bars, light greybars and dark grey bars, respectively
3108 World J Microbiol Biotechnol (2012) 28:3103–3111
123
Fig. 5 Multiple sequence alignment. Multiple sequence alignment of
Y.lipolytica lipases Lip2, Lip11 and Lip12. Conserved signature
sequence residues shown in closed rectangular box, catalytic triad
residues closed in circular box, oxanion hole residues closed in
rhombus and lid region residues are underlined. Alpha helix and b-
strands are represented on top of the alignment
Fig. 6 Superimposition analysis of catalytic triad, oxyanion hole and
lid helix residues. Superimposition of catalytic triad, oxyanion hole
and lid helix residues of Lip11 and Lip12 (dark) with Lip2 (light)shown in a and b, respectively. Figure shows perfect alignment of
Lip11 and Lip2 (rmsd = 0.219 A) while His276 of Lip12 is observed
away from His289 of Lip2 and oxyanion hole residue Phe148 of
Lip12 was observed in place of Leu163 of Lip2 (rmsd = 0.877 A)
World J Microbiol Biotechnol (2012) 28:3103–3111 3109
123
whereas Lip12 was mid chain specific. This is in confir-
mation with earlier report of Lip2 from Y. lipolytica
CLIB122 (Yu et al. 2007a, b). Further Lip2 and Lip11 had
approximately twofold higher specific activities as com-
pared to Lip12 on p-np-palmitate. Over all substrate
specificity indicated that Lip2 is closer to Lip11 as com-
pared to Lip12. Comparative sequence analysis revealed
that Lip11 and Lip12 shared 44 % sequence identity and 62
and 61 % homology with Lip2, respectively. However,
oxyanion hole residue revealed proximity of Lip2 with
Lip11 where leucine and threonine were found conserved
where as in Lip12 leucine was replaced by phenylalanine.
Oxyanion whole residues are responsible for catalytic
efficiency of enzyme and may be Phe being bulky group
responsible for lower specific activity of Lip12 as compare
to Lip2 and Lip11 (Brzozowski et al. 1992, 2000; Kohno
et al. 1996; Bordes et al. 2010).
Further in lipase family, catalytic active site is blocked
by short cover of alpha helix called as ‘‘enzyme lid’’. The
distinct differences with respect to lid region were
observed among these lipases. Lip2 has the longest lid of
18 residues, while Lip11 and Lip12 have 7–8 residues in
the lid region. The sequence homology of lid region from
Lip11 to Lip12 showed only 22 % homology. Thus, both
the difference in the lid region and oxyanion hole may be
responsible for observed differences in the substrate spec-
ificity and catalytic efficiency of Lip2, Lip11 and Lip12.
This is in accordance to study on Candida rugosa lipase
isoenzymes, where substrate specificity differences were
reported to be due to differences in lid region (Brocca et al.
2003).
Three dimensional model of Lip11 showed better
superimposition with Lip2 as compared to Lip12 inferred
by lower rmsd values, between functional residues of
Lip11 and Lip2 (rmsd = 0.219 A) as compared to Lip12
and Lip2 (rmsd = 0.877 A). This is in confirmation with
experimental results where it was observed that substrate
specificity of Lip11 and Lip2 was similar and Lip12 was
different.
In a nutshell, Lip11 is closer to Lip2 and it is solvent
stable, has substrate specificity from mid to long chain and
regioselective. While that of Lip12 is specific for short to
mid chain but not regioselective. Hence, these enzymes can
be exploited in various pharmaceutical or food sectors.
Acknowledgments Financial assistance from DU-DST PURSE,
R&D grant from Delhi University and department of biotechnology is
duly acknowledged. Authors would like to thank Dr. Manisha Goel,
Assistant Professor, Department of Biophysics, University of Delhi
South Campus for critically going through the manuscript.
References
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W,
Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids
Res 25:3389–3402
Arpigny JL, Jaeger KE (1999) Bacterial lipolytic enzymes: classifi-
cation and properties. Biochem J 343:177–183
Bordes F, Barbe S, Escalie P, Mourey L, Andre I, Marty A, Tranier S
(2010) Exploring the conformational states and rearrangements
of Yarrowia lipolytica lipase. Biophys J 99:2225–2234
Brocca S, Secundo F, Ossola M, Alberghina L, Carrea G, Lotti M
(2003) Sequence of the lid affects activity and specificity of
Candida rugosa lipase isoenzymes. Protein Sci 12:2312–2319
Table 1 Parametric
comparison and amino acid
composition analysis of Lip11,
Lip12 and Lip2
Content name Lip11 Lip12 Lip2
Number of protein residues 392 300 301
Molecular formula C1975H2979N511O569S15 C1537H2296N404O439S11 C1504H2288N398O443S11
Molecular weight (Da) 43,466.3 33,810.2 33,385.7
Uncharged polar residues
(Gln ? Asn ? Thr ? Ser)
%, residues
24.5, 96 21.6, 65 23.2, 70
Hydrophobic residues
(Ala ? Val ? Ile ? Leu)
%, residues
26.8, 105 24.7, 74 29.5, 89
Arg (%), residues 3.6, 14 3.7, 11 2.3, 7
Lys (%), residues 4.1, 16 4.0, 12 3.7, 11
Gly (%), residues 7.1, 28 8.3, 25 8.3, 25
Pro (%), residues 6.4, 25 6.7, 20 5.0, 15
Cys (%), residues 2.8, 11 2.6, 8 2.9, 9
Arg/Lys 0.88 0.93 0.62
Average hydrophobicity 0.3 0.3 0.2
Accessible surface area (A2) 12,234.6 12,653.7 11,733.1
Protein volume (A3) 40,826.2 38,942.5 40,532.0
3110 World J Microbiol Biotechnol (2012) 28:3103–3111
123
Brzozowski AM, Derewenda ZS, Dodson EJ, Dodson GG, Turken-
burg JP (1992) Structure and molecular-model refinement of
rhizomucor-miehei triacylglyceride lipase—a case-study of the
use of simulated annealing in partial model refinement. Acta
Crystallogr 48:307–319
Brzozowski MA, Savage H, Verma SC, Turkenburg PJ, Lawson MD,
Svendsen A, Patkar S (2000) Structural origins of the interfacial
activation in Thermomyces (Humicola) lanuginosa Lipase.
J Biochem 39:15071–15082
Canutescu AA, Shelenkov AA, Dunbrack RL (2003) A graph theory
algorithm for protein side-chain prediction. Protein Sci
12:2001–2014
Colovos C, Yeates TO (1993) Verification of protein structures:
patterns of nonbonded atomic interactions. Protein Sci
9:1511–1519
Eswar N, Webb B, Marti RMA, Madhusudhan MS, Eramian D, Shen
MY, Pieper U, Sali A (2006).Comparative protein structure
modelling with MODELLER. Current Protocols in Bioinformat-
ics, vol 15. Wiley, pp 5.6.1–5.6.30
Ficker P, Le DMT, Casaregola S, Gaillardin C, Thonart P, Nicaud JM
(2005) Identification and charecterization of Lip7 and Lip8
genes encoding two extracellular triacylglycerol lipases in the
yeast Yarrowia lipolytica. Fungal Genet Biol 42:264–274
Ficker P, Marty A, Nicaud TM (2011) The lipases from Yarrowialipolytica: genetics, production, regulation, biochemical charac-
terization and biotechnological applications. Biotechnol Adv
29:632–644
Harju S, Fedosyuk H, Peterson KR (2004) Rapid isolation of yeast
genomic DNA. BMC Biotechnol 4:4–8
Jaeger KE, Dijkstra BW, Reetz MT (1999) Bacterial biocatalysts:
molecular biology, three-dimensional structures and biotechno-
logical applications of lipases. Annu Rev Microbiol 53:315–351
Kohno M, Funatsu J, Mikami B, Kugimiya W, Matsuo T, Morita Y
(1996) The crystal structure of lipase II from Rhizopus niveus at
2.2A resolution. J Biochem 120:505–510
Krieger E, Joo K, Lee J, Raman S, Thompson J, Tyka M, Baker D,
Karplus K (2009) Improving physical realism, stereochemistry
and side-chain accuracy in homology modelling: four
approaches that performed well in CASP8. Proteins 77:114–122
Kumar SS, Gupta R (2008) A thiol activated lipase from Trichospo-ron asahii MSR54: detergent compatibility and pre-soak
formulation for oil removal from soiled cloth at ambient
temperature. J Microbiol Biotechnol 10:513–521
Kumari A, Gupta R (2010) Extracellular expression and character-
isation of thermostable Lip8, Lip14 and Lip18 from Yarrowialipolytica. Biotechnol Lett. doi:10.1007/S10529-012-0958-8
Laemmli UK (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227:680–685
Mingrui Y, Shaowei Q, Tianwei T (2007) Purification and charac-
terization of the extracellular lipase Lip2 from Yarrowialipolytica. Process biochem 42(3):384–391
Naka Y, Nakamura T (1992) The effect of serum albumin and related
amino acid on pancreatic lipase and biles salts inhibited
microbial lipases. Biosci Biotechnol Biochem 56:1066–1070
Sharma R, Gupta R (2010) Extracellular expression of keratinases
Ker P from Pseudomonas aeruginosa in E. coli. Biotechnol Lett
32:1863–1868
Singh R, Gupta N, Goswami VK, Gupta R (2006) A simple activity
staining protocol for lipases and esterases. Appl Microbiol
Biotechnol 70:679–682
Szilagyi A, Zavodsky P (2000) Structural differences between
mesophilic, moderately thermophilic and extremely thermophilic
protein subunits: results of a comprehensive survey. Struct Fold
Des 8:493–504
Vakhlu J, Kour A (2006) Yeast lipases: enzyme purification, biochemical
properties and gene cloning. Electron J Biotechnol 9:69–85
Vendittis E, Castellano I, Cotugno R, Ruocco MR, Raimo G, Masullo
M (2008) Adaptation of model proteins from cold to hot
environments involves continuous and small adjustments of
average parameters related to amino acid composition. J Theor
Biol 250:156–171
Willard L, Ranjan A, Zhang H, Monzavi H, Boyko RF, Sykes BD,
Wishart DS (2003) VADAR: a web server for quantitative
evaluation of protein structure quality. Nucleic Acids Res
13:3316–3319
Wrinkler UK, Stuckman M (1979) Glycogen, hyaluronate and some
other polysaccharides greatly enhance the formation of exolipase
by Serratia marcescens. J Bact 138:663–679
Yu MR, Qin SW, Tan TW (2007a) Purification and characterization
of the extracellular lipase Lip2 from Yarrowia lipolytica. Process
Biochem 42:384–391
Yu MR, Lange S, Richter S (2007b) Higher level expression of
extracellular lipase Lip2 from Yarrowia lipolyitca in Pichia
pastoris and its purification and characterisation. Protein Expr
Purif 53:255–263
Zhao H, Zheng L, Wang X, Liu Y, Xu L, Yan Y (2011) Cloning,
expression and characterization of new lipases from Yarrowialipolytica. Biotechnol Lett 33:2445–2452
World J Microbiol Biotechnol (2012) 28:3103–3111 3111
123