ORIGINAL PAPER

Comparative biochemical characterization and in silico analysisof novel lipases Lip11 and Lip12 with Lip2 from Yarrowialipolytica

Arti Kumari • Ved Vrat Verma • Rani Gupta

Received: 15 March 2012 / Accepted: 26 June 2012 / Published online: 31 August 2012

� Springer Science+Business Media B.V. 2012

Abstract Novel lipases lip11 and lip12 from Yarrowia

lipolytica MSR80 were cloned and expressed in E. coli

HB101 pEZZ18 system along with lip2. These enzymes

were constitutively expressed as extracellular proteins with

IgG tag. The enzymes were purified by affinity chroma-

tography and analyzed by SDS-PAGE with specific activity

of 314, 352 and 198 U/mg for Lip2, Lip11 and Lip12,

respectively on olive oil. Biochemical characterization

showed that all were active over broad range of pH 4.0–9.0

and temperature 20–80 �C with optima at pH 7 and 40 �C.

All the three lipases were thermostable up to 80 �C with

varying t1/2. Activity on various substrates revealed that

they were most active on oils [ triacylglycerides [ p-np-

esters. Relatively Lip2 and Lip11 showed specificity for

mid to long chain fatty acids, while Lip12 was mid chain

specific. GC analysis of triolein hydrolysis by these lipases

revealed that Lip2 and Lip11 are regioselective, while

Lip12 is not. Effect of metal ions showed that Lip2 and

Lip12 were activated by Ca2? whereas Lip11 by Mg2?. All

were thiol activated and inhibited by PMSF and N-bro-

mosuccinimide. All were activated by non polar solvents

and inhibited by polar solvents. Detailed sequence analysis

and structural predictions revealed Lip11 and Lip12 shared

61 and 62 % homology with Lip2 (3O0D) and three

dimensional superimposition revealed Lip2 was closer to

Lip11 than to Lip12 as was observed during biochemical

characterization. Finally, thermostability and substrate

specificity has been explained on the basis of detailed

amino acid analysis.

Keywords Yarrowia lipolytica MSR80 � Lipase �Thermostable � Thiol-activation � Regioselectivity

Introduction

Lipases are triacylglycerol hydrolase EC (3.1.1.3), catalyse

synthetic as well as hydrolytic reactions (Jaeger et al.

1999). They are well known for their interfacial activation

which differentiates them from esterases (Brzozowski et al.

2000). They have wide range of substrate specificity; their

natural substrates are oils and triacylglycerides. They have

ability to catalyse regio, chemo and enantio selective

reactions (Arpigny and Jaeger 1999). Hence, they find

application in biotechnological sectors mainly pharma-

ceuticals. These properties of lipases make them increas-

ingly popular in industrial sectors.

Lipases are ubiquitous in nature and are produced by

animals, plants and microorganisms. However, microbial

lipases are known for their better stability and selectivity

(Vakhlu and Kour 2006). Many microorganisms including

bacteria, yeast and fungi are potential producers of lipases.

Among them yeast are of special interest as they produce

diverse isoforms of lipases as many as 3–10 in Candida

albicans, Candida rugosa and Geotricum candidum with

varying biochemical properties (Vakhlu and Kour 2006).

Lately genome survey of Yarrowia lipolytica has

revealed as many as 25 putative lipases (Kumari and Gupta

2010). It is non-conventional lipolytic yeast, of which Lip2

is a major extracellular lipase. Besides this, five more

lipases Lip7, Lip8, Lip9, Lip12 and Lip14 from Y. lipoly-

tica have also been purified and characterized (Ficker et al.

2005; Zhao et al. 2011; Kumari and Gupta 2010). How-

ever, several putative lipases from Y. lipolytica are yet to

A. Kumari � V. V. Verma � R. Gupta (&)

Department of Microbiology, University of Delhi,

South Campus, New Delhi 110021, India

e-mail: ranigupta15@yahoo.com; ranigupta15@rediffmail.com

123

World J Microbiol Biotechnol (2012) 28:3103–3111

DOI 10.1007/s11274-012-1120-4

be characterized to explore their useful properties for

commercial purposes (Ficker et al. 2011).

Therefore, an attempt was made to clone and express

two novel lipases viz. Lip11 and Lip12. Comparative

characterization of these lipases was carried out with

respect to Lip2. E. coli HB101 pEZZ18 system was used to

study extracellular expression of these lipases.

Materials and methods

pEZZ18 vector was purchased from GE Healthcare Bio-

Sciences. Taq DNA polymerase from Bangalore Genei; T4

DNA ligase and restriction enzymes from New England

Biolabs, plasmid extraction and gel elution kits were pur-

chased from Qiagen, Helden, Germany. IgG matrix was

purchased from GE healthcare. Solvents were purchased

from SRL.

Strains

Yarrowia lipolytica MSR80 was selected from laboratory

culture collection. This was previously isolated from

petroleum sludge and has been deposited at National cul-

ture collection MTCC Chandigarh India, with accession

number MTCC 9517.

The strain was revived from glycerol stock in YPD

(yeast extract 1 %, peptone 0.5 %, dextrose 1 %). Genomic

DNA was isolated by conventional method (Harju et al.

2004). E. coli DH5a and E. coli HB101 were available in

the laboratory.

Cloning and sequence analysis of lipases

Amplification of lipase genes lip2, lip11 and lip12 was

carried out by Thermal Cycler (Bio-rad Laboratories,

India) using a set of gene-specific primers on the genomic

DNA of Y. lipolytica MSR80 isolated by conventional

method as described earlier (Harju et al. 2004). The

primers were designed using the sequence of Y. lipolytica

CLIB122 available in Genolevures consortium. The primer

sequence for lip2 was lip2F: GAATTCGCCCATCACTC

CT, lip2R: GTCGACTTAGATACCACAGA with restric-

tion sites of EcoRI and SalI respectively; primer sequence

for lip11 was lip11F: GAATTCGCTTCTAATGTTA,

lip11R: AAGCTTTCAAATGGTGCC with restriction sites

EcoRI and HindIII respectively and for lip12 was lip12F:

GAATTCGGGTATCACTCAA, lip12R: GTCGACTCA

CTGCAAAGG with restriction site EcoRI and SalI

respectively. The restricted amplicon was ligated in

restricted pEZZ18 vector and was transformed into E. coli

DH5a. All the positive clones were sequenced at Central

Instrumental Facility (CIF), University of Delhi South

Campus, New Delhi. Thereafter, BLAST analysis was

done using BLASTx (available at http://www.ebi.

ac.uk/BLASTx) with default parameters.

Extracellular expression and purification

of recombinant lipases

Recombinant pEZZ18 vector was transformed into

expression host E. coli HB101 (Sharma and Gupta 2010).

Extracellular expression of recombinant lipases was carried

out constitutively by E. coli HB101 pEZZ18 system. The

E. coli HB101 containing recombinant plasmid were cul-

tivated in Luria–Bertani (LB) broth supplemented with

0.27 mM ampicillin using 2 % overnight grown culture as

inoculum at 37 �C and 300 rpm. E. coli HB101 pEZZ18

without insert was set as control. After 18 h of incubation,

the cells were separated by centrifugation at 7,4419g for

10 min. The extracellular cell free supernatant was

checked for lipase activity.

The recombinant enzymes were purified by affinity

chromatography using IgG-Sepharose column. The super-

natant from 1 l cultured broth was concentrated using an

ultrafiltration unit (Sartorius, Gottingen, Germany) and

purified by IgG-using 20 % 1, 4-dioxane solvent in TST

buffer as eluant (Kumari and Gupta 2010). Subsequently,

the solvent was removed by speed vac and purified protein

was checked for enzyme activity and protein concentration.

The purity of enzyme was checked by SDS-PAGE using

method of Laemmli (1970). Further zymogram analysis

was carried out according to Singh et al. (2006).

Lipase assay and protein estimation

Lipase activity was determined by spectrophotometric p-

nitrophenyl palmitate assay (Wrinkler and Stuckman 1979)

and confirmed by titrimetry (Naka and Nakamura 1992)

using 10 % (v/v) olive oil as substrate. One international

unit of lipase was defined as the amount of enzyme

required to release 1 lmol of p-nitrophenol or fatty acid,

respectively, per ml per min. The total protein was esti-

mated by Bradford assay using Bovine serum albumin

(BSA) as the standard protein.

Substrate specificity of lipases was studied using

p-nitrophenyl fatty acid esters (p-nitrophenyl esters), tria-

cylglycerides and oils. The Michaelis-Menton constant

(Km) and the maximum velocity for the reaction (Vmax)

were determined by Lineweaver–Burk plot of lipases

(Kumar and Gupta 2008). All the above experiments were

done in triplicate and the final values have been presented

as mean ± standard deviation.

To study regioselectivity of different lipases, triolein

(100 mM) was suspended in hexane (20 ml), and reaction

was started by adding 100 lg of lyophilised enzymes and

3104 World J Microbiol Biotechnol (2012) 28:3103–3111

123

was incubated at 40 �C and 100 rpm for 12 h. Reaction

was stopped by adding 5 ml of diethyl ether. The extracts

were filtered and later analysed by gas Chromatograhy.

The effect of different solvents (90 % v/v), metal ions

(10 mM) and inhibitors (10 mM) was studied by pre-

incubating the 100 lg of enzymes for 1 h. Residual activity

was determined as reported earlier (Kumar and Gupta

2008).

Sequence analysis and homology modelling

PSI-BLAST was used for homologues prediction (http://

blast.ncbi.nlm.nih.gov) (Altschul et al. 1997). Multiple

sequence alignment was done by clustalW2, Multalign and

Espript (http://www.ebi.ac.uk/Tools/msa/clustalw2/, http://

multalin.toulouse.inra.fr/multalin/ and http://espript.ibcp.

fr/ESPript/ESPript/). PSIPRED and VADAR server were

used for secondary structure prediction (Willard et al.

2003). Disulphide bonds formation predictions done by

DiANNA 1.1 server (http://clavius.bc.edu/clotelab/

DiANNA/). Sequential amino acids contents were ana-

lyzed by ProtParam tool (http://web.expasy.org/protparam/).

Structural analysis and superimposition was done by freely

available Pymol protein viewer.

Homology models were built for Lip11 and Lip12 using

MODELLER 9.10 (Eswar et al. 2006) and crystal structure

of Lip2 (3O0D) as a template. SCWRL was used for side-

chain modification (Canutescu et al. 2003). Energy mini-

mizations of final models were done by YASARA force

field (Krieger et al. 2009). Validation of models was done

by Procheck and Whatcheck programs (Colovos and

Yeates 1993).

Results

Cloning, expression and purification of Lip2, Lip11

and Lip12 from Y. lipolytica MSR80

The genes for lip2, lip11 and lip12 from Y. lipolytica

MSR80 were cloned in E. coli DH5a and sequenced.

Sequence analysis of these genes revealed that they shared

99, 98 and 96 % homology with the respective lipase

genes, lip2, lip11 and lip12 of Y. lipolytica CLIB122. The

translated protein sequences of these genes have been

submitted in NCBI Bankit under protein I.D AFH77825,

AFH77826 and AFH77827, respectively.

The recombinant pEZZ18 vector was subsequently

transformed into E. coli HB101 for extracellular expres-

sion. The enzymes were purified by IgG Sepharose with a

purification fold of 78, 82 and 73 for Lip2, Lip11 and

Lip12 with specific activity of 314, 352 and 198 U/mg,

respectively on olive oil. On SDS-PAGE purified Lip2,

Lip11 and Lip12 showed a band corresponding to 47, 51

and 48 kDa, which was 14 kDa higher than their respective

molecular weight indicating the presence of IgG tag

(Fig. 1a–c).

Biochemical characterisation of lipases

pH and temperature optima and stability

All the recombinant lipases were optimally active pH 7.0

(Fig. 2a) and were stable in broad pH range from pH 4.0–9.0

with[50 % residual activity (data not shown). All the three

lipases were active and stable within the range of 20–80 �C,

having temperature optima at 40 �C (Fig. 2b). Their varying

t1/2 at 50, 60, 70 and 80 �C, for Lip2 was t1/2 90, 55, 30 and

15 min; Lip11 120, 90, 50 and 20 min and Lip12 60, 35, 25

and 12 min, respectively. However, at 40 �C all the three

lipases has t1/2 more than 6 h (data not shown).

Substrate specificity of recombinant lipases

These recombinant lipases showed higher activity towards

oils followed by triacylglycerides and p-np-esters (Fig. 3a).

Among oils; Lip2, Lip11 and Lip12 showed highest

activity towards corn oil with 125, 126 and 135 % relative

activity, respectively as against olive oil and the lowest

activity on groundnut oil by Lip11 and on amla oil by Lip2

and Lip12. On triacylglycerides Lip2 and Lip11 exhibited

long chain specificity with increasing relative activity from

C10 to C18, while Lip12 showed highest activity on C10. It

suggested that Lip2 and Lip11 prefered long carbon chain

fatty acid glycerides, whereas Lip12 preferred mid carbon

chain fatty acid glycerides. Hydrolysis of p-np-esters by all

the three lipases showed maximum hydrolysis on p-np-

palmitate with Kcat of 46.0, 58.0, and 26.0 min-1 for Lip2,

Lip11 and Lip12, respectively. Further hydrolysis pattern

for other esters was p-np-laurate [ p-np-stearate [ p-np-

caproate for Lip2 and Lip11 and p-np-caproate [ p-np-

laurate [ p-np-stearate for Lip12.

The position specificity of lipases was studied from the

hydrolysis pattern of triolein by gas chromatography

(Fig. 3b). Four corresponding peaks were detected for

monoolein, diolein (1, 3-diolein; 1, 2-diolein and 2,

3-diolein) and oleic acid by Lip2 and Lip11; whereas only

two peaks of oleic acid and diolein was found corre-

sponding to hydrolysis of triolein by Lip12. It suggested

that Lip2 and Lip11 are 1,3-regioselective enzymes and

Lip12 is non regio-selective.

Effect of organic solvent on lipase activity

Ethanol and butanol inhibited all the lipases. Lip2 retained

16.16 and 12.6 %; Lip11 retained 4.42 and 0.7 %, whereas

World J Microbiol Biotechnol (2012) 28:3103–3111 3105

123

Lip12 retained 39.05 and 71.39 % of residual activity on

ethanol and butanol, respectively. 1, 4-dioxane, hexane and

diethyl ether enhanced the lipase activity of all the three

lipases by approximately 2.0-, 1.8- and 1.5-fold, respec-

tively for Lip2, Lip11 and Lip12.

Effect of metal ions and various inhibitors on lipases

Effect of various metal ions showed that activity of Lip2

and Lip12 was enhanced by Ca2? ions, while Lip11 was

enhanced by Mg2? ions (Fig. 4). Below 20 % residual

activity was observed in presence of Ni2? on Lip2 and by

Fe2? on Lip11 and Lip12. Moderate inhibition was found

in presence of Cu2? for all the three lipases.

All the enzymes are inhibited by EDTA, 1, 10-o-phen-

anthraline, DTNB, PMSF and N-bromosuccinimide and

enhanced in presence of ME (b-mercaptoethanol) and DTT

(dithiothreitol) (Fig. 4).

Sequence analysis and homology modelling

PSI-BLAST search for Lip11 and Lip12 against Protein

Data Bank revealed various fungal lipases (Rhizomucor

miehei, Rhizopus niveus) and feruloyl esterase (Aspergillus

niger) along with Lip2 from Y. lipolytica as closer homo-

logues of Lip 11 and Lip12. However, Lip11 and Lip12

shared highest sequence identity and homology with Lip2

(3O0D; 44 % sequence identity and 62 and 61 % sequence

homology for Lip11 and Lip12, respectively) from Y. li-

polytica. Thus, Lip2 (3O0D) selected as template for

homology modelling.

Multiple sequence alignment presented in Fig. 5

revealed conserved signature sequence as ‘‘GHSLG’’

except Lip12 where leucine was replaced by phenylalanine.

Catalytic triad residues serine, aspartic acid and histidine

were found to well conserved among all lipases. Oxyanion

hole residues (Thr and Leu) known for Lip2 (Bordes et al.

2010) were conserved in Lip11. However, leucine was

replaced by phenylalanine in Lip12. Further, lid containing

helix reported for Lip2 as Thr88-Leu105 (Bordes et al.

2010) was aligned to identify lid containing helices of

Lip11 (Leu162–Aps168) and Lip12 (Leu8–Arg89).

Procheck and Whatcheck analysis of Lip11 and Lip12

homology models showed 90.2 and 90.9 % residues

Fig. 1 SDS-PAGE (a), native-PAGE (b) and zymogram analysis (c) of Lip11, Lip2 and Lip12

(a)

(b)

Temperature °C

Rel

ativ

e ac

tivi

ty (

%)

0

20

40

60

80

100

120

pH

20 30 40 50 60 70 80 90

2 4 6 8 10 12

Rel

ativ

e a

ctiv

ity

(%)

0

20

40

60

80

100

120

Fig. 2 Lipase activity as a function of pH (a) and temperature (b).

Citrate–phosphate buffer from pH 3.0–7.0; potassium phosphate

buffer pH 8.0; tris-chloride buffer pH 9.0; sodium carbonate-

bicarbonate buffer pH 10.0 and glycine–sodium hydroxide-sodium

chloride buffer pH 11.0 (50 mM each), 100 % activity = 314, 352

and 198 U/mg for Lip2 (filled circle), Lip11 (open circle) and Lip12

(inverted triangle), respectively on olive oil at 40 �C and pH 7

3106 World J Microbiol Biotechnol (2012) 28:3103–3111

123

Fig. 3 a Substrate specificity of

lipases Lip2, Lip11 and Lip12

from Yarrowia lipolyticaMSR80. The reaction mixture

contained 80 mM of various p-

nitro phenyl fatty acids, 50 mM

triacylglycerides and 10 % oil

emulsion in 0.05 M pH 7.0

phosphate buffer using 2 %

gum acacia. 100 % activity for

Lip2 (black bars), Lip11 (lightgrey bars) and Lip12 (dark greybars) corresponds to 19.5, 18.9

and 7.6 U/mg; 250, 263 and

89 U/mg; 314, 352 and 198 U/

mg on p-np-palmitate,

tripalmitate and olive oil,

respectively. b Analysis of

hydrolytic product of triolein by

Gas chromatography. The

triolein hydrolysis was

determined by Gas

Chromatography (SHIMADZU

2014) by Stabil wax�—DA

column having FID detector

column with following

conditions: Injector and FID

temperature were set at

250–260 �C, injection volume

1 ll, oven temperature

100–250 �C in split mode,

Helium was used as carrier gas.

In the chromatogram peak a, b,

c and d stands for monolein,

diolein, oleic acid and triolein

respectively, as per standards

World J Microbiol Biotechnol (2012) 28:3103–3111 3107

123

positioned in most favourable region of Ramchandran plot

for Lip11 and Lip12, respectively. Root mean square

deviation (rmsd) value in the Ca positions between mod-

elled structure and template were observed lower for Lip11

(0.783 A) as compared to Lip12 and Lip2 (0.930 A).

Active site structural alignment of Lip11 and Lip12 with

Lip2 showed that Lip11 perfectly aligned with Lip2 as

compared to Lip12 (Fig. 6a, b). Root mean square devia-

tion between catalytic active site residues of Lip11 and

Lip12 with Lip2 was observed as 0.219 and 0.877 A,

respectively.

Thermostability of Lip11, Lip12 and Lip2

Sequences analysis of Y. lipolytica revealed that they are

cysteine rich with 11, 8 and 9 cysteine residues in Lip11,

Lip12 and Lip2, respectively. Likewise disulphide bonds

predicted by DiNNA1.1 tool were found to be as five for

Lip11 (Cys20–Cys367, Cys50–Cys113, Cys54–Cys100,

Cys117–Cys186, Cys330–Cys338) and four for Lip12

(Cys19–Cys105, Cys32–Cys108, Cys36–Cys249, Cys257–

Cys287) and four for Lip2 (Cys30–Cys299, Cys43–Cys47,

Cys120–Cys123, Cys265–Cys273) in addition to this one

free cysteine Cys189 for Lip11 and Cys244 was predicted

for Lip2 (Bordes et al. 2010). Besides this Arg/Lys ratios

for all the lipases was close to 1 and uncharged polar

residues were more than 50 in all the three. Further these

lipases were also found to be rich in proline content as 25,

20 and 15 residues in Lip11, Lip12 and Lip2, respectively.

In addition to this, predicted average hydrophobicity,

accessible surface area (ASA), volume and molecular mass

revealed average hydrophobicity 0.3 for Lip11 and Lip12

and 0.2 for Lip2. ASA was [12,000.00 A2 for Lip11 and

Lip12 and near about 12,000.00 A2 for Lip2 where volume

was [40,000.00 A3 for Lip11 and Lip2 and near about

40,000.00 A3 for Lip12. Further molecular mass was pre-

dicted as 43,466.3 Da for Lip11 and[33,000 Da for Lip12

and Lip2 (Table 1).

Discussion

Yarrowia lipolytica is known to possess 25 putative lipases

(Kumari and Gupta 2010). Of these only six lipases Lip2,

Lip7, Lip8, Lip9, Lip14 and Lip18 have been heterolo-

gously expressed and characterized (Ficker et al. 2005; Yu

et al. 2007a, b; Zhao et al. 2011). Here, two different

lipases Lip11 and Lip12 are described and compared with

well described Lip2, which has lot of biotechnological

impetus (Ficker et al. 2011).

These lipases were extracellularly expressed as IgG

fused protein in E. coli, indicating that prosequence is not

essential for lipase activity, as reported earlier (Ficker et al.

2011). It further suggests that extracellular expression may

be a way to obtain functional expression of lipases. This is

in contrast to earlier report where 18 putative lipases from

Y. lipolytica were cloned using pET 28 ? a vector and only

single lipase was expressed functionally (Zhao et al. 2011).

The present system has already been reported for extra-

cellular expression for other lipases Lip14 and Lip18 from

Y. lipolytica MSR80 (Kumari and Gupta 2010).

Lip2, Lip11 and Lip12 from Y. lipolytica MSR80 has

optima pH 7.0 and 40 �C whereas, Lip2 from Y. lipolytica

CLIB122 has been reported to function in pH range of

5.5–9.0 with optima at pH 8.0 (Mingrui et al. 2007). All the

three lipases were thermostable up to 80 �C and amino acid

analysis revealed that they are cystein protein and are rich

in arginine/lysine ratio, proline content and uncharged

polar residues which are known to be responsible for high

thermostability (Szilagyi and Zavodsky 2000). Further,

according to Vendittis et al. (2008), all the three lipases

satisfy requirement of large protein volume, surface area,

hydrophobicity and molecular weight for thermostability.

In addition to this Lip2 and Lip12 were Ca2? activated and

Lip11 was Mg2? activated likewise inhibited by metal

chelaters and 1, 10-o-phenanthroline. Similar results have

been reported for Lip2 from Y. lipolytica CLIB 122 where

lipase activity was enhanced by Ca2? ions (Mingrui et al.

2007). Inhibition by PMSF shows that lipases are serine

hydrolases and inhibition by N-bromosuccinimide (NBS)

shows that tryptophan residues may be located near the

active site of the enzyme.

These lipases have different substrate specificity with

highest activity on oils followed by triacyglycerides and p-

np-esters. Such differences are often reported for lipases,

where some lipases prefer triacylglycerides over p-np-

esters and vice versa. However, with respect to fatty acids

esters Lip2 and Lip11 had mid to long chain specificity;

Metal ions and Inhibitors (10mM)

CaCl2

MgCl2

CuSO4

NiCl2

FeCl2M

EDTT

EDTA

1,10-p

henan

thra

line

DTNB

PMSF

N-bro

mosu

ccin

amid

e

Rel

ativ

e ac

tivi

ty (

%)

0

50

100

150

200

250

300

350

%

Fig. 4 Effect of metal ions and inhibitors on activity of Lip2, Lip11

and Lip12. Lip2, Lip11 and Lip12 correspond to black bars, light greybars and dark grey bars, respectively

3108 World J Microbiol Biotechnol (2012) 28:3103–3111

123

Fig. 5 Multiple sequence alignment. Multiple sequence alignment of

Y.lipolytica lipases Lip2, Lip11 and Lip12. Conserved signature

sequence residues shown in closed rectangular box, catalytic triad

residues closed in circular box, oxanion hole residues closed in

rhombus and lid region residues are underlined. Alpha helix and b-

strands are represented on top of the alignment

Fig. 6 Superimposition analysis of catalytic triad, oxyanion hole and

lid helix residues. Superimposition of catalytic triad, oxyanion hole

and lid helix residues of Lip11 and Lip12 (dark) with Lip2 (light)shown in a and b, respectively. Figure shows perfect alignment of

Lip11 and Lip2 (rmsd = 0.219 A) while His276 of Lip12 is observed

away from His289 of Lip2 and oxyanion hole residue Phe148 of

Lip12 was observed in place of Leu163 of Lip2 (rmsd = 0.877 A)

World J Microbiol Biotechnol (2012) 28:3103–3111 3109

123

whereas Lip12 was mid chain specific. This is in confir-

mation with earlier report of Lip2 from Y. lipolytica

CLIB122 (Yu et al. 2007a, b). Further Lip2 and Lip11 had

approximately twofold higher specific activities as com-

pared to Lip12 on p-np-palmitate. Over all substrate

specificity indicated that Lip2 is closer to Lip11 as com-

pared to Lip12. Comparative sequence analysis revealed

that Lip11 and Lip12 shared 44 % sequence identity and 62

and 61 % homology with Lip2, respectively. However,

oxyanion hole residue revealed proximity of Lip2 with

Lip11 where leucine and threonine were found conserved

where as in Lip12 leucine was replaced by phenylalanine.

Oxyanion whole residues are responsible for catalytic

efficiency of enzyme and may be Phe being bulky group

responsible for lower specific activity of Lip12 as compare

to Lip2 and Lip11 (Brzozowski et al. 1992, 2000; Kohno

et al. 1996; Bordes et al. 2010).

Further in lipase family, catalytic active site is blocked

by short cover of alpha helix called as ‘‘enzyme lid’’. The

distinct differences with respect to lid region were

observed among these lipases. Lip2 has the longest lid of

18 residues, while Lip11 and Lip12 have 7–8 residues in

the lid region. The sequence homology of lid region from

Lip11 to Lip12 showed only 22 % homology. Thus, both

the difference in the lid region and oxyanion hole may be

responsible for observed differences in the substrate spec-

ificity and catalytic efficiency of Lip2, Lip11 and Lip12.

This is in accordance to study on Candida rugosa lipase

isoenzymes, where substrate specificity differences were

reported to be due to differences in lid region (Brocca et al.

2003).

Three dimensional model of Lip11 showed better

superimposition with Lip2 as compared to Lip12 inferred

by lower rmsd values, between functional residues of

Lip11 and Lip2 (rmsd = 0.219 A) as compared to Lip12

and Lip2 (rmsd = 0.877 A). This is in confirmation with

experimental results where it was observed that substrate

specificity of Lip11 and Lip2 was similar and Lip12 was

different.

In a nutshell, Lip11 is closer to Lip2 and it is solvent

stable, has substrate specificity from mid to long chain and

regioselective. While that of Lip12 is specific for short to

mid chain but not regioselective. Hence, these enzymes can

be exploited in various pharmaceutical or food sectors.

Acknowledgments Financial assistance from DU-DST PURSE,

R&D grant from Delhi University and department of biotechnology is

duly acknowledged. Authors would like to thank Dr. Manisha Goel,

Assistant Professor, Department of Biophysics, University of Delhi

South Campus for critically going through the manuscript.

References

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W,

Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new

generation of protein database search programs. Nucleic Acids

Res 25:3389–3402

Arpigny JL, Jaeger KE (1999) Bacterial lipolytic enzymes: classifi-

cation and properties. Biochem J 343:177–183

Bordes F, Barbe S, Escalie P, Mourey L, Andre I, Marty A, Tranier S

(2010) Exploring the conformational states and rearrangements

of Yarrowia lipolytica lipase. Biophys J 99:2225–2234

Brocca S, Secundo F, Ossola M, Alberghina L, Carrea G, Lotti M

(2003) Sequence of the lid affects activity and specificity of

Candida rugosa lipase isoenzymes. Protein Sci 12:2312–2319

Table 1 Parametric

comparison and amino acid

composition analysis of Lip11,

Lip12 and Lip2

Content name Lip11 Lip12 Lip2

Number of protein residues 392 300 301

Molecular formula C1975H2979N511O569S15 C1537H2296N404O439S11 C1504H2288N398O443S11

Molecular weight (Da) 43,466.3 33,810.2 33,385.7

Uncharged polar residues

(Gln ? Asn ? Thr ? Ser)

%, residues

24.5, 96 21.6, 65 23.2, 70

Hydrophobic residues

(Ala ? Val ? Ile ? Leu)

%, residues

26.8, 105 24.7, 74 29.5, 89

Arg (%), residues 3.6, 14 3.7, 11 2.3, 7

Lys (%), residues 4.1, 16 4.0, 12 3.7, 11

Gly (%), residues 7.1, 28 8.3, 25 8.3, 25

Pro (%), residues 6.4, 25 6.7, 20 5.0, 15

Cys (%), residues 2.8, 11 2.6, 8 2.9, 9

Arg/Lys 0.88 0.93 0.62

Average hydrophobicity 0.3 0.3 0.2

Accessible surface area (A2) 12,234.6 12,653.7 11,733.1

Protein volume (A3) 40,826.2 38,942.5 40,532.0

3110 World J Microbiol Biotechnol (2012) 28:3103–3111

123

Brzozowski AM, Derewenda ZS, Dodson EJ, Dodson GG, Turken-

burg JP (1992) Structure and molecular-model refinement of

rhizomucor-miehei triacylglyceride lipase—a case-study of the

use of simulated annealing in partial model refinement. Acta

Crystallogr 48:307–319

Brzozowski MA, Savage H, Verma SC, Turkenburg PJ, Lawson MD,

Svendsen A, Patkar S (2000) Structural origins of the interfacial

activation in Thermomyces (Humicola) lanuginosa Lipase.

J Biochem 39:15071–15082

Canutescu AA, Shelenkov AA, Dunbrack RL (2003) A graph theory

algorithm for protein side-chain prediction. Protein Sci

12:2001–2014

Colovos C, Yeates TO (1993) Verification of protein structures:

patterns of nonbonded atomic interactions. Protein Sci

9:1511–1519

Eswar N, Webb B, Marti RMA, Madhusudhan MS, Eramian D, Shen

MY, Pieper U, Sali A (2006).Comparative protein structure

modelling with MODELLER. Current Protocols in Bioinformat-

ics, vol 15. Wiley, pp 5.6.1–5.6.30

Ficker P, Le DMT, Casaregola S, Gaillardin C, Thonart P, Nicaud JM

(2005) Identification and charecterization of Lip7 and Lip8

genes encoding two extracellular triacylglycerol lipases in the

yeast Yarrowia lipolytica. Fungal Genet Biol 42:264–274

Ficker P, Marty A, Nicaud TM (2011) The lipases from Yarrowialipolytica: genetics, production, regulation, biochemical charac-

terization and biotechnological applications. Biotechnol Adv

29:632–644

Harju S, Fedosyuk H, Peterson KR (2004) Rapid isolation of yeast

genomic DNA. BMC Biotechnol 4:4–8

Jaeger KE, Dijkstra BW, Reetz MT (1999) Bacterial biocatalysts:

molecular biology, three-dimensional structures and biotechno-

logical applications of lipases. Annu Rev Microbiol 53:315–351

Kohno M, Funatsu J, Mikami B, Kugimiya W, Matsuo T, Morita Y

(1996) The crystal structure of lipase II from Rhizopus niveus at

2.2A resolution. J Biochem 120:505–510

Krieger E, Joo K, Lee J, Raman S, Thompson J, Tyka M, Baker D,

Karplus K (2009) Improving physical realism, stereochemistry

and side-chain accuracy in homology modelling: four

approaches that performed well in CASP8. Proteins 77:114–122

Kumar SS, Gupta R (2008) A thiol activated lipase from Trichospo-ron asahii MSR54: detergent compatibility and pre-soak

formulation for oil removal from soiled cloth at ambient

temperature. J Microbiol Biotechnol 10:513–521

Kumari A, Gupta R (2010) Extracellular expression and character-

isation of thermostable Lip8, Lip14 and Lip18 from Yarrowialipolytica. Biotechnol Lett. doi:10.1007/S10529-012-0958-8

Laemmli UK (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227:680–685

Mingrui Y, Shaowei Q, Tianwei T (2007) Purification and charac-

terization of the extracellular lipase Lip2 from Yarrowialipolytica. Process biochem 42(3):384–391

Naka Y, Nakamura T (1992) The effect of serum albumin and related

amino acid on pancreatic lipase and biles salts inhibited

microbial lipases. Biosci Biotechnol Biochem 56:1066–1070

Sharma R, Gupta R (2010) Extracellular expression of keratinases

Ker P from Pseudomonas aeruginosa in E. coli. Biotechnol Lett

32:1863–1868

Singh R, Gupta N, Goswami VK, Gupta R (2006) A simple activity

staining protocol for lipases and esterases. Appl Microbiol

Biotechnol 70:679–682

Szilagyi A, Zavodsky P (2000) Structural differences between

mesophilic, moderately thermophilic and extremely thermophilic

protein subunits: results of a comprehensive survey. Struct Fold

Des 8:493–504

Vakhlu J, Kour A (2006) Yeast lipases: enzyme purification, biochemical

properties and gene cloning. Electron J Biotechnol 9:69–85

Vendittis E, Castellano I, Cotugno R, Ruocco MR, Raimo G, Masullo

M (2008) Adaptation of model proteins from cold to hot

environments involves continuous and small adjustments of

average parameters related to amino acid composition. J Theor

Biol 250:156–171

Willard L, Ranjan A, Zhang H, Monzavi H, Boyko RF, Sykes BD,

Wishart DS (2003) VADAR: a web server for quantitative

evaluation of protein structure quality. Nucleic Acids Res

13:3316–3319

Wrinkler UK, Stuckman M (1979) Glycogen, hyaluronate and some

other polysaccharides greatly enhance the formation of exolipase

by Serratia marcescens. J Bact 138:663–679

Yu MR, Qin SW, Tan TW (2007a) Purification and characterization

of the extracellular lipase Lip2 from Yarrowia lipolytica. Process

Biochem 42:384–391

Yu MR, Lange S, Richter S (2007b) Higher level expression of

extracellular lipase Lip2 from Yarrowia lipolyitca in Pichia

pastoris and its purification and characterisation. Protein Expr

Purif 53:255–263

Zhao H, Zheng L, Wang X, Liu Y, Xu L, Yan Y (2011) Cloning,

expression and characterization of new lipases from Yarrowialipolytica. Biotechnol Lett 33:2445–2452

World J Microbiol Biotechnol (2012) 28:3103–3111 3111

123