Breeze Summer 2015 RICH · 2018-04-02 · 6 6 Breeze | Summer 2015 Click HERE to return to Table of...

BreezeBreezeBreezeA

Can Mixing Systems Help Prevent Aging Surface Water?

Natural Organic Matter Removal and Disinfection By-Product Reduction

Water Main Replacement Helps Greater Cincinnati

Issue 162 • Summer 2015

Inside:

The Offi cial Publication of the Minnesota Section of the American Water Works Association

Winona’s Wincrest Water Tank Continues to Perform Well

647 Hale Ave. N, Oakdale, MN 55128 Ph: 651-777-4041 Fax: 651-777-5312 www.engamerica.com

Installed: 2008Tank Type: Composite Elevated TankStorage Capacity: 400,000 GallonsEngineer: Short Elliott HendricksonContractor: Engineering America

PROJECT OVERVIEW:Engineering America crews completed the Wincrest water tower in August 2008 for the city of Winona, Minnesota. The 143-foot-tall structure has a capacity of 400,000 gallons and serves the far southwest quadrant of the city.

A life cycle maintenance analysis studied the cost of painting a welded steel water tower over a 50-year life cycle. City officials awarded the project based on a present worth analysis that showed a substantial savings by using Engineering America’s Aquastore composite glass-fused-to-steel elevated tank.

CASE STUDY

In 1980 we made an innovative promise that Aquastore tanks would never have to be sandblasted or painted. No Aquastore tank has required sandblasting or painting since!

100% Employee-Owned

Water professionals agree.

Medora Corporation Dickinson, ND 866-437-8076 www.medoraco.com Brands of Medora Corporation

Medora Corporation helps solve water quality problems and save money.

From California to New York, water operators and engineers trust Medora Corporation

to help reduce operating costs and achieve better compliance in their potable water

systems, wastewater lagoons and lakes. They depend on our electric, solar and

air-powered systems for fast, reliable results. And that’s just the beginning.

Year after year, our customer support and long-term product performance

ensure complete satisfaction.

To read the case studies and learn more, visit medoraco.com/betterwater

POTABLE WATER MIXING Reduce stratification, improve residual, prevent ice buildup

Concord, Massachusetts

WASTEWATER Reduce energy cost, improve nutrient removal, achieve compliance

St. Helens, Oregon

POTABLE WATER THM REMOVAL Achieve compliance

York, New York

LAKES AND RAW WATER Reduce WTP operating costs, control algae, increase hypolimnetic oxygenation

Pagosa Springs, Colorado

FERGUSON.COM/WATERWORKS

The water meter technology race is on. Ferguson Waterworks is out in front.

With advanced metering technology, your business can be more efficient, more profitable and more service orientedthan ever before.

Automated Meter Reading (AMR) and Advanced Metering Infrastructure (AMI) are more than industry buzzwords – they provide a steady flow of valuable data to achieve your business goals, and provide consumers critical understanding of their own usage habits. The result is better business and improved stewardship of our water resources.

IowaSteven Brush

(651) 242-1221

MinnesotaTodd Phillips

(612) 850-9495

Message from the Chair 6Message from the Director 9Message from the Editor 10Governing Board Highlights 12Industry News 53News & Notes 56Professional Directory 60Ad Index 61

DisclaimerThe ideas, opinions, concepts, procedures, etc. expressed in this publication are those of the individual authors and not necessarily those of the MNAWWA section, its offi cers, general membership, or the editor. The mention of trade names for commercial products does not represent or imply the approval or endorsement of AWWA. This magazine is presented solely for informational purposes.

Minnesota Section American Water Works Association

Executive Board of Directors

ChairJeff LarsonMarshall Municipal Utilities113 S. 4th StreetMarshall, MN 56258-1223

Vice ChairJim SadlerCity of Maple Grove12800 Arbor Lakes ParkwayMaple Grove, MN 55369

Section Past ChairSteve SchneiderSt. Paul Regional Water Services19000 Rice StreetSt. Paul, MN 55113

AWWA DirectorJon EatonCity of Eagan3419 Coachman PointEagan, MN 55122

AWWA DirectorUma Vempati HDR Engineering 701 Xenia Avenue South, Suite 600Minneapolis, MN 55416

Section Secretary-TreasurerLucas MartinMinnesota Department of HealthP.O. Box64975St. Paul, MN 55164-0975

Assistant Secretary-TreasurerBen FeldmanSt. Paul Regional Water Services1900 Rice StreetSt. Paul, MN 55113

FeaturesTable of Contents

BreezeIssue 162 • Summer 2015

Visit us at www.mnawwa.org

This document is printed on paper certifi ed to the standards of the Forest Stewardship Council® (FSC®).

Breeze Magazine is published by

Tel: 866-985-9780 Fax: 866-985-9799www.kelmanonline.com

Managing Editor - Scott KelmanDesign/layout - Daniel Goulet

Marketing Manager - Darrell Harrisdarrell@kelman.ca

Advertising Co-ordinator - Stefanie Hagidiakow

Evaluation of Water Main Replacement Program Helps Greater Cincinnati 17Can Mixing Systems Help Prevent Aging Surface Water? 25NOM Removal and Disinfection By-Product Reduction 292015 Membership Directory 352015 Buyers’ Guide 49

Departments

6 Breeze | Summer 2015 Click HERE to return to Table of Contents6 Breeze | Summer 2015 Click HERE to return to Table of Contents

T he dirt is fl ying and hydrants are fl ushing. It’s a nice change from beating frost and routine water plant

maintenance. The primary reason I became involved with AWWA was assisting others in the Southwest operator schools. After this stint as Chair, it would be nice to get back to that more. Admittedly, part of the reason behind this is selfi sh. This reason is providing a relatively close opportunity for operators to obtain contact hours, take examinations, and not fall asleep. At the time this was written, the Metro and Southwest districts recently had their spring schools. It was reported the Metro school exceeded 250 attendees and the Southwest had 70. This is probably record (or near record) attendance for both. Thank you to the attendees, presenters, vendors, Minnesota Department of Health staff, and those who plan all our district schools.

Message from the Chair

Jeff Larson

Besides operator schools, Minne-sota AWWA offers other opportunities. Some have already happened but there are many yet to come. This list doesn’t include all that happens within the coun-cils and committees. It doesn’t include all the “hard” AWWA resources such as standards and other print or web based material. The events do offer another way for those in the industry to learn and grow.

Water For People• 5K Run/Walk, August 14• Motorcycle Ride, August 15

Midwest Water Utility Management InstituteThe Institute was held March 10-13 at Hamline University and had maximum attendance. About ten years ago I had the opportunity to attend. To this day, it wasthree of the best days I’ve spent at a work-related function.

AWWA Legislative Fly-InThis year’s Fly-In was March 18-19 in Washington, DC. Pat Shea and Bill Schlu-enz represented the Minnesota Section.

Regional Meeting of Section Offi cers (RMSO)The RMSO was April 24-25 in Chicago. The Minnesota Section had four members attending.

Summer Leadership WorkshopThe Leadership Workshop is July 21-24 in Denver. The Minnesota Section will have six members attending.

ACEThe Association’s Annual Conference and Exposition is June 7-10 in Anaheim. This will be the fi rst ACE for me, and, from what I’ve heard, it’s a must at least once. The convention center and hotel are across the street from Disneyland. For some awful reason I told this to my 8- and 10-year old daughters. It’s one of those things you want to retract imme-diately after saying it. They can’t believe ACE isn’t a kid’s event being so close to Disney. Since they can’t go I’m sup-posed to bring something back, “or be served with a side of ketchup.” Whatever that means is not quite certain.

MN AWWA Annual ConferenceI’m saving the best for last. This year it will be September 15 -18 in Duluth. It’s tough to beat Duluth in September. Our Annual Conference has a great loca-tion, facility, events, and presentations. If nothing else, you’ll get to see Mr. Chair publicly speak. That’s what we’ll call it for now. A new tie might be in order. That will make tie number four. After that, the tie quota will be full—one tie per each decade of life. •

Upcoming events

Extensive Experience & Client Service:Advanced & Innovative Treatment

Water Storage Tanks & NACE III Certified Inspection

Custom Renovations

Cost Saving Optimizations

Proficient Planning:Navigating Regulatory & Funding Requirements

Water Distribution System Analysis

Water System Planning Studies

Utility Rate Studies

www.bolton-menk.com | bmi@bolton-menk.com Fourteen offices serving the Upper Midwest

DESIGNING FOR A BETTER TOMORROW

YOUR LOCAL WATER & WASTEWATER PROFESSIONALS

––––––

AIRVAC vacuum sewer systems use smaller diameter pipes and shallower trenches which

reduces excavation and surface restoration resulting in significant cost savings compared to

conventional gravity sewers. The AIRVAC system requires only simple maintenance, is operator

friendly and is completely sealed which eliminates any possibility of infiltration and inflow.

––––––

BILFINGER WATER TECHNOLOGIES airvac.water@bilfinger.comwww.water.bilfinger.com

AIRVAC VACUUM SEWER SYSTEMS WILL SAVE YOU MONEY

8 Breeze | Summer 2015 Click HERE to return to Table of Contents

Thousands of quality water treatment installations since 1956. Represented in Minnesota by Great Northern Environmental.

Customized Systems with Guaranteed Results!

763.559.2837

sales@tonkawater.com

WWW.TONKAWATER.COM

Great Northern Environmental

651.289.9100 | www.GNENV.com

Tonka Water offers a wide range of customized water treatment solutions

to meet specific application requirements.

Recommendations tailored for your needs and budget!

MembranesIon ExchangeFiltration

Design with community in mind

stantec.com

Helping communities tap into water’s potential

9Summer 2015 | BreezeClick HERE to return to Table of Contents 9Summer 2015 | BreezeClick HERE to return to Table of Contents

Congratulations! With your help, AWWA grew in 2014. The Association had a total membership of 50,173 as of

12/31/2014.The Minnesota Section was a leader

in membership recruitment in 2014 with a 1.3% increase! The Section represents 1.9% of AWWA’s membership, ended the calendar year with a membership count of 955 (850 Individuals, 17 Utilities, and 88 Service Providers), and beat our membership goal…Yea! Only fi ve sections reached their retention goal; unfortunately Minnesota Section missed its goal by two members but still had the fi fth best reten-tion rate.

The Minnesota Section, along with 17 other sections will be recognized and awarded incentive checks for accom-plishing goals at the 2015 Membership Summit, February 4-6 in Denver, CO. •

Message from the Director

Jon EatonMembership challenge

800-437-1146 • www.pollardwater.com

CATALOG 174 COMING S

Put our Chemical Feed experts to work for you. We offer competitive pricing and fast shipping anywhere in the world.

Pollardwater is your source for Chemical Feed!

Call Nick at x171 for Tech Support and Free Shipping on Chemical Feed Pumps

Message from the Editor

Stew’s thoughtsStew Thornley

In early March, a dispute between North St. Paul mayor Mike Kuehn and council member Scott Thorsen almost escalated to the two duking it out in the

parking lot after Kuehn asked Thorsen if he wanted to take it outside.

It’s good to know that Minnesota AWWA is more functional than North St. Paul, at least to the point that I’m not aware of the chair ever saying to the chair-elect, “Wanna take it outside, Bulldog?”

But even without Ali vs. Frazier, Minnesota AWWA meetings are fun and entertaining while being productive. I’ve been on the board a couple times—once as a council chair and the other time as secretary-

treasurer. In terms of the three-hour meetings I’ve attended in my life, these have been among the more enjoyable.

Work gets done, business gets pro-cessed, actions get taken, but, even sans fi sticuffs, a Minnesota AWWA board meet-ing mirrors the pleasure and satisfaction of the overall participation in the organization.

My predecessor as secretary-treasurer, Dave Brown, told a story of a board meet-ing he taped so he could review the pro-ceedings as he wrote the minutes. His wife overheard some of the recording and said, “Wow, you guys have way too much fun.”

Fun and productivity are big parts of everything we do, and Minnesota

AWWA does it as well as anyone or any organization.

I guess this is a call for volunteers, to join or get even more involved in carrying out our mis-sion of providing safe drinking water and having a good time doing it. Whether serving on the board as a trustee or council chair or joining a committee or getting involved in an activity such as the annual Splash Dash, consider exploring the opportunities for participation.

The folks listed on the page with the table of contents will be happy to help you out in fi nding ways to get even more out of your AWWA membership.

Minnesota AWWA—the most fun you can have with your clothes on. •

WWW.KODRU-EQUIPMENT.COM(952) 479-1045

YOUR TRUSTED SOURCE FOR VALVE & ACTUATOR SOLUTIONS

Governing Board Highlights

Board meeting highlightsBoard ElectionsThe President-elect candidates were Michael Simpson (Indiana Section and AWWA Vice-President) and Jeanne Ben-nett-Bailey (Virginia Section and AWWA Public Affairs Council Chair).

Jeanne is the Public Affairs Offi cer for Fairfax Water in Fairfax, Va., where she has worked in various capacities since 1981. Jeanne left Fairfax Water in 1999 to spend 2½ years working with AWWA on regulatory affairs, returning to Fairfax Water in 2002 as the Public Affairs Offi cer.

Michael is the CEO of M.E. Simpson Company, Inc. in Valparaiso, Ind. He oversees the company as a whole, con-centrating on fi nancial management and business development.

Both gave thoughtful, compelling speeches; the Board voted Jeanne Ben-nett-Bailey as the next President-elect.

There were ten candidates for four open vice-president positions. The Vice-Presidents elected were Steve Dennis (Cal-Nevada Section), Jon Eaton (Min-nesota Section), Martha Segal (Kentucky/Tennessee Section), and Brian Steglitz (Michigan Section). The elected VPs will join Brenda Lennox (Pacifi c Northwest Section) and Warner Palermo (Portico Section) as AWWA’s vice-presidents.

Three candidates competed for one open Director-At-Large position; the Board elected Sally Mills-Wright (Texas Section).

Congratulations to all!

AWWA Trustee to the Research FoundationEach year, the President-Elect of the American Water Works Association is re-sponsible for appointing or reappointing a trustee to the Water Research Founda-tion’s Board of Trustees. In June 2015, the fi rst term for Paul Rush will expire, and as such, he is eligible for reappoint-ment. Paul has indicated his willingness to serve another term and as such has been reappointed.

AWWA Liaison to the Association of Boards of Certifi cation (ABC)The Association of Boards of Certifi cation (ABC), formed by AWWA and WEF, is an organization through which certifying au-thorities may communicate and cooperate in order to better fulfi ll its responsibility to ensure competence of employees of environmental occupations and laborato-ries. The 2011 Memorandum of Under-standing with ABC states that AWWA will appoint one of its members with experi-ence certifi cation programs to serve as the offi cial liaison between AWWA and ABC for a two-year term, with a three term limit. Laurie Dougherty is currently serving her fi rst term which ends in June 2015 and has indicated her willingness to serve another term.

Section AllotmentsSection Allotments for 2015 are calcu-lated as 18% of the dues received for the period of September 1, 2013 through August 31, 2014. The Minnesota Section collected $168,665 in dues during the period. The 2015 approved allotment will be $30,360.

Section AssessmentsIn order to levy an assessment, 35% of a Section’s membership is required to vote in an assessment “referendum,” with two-thirds of those voting approving the assessment. If an assessment was approved by this method, future changes to the amount of the assessment could be determined by a vote of the Sec-tion’s Board of Trustees rather than of the whole membership.

Michigan and Ohio sections have raised a concern, stating the 35% or greater membership vote with a two-thirds approval could be too high of a threshold to meet. The Association Board will review the assessment approval percentage as part of the 21st Century Membership Model discussion.

Business Plan UpdatesAWWA CEO David LaFrance presented up-dates on various initiatives and where they fi t in the 2015 Business Plan (attached)

The AWWA Staff Business Plan is built upon department business plans (Five-Year Financial Model, International Strategic Plan, Membership Strategic Plan, Convention and Education Plan, Publishing Strategic Plan and the AWWA Tech-nology Roadmap), organized by the strategic objectives found in the AWWA Strategic Plan, and summarizes the actions and goals that will be undertaken in 2015.

AWWA2020: A Path to One AWWA - UpdateA resolution was adopted and approved by the Board in June 2014. The resolution views AWWA is the collective “Association” AND “Section” (“We Are One”). In addition, the resolution presents a vision and general guid-ance of how the association wants to operate in 2020 (the future).

The “Path to One AWWA” is broken into fi ve strategic themes. Each theme was discussed by subject matter commit-tees (SMCs…pronounced “smacks”). Below are the themes and some related programs/ideas.Communication• Timely, meaningful information/feedback

will better align AWWAEducation• EPA Grant (a model for the future – associa-

tion makes and sections deliver content)• Water X – Water Training and Educational

Resource Exchange• Education material inventory• Cost sharing of intellectual property (how

will that work?)Branding• Common logos to make AWWA look alike• Members will know they are connected

with AWWA content• Everyone is united around mission and visionMembership• Members ARE part of the association and

section (“We Are One”)

13Summer 2015 | BreezeClick HERE to return to Table of Contents

GOLDFLO WT® ECOFLO®100 INTEGRITY® STORMWATER UNDERGROUND FITTINGS QUALITY DETENTION

For over 35 years, Prinsco has been developing more than just plastic pipe. We’ve been developing a reputation that’s founded on one simple thing: INTEGRITY. It’s how we design our products, it’s how we treat our customers, it’s how we do business.

Look for our GOLD STRIPE of quality to ensure your pipe has been engineered with integrity.

water management solutions

800.992.1725 | prinsco.comAmanda Peterson | 320.444.7206

US: 9 plants & 6 yards Canada: Winkler, Manitoba & Taber, Alberta

Governing Board Highlights

• Clear and coordinated efforts to gather and retain members

• Membership guide (to be re-launched at the membership summit)

Finance• Resources put to the most effi cient use• Association has a bigger buying power

– can extend this to sections• Conference decorating• Business materials and supplies• Printing• Member management software

The Minnesota Section has completed the branding and strategic plan alignment.

21st Century Membership Model StructureThere was much discussion about the membership structure, its multiple options, and the confusion it creates for people looking to join or think they are members because their employer is either a Service Provider or Utility member. Everyone agreed that simplifying the structure would help but not to move away from the hybrid-membership structure (Individual, Utility, or Service Provider). Additional feedback was provided so a refi ned discussion can take place at June 2015 AWWA Board Meeting.

A little counter to the previous discussion, the Board approved adding an “International Member.” Currently, a member is not defi ned by his or her location of residence or business. Members residing outside of North America have typically represented one to two percent of total membership numbers. That statistic will change as AWWA extends its global focus. The new member designation will allow adjustable dues rates and benefi ts based on business and economic factors (World Bank economic indicators). Growth in new international markets, supported by the appropriate member structure for retention, would provide a greater likelihood of Association growth in terms of both fi nances and member count.

Total Water SolutionsAt the June 2013 AWWA Board meeting, a new strategic plan was adopted that in-cluded the following new strategic objec-tive for AWWA: “Expand the Association’s knowledge resources to include additional drinking water and total water solutions in response to member needs.”

To the Association, this means the development of knowledge resources not only in the core focus area of drinking water but also in the areas of wastewater, water reuse, and storm water. This decision was made because drinking water, wastewater, reuse, and storm water management is very closely linked in today’s world. Many water utilities provide a range of services including drinking water production, wastewater collection/treatment, and storm water management. Treated wastewater and storm water is not only discharged into our drinking water supplies but is also being looked at as a valuable resource on its own – either to supplement an existing water resource portfolio or to supplant a currently unsustainable supply. In addition, reuse water is a viable alternative for many utilities.

Staff continue to promote and monitor key metrics on this relatively new initiative (strategic planning, conferences, resource communities, technical programming, and standards)

India InitiativeUma is currently in India with other execu-tive AWWA staff presenting information on the Association and will write an initiative update in the upcoming Breeze.

Standard and Policy Updates…Twenty-three standards were approved.1. B102 Manganese Greensand for Filters2. B112 Microfi ltration and Ultrafi ltration

Membrane Systems3. B116 Electrodialysis and Ion-

Exchange Membrane Systems4. B305 Anhydrous Ammonia5. B306 Aqua Ammonia (Liquid

Ammonium Hydroxide)

6. B512 Sulfur Dioxide7. C213 Fusion-Bonded Epoxy Coat-

ings and Linings for Steel Water Pipe and Fittings

8. C216 Heat-Shrinkable Cross-Linked Polyolefi n Coatings for Steel Water Pipe and Fittings

9. C229 Fusion-Bonded Polyethylene Coatings for Steel Water Pipe and Fittings

10. C507 Ball Valves, 6 In. Through 60 In. (150 mm through 1,500 mm)

11. C560a Cast Iron Slide Gates12. C606 Grooved and Shouldered Joints13. C700 Cold-Water Meters—Displace-

ment Type, Metal Alloy Main Case14. C701 Cold-Water Meters—Turbine

Type, for Customer Service15. C702 Cold-Water Meters—Com-

pound Type16. C703 Cold-Water Meters—Fire-

Service Type17. C704 Propeller_Type Meters for

Waterworks Applications18. C708 Cold-Water Meters—

Multijet Type19. C710 Cold-Water Meters—

Displacement Type, Plastic Main Case20. C712 Cold-Water Meters—

Singlejet Type21. C713 Cold-Water Meters—

Fluidic-Oscillator Type22. C906 Polyethylene (PD) Pressure

Pipe and Fittings, 4 In. Through 65 In. (100 mm through 1,600 mm), for Waterworks

23. G200 Distribution Systems Operation and Management

Five policy statements were revised and approved.1. Assignment of the Continuing

Education Unit and Professional Development Hour Policy

2. Emergency Preparedness & Security Policy

3. Employee Compensation4. Protecting the Allocation of Surface

Water Reservoir Storage Capacity and Yield for Water Supply Purposes

5. Regional Collaboration by Water Utilities •

Since 1947, Brown and Caldwell

has helped municipal utilities

solve their toughest drinking water

challenges. Advance with us.

Master Planning

Water Supply, Distribution and Treatment

Integrated Buried Infrastructure Management

Environmental Compliance

Instrumentation and Control Systems

Business Consulting

Facilities and Energy Optimization

Asset Management

WATER ENGINEERING

WASTEWATER ENGINEERING

WATER RESOURCES ENGINEERING

ELECTRICAL ENGINEERING

FINANCIAL SERVICES

ASSET MANAGEMENT

INSTRUMENTATION & CONTROLS

OPERATIONS OPTIMIZATIONwww.ae2s.com

Advanced Engineering and Environmental Services, Inc. (AE2S)

Vision. Value. Passion. Integrity. Relationships. Attitude.

ELEMENTS OF YOUR SUCCESS

We represent Siemens Industry Inc. If you need to measure fl ow, level, pressure, temperature or other processes, we can provide solutions for

you applications. Call today to schedule a visit.

Jasper Engineering and Equipment CompanyWe offer a full line of Instrumentation solutions

Jasper Engineering & Equipment Co.700 Hamel Road

Medina, MN 55340Phone: 952-938-6504

Fax: 952-935-7772www.jaspereng.com

DependableAccurate &EXPERIENCEDLeak Detectors

he key goals of an asset management (AM) program are to maintain an acceptable level of service, maximize the useful life of infrastruc-ture, and minimize life-cycle costs. As water utilities implement their AM programs, they are faced with the challenges of rehabilitating and replacing aging water mains. In the process of

addressing these needs, “each utility’s objective is to make these investments at the optimal time for maintaining current service levels and to avoid replacing pipes while the repairs are still cost-effective.” (AWWA, 2012) Thus, two common hurdles these utilities encounter are determining the most cost-effective replacement rate and targeting the appropriate pipes for replacement.

Few water utilities have analytical processes in place that allow them to accurately measure the effectiveness of their water main replacement program (WMRP) to validate or improve upon the decision process by which water mains are selected and prioritized for replacement. Nonetheless, in order to optimize an AM program and ensure adequate ongoing funding, a defensible evaluation of a WMRP’s effectiveness is important. Assessing fail-ure causes, failure trends, risk factors, and impact of replacement

Bo Copeland, PE, Associate, Hazen and Sawyer, Cincinnati, OhioJamie Weinle, EIT, Assistant Engineer, Hazen and Sawyer, Cincinnati, OhioBecky Calder, PE, Senior Engineer, Greater Cincinnati Water Works, Cincinnati, Ohio

efforts can improve understanding of replacement dynamics and better inform decision-making. A well-tuned selection process for water main replacement helps maximize system reliability, mini-mize premature pipe replacements, and reduce life-cycle costs.

“… a crucial responsibility for utility managers now and in the future is to develop the processes to continually improve their understanding of the ‘replacement dynamics’ of their own water systems. Those dynamics should be refl ected in an Asset Management Plan (AMP) and, of course, in a long-term capital investment plan.” (AWWA, 2012)

The GCWW storyThis article reviews the successful effectiveness evaluation that was conducted by Hazen and Sawyer (New York, New York) for Greater Cincinnati Water Works (GCWW), a large water utility with 3,100 miles of water main. GCWW is owned and operated by the city of Cincinnati and serves a population of approximately 1.1 million through 247,000 retail and wholesale customer accounts in fi ve counties within southwest Ohio and northern Kentucky (Figure 1).

Reprinted with permission by the KY/TN AWWA from Straight from the Tap Winter/Spring 2015

The pipes in GCWW’s system are up to 150 years old with an average age of 46 years (Figure 2). GCWW has long recognized the importance of good asset management practices, including an ongoing WMRP, to help reduce occurrences of main failures and to prevent a signifi cant increase in failure rates as pipes age. As such, GCWW has maintained water main failure records and employed a proactive WMRP for 30 years while making a signifi -cant investment in replacement of aging and deteriorating water mains through its WMRP.

GCWW’s process for selecting and prioritizing mains for replacement has evolved since it began an organized, proactive program to replace aging and deteriorating water mains in 1985. Prior to that time, water main replacement was strictly reaction-ary based on emergency water main repairs. Initially, budget constraints limited water main replacement projects to an annual replacement rate around 0.25 percent of the entire distribution system. The goal was to address the worst maintenance prob-lems, usually limited to a few individual streets. In the late 1980s,

Figure 2. GCWW Annual Water Main InstallationFigure 1. GCWW Service Areas

Map Legend

City of Cincinnati (Retail Service Area)

GCWW Retail Service Areas

Wholesale Areas

County Boundaries

as a result of an effort by the mayor and council to restore the condition of the city’s assets, GCWW began to target an annual water main replacement rate of 1 percent. Replacement rates since the early 1990s have averaged slightly below the 1percent goal. Today, the WMRP budget allows GCWW to both react to failures and to actively plan the future of the water distribution system. Projects in the program now are multi-street projects which address more than just maintenance, but can also help with fl ow issues, system upgrades, etc. In the past 10 years, the average replacement rate has been 0.95%; and the 1% goal has been exceeded three times (Figure 3).

Evaluating water main failure ratesFor purposes of evaluating the effectiveness of GCWW’s WMRP, failure rates (including both breaks and leaks) were normalized (to number of failures per 100 miles of pipe) by pipe attributes (such as material, diameter, and installation decade) and by spatial attributes (such as soil corrosiveness and operating pressure) in order to identify failure causes and trends. This allowed GCWW to better understand which factors most infl uence water main fail-ure rates in its system, identify recent failure trends for individual pipe classes, and evaluate the effectiveness of nearly 30 years of water main replacement efforts.

Failure rates from 1985–2003 trended upward (Figure 4). The analysis showed that the failure rates increased substan-tially in 1994, but this is likely due to better record-keeping as an electronic recordkeeping system was implemented and fewer breaks and leaks went unlogged. Except for 2007, which had atypical weather conditions (discussed later), failure rates have been trending downward in the last 10 years (Figure 4) as a result of more aggressive main replacement spending—especially in 2003 and 2004 (Figure 3). Since inception of the WMRP, the average failure rate has been 24 failures per 100 miles of pipe; but failure rates were reduced to 16 or less in 2012 and 2013 (the most recent year for which complete data are currently available), which is in line with the top quartile of comparable large water utilities. (AWWA, 2014) The AWWA Partnership for Safe Water Distribution System Optimization Program goal for a fully optimized distribution system is 15 breaks per 100 miles of pipe annually. (AWWA Partnership for Safe Water, 2011)

The detailed analysis confi rmed information that was already known either intuitively or from previous reviews, but it

Figure 4. GCWW Annual Water Main Failure RatesFigure 3. GCWW Annual Water Main Replacement

also revealed several new discoveries and clarifi ed some prior [mis]understandings about which pipes were failing at the highest rates. Ninety-eight percent of the water main failures in GCWW’s system have been on gray cast iron pipes, which still account for the majority of piping in the system, despite ongoing efforts to replace cast iron with ductile iron piping (Figure 5). Sixty-four percent and 25 percent of failures, respectively, have been on six-inch and eight-inch diameter pipes (Figure 6); and 60 percent of failures have been on pipes with leadite joints. There are at least two reasons for high failure rates associated with leadite joints: “First, leadite has a different coeffi cient of thermal expansion than cast iron and results in additional internal stresses that can ultimately lead to longitudinal splits in the pipe bell. Secondly, the sulfur in the leadite can facilitate pitting corrosion resulting in circumferential breaks on the spigot end of the pipe near the leadite joint. The failure rate in the industry for leadite joint pipe is signifi cantly higher than for lead joint pipe even though the pipe may not be as old.” (American Water Works Service Co., Inc. 2002, p3)

Pipe vintage – not to be confused with ageAn interesting fi nding of the evaluation was that pipe vintage (e.g., decade installed) affects failure rates more than does pipe age. In particular, pipe installed in the 1940s has, on average over the past 30 years, had a signifi cantly-higher failure rate than pipe installed in any other decade. Thus, as the system has aged over the last three decades, the median pipe age at failure (Figure 7), i.e., considering all failures to date, has increased from approxi-mately 48 years to approximately 53 years as a result of very low failure rates in pipes installed over the last fi ve decades (Figure 8).

Another observation of note is the average failure rate of 3.67 failures per 100 miles for pipes installed in the current decade (Figure 8), which is relatively high compared to pipes installed during the previous three decades. This is due to the high failure rate that sometimes occurs right after installation, when failures are typically associated with material defects and poor installa-tion. The same phenomenon occurred in the 1990s with pipe

Figure 5. GCWW System Composition by Water Main Pipe Material Figure 6. GCWW System Composition by Water Main Pipe Size

installed during that decade. This effect is described as the ‘burn-in’ phase by Kleiner and Rajani, who note, “The life cycle of a typical buried pipe is often described by a so-called ‘bathtub curve’ ... [which] often distinguishes between three phases in the life of a pipe. The fi rst phase, also known as the ‘burn-in’ phase ” (Kleiner et al, 2001).

Climatic and environmental impactsClimatic conditions—particularly sustained very-low temperatures or sustained hot, dry weather—were found to have a signifi cant effect on main failure rates. A seasonal trend (Table 1) is clearly evident in the historical failure data. Failures occur most frequently in December, January, February, July, and August. Individual years with very high failure rates can often be attributed to a very cold period in the winter and/or hot, dry weather in the summer. For example, 2007 was atypical with an unusually cold winter and prolonged hot, dry weather in late summer, which resulted

in particularly high failure rates in February, March, September, and October (Table 1). GCWW staff have observed that main failure rates increase dramatically once water temperatures fall below approximately 38–39 degrees Fahrenheit, which occurred in February 2007, when the area experienced three consecutive weeks of average ambient temperatures below 22 degrees Fahr-enheit and again in early 2014. This phenomenon is discussed in a report by American Water Works Service Co., Inc. (American Water Works Service Co., Inc., 2002, p12)

Environmental conditions such as soil corrosiveness and frost potential also affect water main failure rates. Using NRCS soil map shapefi les, corresponding soil attributes were spatially joined to the failure records. As expected, there has been a correla-tion between soil corrosiveness and pipe failure rates. Since the

Figure 8 GCWW Water Main Failure Rates by Pipe Installation DecadeFigure 7. GCWW Pipe Age at Failure

majority of GCWW’s distribution network is located in highly cor-rosive soils, this is particularly disconcerting. However, in the past three years the correlation between failure rates and soil corro-siveness has been decreasing, which is thought to be the result of using polyethylene encasement on all new iron pipe, which has been GCWW’s standard since 1977. Hopefully, this practice will eventually eliminate the correlation between soil corrosiveness and water main failures.

Other fi ndingsFor purposes of this study, failures were classifi ed as either breaks or leaks as follows:• Breaks – Circumferential cracks, longitudinal cracks, bell

cracks, and corrosion holes.• Leaks – Joint leaks due to rusted bolts or failed gaskets/joint

material, leaks at couplings or clamps, and leaks at connec-tions between two pipelines (e.g., tee, tapping sleeve, etc.).

An unexpected fi nding of the study was that water main breaks occur much more frequently than leaks among known failures, with fi ve times as many break records as leak records in recent years. Also, the majority of the failures (greater than 54%) were circumferential or longitudinal cracks, and fewer than 20% of failures were attributed to corrosion (Figure 9).

Although most pipe classes have followed the overall trend of decreasing failure rates, there are some exceptions. Figure 10 shows one example of a community where the failure rate has actually increased in the last couple years.

Recordkeeping and other best practicesThrough this evaluation, the importance of compiling accurate, complete, and consistent records of all pipe failure incidents was very apparent. These records are essential to a proper under-standing of historical failures, risk factors, and the effects of water main replacement efforts. Not only do these records allow a utility

Table 1. GCWW Water Main Failures by Month, Average vs. 2007 Figure 9. GCWW Water Main Failures by Failure Type

to identify and understand the pipe attributes and risk factors that most infl uence pipe failure rates in its system, but they also provide the means by which to analyze the impact of water main replace-ment efforts over an extended period of time. In order to manage the data most effi ciently and ensure maximum usefulness, each failure record should include at least the following information:• Failure date• A unique Failure ID• GPS coordinates• Unique pipe Asset ID (e.g., from GIS or CMMS)• Classifi cation of failure, using standardized terminology• Pipe attributes

Asset, Materials, and Maintenance Management SoftwareeRPortal asset management

Some other lessons learned through this evaluation were: 1) water main replacement should not be prioritized based solely on pipe age; 2) do not be misled by the quantity of failures in a certain pipe class, when that pipe class represents a majority of the system—i.e., consider failure rates; and 3) it is important to identify and track all costs for emergency repairs in order to weigh these costs versus the cost of main replacement.

The futureGCWW has already successfully used the results of their WMRP effectiveness evaluation to infl uence their WMRP bud-geting process and refi ne the process by which water mains are targeted and prioritized for replacement. The fi ndings of this study will help maintain ongoing support for the WMRP and im-prove the program’s effi ciency. As budgets allow, future activities to enhance the study may include:• Investigate pipe classes with above-average failure rates.• Investigate pipe classes with a recent increase in failure rate.• Investigate how system and operational changes have im-

pacted failure rates.• Investigate the impacts of pipe rehabilitation on failure rates.• Estimate failure curves for major pipe classes.• Assess risk of failure (i.e., likelihood and consequence) for

individual water mains.• Determine target level(s) of service and key performance

indicators related to main failures and replacement efforts.• Predict long-term water main replacement funding needs.

AcknowledgementsThe authors would like to thank Greater Cincinnati Water Works and its staff (past and present) for their involvement in providing extensive documentation and anecdotal information, as well as compiling and validating copious data, all of which helped to make this study a success.

ReferencesAmerican Water Works Association (AWWA) (2012), Buried

No Longer: Confronting America’s Water Infrastructure Challenge.

AWWA (2014), 2012 Benchmarking: Performance Indicators for Water and Wastewater Utilities: Survey Data and Analyses Report.

AWWA Partnership for Safe Water Distribution Program (2011), Distribution System Optimization Program (Overview).

American Water Works Service Co., Inc. Engineering Dept. (2002), Deteriorating Buried Infrastructure Management Challenges and Strategies.

Kleiner, Y.; Rajani, B. (2001), Comprehensive review of structural deterioration of water mains: statistical models, Urban Water, 3 (2001) 131-150, Elsevier Science Ltd. •

Figure 10. Atypical Water Main Failure Trends for an Example Community

Through a network of 24 offices, KLJ provides integrated engineering, surveying, planning and

environmental services. We have the people and commitment to make a lasting difference in your

community. Learn more about our services and explore career opportunities at kljeng.com

k l j e n g . c o m

Municipal Engineering for Greater Minnesota Communities.

Engineering | Architecture | Surveying | Environmental

CLEAN WATER IS EVERYBODY’S BUSINESS.

HR Green has tackled water challenges for over 100 years with a careful business approach at every step of the journey: design, construction, ownership and operation.

TRANSPORTATION | WATER | GOVERNMENTAL SERVICES SENIOR LIVING | ENERGY | LAND DEVELOPMENT

2550 University Ave W, Suite 400N | St. Paul, MNPhone 651.644.4389 | Learn more at HRGreen.com

WATER TREATMENT PLANT UPGRADESMcHenry, Illinois

Find us in your town and all over the globe.

I n the past, many water operators thought daily turnover and fluctuation of volume was enough to mix the water in a stor-age tank. Today, research and tests are showing more effort

may be needed to effectively mix storage tank water and improve water quality. Several water tank features can contribute to how effective water is mixed and the rate at which it ages.

A tank’s design, daily use, and location in the system should all be considered when deciding the best action for improv-ing water quality. Tanks with high height to diameter ratio, such as standpipes, are more susceptible to aging surface water because greater water variations can develop among the many layers. As the distance between surface and bottom water increases, more effort is required for the bottom layers to reach the distant top layers. Same thing applies when inlet and outlet pipes are both placed in the bottom ring of a tank: the new incoming water is also the first to exit the tank while surface water is left to continue aging. However, if the inlet pipe is extended to allow over-the-top filling, then surface water can be pushed to the bottom and mixed with incoming water. “Water quality is a significant concern to water distribution

system managers. Disinfection by-product (DBP) formation is largely dependent on reaction time, and it can continue for several days within the distribution system. At the same time, disinfectant residual must be maintained throughout the most remote components of the system to ensure pathogen-free water. Managing the residence time of water within storage tanks is one practice available to minimize water age within the distribution system. Water system managers and engi-neers should consider the need for circulation of water and residence time management within storage tanks during the design phase.” AWWA M42

Although, water quality and circulation are often discussed during the design phase, they are continuing concerns for water

By Erika Henderson, Director of ResearchPittsburg Tank & Tower

operators. Deaths and illnesses occur daily from unhealthy water, and water operators can lose their license to operate a water system if unhealthy water is found in their system. Great responsibility comes with being a water operator and many pride themselves on providing excellent water quality. A popular method for improving water quality is to install a mixing system. Mixing systems can help prevent aging surface water that often leads to stratification, accumulation of disinfectant by-products, water quality loss and ice formation.

StratificationStratification occurs when water has become separated into layers. Layers are arranged according to density, and density differences are created when variations of water temperature or pH exist. The warmer, less dense, older water sits above the cooler, denser, new water coming in creating layers. The incom-ing water stays near the bottom and is also the first to exit the tank if an over-the-top fill has not been installed. The top layer of older water is left to age even further. As water ages, the quality deteriorates and bacterial growth increases. The bacteria may not cause sample problems in the warmer months, but may show up when the older, surface water begins to cool and sink to the bottom in the cooler months.

Water temperature can be checked every five foot during an inspection to help determine whether stratification is a problem. If stratification is an issue, then a mixing system may be needed. Mixing systems should be designed according to the tank’s unique dimensions and needs. Most are designed to take the denser, newer water from the bottom and mixing it with the less dense, warmer surface water. Mixing helps maintain consistent water temperatures and pH levels throughout the tank thus prevent-ing stratification. However, mixing must occur regularly to prevent reoccurring stratification, sample inconsistences and inaccurate disinfection treatment.

Disinfectant By-ProductsDisinfectant decay occurs when chemicals used for disinfection react with other organic material, organisms, and surfaces. These reactions create carcinogenic disinfectant by-products known as Trihalomethanes (TTHMs) and halo-acetic acids (HAAs). By-prod-ucts are present in almost all chlorinated water supplies, but the

key is keeping these levels as low as possible. Mixing systems can help keep these levels low by effectively blending all water with disinfectants increasing the contact time. When disinfectant contact time is increased less chlorine concentration is needed and thus fewer by-products are produced.

Ice FormationMost compounds become denser as they change from a liquid to a solid because the molecules become more tightly packed. But water is most dense at 39.2°F (4° C), and becomes less dense at lower temperatures causing ice to float. Water in a tank is the same and according to NFPA 25, “the temperature of water tanks shall not be less than 40°F (4.4°C).” When temperatures fall below freezing, ice can form on the surface. The ice will con-tinue to expand and get thicker as the water temperature remains below freezing. Ice can cause serious damage to a tank: tank coatings are often damaged, pipes can become clogged, leaks and structural damage can result, and even tank failures have occurred from ice forming in water tanks. “When a tank freezes, one or more of the following conditions

usually results and cause leakage.• Inside overflow or other piping breaks occur. • Ladders or other attachments to the container are pulled out

by ice, making a hole at the point of attachment.• Ice pressure can expand and place hoop stress loads on

the steel and seams, which may cause the tank wall to yield or burst.

• Leaks due to corrosion become apparent.” AWWA M42 Mixing systems can provide regular water circulation to help maintain a consistent water temperature above freezing and prevent the water from separating into layers where dangerous ice can form on the surface and sides of tanks.

Maintaining Water QualityAll tanks should be regularly monitored for mixing efficiency, but tanks with low filling cycles, high volume, or at the end of a water system should be monitored more often. These types of tanks may not only require mixing system upgrades, but may also re-quire more frequent inspections and cleanings to maintain water quality and reduce aging surface water. Mixing systems can help prevent aging surface water, but they must be designed and installed properly to be effective. A reputable tank company with knowledge and experience in these types of upgrades should be contacted to perform the work. For further information on water tanks and mixing systems please contact Don Johnston at 270-748-1343 or djohnston@watertank.com.

ReferencesAmerican Water Works Association, 2013. Steel Water Storage

Tanks. Manual M42 Revised Edition, Chapter 5, Water Quality Issues.

American Water Works Association, 2013. Steel Water Storage Tanks. Manual M42 Revised Edition, Chapter 10, Results of Freezing.

National Fire Protection Association, 2011. Standard for the Inspection, Testing, and Maintenance of Water-Based Fire Protection Systems. NFPA 25 2011 Edition, Section 9.2.4.1. •

Architecture

Aviation Services

Civil Engineering

Community Development

Construction Services

Environmental Services

Planning

Project Funding

Structural Engineering

Surveying

Transportation Services

Water and Wastewater

Water Resources

Offices Located in Brainerd, Duluth,

Grand Rapids, Hutchinson, Mankato,

Minneapolis, Minnetonka, Rochester,

St. Cloud, St. Paul and Virginia.

800.325.2055 • sehinc.com

Engineers | Architects | Planners | Scientists

Building a Better World for All of Us®

wsbeng.com

Building a Legacy

(888) 541-4800

24 Hour EmergencyService

651-765-0765interstatepm.com

Interstate Companies

1.855.84KLEAN Des Moines | Mankato | Rogers | Watertown | Sioux Falls

Experience the difference. One call. One experience. One service provider.

Visit Hydro-Klean.comto view our project library and learn

more about the valuable services Hydro-Klean has to offer.

Providing municipal services for water and wastewater utilities for over 30 years.

M icrosand ballasted clarifi cation has long been used in drinking water treatment as a means for turbidity and total organic carbon (TOC) removal. However,

further reduction of disinfection by-products (DBPs) has been hampered due to the inability to remove TOC with coagulation, fl occulation, and settling alone. With the addition of powdered activated carbon (PAC) into a pre-contact chamber ahead of the ballasted clarifi cation system, adsorption properties aid in the removal of the natural organic matter (NOM) and in turn

By: Bryan Fincher, Matt Cotton, Jim Daugherty, and Rich Dimassimo

help to meet U.S. Environmental Protection Agency (EPA) limits for DBPs. PAC is an extremely porous material as a result of the activation step, and a single particle can range in size from 1–150 micrometer (μm). A single gram of activated carbon can have a surface area in excess of 500 m2. By recycling the PAC back through the system to an upfront contact tank, versus single pass PAC dosing, further use of the PAC adsorption ca-pacity can be achieved, thus lowering operating costs associ-ated with DBP reduction.

Figure 1. Microsand Ballasted Clarifi cation with PAC Recycle Flow Diagram

Reprinted with permission by the KY/TN AWWA from Straight from the Tap Winter/Spring 2015

Process descriptionThe microsand ballasted clarifi cation system with PAC recycle includes typical coagulation, fl occulation, and settling tanks with the addition of a PAC pre-contact tank upstream of the coagu-lation basin (Figure 1). Within the PAC pre-contact tank, fresh PAC is added at the inlet at a dose of 5–30 milligram/liter (mg/L). Recycled sludge and PAC is also re-injected back to the process in the pre-contact tank which has a hydraulic retention time of 8–10 minutes. The solids content within the pre-contact tank is maintained at 1–2 g/L by controlling the PAC waste rate. After ex-iting the PAC contact tank, fl ow enters the coagulation basin with a retention time of 2–3 minutes. Coagulant is injected into the coagulation basin where rapid mixing is occurring and micro-fl ocs are beginning to form. Flow then enters the fl occulation basin for a retention time of 3–4 minutes. Here, microsand ballast is re-injected back into the process from the hydrocyclone where it was separated from the sludge. A polymer is also added to bind the fl ocs to the ballast in order to aid in settling.

Once leaving the fl occulation basin, fl ow enters the set-tling tank where the ballasted fl oc settle to the bottom and are collected by a scraper mechanism, and clarifi ed water exits the process via lamella settlers and overfl ow weirs. Solids at the bottom of the tank are then extracted through a slurry pump and recirculated to a hydrocyclone that separates the microsand bal-last from the PAC and sludge. The PAC and sludge are sent to a PAC waste tank where a small waste stream is pulled from the waste tank at a rate of roughly 0.1% of the raw water fl ow and the rest of the fl ow is returned to the pre-contact tank. The waste stream will increase or decrease in order to maintain a system solids concentration within the PAC pre-contact tank.

Nashville, TN: Pilot testingPilot testing was conducted in Nashville, TN at the Harpeth Valley Utility District (HVUD) Water Treatment Plant in late 2011. The plant currently has a rated capacity of 51 million gallons per day (mgd). The goals of the pilot testing were to maintain effl uent TOC levels below 1.0 mg/L while reducing DBPs to less than 48 μg/L Trihalomethanes (TTHMs) and less than 36 μg/L Haloacetic Acids (HAA5). Pre-sedimentation basin effl uent served as the water source for the pilot.

The pilot was optimized using different fresh PAC doses rang-ing from 10–30 mg/L. The PAC contact tank total suspended solids (TSS) were monitored and ranged from 1.0–2.0 g/L. Table 1 shows the TOC results observed during the fresh PAC optimi-zation testing. During this portion of testing it was determined that

a target of 15–20 mg/L of fresh PAC would provide the best TOC removal while minimizing operating costs.

Following optimization of the PAC within the system, a 35-day extended run test (Figure 1) was performed as fresh PAC was added to the raw water stream ahead of the pre-contact tank at a dose of 18–19 mg/L. TSS was monitored in the pre-contact chamber with a target value of 1,000 mg/L which served as the system PAC concentration. As fl ow exited the pre-contact tank, Aluminum Chlorohydrate (ACH) was fed at a dose of 18– 7 mg/L as product. A dry anionic polymer was fed into the fl occulation zone of the ballasted clarifi cation system at a dose of 0.30–0.65 mg/L. PAC was recycled back to the pre-contact chamber and used PAC was wasted to maintain the 1,000 mg/L system concentration. Average settled water turbidity was maintained at < 1 nephelometric turbidity units (NTU) while operating at system hydraulic overfl ow rates of 10–16 gpm/sf. Effl uent TOC averaged less than 1.0 mg/L throughout the run.

DBPs were spot sampled throughout the testing. The results (Table 2) showed that the pilot was able to meet the goals set forth of less than 48 μg/L TTHM and less than 36 μg/L HAA5.

HLR (gpm/sf)Fresh PAC

(mg/L)Coagulant

(mg/L)Polymer (mg/L)

TSS (mg/L) PAC Tank

INF EFF % Rem

15 10 10 0.95 1578 3.18 1.42 55.3

15 15 10 0.95 1371 2.96 1.26 57.4

15 20 10 0.95 1398 2.83 1.04 63.3

15 30 10 0.95 1622 2.85 1.1 61.4

Table 1. Nashville, TN Fresh PAC Optimization

Table 2. Nashville, TN DBP Results

TTHM (μg/L) HAA5 (μg/L)

10/3/2011 12.1 8.17

10/10/2011 6.4 18.3

11/8/2011 3.2 3.43

Figure 2. Nashville, TN Extended Run TOC Results

MMMMMMMMMiiiiiiiiicccccccccrrrrrrrrooooooooosssssssssaaaaaaaaannnnnnnndddddddddd BBBBBBBBBaaaaaaaaallllllllllllllllllaaaaaaaaassssssssstttttttttteeeeeeeeedddddddddd CCCCCCCCCClllllllllaaaaaaaaarrrrrrrriiiiiiiiififififififififificccccccccaaaaaaaaattttttttttiiiiiiiiiooooooooonnnnnnnn wwwwwwwwiiiiiiiiitttttttttthhhhhhhhh PPPPPPPPPooooooooowwwwwwwwddddddddddeeeeeeeeerrrrrrrreeeeeeeeedddddddddd AAAAAAAAAcccccccccttttttttttiiiiiiiiivvvvvvvvaaaaaaaaatttttttttteeeeeeeeedddddddddd CCCCCCCCCCaaaaaaaaarrrrrrrrbbbbbbbbbbooooooooonnnnnnnn

Table 3. Spring Hill, TN Fresh PAC Optimization

HLR (gpm/sf)

Fresh PAC (mg/L)

Coagulant (mg/L)

Polymer (mg/L)

TSS (mg/L) PAC Tank

TOC (mg/L)

INF EFF % Rem

13.1 10 20 0.8 1355 2.50 1.40 44.0

13.1 10 30 0.8 1350 2.50 1.10 56.0

13.1 10 40 0.8 1350 2.50 1.10 56.0

13.1 10 50 0.8 1350 2.50 1.20 52.0

13.1 15 15 0.9 1120 2.20 1.20 45.5

13.1 15 30 0.9 1200 2.20 1.00 54.5

13.1 15 40 0.9 2.20 1.30 40.9

13.1 20 10 0.9 1379 1.80 0.83 53.9

13.1 20 15 0.9 1302 1.90 0.71 62.6

13.1 20 20 0.9 1335 1.80 0.78 56.7

13.1 20 25 0.9 1425 2.10 1.10 47.6

13.1 20 30 0.9 1420 2.00 0.63 68.5

Table 4. Spring Hill, TN DBP Results

(gpm/sf)Fresh PAC

(mg/L)

CoagulantPolymer (mg/L)

TSS (mg/L) PAC Tank

TOC (mg/L)TTHM (μg/L)

(μg/L)Type (mg/L) INF EFF % Rem

13.1 20 Ferric 40 mg/L 0.9 1934 2.60 1.10 57.7 12.9 19.0

13.1 20 Ferric 30 mg/L 0.8 1643 2.90 1.10 62.1 19.8 23.3

13.1 20 PACI 40 mg/L 0.8 1394 3.60 1.40 61.1 30.0 32.8

16 20 ACH 10 mg/L 0.8 1032 2.20 1.30 57.7 25.6 25.0

Currently, HVUD is in phase one of a four phase ex-pansion that will provide a 23 mgd microsand ballasted clarification system with PAC recycle ahead of microfiltration (MF) hollow fiber PVDF membranes, with outside-in flow pattern, for removal of TOC and reduction of disinfection by-products. This system is scheduled for commissioning in 2015.

Springhill, TN: Pilot testingPilot testing was conducted in Springhill, Tennessee, at the Springhill Water Treatment Plant in early 2012. The plant currently has a rated capacity of 4 million gallons per day (mgd). The goals of the pilot testing were to improve efflu-ent TOC levels while reducing DBPs to fewer than 80 μg/L Trihalomethanes (TTHMs) and fewer than 60 μg/L Haloace-tic Acids (HAA5). The pilot was operated on plant raw water as well as effluent from an existing pre-sedimentation basin.

The pilot was optimized using different coagulants and fresh PAC doses ranging from 10–20 mg/L. The PAC contact tank total suspended solids (TSS) were monitored and ranged from 1.0–2.0 g/L. Table 3 shows the TOC results observed during the fresh PAC and ferric chloride optimization testing. During this por-tion of testing it was determined that a target of 20 mg/L of fresh PAC would provide the best TOC removal.

During the pilot study, DBPs were spot sampled using dif-ferent coagulants for comparison. The results (Table 4) showed that all coagulants tested were able to meet the goals set forth of fewer than 80 μg/L TTHM and fewer than 60 μg/L HAA5.

Fayette, GA: Pilot TestingPilot testing was conducted in Fayette, GA in mid-2010. The goals of the pilot testing were to improve effluent TOC levels while reducing DBPs to fewer than 80 μg/L Trihalomethanes (TTHMs) and fewer than 60 μg/L Haloacetic Acids (HAA5).

“Microsand ballasted clarification with PAC recycle has been accepted as a drinking water treatment alternative for removing TOC and reducing DBPs.”

The pilot was operated on plant raw water from a nearby res-ervoir. During the pilot, fresh PAC was added to the raw water stream ahead of the pre-contact tank at a dose of 10–30 mg/L. TSS was monitored in the pre-contact chamber with a target value of 1–2 g/L. As fl ow exited the pre-contact tank, aluminum sulfate was fed at a dose of 15–20 mg/L as product. A dry anionic polymer was fed into the fl occulation zone of the bal-lasted clarifi cation system at a dose of 0.60–0.90 mg/L. PAC was recycled back to the pre-contact chamber and used PAC was wasted to maintain a steady system concentration. Average settled water turbidity was maintained at < 1 NTU while operat-ing at system hydraulic overfl ow rates of 10–16 gpm/sf. Testing

was also conducted to compare PAC recycle to single pass dosing and the results can be seen in Table 5 below.

DBP results showed that similar TTHM and HAA levels could be achieved with a lower fresh PAC dose and lower coagulant dose when using the PAC recycle versus a single pass of dosing and wasting.

ConclusionMicrosand ballasted clarifi cation with PAC recycle has been accepted as a drinking water treatment alternative for removing TOC and reducing DBPs. Numerous pilot studies and data confi rm that a ballasted clarifi er with PAC recycle is signifi cantly more effi cient than single pass PAC dosing with respect to overall PAC usage. The pilot data also shows NOM removal capabilities in limiting DBP formations. With the increased utilization of the adsorption capacity of PAC through recycle, signifi cant operational savings can be achieved when trying to reduce DBPs and remove natural organic matter. •

Table 5. Fayette County, GA DBP Results of PAC Single Pass vs. Recycle

PAC SetupFresh PAC

(mg/L)Coagulant

(mg/L)TTHM (μg/L)

(μg/L)

Single Pass 20 18 67 56

Recycle 10 15 60 47

MMMMMMMMMiiiiiiiiicccccccccrrrrrrrrooooooooosssssssssaaaaaaaaannnnnnnndddddddddd BBBBBBBBBaaaaaaaaallllllllllllllllllaaaaaaaaassssssssstttttttttteeeeeeeeedddddddddd CCCCCCCCCClllllllllaaaaaaaaarrrrrrrriiiiiiiiififififififififificccccccccaaaaaaaaattttttttttiiiiiiiiiooooooooonnnnnnnn wwwwwwwwiiiiiiiiitttttttttthhhhhhhhh PPPPPPPPPooooooooowwwwwwwwddddddddddeeeeeeeeerrrrrrrreeeeeeeeedddddddddd AAAAAAAAAcccccccccttttttttttiiiiiiiiivvvvvvvvaaaaaaaaatttttttttteeeeeeeeedddddddddd CCCCCCCCCCaaaaaaaaarrrrrrrrbbbbbbbbbbooooooooonnnnnnnn

“Numerous pilot studies and data confi rm that a ballasted clarifi er with PAC recycle is signifi cantly more effi cient than single pass PAC dosing with respect to overall PAC usage.”

water | transportation | municipal | facilities

ApexEngGroup.com

Celebrating four years of different.

If you set the bar at competence,

how do you reach excellence?

Accurate, versatilechemical pumps

qdospumps.comsupport@wmpg.us

R E V O LU T I O N A R Y P E R I S TA LT I C P U M P H E A D

AECOM collaborates with its clients to provide comprehensive water and wastewater solutions to manage, protect and conserve water systems and resources. We provide a blend of global reach, local knowledge, innovation and technical excellence in delivering customized and creative solutions that meet the needs of clients’ projects.

www.aecom.com

CREATING A BETTER TOMORROW

Shakopee, MN8050 County Road 101 ast 888.320.4292

PROVEN POWER SOLUTIONS

• Prime, standby and emergency power• Diesel, natural gas and low BTU gas• Mobile and stationary units• Fuel analysis and switchgear maintenance • Emergency services available 24/7/365 • Preventive maintenance programs available on all makes

Sales. Service. Rental.

Hawkins Water TreatmentGroup has been meeting

the requirements ofcommercial, industrial,

municipal and institutionalorganizations since 1938.

Minneapolis612-331-6910

Fargo, ND701-293-9618

Sioux Falls, SD605-368-5793

Superior, WI715-392-5121

Water Treatmentis our Business

Complete Water ServicesWater Supply, Water Treatment, Storage, Distribution, Operations Support

Visit tkda.com or call 800.247.1714 for more information. Saint Paul | Duluth

Innovative & Sustainable

Engineering, Architecture, Planning

3M Corrosion Protection Products

3M Center Bldg 22302S24Saint Paul, MN 55144-1000P: 651-733-3103

ACorey AadalenCity of Red Wing229 Tyler Rd NRed Wing, MN 55066-1826P: 651-385-5160corey.aadalen@ci.red-wing.mn.us

Issac AfwerkeCity of Saint Paul Water Utility1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6267issac.afwerke@ci.stpaul.mn.us

Steven AhlschlagerMoore Engineering, Inc.1808 E Fir Ave Fergus Falls, MN 56537-3974P: 218-998-4041sahlschlager@

mooreengineeringinc.com

Aitkin Public Utilities Comm.120 1st St NWAitkin, MN 56431-1306P: 218-927-3222

Buick AlavyCity of Minneapolis

Water Department4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4983buick.alavy@minneapolismn.gov

Todd AlcottWaterous Company125 Hardman Ave SSouth St Paul, MN 55075-2421P: 651-450-5054tmalcott@waterousco.com

Alexandria Light & PowerPO Box 609Alexandria, MN 56308-0609P: 320-763-6501

Jaclyn Alm3235 Santa Fe TrlSaint Cloud, MN 56301-9167P: 320-428-5354jaclynalm@yahoo.com

Mike AlmstedMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: 612-673-5600

Richard AltCity of Cottage Grove8635 W Point Douglas Rd SCottage Grove, MN 55016-3318P: 651-458-2842

American Water Works Association

6666 W Quincy AveDenver, CO 80235-3098P: 303-794-7711

Jeff AmyWells Public UtilitiesPO Box 96Wells, MN 56097-0096P: 507-553-3119jeff@wpuc.net

William Anderl3132 Edgewood Ave NCrystal, MN 55427-3019P: 763-529-5008banderl@yahoo.com

Thomas Anderson4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4947Thomas.Anderson@

minneapolismn.gov

Gary Anderson6320 142nd Ln NWRamsey, MN 55303-5698gary.d.anderson@evoqua.com

Todd Anderson2826 Mill St NEBemidji, MN 56601-8403P: 218-333-1854todd.anderson@ci.bemidji.mn.us

Scott AndersonCity of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3027

Doug AndersonCity of Hopkins11100 Excelsior BlvdHopkins, MN 55343-3435P: 952-548-6373danderson@hopkinsmn.com

Anita AndersonMinnesota Department of Health11 E Superior St Ste 290Duluth, MN 55802-2225P: 218-302-6143anita.c.anderson@state.mn.us

Michael AndersonSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6264mike.anderson@ci.stpaul.mn.us

Heidi AndristRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-292-1215handrist@rpu.org

Matt AnfangSaint Paul Board of Water1900 Rice StSaint Paul, MN 55113-6810mranfang@comcast.net

William AngermanWHKS & Co.2905 S BroadwayRochester, MN 55904-5515P: 507-288-3923bangerman@whks.com

Michael AppelwickNortheast Technical Services, Inc.PO Box 1142Virginia, MN 55792-1142P: 218-741-4290mapplewick@netechnical.com

Todd Arlander6188 Rome Cir NWRochester, MN 55901-4846P: 507-259-1855todd.arlander@stantec.com

Steve ArndtCity of Farmington19650 Municipal DrFarmington, MN 55024-8445P: 651-248-9194sarndt@ci.farmington.mn.us

Marie AsgianMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: 612-673-5682marie.asgian@minneapolismn.gov

Ken AshfeldCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: 763-494-6351kashfeld@maplegrovemn.gov

Justin Attipou7849 Colorado Ave NBrooklyn Park, MN 55443-2926P: 612-661-4949attiogbe.attipou@

minneapolismn.gov

Austin Utilities400 4th St NEAustin, MN 55912-3495P: 507-433-8886

BBabbitt Public Utilities71 South DrBabbitt, MN 55706-1232P: 218-827-3292

Tim BagstadSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6283tim.bagstad@ci.stpaul.mn.us

Corbin Baker815 Fox CtYoung America, MN 55397-4524P: 612-715-6837basmascla@gmail.com

Tejpal BalaBolton and Menk, Inc.7533 Sunwood Dr NW Ste 206Ramsey, MN 55303-5191P: 763-433-2851tejpalsi@bolton-menk.com

Bassam BanatMinnesota Dept. of HealthPO Box 64975Saint Paul, MN 55164-0975P: 952-432-7092bassam.banat@state.mn.us

Annika BankstonMN Div of Wtr

Treatment and Dist Srvcs4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4975Annika.bankston@

minneapolismn.gov

Randy BartzCoating Resources Inc.625 St Louis St Ste 12Hopkins, MN 55343-4427P: 952-746-1909rbartz@tnemec.com

J. BatesCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707

Matt BauerCarleton College1 N College StNorthfi eld, MN 55057-4044P: 507-222-4132mbauer@carleton.edu

Wade BaumbergerMinnesota Pipe & EquipmentPO Box 249Farmington, MN 55024-0249P: 651-463-6090wadeb@mnpipe.com

Phillip Baxter529 16th Ave NSaint Cloud, MN 56303-3954P: 320-298-2577

Abbie BeaudryAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: 715-781-8860Abbie.Beaudry@ae2s.com

Steve BeckelCity of Jackson80 W Ashley StJackson, MN 56143-1669P: 507-847-4410

Harold BeckerDelano Municipal UtilitiesPO Box 65Delano, MN 55328-0065P: 763-972-0557hbecker@delanomn.us

Richard Bednar11155 Robinson Dr NWCoon Rapids, MN 55433-3761P: 763-767-6576

James BeemanE. Grand Forks Water Plant801 2nd St NEEast Grand Forks, MN 56721-3100P: 218-773-1511jbeeman@eastgrandforks.net

Anthony BeldenEngineering America Inc.647 Hale Ave NOakdale, MN 55128-7534P: 651-777-4041tbelden@engamerica.com

Doug BendorfStaples Public Works Commission122 6th St NEStaples, MN 56479-2932P: 218-894-2550dbendorf@ci.staples.mn.us

James BenningDuluth Public Works & Utilities520 Garfi eld AveDuluth, MN 55802-2610

Robert BensonCity of Stillwater Water Dept.PO Box 242Stillwater, MN 55082-0242P: 651-439-6231waterboard@ci.stillwater.mn.us

Tony BensonRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414tbenson@rpu.org

Bruce BergSt Paul Regional Water Services1900 Rice StSaint Paul, MN 55113P: 651-266-6840bruce.berg@ci.stpaul.mn.us

Brian BergantineAE2S3101 S Frontage Rd Ste 100Moorhead, MN 56560-2545P: 218-299-5610Brian.Bergantine@AE2S.com

Justin BergersonSt. Cloud Technical College8950 296th Ave NENorth Branch, MN 55056-6452P: 651-491-6125jusbergie@gmail.com

Membership DirectoryMN AWWA 2015

Bob BergsgaardCarbonair1480 County Road C WSaint Paul, MN 55113-3159P: 651-202-2952bbergsgaard@carbonair.com

David BerkowitzCity of Andover1685 Crosstown Blvd NWAndover, MN 55304-2612P: 763-755-5100dberkowitz@ci.andover.mn.us

Timothy BerquamBergerson Caswell Inc.5115 Industrial StMaple Plain, MN 55359-8610P: 763-479-3121tim.berquam@

bergersoncaswell.com

John BerriganTKDA444 Cedar St Ste 1500Saint Paul, MN 55101-2110P: 651-292-4400john.berrigan@tkda.com

David BerrymanRodeberg & Berryman, Inc.PO Box 55Montevideo, MN 56265-0055P: 320-269-7695dberryman@rbengr.com

Bruce BerthiaumeSt. Louis Park Water Department7305 Oxford StMinneapolis, MN 55426-4512P: 952-924-2558bberthiaume@stlouispark.org

Doug Besendorf535 3rd StFrost, MN 56033-6344P: 507-878-3149

Dragoljub BilanovicBemidji State University1500 Birchmont Dr NEBemidji, MN 56601-2600P: 218-759-8700dbilanovic@bemidjistate.edu

Bilfinger Water Technologies1950 Old Highway 8 NWNew Brighton, MN 55112651-638-3134

Josephine Bitzan10185 County Road 12 NWGarfield, MN 56332-8130P: 320-766-3976jbitzan94@gmail.com

Duane BjellandRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1504dbjelland@rpu.org

Dana BjorkCity of Lakeville Water Department20195 Holyoke AveLakeville, MN 55044-8339P: 952-985-2741dbjork@ci.lakevillemn.us

Jeff BlakelyAmerican Cast Iron Pipe Co.21695 Highview AveLakeville, MN 55044-7539P: 218-686-7434jblakely@american-usa.com

Nick BleessBlue Earth Light & Water125 E 7th StBlue Earth, MN 56013-2022P: 507-526-2191nick.bleess@belw.org

John BlommeMinnesota Department of Health1400 E Lyon St Ste 102Marshall, MN 56258-2504P: 507-537-7308john.blomme@state.mn.us

Jordan Blommel2100 Morningside Dr NESaint Cloud, MN 56304-9618P: 320-292-5688jblommel911@gmail.com

Carol Blommel JohnsonCity of Apple Valley7100 147th St WApple Valley, MN 55124-7519P: 612-790-7167cblommel@ci.apple-valley.mn.us

Todd BlomstromCity of Apple Valley7100 147th St WApple Valley, MN 55124-6562P: 952-953-2400tblomstrom@ci.apple-valley.mn.us

Douglas BodeCity of Waconia310 E 10th StWaconia, MN 55387-4551P: 952-442-2615dbode@waconia.org

Jim BodeSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-1651james.bode@ci.stpaul.mn.us

Boerger LLC2860 Water Tower PlChanhassen, MN 55317-8004P: 612-435-7300

Brad BoiceCity of EyotaPO Box 328Eyota, MN 55934-0328P: 507-545-2135bboice@cityofeyota.com

Scott BollerCity of New Brighton700 5th St NWSaint Paul, MN 55112-2724P: 651-638-2119scott.boller@newbrightonmn.gov

Gregory BonaMinneapolis Water Works4300 Marshall St NEFridley, MN 55421-2510P: 612-661-4924gregory.bona@minneapolismn.gov

Jeanette BootheMinnesota Department of Health625 Robert St NSaint Paul, MN 55155-2538P: 651-201-4697jeanette.boothe@state.mn.us

Charlie BoraohCity of Eagan3419 Coachman PtSaint Paul, MN 55122-1202P: 651-675-5200cborash@cityofeagan.com

Bradley BordersPO Box 140Sartell, MN 56377-0140P: 320-253-2171brad@sartellmn.com

Luke BotzekSt. Cloud Technical College8170 155th Ave NEFoley, MN 56357-8901P: 320-968-6824luke.botzek@gmail.com

Adam BourassaSt. Cloud Public Utilities400 2nd St SSaint Cloud, MN 56301-3622

Michael BouthiletCity Of Lake Elmo3800 Laverne Ave NLake Elmo, MN 55042-9699P: 651-747-3940mike.bouthilet@lakeelmo.org

Dan BoyceE. Grand Forks

Water & Light DepartmentPO Box 322East Grand Forks, MN 56721-0322P: 218-773-1163dboyce@ci.east-grand-forks.mn.us

Darren BraegelmanCity of BelgradePO Box 296Belgrade, MN 56312-0296P: 320-492-1172darrenb06@hotmail.com

Joel BraegelmanWillmar Municipal Utility704 Litchfield Ave SWWillmar, MN 56201-3111P: 320-235-4422

Brainerd Public UtilitiesPO Box 373Brainerd, MN 56401-0373P: 218-825-3220

Michael BramwellCity of Champlin11955 Champlin DrChamplin, MN 55316-2379P: 763-968-2167mbramwell@ci.champlin.mn.us

Katherine Bray9778 170th StMilaca, MN 56353-3447P: 507-690-8196katherinebray19@gmail.com

Scott BredehoftWonderware Midwest5850 Opus Pkwy Ste 140Minnetonka, MN 55343-4400P: 866-826-9725scott.bredehoft@

wonderwaremidwest.com

Todd BredesenHD Supply Waterworks15800 W 79th StEden Prairie, MN 55344-1894P: 612-597-8519todd.bredesen@hdsupply.com

Dustin BremnessPlant & Flanged Equipment LLC10101 Xylite St NEMinneapolis, MN 55449-5227P: 763-792-3870db@plantandflanged.com

Matt BrinkMinneapolis Water Works350 S 5th St Ste 203Minneapolis, MN 55415-1355matt.brink@minneapolismn.gov

George Brown1427 Heinenhill StNew Ulm, MN 56073-2027P: 785-309-3122

Robert BrownBolton & Menk Inc.1960 Premier DrMankato, MN 56001-5900P: 507-625-4171robert.brown@bolton-menk.com

Larry BrownCity of Shorewood5755 Country Club RdExcelsior, MN 55331-8926P: 952-401-1637lbrown@shorewoodpw.com

David BrownProgressive Consulting Engineers6120 Earle Brown Dr Ste 629Brooklyn Center, MN 55430-4102P: 763-560-9133davidbrown@pce.com

Terrance BrueckEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: 651-639-5600tbrueck@ema-inc.com

Bernie BullertTKDA444 Cedar St Ste 1500Saint Paul, MN 55101-2110P: 651-292-4497bernie.bullert@tkda.com

Martha BurckhardtSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 763-434-0876martha.burckhardt@ci.stpaul.mn.us

Michael BurdorfWSB & Associates, Inc.701 Xenia Ave S Ste 300Minneapolis, MN 55416-1030P: 763-287-7151mburdorf@wsbeng.com

Michael BurgdorfCity of Plainview241 W BroadwayPlainview, MN 55964-1253P: 507-534-3701

Steve BurianAE2S4050 Gardenview Dr Ste 200Grand Forks, ND 58201-7215P: 701-746-8087Steve.Burian@ae2s.com

Steve BurklundCity of Milaca255 1st St EMilaca, MN 56353-1609P: 320-983-6547steveburklund@aol.com

Scott BurnellMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: 612-437-3660scott.burnell@minneapolismn.gov

Burns & McDonnell Engineering Co. Inc.

9400 Ward PkwyKansas City, MO 64114-3319P: 816-822-3218

Thomas ButhSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6345tom.buth@ci.stpaul.mn.us

Todd ButzTreatment Resources, Inc.11670 Fountains Dr Ste 200Minneapolis, MN 55369-7195P: 612-816-2230tbutz@treatmentresources.com

CRyan CapelleStantec Inc.2335 Highway 36 WSaint Paul, MN 55113-3819P: 651-604-4857ryan.capelle@bonestroo.com

Wade CardinalThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Jacquelynn CareySt. Paul Water Utility1900 Rice StRoseville, MN 55113-6810P: 651-266-6871jackie.carey@ci.stpaul.mn.us

Mike CarrTherma-Stor, LLC4201 Lien RdMadison, WI 53704-3606P: 800-533-7533mcarr@thermastor.com

Peter CartwrightCartwright Consulting Co.8324 16th Ave SMinneapolis, MN 55425-1742P: 612-854-4911pscartwright@msn.com

Chris Catlin2612 Hidden Valley LnStillwater, MN 55082-5411tanzwater@gmail.com

Mona Cavalcoli207 Depew StDumont, NJ 07628-2523P: 718-728-8469mcavalcoli@gmail.com

Karen CavettSEH, Inc.12 Civic Center Plz Ste 2088Mankato, MN 56001-7787P: 507-327-6233kcavett@sehinc.com

Qigang ChangAdvanced Engineering and

Environmental Services Inc. (AE2S)3101 S Frontage RdMoorhead, MN 56560P: 701-541-6155Qigang.Chang@ae2s.com

Bill ChangMSA Professional Services60 Plato Blvd E Ste 140Saint Paul, MN 55107-1835P: 612-548-3130bchang@msa-ps.com

Che Fei ChenSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 763-780-9280chefei.chen@ci.stpaul.mn.us

Donald CheneySaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6343donald.cheney@ci.stpaul.mn.us

James Chidester4700 Harbor Ln NPlymouth, MN 55446-3440P: 763-913-8783jim.chidester@comcast.net

Damon ChmelaAdvanced Engineering

& Env. Svcs., Inc.6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: 763-463-5036damon.chmela@ae2s.com

Mark ChristMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: 612-875-1243

Jarrod Christen14879 Woodland DrDetroit Lakes, MN 56501-7407P: 218-846-7778

Paul ChristensenPeopleServicePO Box 94Lester Prairie, MN 55354-0094P: 507-964-2231pchristensen@peopleservice.com

Don ChristiansonMinnesota Rural Water Assn.217 12th Ave SEElbow Lake, MN 56531-4741P: 218-685-5197don.christianson@mrwa.com

Matthew ChumleyCity of Burnsville13713 Frontier CtBurnsville, MN 55337-4720P: 952-845-4550

City of Albert Lea221 E Clark StAlbert Lea, MN 56007-2421P: 507-377-4378

City of Aurora16 W 2nd Ave NAurora, MN 55705-1389P: 218-229-2624

City of BaxterPO Box 2626Baxter, MN 56425-2626P: 218-454-5115

City of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3071P: 952-563-8774

City of Brooklyn Center Water Dept.

6844 Shingle Creek PkwyBrooklyn Center, MN 55430-1418P: 763-585-7103

City of Brooklyn Park8300 Noble Ave NBrooklyn Park, MN 55443-2400P: 763-315-8412

City of Circle Pines200 Civic Heights CirCircle Pines, MN 55014-1788P: 763-784-5898

City of Cottage Grove8635 W Point Douglas Rd SCottage Grove, MN 55016-3318P: 651-458-2808

City of Crookston Water Department

124 N BroadwayCrookston, MN 56716-1731P: 218-281-5711

City of Detroit LakesPO Box 647Detroit Lakes, MN 56502-0647P: 218-846-7102

City of Eagan3419 Coachman PtEagan, MN 55122-1202P: 651-675-5215

City of Excelsior339 3rd StExcelsior, MN 55331-1809P: 952-474-3464

City of Fergus Falls112 W Washington AveFergus Falls, MN 56537-2568P: 218-332-5435

City of Glencoe1107 11th St E Ste 107Glencoe, MN 55336-2327P: 320-864-6954

City of Golden Valley7800 Golden Valley RdGolden Valley, MN 55427-4508P: 763-593-3981

City of Granite Falls641 Prentice StGranite Falls, MN 56241-1517P: 320-564-2530

City of Hutchinson Water Department

111 Hassan St SEHutchinson, MN 55350-2522P: 320-234-4222

City of Inver Grove Heights8168 Barbara AveInver Grove Heights, MN 55077-3410P: 651-450-2565

City of Lake City205 W Center StLake City, MN 55041-1609P: 651-345-6850

City of Le Sueur- Water/Wastewater

1500 Commerce StLe Sueur, MN 56058-1118P: 507-665-9941

City of Lino Lakes600 Town Center PkwyLino Lakes, MN 55014-1182P: 651-982-2452

City of Little Canada515 Little Canada Rd ELittle Canada, MN 55117-1633P: 651-766-4049

City of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: 763-494-6371

City of Medina2052 County Road 24Medina, MN 55340-9790P: 763-473-4643

City of Monticello505 Walnut St Ste 1Monticello, MN 55362-8822P: 763-271-3274

City of Mound Water Department

2415 Wilshire BlvdMound, MN 55364-1668P: 952-472-0614

City of Northfield801 Washington StNorthfield, MN 55057-2565P: 507-645-3088

City of Paynesville221 Washburne AvePaynesville, MN 56362-1642P: 320-243-3714

City of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707P: 763-509-5999

City of Prior Lake17073 Adelmann St SEPrior Lake, MN 55372-3968P: 952-447-9890

City of Richfield1901 E 66th StRichfield, MN 55423-2711P: 612-221-6170

City of Roseville2660 Civic Center DrSaint Paul, MN 55113-1815P: 651-792-7003

City of S. St. Paul125 3rd Ave N Ste 1South Saint Paul, MN 55075-2097P: 651-554-3210

City of Shoreview4600 Victoria St NShoreview, MN 55126-5817P: 651-490-4651

City of SpicerPO Box 656Spicer, MN 56288-0656P: 320-796-5562

City of St. Francis4058 Saint Francis Blvd NWSaint Francis, MN 55070-9701P: 763-235-2304

City of Waconia310 E 10th StWaconia, MN 55387-4551P: 952-442-2615

City of Warren120 E Bridge AveWarren, MN 56762-1510P: 218-745-5343

City of Waseca508 State St SWaseca, MN 56093-3033P: 507-835-9713

City of Woodbury2301 Tower DrWoodbury, MN 55125-1642P: 651-714-3720

City of WyomingPO Box 188Wyoming, MN 55092-0188P: 651-462-0580

City of Zimmerman12980 Fremont AveZimmerman, MN 55398-9414P: 763-856-4088

Brian Clausen8558 Holland TrlFaribault, MN 55021-7446P: 507-475-3228clausenb@owatonnautilities.com

Gary Cline11115 E Desert Vista DrScottsdale, AZ 85255-8063P: 701-330-7479clinegc@me.com

Dave CluffAitkin Public Utilities Comm.120 1st St NWAitkin, MN 56431-1395

Michael CoauetteEast Grand Forks Wtr. & Light Dept.1010 5th Ave NEEast Grand Forks, MN 56721-1616P: 218-773-0515

Robert CockrielCity of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3027P: 952-563-8774bcockriel@ci.bloomington.mn.us

Larry Cole1200 Lakeview Ave SMinneapolis, MN 55416-3631P: 612-374-4362

Gregory CookCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707P: 763-509-5992gcook@ci.plymouth.mn.us

Brandon CoombsAEROMIX Systems, Inc7135 Madison Ave WGolden Valley, MN 55427-3601P: 763-746-9289

Paul CooneCity of Roseville2701 Lexington Ave NRoseville, MN 55113-2007paul.coone@ci.roseville.mn.us

Richard CorbettVessco, Inc.8217 Upland CirChanhassen, MN 55317-9626P: 952-941-2678dcorbett@vessco.com

Ramsey Coronado1990 Burns Ave Apt 118Saint Paul, MN 55119-4971ramsey.coronado@ci.stpaul.mn.us

Country Enterprises Inc.PO Box 157Lucan, MN 56255-0157P: 507-747-2574

Lynda CowellMountain Lake Water DepartmentPO Box CMountain Lake, MN 56159-0320P: 507-427-2633lyndacowell@

mountainlake.govoffice.com

Patti CraddockShort Elliott Hendrickson3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5108P: 651-490-2067pcraddock@sehinc.com

Kevin CrooksCity of Chanhassen Utility Dept7901 Park PlChanhassen, MN 55317-9237P: 952-227-1311kcrooks@ci.chanhassen.mn.us

John CrooksShakopee Public Utilites255 Sarazin StShakopee, MN 55379-3942P: 952-233-1511jcrooks@shakopeeutilities.com

Allen CrowserAlexandria Light & PowerPO Box 609Alexandria, MN 56308-0609P: 320-763-6501acrowser@rea-alp.com

Steve Crumley4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4907steve.crumley@minneapolismn.gov

Marc CulverCity of Roseville2660 Civic Center DrSaint Paul, MN 55113-1899P: 651-792-7042mark.culver@ci.roseville.mn.us

Daniel CurleyCity of Shoreview4600 Victoria St NShoreview, MN 55126-5817P: 651-490-4672dcurley@shoreviewmn.gov

Randolph Czech23857 180th StHutchinson, MN 55350-6618P: 320-234-5617

DJason Dahl1541 Aspen DrSaint Peter, MN 56082-1586P: 507-519-1060jjdahl77@mediacombb.net

Dustin DaleAdvanced Engineering &

Enviroment Services, Inc.3101 S Frontage Rd Ste 100Moorhead, MN 56560-2545P: 218-299-5610dustin.dale@ae2s.com

Jeff DaleMinnesota Rural Water Assn.217 12th Ave SEElbow Lake, MN 56531-4741P: 218-685-5197jeff.dale@mrwa.com

Bill DaleyLake Crystal Municipal Utils.PO Box 86Lake Crystal, MN 56055-0086P: 507-726-2536bdaleylkcr@yahoo.com

Jason DarcoThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Peter DavisSaint Paul Regional Water Services8565 Jewell Ave NStillwater, MN 55082-9351P: 651-755-4642peter.davis@ci.stpaul.mn.us

Thomas DavisTonka Water13305 Water Tower CirPlymouth, MN 55441P: 763-559-2837ddavis@tonkawater.com

Daniel DawsonCity of St. Augusta1914 250th StSaint Cloud, MN 56301-7706P: 320-654-0387publicworks@staugustamn.com

James de LambertLiesch Associates, Inc.13400 15th Ave N Ste APlymouth, MN 55441-4532P: 763-559-1423jimd@liesch.com

Don DebelakLiqTech NA1804 Buerkle RdWhite Bear Lake, MN 55110-5245P: 651-773-5850dsd@liqtech.com

Jeff DegroteCity of CokatoPO Box 1030Cokato, MN 55321-1030P: 320-286-2327

Christopher DeHaan559 246th St SHawley, MN 56549-9645christopher.dehaan@ndsu.edu

Delano Municipal UtilitiesPO Box 65Delano, MN 55328-0065P: 763-972-0557

John DeMarMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4821john.demars@minneapolismn.gov

Harold DesautelPreferred Controls, Inc.PO Box 487Albany, MN 56307-0487P: 320-845-6772desautelh@preferredcontrols.com

Dillon DevittSambatek10601 Smetana Rd Apt 109Minnetonka, MN 55343-8000P: 712-221-9562ddevitt@sambatek.com

Brian DeWolfVessco, Inc.8217 Upland CirChanhassen, MN 55317-9626P: 952-941-2678bdewolf@vessco.com

Dezurik, Inc250 Riverside Ave NSartell, MN 56377-2129

Herman DharmarajahBolton & Menk, Inc.1960 Premier DrMankato, MN 56001-5900P: 507-625-2726hermandh@bolton-menk.com

Costa Dimitracopoulos4340 Hemlock Ln NPlymouth, MN 55442-2730P: 763-557-9623costa.john.d@gmail.com

Bill DircksCity of Little Canada515 Little Canada Rd ELittle Canada, MN 55117-1600P: 651-766-4049bill.dircks@ci.little-canada.mn.us

Dixon Engineering, Inc.1104 3rd AveLake Odessa, MI 48849-1191P: 616-374-3221

Craig Doeden21695 Highview AveLakeville, MN 55044-7539P: 952-469-1100cdoeden@american-usa.com

William DoughertyMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: 612-673-5600william.dougherty@

minneapolismn.gov

Drew Downhour6441 Barclay AveInver Grove Heights, MN 55077-2165P: 651-238-2465drew.downhour@

wolves.northern.edu

Dennis DoylePublic Utilities CommissionPO Box 658Grand Rapids, MN 55744-0658P: 218-326-7192dmdoyle@grpuc.org

Dennis DuCheneCity of Faribault208 1st Ave NWFaribault, MN 55021-5180P: 507-384-0559dduchene@ci.faribault.mn.us

David DudinskyCity of Wayzata Public Works299 Wayzata Blvd WWayzata, MN 55391-9595P: 952-404-5360daved@wayzata.org

Duluth Public Works & Utilities520 Garfield AveDuluth, MN 55802-2610P: 218-730-4061

Jennifer Dunn324 Vinewood Ln NPlymouth, MN 55441-5530P: 612-816-6502dunjen@gmail.com

Pat DunnCity of S. St. Paul125 3rd Ave N Ste 1South Saint Paul, MN 55075-2097

Robert DunnCity of Winona Water Department1 Johnson StWinona, MN 55987-3419P: 507-457-8270bdunn@ci.winona.mn.us

Steven Duvall21655 Weber WayRogers, MN 55374-4516P: 515-371-3139seduvall1554@gmail.com

Samuel DyrudVan Bergen & Markson9366 Deerwood Ln NMaple Grove, MN 55369-3634P: 763-546-4340

EE. Grand Forks Water & Light801 2nd St NEE Grand Forks, MN 56721-3100P: 218-773-1511

Jon EatonCity of Eagan3419 Coachman PtEagan, MN 55122-1202P: 651-675-5215jeaton@cityofeagan.com

Richard EbertCity of Hutchinson20383 248th CirHutchinson, MN 55350-4147P: 320-587-2493debert@ci.hutchinson.mn.us

Klayton EcklesCity of Woodbury2301 Tower DrWoodbury, MN 55125-1642keckles@ci.woodbury.nm.us

Ismail EddhiCity of Hopkins11100 Excelsior BlvdHopkins, MN 55343-3435P: 958-298-2885

Ismail EddihiCity of Hopkins11100 Excelsior BlvdHopkins, MN 55343-3435P: 952-292-2885ieddihi@hopkinsmn.com

Randy EggertKenyon Municipal Utilities709 2nd StKenyon, MN 55946-1339P: 507-789-6415utility@cityofkenyon.com

Bradley Eilts7910 Guild CtSaint Paul, MN 55124-7678P: 651-668-2619brad.eilts@ci.stpaul.mn.us

Bill EisenmengerCity of WyomingPO Box 188Wyoming, MN 55092-0188P: 651-462-0580beisenmenger@wyomingmn.org

Craig EldredCity of Waconia310 E 10th StWaconia, MN 55387-4551celdred@waconia.org

Joel ElferingWillmar Municipal UtilitiesPO Box 937Willmar, MN 56201-0937P: 320-235-4422water@wmu.willmar.mn.us

Ali ElhassanMetropolitan Council390 Robert St NSaint Paul, MN 55101-1634Ali.Elhassan@metc.state.mn.us

Elk River Municipal UtilitiesPO Box 430Elk River, MN 55330-0430P: 763-441-2020

Matt EllingsonTKDA444 Cedar St Ste 1500Saint Paul, MN 55101-2110P: 651-292-4578matt.ellingson@tkda.com

Todd ElliottCH2M HILL1295 Northland Dr Ste 200Mendota Heights, MN 55120-1380P: 651-365-8541todd.elliott@ch2m.com

Bob ElstonSleepy Eye Public UtilitiesPO Box 408Sleepy Eye, MN 56085-0408P: 507-794-5323sepuc@sleepyeyetel.net

EMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: 651-639-5600

Steven EmeryWidsith Smith Nolting & Associate1600 Central Ave NEEast Grand Forks, MN 56721-1335P: 218-773-1185steve.emery@wsn.us.com

William EmmersJohnson Screens1950 Old Highway 8 NWNew Brighton, MN 55112P: 651-638-3151william.emmers@

johnsonscreens.com

Gary Englund4554 Ches Mar DrEagan, MN 55123-1868P: 651-341-5698judyke1@comcast.net

Daniel EngstrandEngineered Sales Co.8912 Wentworth Ave SBloomington, MN 55420-2814P: 952-888-1131Dan@engineeredsalesco.com

Michael EnstadCity of Granite Falls641 Prentice StGranite Falls, MN 56241-1517P: 320-564-2530water@mvtvwireless.com

John Erickson3823 Kipling AveSt Louis Park, MN 55416-4945P: 510-437-0846john.j.erickson@gmail.com

Andy EricksonSt. Anthony Falls Lab, Univ. of MN2 3rd Ave SEMinneapolis, MN 55414-2125P: 612-624-4629eric0706@umn.edu

Robert ErvinMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205Robert.ervin@minneapolismn.gov

Brenda EschenbacherMinnesota Dept. of HealthPO Box 64975Saint Paul, MN 55164-0975P: 651-201-3976brenda.eschenbacher@state.mn.us

Tannie EshenaurMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: 651-201-4074tannie.eshenaur@state.mn.us

Zeke EtukudoMinnesota Department of Health625 Robert St NSaint Paul, MN 55155-2538P: 651-201-3975ezekiel.m.etukudo@state.mn.us

Kent ExnerCity of Hutchinson Water Department111 Hassan St SEHutchinson, MN 55350-2522P: 320-587-4212kexner@ci.hutchinson.mn.us

FBenjamin FeldmanSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810benjamin.feldman@ci.stpaul.mn.us

Benjamin FinneganCDM Smith125 S Wacker Dr Ste 600Chicago, IL 60606-4437P: 312-346-5000finneganbj@cdmsmith.com

Colin FitzgeraldSEH3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5118P: 651-256-0429cfitzgerald@sehinc.com

Dale FolenMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4908dale.folen@minneapolismn.gov

Brad ForesterEngineering America, Inc647 Hale Ave NOakdale, MN 55128-7534P: 612-239-6444bforester@engamerica.com

James ForslundCity of Minneapolis4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-803-5279james.forslund@minneapolismn.gov

Richard FottMueller Systems MN 11228 W River RdChamplin, MN 55316-3524rfott@muellersystems.com

Tim FoxMetropolitan Airports Commision6045 28th Ave SMinneapolis, MN 55450-2702P: 612-725-6165Tim.fox@mspmac.org

Mary FralishCity of MankatoPO Box 3368Mankato, MN 56002-3368P: 507-387-8665mfralish@city.mankato.mn.us

Wayne FrankPO Box 247Lyle, MN 55953-0247P: 507-325-2311

Anthony FranzRick Lake Construction Group22360 County Road 12Deerwood, MN 56444-6113P: 763-229-1172

Douglas Frederickson19 Joy Ave SWMadelia, MN 56062-1105P: 507-642-3538cityhall@madeliamn.com

Eric FreihammerMinnesota Dept. of Health985 Shady Oak CirMonticello, MN 55362-7907P: 320-241-9135eric.freihammer@state.mn.us

John FrielSEH Inc.3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5118P: 651-490-2140jfriel@sehinc.com

Matthew FritzeGreat Northern Environmental643 Hale Ave NSaint Paul, MN 55128-7534P: 952-239-2264mfritze@gnenv.com

Scott FronekBlack & Veatch7760 France Ave S Ste 1200Minneapolis, MN 55435-3215P: 952-896-0701froneksd@bv.com

Paul FrostSL-Serco2817 Anthony Ln S Ste 104St Anthony, MN 55418-2489P: 651-262-9337pfrost@sl-serco.com

Kenneth Funt3851 2nd St NEMinneapolis, MN 55421-3733P: 320-266-6908funtke61@my.sctcc.edu

GKristian Gaasland8016 Garfield St NESpring Lake Park, MN 55432-2163P: 218-341-8599kristian.gaasland@gmail.com

Jackie GallagherParker Hannifin

Process Filtration Division10531 Cedar Lake Rd Apt 314Minnetonka, MN 55305-3323P: 612-867-9818jvgallagher@parker.com

Gary GanserCity of Two Harbors522 1st AveTwo Harbors, MN 55616-1535P: 218-834-5572

Jimmie GatesCity Of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3027P: 952-563-8730jgatc@ci.bloomington.mn.us

Steven GatlinCity of Coon Rapids11155 Robinson Dr NWCoon Rapids, MN 55433-3761P: 763-767-6458SGatlin@coonrapidsmn.gov

Todd Gatz1460 Highway 1Ely, MN 55731-8207P: 218-365-4049tgatz@coca-cola.com

Katy GehlerCity of Prior Lake17073 Adelmann St SEPrior Lake, MN 55372-3968kgehler@cityofpriorlake.com

Justin GeorgeKLJ Engineering2611 Gabel RdBillings, MT 59102-7329P: 406-373-7244justin.george@kljeng.com

Glen GeradsCity of Minneapolis350 S 5th St Ste 203Minneapolis, MN 55415-1355P: 612-673-2191glen.gerads@minneapolismn.gov

Craig GeyerDeZURIK Water Controls250 Riverside Ave NSartell, MN 56377-2129P: 320-259-2090info@dezurikwater.com

Jamal Ghauri1905 43rd Ave SMoorhead, MN 56560-7112P: 701-306-9126jamal.ghauri@ndsu.edu

Joe Gherity1744 Ashland AveSaint Paul, MN 55104-6159P: 651-271-8854gherityjoe@gmail.com

Nathan GieskeMinnesota Department of Health11 E Superior St Ste 290Duluth, MN 55802-2225nathan.gieske@state.mn.us

Steve GilbergCity of Eagan3419 Coachman PtEagan, MN 55122-1202sgilberg@cityofeagan.com

Gary GileCity of KelloggPO Box 147Kellogg, MN 55945-0147P: 507-767-4870watersewer@cityofkellogg.org

Christopher GlassingAMERICAN Cast Iron Pipe Company21695 Highview AveLakeville, MN 55044-7539P: 952-469-1100cglassing@american-usa.com

Stephen GleasonSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6820steve.gleason@ci.stpaul.mn.us

Gary GleisnerNew Ulm Public Utilities310 1st St NNew Ulm, MN 56073-1675P: 507-359-8264gary.gleisner@ci.new-ulm.us

Ryan GodfreyTonka Water13305 Water Tower CirPlymouth, MN 55441-3819P: 763-559-2837rgodfrey@tonkawater.com

David GoergenCity of Edina7450 Metro BlvdEdina, MN 55439-3037P: 952-826-0312dgoergen@edinamn.gov

David GomanCity of Spring Park4349 Warren AveSpring Park, MN 55384-9711P: 952-471-9051djgoman@ci.spring-park.mn.us

Christa Gomez1482 Edmund AveSaint Paul, MN 55104-2409P: 612-626-9536kimigomez@gmail.com

Jeremy GosewischShakopee Mdewakanton

Sioux Community2330 Sioux Trl NWPrior Lake, MN 55372-9077P: 952-496-6176jeremy.gosewisch@

shakopeedakota.org

Grand Rapids Public Utilities Commission

PO Box 658Grand Rapids, MN 55744-0658P: 218-326-7024

John Grant3M224 3E 30 3M CtrSaint Paul, MN 55144-1000P: 651-733-5864jlgrant1@mmm.com

Jerry GrantDezurik, Inc250 Riverside Ave NSartell, MN 56377-2129jerry.grant@dezurik.com

John GraupmanBolton & Menk, Inc.1960 Premier DrMankato, MN 56001-5900P: 507-625-4171johngr@bolton-menk.com

James GraupmannSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-1650jim.graupmann@ci.stpaul.mn.us

Scott GravsethE. Grand Forks Water & Light Dept.1010 5th Ave NEEast Grand Forks, MN 56721-1616P: 218-773-0515mswingen@

ci.east-grand-forks.mn.us

William GreggSummit Envirosolutions, Inc1217 Bandana Blvd NSaint Paul, MN 55108-5114P: 651-262-4236bgregg@summite.com

Stephanie GretschMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: 651-201-5283stephanie.gretsch@state.mn.us

Mike GriebelNew Ulm Public Utilities310 1st St NNew Ulm, MN 56073-1675mike.griebel@ci.new-ulm.mn.us

James GrilloSensus USA, Inc19598 Quinn Cir NWElk River, MN 55330-4113P: 763-274-0357jim.grillo@sensus.com

Tim GroganTonka Water13305 Water Tower CirPlymouth, MN 55441-3819P: 763-559-2837tgrogan@tonkawater.com

Greg GuerreroDuluth Public Works & Utilities520 Garfield AveDuluth, MN 55802-2610gguerrero@duluthmn.gov

Mark Guisfredi417 W Owatonna StDuluth, MN 55803-1748P: 218-348-9136mguisfredi@duluthmn.gov

Brian GuldanBolton & Menk, Inc7533 Sunwood Dr NW Ste 206Ramsey, MN 55303-5191briangu@bolten-menk.com

Geoff GussMcWane Ductile-Ohio2266 S 6th StCoshocton, OH 43812-8906P: 800-800-6013geoff.guss@mcwaneductile.com

HDaniel HaatsCity of SpicerPO Box 656Spicer, MN 56288-0656P: 320-796-5562lvaliant@cityofspicer.org

Matthew HaefnerCity of Chaska660 Victoria DrChaska, MN 55318-1440P: 952-227-7733mhaefner@chaskamn.com

Ronald HagemeierGreen Lake

Sanitary Sewer & Water Dist.14403 138th Ave NESpicer, MN 56288-8501P: 320-796-4523glswd@co.kandiyohi.mn.us

David HagenShanopee Public Utilites255 Sarazin StShakopee, MN 55379-3942P: 952-233-1503dhagen@shakopeeutilites.com

Jay HallSt. Louis Park Water Department7305 Oxford StMinneapolis, MN 55426-4512P: 952-242-2557jhall@stlouispark.org

Mark HallanWidseth Smith Nolting Assoc.7804 Industrial Park RdBaxter, MN 56425-8267P: 218-829-5117mark.hallan@wsn.us.com

Paul Halvorson5777 Longboat Rd NWRochester, MN 55901-0152P: 507-206-2724paul.halvorson@state.mn.us

Mike HamernikCity of Winona1 Johnson StWinona, MN 55987-3419

Abdelsalam HamidSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6818Abdelsalam.Hamid@ci.stpaul.mn.us

Steven HamsPO Box 202Red Lake Falls, MN 56750-0202218-253-2267

Kevin HansenCity of Columbia Heights637 38th Ave NEColumbia Heights, MN 55421-3806P: 763-706-3705

Dan HansenCity of Woodbury2301 Tower DrSaint Paul, MN 55125-1642dhansen@ci.woodbury.mn.us

Ray HansonCity of Mound Water Department2415 Wilshire BlvdMound, MN 55364-1668P: 952-472-0614rayhanson@cityofmound.com

Mark HansonSt. Louis Park Water Department7305 Oxford StMinneapolis, MN 55426-4512P: 952-924-2189mhanson@stlouispark.org

Adrian HansonUniversity of Minnesota-DuluthSwenson Civil Eng. BldgDuluth, MN 55812P: 218-726-6438athanson@d.umn.edu

Matt HarderTetra TechPO Box 124Mountain Lake, MN 56159P: 612-584-9177matayo77@gmail.com

John Harren27148 County Road 39Freeport, MN 56331-9605P: 320-235-4422harrenj@gmail.com

David HarrisFischer, Harris & Associates5865 Neal Ave NStillwater, MN 55082-2177P: 651-338-9222fhaa_dave@hotmail.com

Jay HartmanSt. Anthony Village3301 Silver Lake Rd NE Ste AMinneapolis, MN 55418-1668P: 612-782-3314

Charles HaupertAdvanced Engineering

and Enviromental Services, Inc6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: 763-463-5036charles.haupert@ae2s.com

James HauthCity of Eagan3419 Coachman PtEagan, MN 55122-1202P: 651-675-5216jhauth@cityofeagan.com

Mike HeckerTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: 763-559-2837mhecker@tonkawater.com

Mike HeimerRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1506mheimer@rpu.org

Jared HellerAdvanced Engineering

and Enviromental Services3170 43rd St S Ste 100Fargo, ND 58104-8908P: 701-364-9111jared.heller@ae2s.com

Dan HellingCity of Inver Grove Heights8168 Barbara AveInver Grove Heights, MN 55077-3410P: 651-450-2565dhelling@

ci.inver-grove-heights.mn.us

Jack HendricksonDSG4557 15th Ave NFargo, ND 58102-2840P: 701-241-9329jack@fgoh2o.com

James HenryHenry’s Waterworks, Inc.510 9th Ave SSauk Rapids, MN 56379-1360P: 320-259-5727jim@henryswaterworks.com

Cara HesseCity of Buffalo212 Central AveBuffalo, MN 55313-1699P: 763-684-5432cara.hesse@ci.buffalo.mn.us

Tim HewettSt. Cloud Public Utilities400 2nd St SSaint Cloud, MN 56301-3622

Rich HibbardSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 612-296-4573richard.hibbard@ci.stpaul.mn.us

Hibbing Public Utility Comm.PO Box 249Hibbing, MN 55746-0249P: 218-262-7725

Matt HillbrandKodru - Mooney3650 N Chestnut St Ste 102Chaska, MN 55318-3045P: 952-479-1045matt@kodru-equipment.com

Tim HillesheimCity of Lino Lakes600 Town Center PkwyLino Lakes, MN 55014-1182P: 651-464-5567tim.hillesheim@ci.lino-lakes.ms.us

Jason HillmanMarshall & Polk

Rural Water System401 N Main StWarren, MN 56762-1119mprws@mncable.net

Joseph HillstromShakopee Public UtilitiesPO Box 470Shakopee, MN 55379-0470P: 952-445-1988jhillstrom@shakopeeutilities.com

Kyle HinrichsCity of Mankato109 Jade LnMankato, MN 56001-6846P: 507-381-0220khinrichs@city.mankato.mn.us

Robert HintgenCity Of Richfield1901 E 66th StRichfield, MN 55423-2711P: 612-861-9165rhintgen@cityofrichfield.org

Phu Hoang7740 Carnelian LnEden Prairie, MN 55346-4347P: 612-232-0725hoanph77@my.sctcc.edu

Joseph HobanDixon Engineering, Inc.845 Terrace AveMenasha, WI 54952-1438P: 800-327-1578joehoban@dixonengineering.net

Tracy HodelSt. Cloud Public Utilities400 2nd St SSaint Cloud, MN 56301-3622P: 320-255-7225tracy.hodel@ci.stcloud.mn.us

Robyn Hoerr10641 184th Ct NWElk River, MN 55330-6106P: 218-685-5197robyn.hoerr@mrwa.com

Paul HoeschenCity of Cold Spring27 Red River Ave SCold Spring, MN 56320-2536P: 320-685-3524phoeschen@

coldspring.govoffice.com

Joe HoffmanPreston Public Utilities CommissionPO Box 657Preston, MN 55965-0657P: 507-765-2491jhoffman@prestonmn.org

David HollandDalton Scientific Inc.7567 Debbie LnEden Prairie, MN 55346-4004P: 952-934-3587dholland@daltonscientific.com

C. HolterCity of Onalaska415 Main StOnalaska, WI 54650-2953P: 608-781-9537jholter@cityofonalaska.com

Michael HolwegerCity of East Grand Forks

Water & Light Dept.1010 5th Ave NEEast Grand Forks, MN 56721-1616P: 218-773-0515

Dave HorvathCity of Zimmerman12980 Fremont AveZimmerman, MN 55398-9414P: 763-856-4666dhorvath@sherbtel.net

Jeffery Hovlid5583 Jefferson Ave SWHoward Lake, MN 55349-5009P: 320-543-2024

Deborah Howard-RyburnAe2s6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: 763-463-5036debbie.hryburn@ae2s.com

Mike HowellBilfinger Water Technologies1950 Old Highway 8 NWNew Brighton, MN 55112P: 651-638-3134mike.howell@bilfinger.com

Raymond HozalskiUniversity of Minnesota500 Pillsbury Dr SEMinneapolis, MN 55455-0233P: 612-626-9650hozalski@umn.edu

Ruth HubbardMinnesota Rural Water Association217 12th Ave SEElbow Lake, MN 56531-4741P: 218-685-5197ruth.hubbard@mrwa.com

John HudakHydro Designs, Inc.5700 Crooks Rd Ste 100Troy, MI 48098-2826P: 248-250-5005jhudak@hydrodesignsinc.com

David HumeLeggette, Brashears & Graham Inc.8 Pine Tree Dr Ste 250Saint Paul, MN 55112-3781P: 651-490-1405dave.hume@lbgmn.com

Henry HuntLayne Christensen -

Ranney Collector Wells6360 Huntley RdColumbus, OH 43229-1008P: 614-888-6263henry.hunt@layne.com

Renee HusetSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6877renee.huset@ci.stpaul.mn.us

Binh HuynhSPRWS1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6269binh.huynh@ci.stpaul.mn.us

Indian Health Service - Bemidji Area DSFC

522 Minnesota Ave Fed Bldg Rm 216Bemidji, MN 56601P: 218-444-0502

IRobert IsabelCDM Smith Inc.7650 Currell Blvd Ste 300Saint Paul, MN 55125-8209P: 651-252-3800isabelrs@cdm.com

JAnton Jachim3M3M Center # 201Saint Paul, MN 55144-1001P: 651-733-8832afjachim@mmm.com

Steve JacksonCity of Onalaska415 Main StOnalaska, WI 54650-2953P: 608-781-9545SJackson@cityofonalaska.com

Verne JacobsenTKDA332 Summit AveSaint Paul, MN 55102-2124P: 651-292-4484verne.jacobsen@tkda.com

Howard JacobsonCity of Duluth520 Garfield AveDuluth, MN 55802-2610P: 218-730-4061hjacobson@duluthmn.gov

Kelley JanesCity of Golden Valley7800 Golden Valley RdGolden Valley, MN 55427-4508P: 763-593-8038kjanes@goldenvalleymn.gov

Sunidh Jani3M Company3M Center Bldg 22302S24Saint Paul, MN 55144-1000sjani@mmm.com

Daniel JanishCity of Rogers Public Works22350 S Diamond Lake RdRogers, MN 55374-4773P: 763-428-8580djanish@ci.rogers.mn.us

Loren JansonCity of Duluth Pub. Wks. & Utilities8130 Congdon BlvdDuluth, MN 55804-3138P: 218-730-4160

Scott JensenCity of Lake City205 W Center StLake City, MN 55041-1609P: 651-345-4711sjensen@ci.lake-city.mn.us

Cory JensenCountry Enterprises Inc.PO Box 157Lucan, MN 56255-0157P: 507-747-2574cory@countryent.net

Karen JensenHawkins, Inc.2381 RosegateRoseville, MN 55113-2625P: 612-331-6910Karen.Jensen@HawkinsInc.com

Miles JensenShort-Elliott-Hendrickson, Inc.3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5108P: 651-490-2020mjensen@sehinc.com

2Adam JirakCity of Medford4645 Halstad AveWebster, MN 55088-2019P: 952-237-4342ajirak@live.com

Wayne Johnson10339 150th Ave SESaint Hilaire, MN 56754-9756P: 218-681-3809wjohnson@citytrf.net

Gregory Johnson5655 Newell Cir NStillwater, MN 55082-5493P: 651-704-9970gjohnson@wsbeng.com

Randie JohnsonCity of East Grand Forks/

Water & Light Dept.801 2nd St NEEast Grand Forks, MN 56721-3100P: 218-773-1511rjohnson@egf.mn

Todd JohnsonMinnesota Department of Health705 5th St NW Ste ABemidji, MN 56601-2933P: 218-308-2100todd.johnson@state.mn.us

Ronnie JohnsonOwatonna Public UtilitiesPO Box 800Owatonna, MN 55060-0800P: 507-446-5437johnsonr@owatonnautilities.com

Cary JohnsonRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1507cjohnson@rpu.org

Kurt JohnsonStantec3616 Oak Creek TerVadnais Heights, MN 55127-7034P: 651-967-4611kbjohns36@gmail.com

Wayne JohnsonThe Ford Meter Box Co., Inc.13685 Couchtown AveRosemount, MN 55068-4711P: 651-315-6635wjohnson@fordmeterbox.com

Bo JohnstonBlack & Veatch7760 France Ave S Ste 1200Minneapolis, MN 55435-3215P: 952-896-0704johnstonrw@bv.com

Kathryn JonesHDR Engineering, Inc.701 Xenia Ave S Ste 600Minneapolis, MN 55416-3636P: 763-278-5917kathryn.jones@hdrinc.com

Kory JorgensenCity of Fridley11877 Alder St NWMinneapolis, MN 55448-2427P: 763-572-3546

Todd JorgensonAustin Utilities400 4th St NEAustin, MN 55912-3495P: 507-433-8886toddj@austinutilities.com

Ben JulsonAE2S3101 Frontage Road SMoorhead, MN 56560P: 218-299-5610ben.julson@ae2s.com

KNancy KadrlikMinnesota Department of Health625 Robert St NSaint Paul, MN 55155-2538P: 651-201-4578nancy.kadrlik@state.mn.us

Richard KakachCity of Golden Valley7800 Golden Valley RdGolden Valley, MN 55427-4508P: 952-457-2006rkakach@goldenvalleymn.gov

Timothy KampaCity of Bloomington Utilities1700 W 98th StBloomington, MN 55431-2501P: 952-563-8776tkampa@ci.bloomington.mn.us

Steve KariTonka Water13305 Water Tower CirPlymouth, MN 55441-3819P: 763-559-2837skari@tonkawater.com

John KarwackiSambatek, Inc.12800 Whitewater Dr Ste 300Minnetonka, MN 55343-9347P: 763-746-1628jkarwacki@sambatek.com

Sophie Kasahara9049 Kell Ave SBloomington, MN 55437-1807P: 612-991-5593kasah007@umn.edu

Sreerama Murthy Kasi Somayajula

Moore Engineering925 10th Ave EWest Fargo, ND 58078-5211P: 701-499-5878mkasi@mooreengineeringinc.com

Carol KaszynskiCity of Bloomington1700 W 98th StMinneapolis, MN 55431-2501P: 952-563-4848ckaszynski@bloomingtonmn.gov

Chad Katzenberger416 S 6th St Ste 200Brainerd, MN 56401-3580P: 218-855-1720ckatzenberger@sehinc.com

Kevin KawlewskiWSB & Associates, Inc.701 Xenia Ave S Ste 300Minneapolis, MN 55416-1030P: 763-287-7193kkawlewski@wsbeng.com

Kyle KedrowskiMinnesota Rural Water Association216 12th Ave SEElbow Lake, MN 56531-4737P: 218-685-5197kyle.kedrowski@mrwa.com

Karl KeelCity of Bloomington1800 W Old Shakopee RdMinneapolis, MN 55431-3027P: 952-563-8731kkeel@ci.bloomington.mn.us

Jack KegelMinnesota Municipal

Utilities Association3025 Harbor Ln N Ste 400Plymouth, MN 55447-5142P: 763-551-1230jkegel@mmua.org

Andrew KegleyCity of Oak Park Heights14168 Oak Park BlvdOak Park Heights, MN 55082-6476P: 651-334-5140akegley@cityofoakparkheights.com

Travis Keller17436 85th St SWBecker, MN 55308P: 320-282-3330traviskeller.seo@gmail.com

Thomas KellerHawkins Water Treatment Group2381 RosegateRoseville, MN 55113-2625P: 612-718-4472tom.keller@hawkinsinc.com

Pat KellyCity of Crookston124 N BroadwayCrookston, MN 56716-1731P: 218-281-1232pkelly@crookston.mn.us

Shawn KellyCity of Int’L Falls600 4th StIntl Falls, MN 56649-2442P: 218-283-2990

Scott KetchmarkPrescott Water Operations1481 Sundog Ranch RdPrescott, AZ 86301-5507P: 928-830-7531scott.ketchmark@prescott-az.gov

Mary KimlingerUponor5925 148th St WApple Valley, MN 55124-8197P: 952-997-4296mary.kimlinger@uponor.com

Kinetrol USA, Inc.1085 Ohio DrPlano, TX 75093-5320P: 972-835-7917

Richard KittelsonBlooming Prairie Public Utils.PO Box 55Blooming Prairie, MN 55917-0055P: 507-583-6683rdkbppu@frontiernet.net

Kent KjellbergKjellberg’s, Incorporated1000 Kjellberg Park WMonticello, MN 55362-9139P: 763-295-2931

Douglas Klamerus14264 Cosette Ln NHugo, MN 55038-4424P: 507-280-1508dklamerus@rpu.org

Kathryn KlarichBarr Engineering Co.850 Washington Ave SE Apt 309Minneapolis, MN 55414-3070P: 507-272-3954kklarich@barr.com.edu

Michael KlimersCity of Savage Utilities Services13770 Dakota AveSavage, MN 55378-4431P: 952-224-3400mklimers@ci.savage.mn.us

Wade KlingspornVermillion College1900 E Camp StEly, MN 55731-1996P: 218-235-2145w.klingsporn@vcc.edu

Randy KloepperCity of Crystal4141 Douglas Dr NCrystal, MN 55422-1609P: 763-531-1166randy.kloepper@crystalmn.gov

Robert Klug21544 Nebish Rd NEBlackduck, MN 56630-5196P: 218-835-4809rkpws@paulbunyan.net

Kristofer KnutsonMoorhead Public ServicePO Box 779Moorhead, MN 56561-0779P: 218-477-8071kknutson@mpsutility.com

Charles KocourekMinneapolis Water Treatment &

Distribution Services4500 Marshall St NEFridley, MN 55421-2508P: 612-799-0895charlie.kocourek@

minneapolismn.gov

Jennifer KoenigMinnesota Rural Water Assn.217 12th Ave SEElbow Lake, MN 56531-4741P: 320-815-4991Jennifer.Koenig@mrwa.com

Jim KoepLakefield Public UtilitiesPO Box 1023Lakefield, MN 56150-1023utilities@lakefieldmn.com

Curt KoivistoBabbitt Public Utilities71 South DrBabbitt, MN 55706-1232P: 218-827-3292babbittpuc@frontiernet.net

Tim KosekCity of Howard LakePO Box 736Howard Lake, MN 55349-0736P: 320-543-2318

Larry KoshireRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1605

Jason KosmatkaAE2S3101 S Frontage Rd Ste 100Moorhead, MN 56560-2545P: 218-825-1979jason.kosmatka@ae2s.com

Brian KraabelCity of Andover1685 Crosstown Blvd NWAndover, MN 55304-2612P: 763-767-5180b.kraabel@andovermn.gov

Adam Kramer5464 Needham Ave NESaint Michael, MN 55376-8602P: 612-432-5656awkram@aol.com

George KraynickMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 412-331-4723george.kraynick@

minneapolismn.gov

Teresa KreckowMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 763-432-3301Teresa.Kreckow@

minneapolismn.gov

Raymond Kristiansen624 University Dr SSaint Cloud, MN 56301-5301P: 320-979-5111raymondkristiansen@yahoo.com

Joseph KroeningMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4989joseph.kroening@

minneapolismn.gov

Herbert Krueger5766 County 12 BlvdKenyon, MN 55946-4015P: 507-964-2231

Sidney KrugerDeZurik, Inc.250 Riverside Ave NSartell, MN 56377-2129P: 320-259-2060sid.kruger@dezurik.com

Ben KuchtaPlant & Flanged Equipment Co.10101 Xylite St NEMinneapolis, MN 55449-5227P: 763-792-3870ben@plantandflanged.com

Paul Kuhn18042 62nd Ave NMaple Grove, MN 55311-4681P: 763-205-2456paulkuhn6864@comcast.net

LAlan LaisCity of Luverne305 E Luverne StLuverne, MN 56156-1611P: 507-449-5030alais@cityofluverne.org

Lake Crystal Municipal Utilities

PO Box 86Lake Crystal, MN 56055-0086P: 507-726-2536

Lakefield Public UtilitiesPO Box 1023Lakefield, MN 56150-1023P: 507-662-5457

Bill LalondeCity of Richfield6700 Portland AveRichfield, MN 55423-2560P: 612-861-9165

Allen Lamm45200 Jeremy DrNew Ulm, MN 56073-5501P: 507-354-9765ajlamm@newulmtel.net

Andrew Landman720 Main StCold Spring, MN 56320-2152P: 763-443-5500aslandman@yahoo.com

Craig LangbehnRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414

Kelly Lange-HaiderDow Water & Process Solutions7600 Metro BlvdMinneapolis, MN 55439-3048P: 952-897-4311KPLange-Haider@dow.com

Timothy LaPara11137 Nassau Cir NEBlaine, MN 55449-5488P: 626-624-6028lapar001@umn.edu

John Lapointe4412 Drew Ave NRobbinsdale, MN 55422-1553j.jlapointe@comcast.net

Kim LarsenMinnesota Department of Health3333 W Division St Ste 212Saint Cloud, MN 56301-4557P: 320-293-7992kim.larsen@state.mn.us

Larry LarsenSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810larry.larsen@ci.stpaul.mn.us

Stephen Larson456 2nd St NBayport, MN 55003-1021P: 615-678-3391Stephen.Larson@akzonobel.com

Jeff LarsonMarshall Municipal Utilities113 S 4th StMarshall, MN 56258-1223P: 507-537-7005jeffl@marshallutilities.com

Christopher LarsonSEH, Inc.3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5118P: 651-765-2961clarson@sehinc.com

John LaumannSt. Louis Park Water Department7305 Oxford StMinneapolis, MN 55426-4512P: 952-924-2558jlaumann@stlouispark.org

Richard LavellCity of Circle Pines200 Civic Heights CirCircle Pines, MN 55014-1788P: 763-784-5898rlavell@ci.circle-pintes.mn.us

Jeff LedinShort Elliott Hendrickson416 S 6th St Ste 200Brainerd, MN 56401-3580P: 218-851-4569jledin@sehinc.com

Matthew Lee1115 6th Ave NEDilworth, MN 56529-1536P: 218-329-9929matthew.e.lee@ndsu.edu

Brian LeMonBarr Engineering Company4700 W 77th St Ste 200Minneapolis, MN 55435-4820P: 952-832-2774blemon@barr.com

Randy LeppalaAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: 612-619-7167randy.leppala@ae2s.com

Corey LerbsTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: 763-559-2837clerbs@tonkawater.com

A.W. Libke250 Riverside Ave NSartell, MN 56377-2129al.libke@dezurik.com

Mike LienCity of Hutchinson440 School Rd NWHutchinson, MN 55350-1406

Liesch Associates - A Terracon Company

13400 15th Ave NPlymouth, MN 55441-4532P: 763-489-3100

Lincoln Pipestone Rural WaterPO Box 188Lake Benton, MN 56149-0188P: 507-368-4248

Alison LingBarr Engineering4700 W 77th St Ste 200Minneapolis, MN 55435-4820aling@barr.com

Krystal Lingofelt1390 Broadway St WCold Spring, MN 56320-4802P: 320-282-4851lingoracer19@yahoo.com

LiqTech NA1804 Buerkle RdWhite Bear Lake, MN 55110-5245P: 651-773-5850

Litchfield Water Department126 N Marshall AveLitchfield, MN 55355-2110P: 320-593-4400

Little FallsPO Box 244Little Falls, MN 56345-0244P: 320-616-5500

Bin Liu13025 Dahlia Cir Apt 314Eden Prairie, MN 55344-7637P: 919-561-4550bliu7@ncsu.edu

James Long2468 E Catalina DrSalt Lake City, UT 84121-3911P: 801-618-8688james2che@yahoo.com

Steven LorbachSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6353Steve.Lorbach@ci.stpaul.mn.us

Gena LoudenMoorhead Public ServicePO Box 779Moorhead, MN 56561-0779P: 218-299-5470glouden@mpsutility.com

Douglas LubbenCH2M HILL1295 Northland Dr Ste 200Mendota Heights, MN 55120-1373P: 651-497-6498doug.lubben@ch2m.com

Corey LubovichHibbing Public Utilities1902 6th Ave EHibbing, MN 55746-1663P: 218-262-7725coreyl@hpuc.com

Richard LuckowCity of Brooklyn Park8300 Noble Ave NBrooklyn Park, MN 55443-2400richard.luckow@brooklynpark.org

Jerome LuddenSt Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6853jerry.ludden@ci.stpaul.mn.us

Dolly LuddenSt. Paul Regional Water1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6880dolly.ludden@ci.stpaul.mn.us

Justin Lueck1226 Woodlawn Acres DrSaint Cloud, MN 56301-9525P: 320-253-0305justinjlueck@gmail.com

Shane LundCity of St. Cloud400 2nd St SSaint Cloud, MN 56301-3622P: 320-255-7226shane.lund@ci.stcloud.mn.us

Russ LupkesCity of Richfield6221 Portland AveRichfield, MN 55423-2560P: 612-636-9486rlupkes@cityofrichfield.org

Noel LutseyAnoka Technical College1355 W Highway 10Anoka, MN 55303-1590P: 763-576-4948nlutsey@anokatech.edu

Amy LynchMinnesota Department of Health12 Civic Center Plz Ste 2105Mankato, MN 56001-7789P: 507-344-2713amy.lynch@state.mn.us

Seth LynneApex Engineering Group4733 Amber Valley Parkway SouthFargo, ND 58104-8647P: 701-373-7990seth.lynne@apexenggroup.com

MM.E. Simpson Company, Inc.3406 Enterprise AveValparaiso, IN 46383-6953P: 800-255-1521

Ben MaUniversity Of Minnesota420 Delaware St SEMinneapolis, MN 55455-0341P: 847-868-4783maxxx853@umn.edu

Mark MachacekTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: 763-559-2837mmachacek@tonkawater.com

Shelly MaguireSJE RhombusPO Box 1708Detroit Lakes, MN 56502-1708P: 218-847-1317Shelly.Maguire@sjerhombus.com

Charlie MahadyTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: 763-559-2837cmahady@tonkawater.com

Gerald Mahon901 Heritage Dr Apt 306Sartell, MN 56377-4789P: 320-253-2346marjandger@gmail.com

Danica MaierPVS Chemicals32391 N Cambridge DrFraser, MI 48026-2333P: 313-571-1100dmaier@pvschemicals.com

Patrick MalayQuality Flow Systems, Inc.800 6th St NWNew Prague, MN 56071-1148P: 952-758-9445qfspat@aol.com

Brian MalmBolton & Menk, Inc.2778 Commerce Dr NW Ste CRochester, MN 55901-2262P: 507-208-4332brianma@bolton-menk.com

Jim MaloneCity of Minnetonka11522 Minnetonka BlvdHopkins, MN 55305-4370P: 763-593-8077jmalone@eminnetonka.com

Mark MaloneyCity of Shoreview4600 Victoria St NShoreview, MN 55126-5817P: 651-490-4651mmaloney@shoreviewmn.gov

Douglas Mandy2545 Bobolink RdLong Lake, MN 55356-9265P: 763-242-5937mandydjm@mchsi.com

Mankato UtilitiesPO Box 3368Mankato, MN 56002-3368P: 507-387-8624

Richard MannTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: 763-559-2837rmann@tonkawater.com

Pat MarinelloThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Adam MarkosBlack & Veatch7760 France Ave S Ste 1200Minneapolis, MN 55435-3215P: 952-896-0500markosa@bv.com

Michael MarshCity of Brooklyn Center Water Dept6844 Shingle Creek PkwyBrooklyn Center, MN 55430-1418mmarsh@ci.brooklyn-center.mn.us

Marshall & Polk Rural Water System

401 N Main StWarren, MN 56762-1119P: 218-745-5471

Marshall Municipal Utilities113 S 4th StMarshall, MN 56258-1223P: 507-537-7005

Brent MarsolekSaint Pual Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6810brent.marsolek@ci.stpaul.mn.us

Dennis MartensonSelf-Employed100 Clydesdale Trl Apt 225Medina, MN 55340-4581P: 763-537-5295martensondr@gmail.com

Lucas Martin4618 1/2 Penkwe WaySaint Paul, MN 55122-3718P: 651-201-4144lucas.martin@state.mn.us

Brent Massmann7197 Cambridge RdShakopee, MN 55379-7014P: 320-980-19351brentmassmann@gmail.com

Master Electric CO.8555 W 123rd StSavage, MN 55378-1150P: 952-201-3043

Kevin MasteyCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707

Kyle MattsonNYM Public WorksPO Box HNew York Mills, MN 56567-0368P: 218-385-2213nympublicworks@gmail.com

Richard MaurisCity of Winnebago463 2nd Ave SWWinnebago, MN 56098-2036P: 507-893-3845rmauris@cityofwinnebago.com

Ross Mayer3618 Rainbow DrMinnetonka, MN 55345-1035P: 952-476-6642

Ronald McCabeMinnesota Pipe & Equipment5145 211th St WFarmington, MN 55024-8919P: 952-469-5457rmccabe@mnpipe.com

Lauren McClanahanCity of Columbia Heights637 38th Ave NEColumbia Hts, MN 55421-3806P: 763-706-3700

Danette McCulleyMinneapolis Water Works350 S 5th St Ste 203Minneapolis, MN 55415-1355

Steve McCuskeyHach Company9268 Queensland Ln NMaplegrove, MN 55311-4444P: 763-370-0852smccuskey@hach.com

Marc McDanielW.W. Goetsch Associates, Inc.5250 W 74th StEdina, MN 55439-2227P: 952-831-4340mmcdaniel@wwgoetsch.com

Greg McGillisLittle FallsPO Box 244Little Falls, MN 56345-0244Lfwaste@littlefallswireless.com

Dan McGrane1197 Dawn LnSaint Paul, MN 55125-8507P: 952-890-3811

Clifford McLain2710 17th St SMoorhead, MN 56560-4807P: 218-443-3962cliffm2010@live.com

Gary McLarenHydro Designs, Inc.2665 S Moorland Rd Ste 209New Berlin, WI 53151-2900P: 262-951-0059gmclaren@hydrodesignsinc.com

Michael McNabbBadger Meter12916 2nd Ave SBurnsville, MN 55337-3503mmcnabb@badgermeter.com

Bob McNuttCLOW12735 24th Ave NPlymouth, MN 55441-3946P: 612-743-1973bob.mcnutt@clowvalve.com

MDOT395 John Ireland BlvdSaint Paul, MN 55155-1800P: 651-366-3567

Merle MeeceCity of PerhamPO Box 130Perham, MN 56573-0130P: 218-346-5242mmeece@cityofperham.com

Kelly MeighanEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: 651-639-5640acarlson@ema-inc.com

Duane MelizaCity of Dundas213 Railway St SDundas, MN 55019-4014P: 507-645-8062drmeliza@dundas.us

Amy MellCity of RushPO Box 556Rush City, MN 55069-0556P: 320-358-4743cityhall@ci.rush-city.mn.us

David MendelSt. Cloud Public Utilities400 2nd St SSaint Cloud, MN 56301-3622dave.mendel@ci.stcloud.mn.us

Steven MerenessMetering & Technology Solutions11551 Rupp DrBurnsville, MN 55337-1248P: 952-242-1960stevem@metertechsolutions.com

Ron MergenCity of Paynesville221 Washburne AvePaynesville, MN 56362-1697P: 320-243-3714ron@paynesvillemn.com

Scott MerkleyCity of St. Louis Park7305 Oxford StSaint Louis Park, MN 55426-4512P: 952-924-2181smerkley@stlouispark.org

Thomas MettlerWaterous Company125 Hardman Ave SSouth St Paul, MN 55075-2456P: 651-450-5053tjmettler@waterousco.com

Gary MetzlerVan Bergen & Markson, Inc.9366 Deerwood Ln NMaple Grove, MN 55369-3634P: 763-546-4340gary@vbminc.com

Grant MeyerAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: 763-463-5036Grant.Meyer@ae2s.com

George MihelichBois Forte Lake

Vermilian Reservation1342 Tibbetts TrlTower, MN 55790-8168P: 218-753-2854gmihelich@frontiernet.net

Hanna Miller2076 Como Ave Apt 4Saint Paul, MN 55108-2026P: 989-600-9730mill3731@umn.edu

James MillerFoth I&E, LLC300 Douglas DrBuffalo, MN 55313-9239P: 612-961-2505jim.miller@foth.com

Minneapolis Water Works350 S 5th St Ste 203Minneapolis, MN 55415-1355P: 612-673-2418

Minnesota Department of Health

PO Box 64975Saint Paul, MN 55164-0975P: 651-201-4679

Gregory MitzigaKittson-Marshall Rural Water, Inc.410 Commercial StDonaldson, MN 56720-9998P: 218-674-4407kmrw@invisimax.com

Martin MoegleinThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809moegl@yahoo.com

Nicole Mohapp2179 Stewart AveSaint Paul, MN 55116-3148P: 847-791-2844nikki.mohapp@gmail.com

Joseph MomsenCity of Vadnais Heights800 County Road E EVadnais Heights, MN 55127-7117P: 651-204-6051jmomsen@cityvadnaisheights.com

Matthew MontgomeryTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: 763-559-2837mmontgomery@tonkawater.com

Eric MooreCity of Hutchinson Water Department1300 Adams St SEHutchinson, MN 55350-7009P: 320-234-4257emoore@ci.hutchinson.mn.us

Michael MooreCopperhead Industries, LLCPO Box 1081Monticello, MN 55362-1081P: 877-726-5644m.moore@copperheadwire.com

Moorhead Public ServicePO Box 779Moorhead, MN 56561-0779P: 218-299-5400

Shannon MortensonCity of Warren120 E Bridge AveWarren, MN 56762-1510P: 218-745-5343shannonm@warrenminnesota.com

Gayle MoserSaint Paul Regional Water Service1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6858gayle.moser@ci.stpaul.mn.us

Adam MoultonMinnesota Pipe & Equipment5145 211th St WFarmington, MN 55024-8919P: 651-463-6090amoulton@mnpipe.com

Pete MoultonSt. Peter Public Works405 Saint Julien StSaint Peter, MN 56082-1874P: 507-934-0670petem@saintpetermn.gov

Mountain Lake Water Department

PO Box CMountain Lake, MN 56159-0320P: 507-427-2633

Shawn MulhernKLM Engineering, Inc.PO Box 897Lake Elmo, MN 55042-0497P: 651-773-5111smulhern@klmengineering.com

Linda MullenCity of Burnsville13713 Frontier CtBurnsville, MN 55337P: 952-895-4552linda.mullen@burnsvillemn.gov

Joseph MunnCity of Crookston Water

Department124 N BroadwayCrookston, MN 56716-1731P: 218-281-5711waterdept@crookston.mn.us

Anna MunsonBlack & Veatch12632 Dover DrApple Valley, MN 55124-5237P: 952-896-0767munsona@bv.com

Jerry MyersDN Tanks4247 Grove AveGurnee, IL 60031-2134P: 847-782-0357jmyers@natgun.com

Rick MyskewitzAmerican Flow Control21695 Highview AveLakeville, MN 55044-7539P: 612-790-6240rmyskewitz@american-usa.com

NRichard NagyCity of Hutchinson Water Dept.111 Hassan St SEHutchinson, MN 55350-2522P: 320-234-5629dnagy@ci.hutchinson.mn.us

James NavratilPO Box 117Silver Lake, MN 55381-0117P: 320-237-3766jimnavratil@hotmail.com

Doug NeidCity of Brooklyn Park8300 Noble Ave NBrooklyn Park, MN 55443-2400P: 763-493-8099

Steven NelsonBolton & Menk, Inc.7533 Sunwood Dr NW Ste 206Ramsey, MN 55303-5191P: 763-433-2851stevene@bolton-menk.com

Thomas NelsonCity of Grand MaraisPO Box 600Grand Marais, MN 55604-0600P: 218-387-1160wwtf@boreal.org

Mark NelsonCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: 763-494-6000

Jerome NelsonCity of Newfolden35930 140th Ave NWNewfolden, MN 56738-9212P: 218-874-8155newfolden@wiktel.com

Craig NelsonCity of Sauk Rapids360 Summit Ave NSauk Rapids, MN 56379-2670P: 320-258-5318cnelson@ci.sauk-rapids.mn.us

Shawn NelsonOakdale Water Department1900 Hadley Ave NOakdale, MN 55128-5412P: 651-730-2740shawn.nelson@ci.oakdale.mn.us

Kimberly NelsonWigen Water Technologies302 Lake Hazeltine DrChaska, MN 55318-1034P: 800-240-3330kim.nelson@wigen.com

Terry NeumanCity Of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3027P: 952-563-4908tneuman@ci.bloomington.mn.us

Kurt Neumann13850 Rosewood Ln NDayton, MN 55327-9574P: 763-323-3560kwoodtic@msn.com

New Prague Utilities Commission

118 Central Ave N Ste 2New Prague, MN 56071-5514P: 952-758-4401

New Ulm Public Utilities310 1st St NNew Ulm, MN 56073-1675P: 507-359-8279

Scott NewbergerCity of Plymouth14900 23rd Ave NPlymouth, MN 55447P: 763-509-5999snewberg@ci.plymouth.mn.us

Richelle NicosiaSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6818richelle.nicosia@ci.stpaul.mn.us

Diane NielsenMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4960diane.nielsen@minneaplismn.gov

Adrian Nino De Rivera Frost15407 McGinty Rd WWayzata, MN 55391-2365P: 713-932-2332adrianninoderivera@mail.com

Brian NomaMinnesota Dept. of HealthPO Box 64975Saint Paul, MN 55164-0975brian.noma@state.mn.us

Yoko NomuraProgressive Consulting

Engineers, Inc.6120 Earle Brown Dr Ste 629Minneapolis, MN 55430-4102yokonomura@pce.com

Todd NordineNorth Kittson Rural WaterPO Box 99Lake Bronson, MN 56734-0099P: 218-754-6161nkrw@wiktel.com

Jeffrey NylandCity of Brooklyn Center6844 Shingle Creek PkwyMinneapolis, MN 55430-1418P: 763-585-7100

Paul O’BrienCity of HayfieldPO Box 53Hayfield, MN 55940-0053pmobrien98@yahoo.com

Ruth O’BrienSaint Paul Regional Water1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6322ruth.obrien@ci.stpaul.mn.us

Oakdale Water Department1900 Hadley Ave NOakdale, MN 55128-5412P: 651-730-2740

OScott OberaignerCity of OronoPO Box 66Crystal Bay, MN 55323-0066P: 952-249-4600soberaigner@ci.orono.mn.us

Mark OberhelmanHawkins, Inc.2381 RosegateRoseville, MN 55113-2625P: 612-617-8603mark.oberhelman@hawkinsinc.com

Sarah Oftedahl BrownSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810sarah.brown@ci.stpaul.mn.us

Andrew OhrtARCADIS US, Inc.430 1st Ave N Ste 720Minneapolis, MN 55401-1746P: 612-373-0232aohrt@arcadis-us.com

Todd OlmschenkMulcahy2700 Blue Waters Rd Ste 100Saint Paul, MN 55121-1429P: 651-256-2452tolmschenk@mulcahyco.com

Brian OlsonCity of Minneapolis

Water Department935 5th Ave SEMinneapolis, MN 55414-1205P: 612-581-6532brian.olson@minneapolismn.gov

Scott OlsonCity of Thief River FallsPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Jeff OlsonEGF1010 5th Ave NEEast Grand Forks, MN 56721-1616P: 218-773-0515jolson@egf.mn

Travis Olufson2760 Ocarina DrSauk Rapids, MN 56379-4609P: 320-493-5608tolufson@yahoo.com

Lucian OsujiMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4924lucian.osuji@minneapolismn.gov

John OswaldLeggette Brashears & Graham8 Pine Tree Dr Ste 250Saint Paul, MN 55112-3792

Todd OsweilerRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1584tosweiler@rpu.org

Jason OverbyLincoln Pipestone Rural WaterPO Box 188Lake Benton, MN 56149-0188P: 507-368-4248lprwgis@itctel.com

Owatonna Public UtilitiesPO Box 800Owatonna, MN 55060-0800P: 507-451-2839

Rodney Owens901 E 66th St Apt 6Richfield, MN 55423-2543P: 612-237-3558wise.warriors4him@gmail.com

PJohn PackardCulligan Water Conditioning6030 Culligan WayMinnetonka, MN 55345-5917P: 952-912-7363valarie.murray@culliganwater.com

Paul PalzerCity of Centerville1880 Main StCenterville, MN 55038-9794P: 651-429-4750ppalzer@centervillemn.com

Thomas Pankaw995 Jefferson Commons CirSaint Paul, MN 55114P: 630-947-9359panka014@umn.edu

Richard Parr4931 Lilac Way NLake Elmo, MN 55042-8531P: 312-402-1632rparr@donohue-associates.com

Philip ParsonsParsons Engineered ProductsPO Box 16507Saint Louis Park, MN 55416-0507P: 952-926-7000philp@pep-reps.com

Robert PaschkeCity of New Hope5500 International PkwyNew Hope, MN 55428-3606P: 763-271-3271Bpaschke@ci.new-hope.mn.us

Sam Paske2118 Wellesley AveSaint Paul, MN 55105-1231P: 651-400-0456sam.paske@gmail.com

David PaulsonWater Think Tank, LLC16929 Creek Ridge PlMinnetonka, MN 55345-6303P: 952-220-5778dave@waterthinktank.com

Timothy Paustian4709 Woodhaven St SFargo, ND 58104-4246P: 701-799-7294tjpaustian@gmail.com

Barry PawelekAmerican Water Company18066 Dane DrEden Prairie, MN 55347-3496P: 619-587-1693barry.pawelek@amwater.com

Richard PawlickiA.Y. Mcdonald Mfg. Co12725 Laurie LnChaska, MN 55318-9270P: 952-448-5664

Mark PedersenCountry Enterprises Inc.PO Box 157Lucan, MN 56255-0157markp@countryent.net

Eric Pederson10117 Harriet Ave SBloomington, MN 55420-4728P: 612-296-6528dulieguy@aol.com

Brittany PentekCity of Minneapolis Public Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4912brittany.pentek@

minneapolismn.gov

Robert PeplinSambatek12800 Whitewater Dr Ste 300Minnetonka, MN 55343-9347P: 612-799-5297BPeplin@sambatek.com

Timothy PeschmanEvoqa Water Technologies LLC2430 Rose PlSaint Paul, MN 55113-2511P: 612-308-9243timothy.peschman@evoqua.com

Gary PetersWadena Light & Water Dept.104 Jefferson St NWadena, MN 56482-1369P: 218-631-5734

Michael PetersenBarr Engineering Co.4700 W 77th St Ste 200Minneapolis, MN 55435-4820P: 952-832-2644MPetersen2@barr.com

Kira Peterson1934 Hayes St NE Apt 1Minneapolis, MN 55418-4859P: 218-390-3664kira.peterson@gmail.com

Kirk Peterson13860 54th Ave N Unit 4Plymouth, MN 55446-1156P: 612-202-7786kirk.peterson@hdsupply.com

Jon PetersonBolton & Menk, Inc.1960 Premier DrMankato, MN 56001-5900P: 507-625-4171jonpe@bolton-menk.com

Seth PetersonBolton & Menk, Inc.12224 Nicollet AveBurnsville, MN 55337-1649P: 952-890-0509sethpe@bolton-menk.com

Eric PetersonCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707

Doug PetersonCity of Woodbury2301 Tower DrWoodbury, MN 55125-1642P: 651-714-3720dpeterson@ci.woodbury.mn.us

Karla PetersonMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: 651-201-4679karla.peterson@health.state.mn.us

Christopher PetreeCity of Lakeville20195 Holyoke AveLakeville, MN 55044-9047P: 952-985-2701cpetree@lakevillemn.gov

Peter PfisterMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4906peter.pfister@minneapolismn.gov

Todd PhillipsFerguson Waterworks16905 Xylite St NEHam Lake, MN 55304-5030P: 763-560-5200todd.phillips@ferguson.com

Dan PinceCity of S. St. Paul400 Richmond St ESouth Saint Paul, MN 55075-5940P: 651-554-3235dan.pince@southstpaul.org

Jeff PinkowskiCambridge Brass242 Golden Pheasant DrGetzville, NY 14068-1488P: 800-724-3906jpinkowski@cbrass.com

Brad PirsigCity of Albert Lea221 E Clark StAlbert Lea, MN 56007-2496P: 507-377-4378bpirsig@city.albertlea.org

Mike PlanteLBG8 Pine Tree Dr Ste 250Saint Paul, MN 55112-3792P: 651-490-1405mike.plante@lbgmn.com

Jerry PleinCity of Red Wing229 Tyler Rd NRed Wing, MN 55066-1826P: 651-385-3691jerry.plein@ci.red-wing.mn.us

Thomas PletcherCity of Minnetonka11522 Minnetonka BlvdHopkins, MN 55305-4370P: 952-988-8400tpletcher@eminnetonka.com

Angelo PolsinelliDakota Pump & Control705 Quadee DrWatertown, SD 57201-4075P: 605-886-4672angelo@dpc.us.com

Randy PooreCity of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3071P: 952-563-4912rpoore@ci.bloomington.mn.us

Daniel PortlockMoore Engineering, Inc.925 10th Ave EWest Fargo, ND 58078-5211P: 218-329-3875taz123321@hotmail.com

Brent PowersCity of DawsonPO Box 552Dawson, MN 56232-0552P: 320-769-2154

Lynne PowersEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: 612-965-8611lpowers@ema-inc.com

Preload Inc.Preload, LLC2613 Industrial LnGarland, TX 75041-2302P: 972-994-0550

Preston Public Utilities Commission

PO Box 657Preston, MN 55965-0657P: 507-765-2491

Jim PrindleCity of Onalaska415 Main StOnalaska, WI 54650-2953P: 608-781-9543jprindle@cityofonalaska.com

Jim PritchardMinnesota Pipe & EquipmentPO Box 249Farmington, MN 55024-0249P: 651-463-6090jpritchard@mnpipe.com

Amy Prok11003 Dalton Ave SEDelano, MN 55328-8330P: 952-956-2461aprok@frontiernet.net

Mark ProulxPO Box 169001Duluth, MN 55816-9001P: 952-240-2023

James PrusakCity of Cloquet

Municipal Water Supply1307 Cloquet AveCloquet, MN 55720-1657P: 218-879-6758

Ben PrzybillaCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707P: 763-509-5996

QNaeem QureshiProgressive Consulting

Engineers, Inc.6120 Earle Brown Dr Ste 629Minneapolis, MN 55430-4102P: 763-560-9133naeemqureshi@pce.com

Nuzhat QureshiProgressive Consulting

Engineers, Inc.6120 Earle Brown Dr Ste 629Minneapolis, MN 55430-4102P: 763-560-9133nuzhatqureshi@pce.com

RDuane RaderNorth Mankato Water Department1001 Belgrade AveNorth Mankato, MN 56003-3501P: 507-625-3382drader@northmankato.com

Jeffrey RadickCity of Burnsville100 Civic Center PkwyBurnsville, MN 55337-3817P: 952-895-4418jeffrey.radick@ci.burnsville.mn.us

Raj Rajagopal3M Company3M Center # 2013E03Saint Paul, MN 55144-0001P: 651-737-6752bsrajagopal@mmm.com

Terry RandallCity of Spring Lake Park1301 81st Ave NEMinneapolis, MN 55432-2188P: 763-782-2893

Randall Rapacz1427 5th Ave NWE Grand Forks, MN 56721-1410P: 218-773-9163rrapacz@egf.mn

Red Flint Sand and GravelPO Box 688Eau Claire, WI 54702-0688P: 800-238-9139

Nathan ReedGreen Lake

Sanitary Sewer & Water Dist14403 138th Ave NESpicer, MN 56288-8501P: 320-796-4523nathan.reed@co.kandiydri.mn.ius

Dale ReedWhite Bear Township1281 Hammond RdWhite Bear Township, MN 55110P: 651-747-2777dale.reed@

ci.white-bear-township.mn.us

Curtis ReetzPO Box 1033Arlington, MN 55307-1033P: 507-964-5650creetz02@mchsi.com

Neile ReiderMDOT395 John Ireland BlvdSaint Paul, MN 55155-1800P: 651-366-3567neile.reider@state.mn.us

Bruce ReimersNew Prague Utilities Commission118 Central Ave N Ste 2New Prague, MN 56071-5514P: 952-758-1142breimers@ci.new-praque.mn.us

Terry ReischCity of LuvernePO Box 659Luverne, MN 56156-0659P: 507-449-5030kreisch@cityofluverne.org

Roger RennerE. H. Renner & Sons, Inc.15688 Jarvis St NWElk River, MN 55330-6220P: 763-427-6100rerenner@ehrenner.com

Melanie RettieEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: 651-639-5600mrettie@ema-inc.com

Terry Rewertz421 Chicago Ave SWRed Lake Falls, MN 56750-4523P: 218-253-2002trewertz@gmail.com

Shahin RezaniaMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4902Shahin.rezania@

minneapolismn.gov

Lih-In RezaniaMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: 651-201-4661lih-in.rezania@state.mn.us

Scott RichardsonKinetrol USA, Inc.1112 Wildwood WayChaska, MN 55318-9732P: 972-835-7917scottrichardson@kinetrolusa.com

Donn RichardsonRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1509drichardson@rpu.org

David RindalPO Box 141135Minneapolis, MN 55414-6135P: 651-201-4660david.rindal@state.mn.us

Jim RingMinneapolis Water Dept.4500 Marshall St NEMinneapolis, MN 55421-2508P: 612-718-9560james.ring@minneapolismn.gov

Kent RittermanMoore Engineering, Inc.925 10th Ave EWest Fargo, ND 58078-5211P: 701-282-4692kritterman@

mooreengineeringinc.com

Mark RobbinsESRI880 Blue Gentian Rd Ste 200Saint Paul, MN 55121-1670P: 651-454-0600mrobbins@esri.com

Allen Robeck828 Armstrong Ave NGlencoe, MN 55336-2712P: 320-864-2784robeck@hutchtel.net

Vernell RobertsCity of Detroit LakesPO Box 647Detroit Lakes, MN 56502-0647P: 218-846-7139dlpublic@ci.detroit-lakes.mn.us

Stephen RobertsS. Roberts Co.17575 Bearpath TrlEden Prairie, MN 55347-3488P: 952-949-2655srobertsco@comcast.net

Rick Robinson13878 Eagle View Lake RdBig Stone City, SD 57216-8238P: 507-626-0770rrobinson@dsginc.biz

Phillip RobinsonPO Box 152Winsted, MN 55395-0152P: 712-297-5630

Charles RobinsonStantec Consulting Services2335 Highway 36 WRoseville, MN 55113-3819P: 651-604-4707chip.robinson@stantec.com

David RobinsonTonka Water13305 Water Tower CirPlymouth, MN 55441-3819P: 763-559-2837drobinson@tonkawater.com

Rochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1605

Justine RoeSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-1628justine.roe@ci.stpaul.mn.us

Jerry RoehlCity of Golden Valley13175 Gray Fox TrlRogers, MN 55374-8742P: 763-593-8078jroehl@goldenvalleymn.gov

Steven RoepkeCity of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3071P: 952-563-4501sroepke@bloomingtonmn.gov

Michael RoersMinnesota Rural Water217 12th Ave SEElbow Lake, MN 56531-4737P: 218-685-5197mike.roers@mrwa.com

Eric RoosWorthington Public UtilitiesPO Box 458Worthington, MN 56187-0458P: 507-372-8680eroos@worthingtonutilities.com

George Rosati206 Woodhaven LnMankato, MN 56001-5706P: 507-388-5646grosati@charter.net

Dennis RosemarkSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810dennis.rosemark@ci.stpaul.mn.us

Samuel RosenbergFederal Cartridge900 Bob Ehlen DrAnoka, MN 55303-7502P: 763-331-4381kidhersh@me.com

C.W. Ross13218 Findlay WayApple Valley, MN 55124-7935P: 952-431-8800

Holly Ross645 Franklin St SWHutchinson, MN 55350-2803P: 320-583-2416rosco203@mchsi.com

Steve Ross8333 Kentucky Ave NMinneapolis, MN 55445-2241P: 763-360-6716steve.ross@brooklynpwk.org

Alexis RossowSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810alexis.rossow@ci.stpaul.mn.us

Thomas RousharWSB & Associates, Inc.701 Xenia Ave S Ste 300Minneapolis, MN 55416-1030P: 763-287-7195troushar@wsbeng.com

Douglas RovangRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1605drovang@rpu.org

Matt Rowedder5817 34th Ave NCrystal, MN 55422-2553P: 763-286-8890mrowedder@goldenvalleymn.gov

Camille RubeizPPI2839 Maple LnFairfax, VA 22031-1425P: 469-499-1050crubeiz@plasticpipe.org

Daniel RuizCity of Brooklyn Park8300 Noble Ave NBrooklyn Park, MN 55443-2400

Joel RuterWillmar Municipal UtilitiesPO Box 937Willmar, MN 56201-0937P: 320-235-4422

Rose Rutherford425 University Ave SE Apt 205Minneapolis, MN 55414-1730P: 619-227-5992rosea1313@gmail.com

Theresa RyanInterstate Companies20920 Forest Rd NForest Lake, MN 55025-9767P: 651-334-6814theresa.ryan@interstatepm.com

Chris RydellMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 952-543-8577christopher.rydell@

ci.minneapolis.mn.us

SJohn SachiCity of South St. Paul125 3rd Ave N Ste 1South St Paul, MN 55075-2097P: 651-554-3210john.sachi@southstpaul.org

James SadlerCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: 763-494-6377jsadler@ci.maple-grove.mn.us

Paul SaffertBolton & Menk7533 Sunwood Dr NW Ste 206Ramsey, MN 55303-5191P: 763-433-2851paulsa@bolton-menk.com

Saint Paul Regional Water Services

1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6815

Saint Peter Water Utilities405 Saint Julien StSaint Peter, MN 56082-1874P: 507-934-0670

Adam SaloHR Green20875 Independence AveLakeville, MN 55044-5878P: 651-644-4389asalo@hrgreen.com

Kyle Sandberg581 Pascal St NSaint Paul, MN 55104-2412P: 610-295-4989sandb283@umn.edu

Robert SandillaIn Control, Inc.10350 Jamestown St NEMinneapolis, MN 55449-4524P: 952-941-2296ras@in-ctrl.com

Andrew SantiHD Supply Waterworks12357 Ethan Ave NWhite Bear Lake, MN 55110-5965P: 262-844-2923andy.santi@hdsupply.com

David SappBrown and Caldwell30 7th St E Ste 2500Saint Paul, MN 55101-4924P: 651-468-2044dsapp@brwncald.com

Michael Savelli2318 115th Ave NWMinneapolis, MN 55433-3023P: 763-257-5849MSavelli@hach.com

Scott SchaeferAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: 763-463-5036scott.schaefer@ae2s.com

Roger ScharfCH2M HILL1295 Northland Dr Ste 200Mendota Heights, MN 55120-1380P: 651-365-8539roger.scharf@ch2m.com

Jake Scheffler18850 Fairbanks AveFaribault, MN 55021-8807P: 507-491-4825scheja99@my.sctcc.edu

Lon SchemelShakopee Public

Utilities CommissionPO Box 470Shakopee, MN 55379-0470P: 952-233-1504lschemel@shakopeeutilities.com

Steven SchererCity of Medina2052 County Road 24Medina, MN 55340-9790P: 763-473-4643steve.scherer@ci.medina.mn.us

Terry SchiroVessco Inc.8217 Upland CirChanhassen, MN 55317-9626P: 952-941-2678tschiro@vessco.com

William SchluenzCity of Waite ParkPO Box 339Waite Park, MN 56387-0339P: 320-252-6822bill.schluenz@ci.waitepark.mn.us

Scott Schmitz1304 2nd St NCold Spring, MN 56320-1069P: 320-828-3352trschmitz4@gmail.com

Steve SchneiderSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6274steve.schneider@ci.stpaul.mn.us

Alan SchneiderTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: 763-559-2837aschneider@tonkawater.com

Thomas SchneidermanCity of East Grand Forks Water &

Light Dept.1010 5th Ave NEEast Grand Forks, MN 56721-1616P: 218-773-0515wlap@eastgrandforks.net

Harold SchollerCity of International Falls4211 Highway 11International Falls, MN56649-9104P: 218-283-2990schollers@frontiernet.net

Tony SchrantzWater Conservation Services, Inc.6251 W Shadow Lake DrLino Lakes, MN 55014-3327P: 612-600-8716tony.schrantz@gmail.com

Gary Schreifels1107 11th St E Ste 107Glencoe, MN 55336-2327P: 320-864-6954gschreifels@ci.glencoe.mn.us

Kevin SchubertCity of Onalaska415 Main StOnalaska, WI 54650-2953P: 608-781-9537kschubert@cityofonalaska.com

David Schultz1309 Northway CirSaint Cloud, MN 56303-1752P: 320-259-9008davidschultz22@hotmail.com

Scott SchultzWillmar Municipal Utility704 Litchfield Ave SWWillmar, MN 56201-3111P: 320-235-4422

Jennifer SchumannPO Box 270082Golden Valley, MN 55427-6082P: 763-302-9559schum512@umn.edu

Thomas SchurPublic UtilitiesPO Box 384Mountain Iron, MN 55768-0384P: 218-735-8475

Todd SchwabCity of Cambridge300 3rd Ave NECambridge, MN 55008-1281P: 763-689-1800tschwab@cambridgepw.org

William SchwandtMoorhead Public Service Dept.PO Box 779Moorhead, MN 56561-0779P: 218-299-5400bschwandt@mpsutility.com

Duane SchwartzCity of Roseville2701 Lexington Ave NSaint Paul, MN 55113-2007P: 651-490-2312duane.schwartz@ci.roseville.mn.us

Corey SchweichCity Of Elko New MarketPO Box 99Elko New Market, MN 55020-0099P: 952-461-2777cschweich@ci.enm.mn.us

Brandon ScottWillmar Municipal UtilityPO Box 937Willmar, MN 56201-0937P: 507-445-3139

Allen SeebeckLiqTech NA1804 Buerkle RdWhite Bear Lake, MN 55110-5245aes@liqtechna.com

John SeifertCity of Rogers22350 S Diamond Lake RdRogers, MN 55374-4773P: 763-428-8580jseifert@ci.rogers.mn.us

Michael Semmens2163 Goodrich AveSaint Paul, MN 55105-1021P: 651-226-4418semme001@gmail.com

Jim SeppMoore Engineering, Inc.934 16th Ave WWest Fargo, ND 58078-4621P: 701-499-5824jsepp@mooreengineeringinc.com

Eric ShafferDuluth Public Works & Utilities520 Garfield AveDuluth, MN 55802-2610

Patrick SheaCity of St. Cloud400 2nd St SSaint Cloud, MN 56301-3622P: 320-255-7225patrick.shea@ci.stcloud.mn.us

Bryce Shearen918 Woodlynn AveRoseville, MN 55113-1938P: 651-246-9098bshearen@gmail.com

Shorewood Public Water5755 Country Club RdExcelsior, MN 55331-8926P: 952-960-7913

Prashant ShrikhandeGE Water5951 Clearwater DrMinnetonka, MN 55343-8990P: 952-988-6309prashant.shrikhande@ge.com

Jessica Shu1151 Devonshire CurvBloomington, MN 55431-3192jshu@dow.com

Louis Sigtermans22 Raymond Pl Apt 5Saint Paul, MN 55114-1163P: 952-378-0040lhsigtermans@gmail.com

Ron SikMankato UtilitiesPO Box 3368Mankato, MN 56002-3368

SJE-Primex Controls, Inc.PO Box 1708Detroit Lakes, MN 56502-1708P: 218-847-1317

Gary SkallmanCity of Int’l FallsPO Box 831Intl Falls, MN 56649-0831P: 218-240-1412

Robert SkibnessCity of Fergus Falls112 W Washington AveFergus Falls, MN 56537-2568P: 218-864-8390rob.skibness@ci.fergus-falls.mn.us

Brian SkokCity of CarverPO Box 147Carver, MN 55315-0147P: 507-665-9941bskok@cityoflesueur.com

Sleepy Eye Municipal UtilityPO Box 408Sleepy Eye, MN 56085-0408P: 507-794-4371

Dean Sletten3527 110th Ave NMoorhead, MN 56560-7221P: 701-412-3965dsletten@mooreengineeringinc.com

Mark SloanMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: 651-201-4652mark.sloan@state.mn.us

Pete Smith26795 Pat Clark RdOgema, MN 56569-9590P: 218-204-0877psmith@map-inc.org

Sharon SmithMinnesota Department of Health1505 Pebble Lake Rd Ste 300Fergus Falls, MN 56537-3800P: 218-332-5145sharon.l.smith@state.mn.us

Stuart SmithSpring Valley Public Utilities104 S Section AveSpring Valley, MN 55975-1646P: 507-346-7622svutil@myclearwave.net

Racquel SmrzSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810racquel.smrz@ci.stpaul.mn.us

Scott SnellIndian Health Service -

Bemidji Area DSFC522 Minnesota Ave Fed Bldg Rm 216Bemidji, MN 56601P: 218-444-0502scott.snell@ihs.gov

Don SolgaCity of Pelican RapidsPO Box 350Pelican Rapids, MN 56572-0350P: 218-863-6572pradmin@loretel.net

Carl SonnenbergWaseca Water & Light Dept.508 State St SWaseca, MN 56093-3033P: 507-835-9713CarlS@city.waseca.com

William SpainSt. Cloud Technical

& Community College1540 Northway DrSaint Cloud, MN 56303-1240P: 320-308-5952bspain@sctcc.edu

Luke SpaljRice Lake Construction GroupPO Box 517Deerwood, MN 56444-0517P: 218-546-5519luke_spalj@ricelake.org

Spring Valley Public Utilities104 S Section AveSpring Valley, MN 55975-1646P: 507-346-7622

Cael Sprute9850 Cromwell DrEden Prairie, MN 55347-2945P: 952-941-0171csprute@hotmail.com

St. Cloud Public Utilities400 2nd St SSaint Cloud, MN 56301-3622P: 320-255-7225

St. James Water DepartmentPO Box 70Saint James, MN 56081-0070P: 507-375-1229

St. Louis Park Water Department

7305 Oxford StMinneapolis, MN 55426-4512P: 952-924-2557

Lyle Stai1185 160th Ave SEKerkhoven, MN 56252-9566P: 320-212-8590lylestai@mvtvwireless.com

Russell StammerISG3645 Arbor Dr NWRochester, MN 55901-4158P: 507-331-1500rdstammer@gmail.com

Staples Public Works Commission

122 6th St NEStaples, MN 56479-2932P: 218-894-2550

Robert Stark1531 Hill View CtRed Wing, MN 55066-4230P: 650-385-5112bob.stark@ci.red-wing.mn.us

Andrew StephesCity of Prior Lake17073 Adelmann St SEPrior Lake, MN 55372-3968P: 952-292-1088astephes@cityofpriorlake.com

Larry StierMaster Companies8555 W 123rd StSavage, MN 55378-1150

Razvan StoicescuEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3819P: 651-639-5600

Gregory StonehouseHDR Engineering701 Xenia Ave S Ste 600Minneapolis, MN 55416-3636P: 763-591-5400greg.stonehouse@hdrinc.com

Thomas StordahlMinnesota Pipe & EquipmentPO Box 249Farmington, MN 55024-0249P: 651-463-6090tstordahl@mnpipe.com

Leslee Storlie8700 Ironwood Ave SCottage Grove, MN 55016-4725P: 651-307-3772LStorlie@wsbeng.com

Jacqueline Strait2517 Bryant Ave S Apt 203Minneapolis, MN 55405-2956strai046@umn.edu

Ted StrandCity of Crosslake37028 County Road 66Crosslake, MN 56442-2528P: 218-820-3303publicwk@crosslake.net

Scott StrebelFer-Pal Construction USA LLC1350 Gasket DrElgin, IL 60120-7543P: 847-214-0103scott.strebel@

ferpalinfrastructure.com

Karl Streed2306 Lincoln St NEMinneapolis, MN 55418-3826P: 612-788-4669stree013@tc.umn.edu

T.J. StroeblTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: 763-559-2837tstroebl@tonkawater.com

Mark SturmCity of St. JamesPO Box 70Saint James, MN 56081-0070P: 507-375-1229mesturm@embarqmail.com

Tom SullivanMaster Companies8555 W 123rd StSavage, MN 55378-1150P: 952-201-3482tom.sullivan@masterelectric.com

Summit Envirosolutions, Inc1217 Bandana Blvd NSaint Paul, MN 55108-5114P: 651-644-8080

Kristopher SwansonBolton & Menk1960 Premier DrMankato, MN 56001-5900P: 507-380-3206krissw@bolton-menk.com

Mark SweersMinnesota Dept. of Health12 Civic Center Plz Ste 2105Mankato, MN 56001-7789P: 507-344-2736mark.sweers@state.mn.us

John SzymanskiSzymanski’s S.I., Inc.65910 267th StAlden, MN 56009-4211P: 507-863-2422johnszymanski99@hotmail.com

TCharles Taflin12650 Elm Creek XingChamplin, MN 55316-1167P: 763-421-6569cotaflin@usfamily.net

Anthony TalamantezMankato Public Works

Utilities InfrastructurePO Box 3368Mankato, MN 56002-3368P: 507-387-8663ttalamantez@city.mankato.mn.us

Harvey TamCity of Richfield6700 Portland AveRichfield, MN 55423-2560P: 612-861-9165

Harold TaylorCity of Cottage Grove8635 W Point Douglas Rd SCottage Grove, MN 55016-3318P: 651-458-2853htaylor@cottage-grove.org

Len TaylorCity of Fergus Falls112 W Washington AveFergus Falls, MN 56537-2568P: 218-332-5420len.taylor@ci.fergus-falls.mn.us

Paul TeicherCity of St. Francis4058 Saint Francis Blvd NWSaint Francis, MN 55070-9701P: 763-235-2304pteicher@stfrancismn.org

David TetzloffCity of LewisvillePO Box 13Lewisville, MN 56060-0013P: 507-435-2791cityoflewisville@hotmail.com

Zack TheinThein Well CompanyPO Box 778Spicer, MN 56288-0778P: 320-796-2111zack@theinwell.com

Thief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Paul ThomHD Supply Waterworks1630 Woodlawn CirWaconia, MN 55387-1242P: 612-597-8515paul.thom@hdsupply.com

John ThomSEH, Inc.3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5118P: 651-765-2965jthom@sehinc.com

Anthony ThompsonMinneapolis Water Works4500 Marshall St NEMinneapolis, MN 55468P: 612-661-4930Anthony.thompson@

minneapolismn.gov

Steve ThomsCity of Red Wing229 Tyler Rd NRed Wing, MN 55066-1826P: 651-380-0470steve.thomas@ci.red-wing.mn.us

Stew ThornleyMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: 651-201-4655stew.thornley@state.mn.us

Wayne ThuringerCity of AuroraPO Box 160Aurora, MN 55705-0160P: 218-229-2624awff@frontier.com

Chris TolbertSt Paul Regional Water1900 Rice StSaint Paul, MN 55113-6810P: 641-266-6260chris.tolbert@ci.stpaul.mn.us

Tonka WaterPO Box 41126Plymouth, MN 55441-0126763-559-2837

Bert TracyCity of Golden Valley7800 Golden Valley RdGolden Valley, MN 55427-4508P: 763-593-3981btracy@goldenvalleymn.gov

James TraenDownhole Well Services, LLC8145 Long Lake RdMounds View, MN 55112-6033P: 763-785-1876jim@downholewellservices.com

Dale TranterFoth & Van Dyke8550 Hudson Blvd N Ste 100Lake Elmo, MN 55042-8706P: 651-288-8505dale.tranter@foth.com

Dave TrautMark J. Traut Wells, Inc.141 28th Ave SWaite Park, MN 56387-1085P: 320-251-5090dave@trautwells.com

Kathy TravisSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6874kathy.travis@ci.stpaul.mn.us

Chad TroitteE. Grand Forks Wtr. & Light De801 2nd St NEEast Grand Forks, MN 56721-3100P: 218-773-1511chadtroitte@yahoo.com

Nicholas TrudeauThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-6809

William TschidaSt. Paul Water Utility1900 Rice StSaint Paul, MN 55113-6810P: 651-292-6583

Tara TurchEMA, Inc.2355 Highway 36 W Ste 200Roseville, MN 55113-3903tturch@ema-inc.com

Jerry Tveit4561 232nd Ln NWSaint Francis, MN 55070-8785P: 763-286-5192jerrytvit@gmail.com

Curtis Tvinnereim3420 Urbandale Ln NPlymouth, MN 55447-1018P: 763-475-1828

UIlhan UlkemValspar1101 S 3rd StMinneapolis, MN 55415-1211P: 612-375-7973ilhan.ulkem@valspar.com

Michael UlrichCity of Blaine1801 101st Ave NEBlaine, MN 55449-4408P: 763-785-6167

USABlueBookPO Box 9006Gurnee, IL 60031-9006P: 800-548-1234

VTim ValleyCity of Northfield - WWTP1450 Highway 3 NNorthfield, MN 55057-1494tim.valley@ci.northfield.mn.us

Steven Valtinson1606 Cedar Knoll PlSaint Cloud, MN 56301-5727

Lawrence Van Hout123 Linden AveAlexandria, MN 56308-8902P: 320-762-0699larry.vanhout@wn.us.com

Jordan VandalRCAP-Midwest Assistance ProgramPO Box 32Knife River, MN 55609-0032P: 701-212-2165jvandal@map-inc.org

Kou Vang4036 Scheuneman RdSaint Paul, MN 55110-4113P: 651-653-3525kou.vang@ci.stpaul.mn.us

George Vania2200 Oak Glen CirStillwater, MN 55082-9613P: 651-351-7291gjvania1@gmail.com

Harlan VanWyheCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: 763-494-6358hvanwyhe@ci.maple-grove.mn.us

Charles VeinAE2S4050 Gardenview Dr Ste 200Grand Forks, ND 58201-7215P: 701-746-8087charles.vein@ae2s.com

Uma Vempati17664 69th Pl NOsseo, MN 55311-3027P: 612-209-1912uma.mnawwa@gmail.com

Robert VerkeMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4905rob.verke@minneapolismn.gov

Chris VoeltzSaint Peter Water Utilities405 Saint Julien StSaint Peter, MN 56082-1874P: 507-934-0670chrisv@saintpetermn.gov

Thomas VogelOrder of Saint BenedictPO Box 7299Collegeville, MN 56321-7299P: 320-363-2541tvogel@csbsju.edu

Cindy VoigtCity of Duluth411 W 1st St Rm 211Duluth, MN 55802-1191P: 218-730-5071cvoigt@duluthmn.gov

Eric VolkElk River Municipal Utilities1705 Main St NWElk River, MN 55330-1830P: 763-635-1361evolk@elkriverutilities.com

Greg VolkartCity of Goodview4140 W 5th StWinona, MN 55987-1599P: 507-452-1630gvolkart@goodviewmn.com

Rodney VolkerImage Communications17783 220th AveDetroit Lakes, MN 56501-7915P: 218-849-9688rav@loretel.net

Myron VolkerOwatonna Public Utilities208 S Walnut AveOwatonna, MN 55060-2940P: 507-446-5454volkerm@owatonnautilities.com

Lisa VollbrechtSt. Cloud Public Utilites/ City Hall400 2nd St SSaint Cloud, MN 56301-3622P: 320-255-7225lisa.vollbrecht@ci.stcloud.mn.us

Kevin VranicarMangney Construction, Inc.1401 Park RdChanhassen, MN 55317-9592P: 352-474-1674kevin@magneyconstruction.com

WMichael WaakUniversity of Minnesota500 Pillsbury Dr SEMinneapolis, MN 55455-0233P: 920-609-0803waakx002@umn.edu

Wadena Light & Water Dept.104 Jefferson St NWadena, MN 56482-1369P: 218-631-5734

Richard WagnerAE2S3101 S Frontage Rd Ste 100Moorhead, MN 56560-2545P: 218-299-5610Richard.Wagner@AE2S.com

Justin WagnerCity of Northfield801 Washington StNorthfield, MN 55057-2598P: 507-645-3083justin.wagner@ci.northfield.mn.us

Jeff WagnerSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-325-1500jeff.wagner@ci.stpaul.mn.us

David WagnerSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: 651-488-0784dave.wagner@ci.stpaul.mn.us

Brian WagstromCity of Minnetonka11522 Minnetonka BlvdMinnetonka, MN 55305-4370P: 952-988-8400bwagstrom@eminnetonka.com

David WaldochAmerican Cast Iron Pipe21695 Highview AveLakeville, MN 55044-7539P: 952-469-1100dwaldoch@american-usa.com

Jodi WallinSt Paul Regional Water Service1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6308jodi.wallin@ci.stpaul.mn.us

Mark WallisSEH418 W Superior StDuluth, MN 55802-1512P: 218-279-3017mwallis@sehinc.com

Trevor WalterCity of BaxterPO Box 2626Baxter, MN 56425-2626P: 218-855-5115trevor.walter@ci.baxter.mn.us

Connie WangenPrinceton Public Utilities907 1st StPrinceton, MN 55371-1559P: 763-691-1193cwangen@princetonutilities.com

Joseph WardWSB & Associates701 Xenia Ave S Ste 300Minneapolis, MN 55416-1030P: 763-512-5253jward@wsbeng.com

Gary WarnerTonka Water13305 Water Tower CirPlymouth, MN 55441-3803P: 763-559-2837gwarner@tonkawater.com

Water Remediation Technology LLC

5525 W 56th Ave Ste 100Arvada, CO 80002P: 303-424-5355

Herbert WatryLitchfield Public Utilities126 N Marshall AveLitchfield, MN 55355-2110P: 320-593-4400herb.watry@ci.litchfield.mn.us

Jonathan Watson8300 Noble Ave NBrooklyn Park, MN 55443-2400P: 763-493-8008jon.watson@brooklynpark.org

Paul Webber15801 Nursery DrMinnetonka, MN 55345-4553mimmehaha@icloud.com

Tom WelleApex Engineering Group, Inc4733 Amber Valley Parkway S.Fargo, ND 58104P: 218-236-6328tom.welle@apexenggroup.com

Chet WelleCity Of Rochester301 37th St NWRochester, MN 55901-3403P: 507-281-6191cwelle@rochestermn.gov

Austin Weltzin17590 Eureka Ave WFarmington, MN 55024-9090P: 612-718-5188austeno96@hotmail.com

Deborah WeltzinCity of Bloomington Water

Treatment Plant9300 Poplar Bridge RdBloomington, MN 55437P: 952-563-4904dweltzin@BloomingtonMN.gov

Norman WenckWenck Associates, Inc.PO Box 249Maple Plain, MN 55359-0249P: 763-479-4200nwenck@wenck.com

Tom WesoloskiCity of Shoreview4600 Victoria St NShoreview, MN 55126-5817P: 651-490-4652twesolowski@shoreviewmn.gov

Jim WestermanCity of Woodbury8301 Valley Creek RdWoodbury, MN 55125-3330jwesterman@ci.woodbury.mn.us

Richard Wetzel2800 Fox Run NWPrior Lake, MN 55372-3238P: 952-403-0942richard_d_wetzel@yahoo.com

David WeumMinnesota Dept. of HealthPO Box 64975Saint Paul, MN 55164-0975P: 651-201-4684david.weum@state.mn.us

Andrew WeyerMinneapolis Water Works4300 Marshall St NEFridley, MN 55421-2510P: 612-661-4925andrew.weyer@minneapolismn.gov

Tony WhiteCity of Burnsville13713 Frontier CtBurnsville, MN 55337-4720P: 952-895-4550tony.white@ci.burnsville.mn.us

Wendy WicheltEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: 651-639-5737wwichelt@ema-inc.com

Todd WicklundBrainerd Public UtilitiesPO Box 373Brainerd, MN 56401-0373P: 218-825-3220twicklund@bpu.org

Widseth Smith Nolting Assoc.7804 Industrial Park RdBaxter, MN 56425-8267P: 218-829-5117

Jason WiehleCity of Fridley6431 University Ave NEMinneapolis, MN 55432-4303P: 612-710-4734jason.wiehle@fridleymn.gov

Wigen Water TechnologiesGenevieve Hutchens302 Lake Hazeltine DrChaska, MN 55318-1034P: 952-448-4884

Willmar Municipal UtilityPO Box 937Willmar, MN 56201-0937P: 320-235-4422

Jason WilmHawkins Inc.2381 RosegateRoseville, MN 55113-2625P: 402-314-0346jason.wilm@hawkinsinc.com

Jordan Wilson905 Kilian Blvd SE Apt 7Saint Cloud, MN 56304-1442wilsjo43@my.sctcc.edu

Bruce WilsonCity of International FallsPO Box 831International Falls, MN 56649-0831P: 218-283-2990brucew@ci.international-falls.mn.us

William WiltseCity of KinneyPO Box 307Kinney, MN 55758-0307P: 218-258-2206tazzman@mchsi.com

Dave WisdorfCity of Excelsior339 3rd StExcelsior, MN 55331-1809P: 952-474-3464dwisdorf@ci.excelsior.mn.us

Brian WiseNanostone Water10250 Valley View Rd Ste 143Eden Prairie, MN 55344-3534P: 612-618-5023brian.wise@nanostone.com

Joesph WoksonCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: 763-494-6380jwokson@ci.maple-grove.mn.us

Nate WoldMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205nate.wold@minneapolismn.gov

Worthington Public UtilitiesPO Box 458Worthington, MN 56187-0458P: 507-372-8680

Jeremy WurptsTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: 763-559-2837jwurpts@tonkawater.com

Marvin WurzerCity of Long LakePO Box 606Long Lake, MN 55356-0606P: 925-476-2855mwurzer@ci.long-lake.mn.us

XJosh XiongLiqTech NA1804 Buerkle RdWhite Bear Lake, MN 55110-5245

YCraig YokopenicEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: 651-639-5600cyokopenic@ema-inc.com

Kevin Young1131 37th Ave SMoorhead, MN 56560-6144P: 320-293-2546kyoung@mpsutility.com

ZMike ZaborowskiCity of Winona1 Johnson StWinona, MN 55987-3419P: 507-457-8272

Joe ZaunerFischer, Harris & Associates5865 Neal Ave NStillwater, MN 55082-2177joe@fischer-harris.com

Carol ZehrerTonka Equipment Company13305 Water Tower CirPlymouth, MN 55441-3819P: 763-559-2837czehrer@tonkawater.com

Nancy ZeiglerAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: 763-463-5036Nancy.Zeigler@ae2s.com

Li ZhangMinneapolis Div. Wtr.

Treatment and Distribution Svcs.4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4904li.zhang@minneapolismn.gov

Paul ZimmerCity of MankatoPO Box 3368Mankato, MN 56002-3368P: 507-243-3597pzimmer@city.mankato.mn.us

Steve ZwiefelTruman Public UtilitiesPO Box 397Truman, MN 56088-0397P: 507-776-6501 •

Buyers’ GuideMN AWWA 2015

AccessoriesGeneral Repair ServiceMid America Meter, Inc

Activated CarbonCEI-Carbon Enterprises Inc.

Algae ControlMedora Corporation, home of SolarBee and GridBee brands

AMR Systems and Meters /AMI SolutionsFerguson Waterworks HD Supply WaterworksMid America Meter, Inc

AnthraciteCEI-Carbon Enterprises Inc.

Backfl ow Prevention ProgramsHydroCorp

Chemical Processing & Feed SystemsPollardwater.com

Contractors Bergerson Caswell Inc Hydro-KleanInterstate Companies

Cross Connection ControlHydroCorp

DechlorinationPollardwater.com

Design-Build ContractorBergerson Caswell Inc Black & VeatchBrown and Caldwell

Electrical Instrumentation/Controls/GeneratorsMid America Meter, IncMinnesota Pump WorksTitan Energy Systems Inc.Ziegler Power Systems

Engineers/ConsultantsAE2S AECOMApex Engineering Group Banner Associates, Inc.Black & VeatchBolton & Menk, Inc.Brown and CaldwellDixon Engineering, Inc.

HR Green, Inc.KLJLeggette, Brashears & Graham, Inc.Moore Engineering, Inc. Progressive Consulting Engineers, Inc. Short Elliott Hendrickson Inc. (SEH)Stantec Consulting ServicesSummit Envirosolutions, Inc.TKDAWidseth Smith NoltingWSB & Associates, Inc.

Environmental DrillingBergerson Caswell IncSummit Envirosolutions, Inc.Thein Well Company

Filter Media Remove/Supply & InstallCEI-Carbon Enterprises Inc.Tonka Water

Filtration CEI-Carbon Enterprises Inc.Hawkins Water Treatment GroupProgressive Consulting Engineers, Inc. Tonka WaterVan Bergen & Markson, Inc.Vessco, Inc.

General IndustrialHydro-KleanProfessional Workforce Training

GISAE2S Bolton & Menk, Inc.Moore Engineering, Inc.Stantec Consulting ServicesSummit Envirosolutions, Inc.

Greensand PlusCEI-Carbon Enterprises Inc.

Industrial Wireless Data CommunicationsShort Elliott Hendrickson Inc. (SEH)

Inspector/LocatorsPollardwater.com

Land SurveyingAE2S KLJMoore Engineering, Inc.Stantec Consulting ServicesWidseth Smith Nolting

Leak Detection/Correlator Services M.E. Simpson Co., Inc.Water Conservation Services, Inc-Water Leak Detection

Manhole and Catch Basin CastingsESS Brothers & Sons Inc.Ferguson Waterworks

MembranesProgressive Consulting Engineers, Inc. Tonka WaterVan Bergen & Markson, Inc.Vessco, Inc.

Meters/Meter TestingM.E. Simpson Co., Inc.Mid America Meter, Inc

Mixing EquipmentMedora Corporation, home of SolarBee and GridBee brands

Odor Control SolutionsHawkins Water Treatment GroupMedora Corporation, home of SolarBee and GridBee brandsPollardwater.com

Odor & Corrosion ControlVessco, Inc.

Operation ServicesBolton & Menk, Inc.eRPortal Software Group Mid America Meter, IncProfessional Workforce TrainingStantec Consulting Services

Pipe & AppurtenancesAmerican Cast Iron Pipe CompanyHD Supply Waterworks

Pipelines (Steel/Concrete)AECOM

Process MechanicalBrown and CaldwellVan Bergen & Markson, Inc.WSB & Associates, Inc.

When making purchasing decisions about products and services in the wastewater industry throughout Minnesota and beyond, please support the companies whose advertising makes the Breeze magazine possible. You will fi nd them quickly with our convenient, easy to use Buyers’ Guide. On the following pages, you will fi nd information that will help you meet your purchasing requirements throughout the year ahead. The initial section of this Guide lists categories of products and services along with the various companies that can provide them to you. The following section provides an alphabetical listing of those companies, as well as the contact information you will need to reach them.

Breeze Summer 2015 RICH · 2018-04-02 · 6 6 Breeze | Summer 2015 Click HERE to return to Table of...

Documents

Transcript of Breeze Summer 2015 RICH · 2018-04-02 · 6 6 Breeze | Summer 2015 Click HERE to return to Table of...

Inference engine - People @ EECS at UC Berkeleyrussell/slides/chapter... · 1998-11-25 · Breeze Breeze Breeze Breeze Breeze Stench Stench Breeze PIT PIT PIT 1 2 3 4 1 2 3 4 START

DERRERA Gayle (Daughty ...sites.rootsweb.com/~cowcgs/WCMI/Derrera_G.pdf · The Johnstown Breeze The Johnstown Breeze The Johnstown Breeze The Johnstown Breeze The Johnstown Breeze

Instruksjonsmanual VOD issue E - SSWM · ﬂ ushing toilet. A vacuum toilet used 5 - 8 dl. water per ﬂ ush, to keep the bowl clean. There is a valve in the toilet to facilitate

A ﬂ ushing weed control story worth telling. To everyone. Clearfield... · A ﬂ ushing weed control story worth telling. ... control of grassy and broadleaf weeds, ... “We’ve

HPS and LPS - hygromatik.com · 100% • Made only with inert materials • Control system optimized for hygiene • VDI 6022-compliant stand-by ﬂ ushing • Simple modular assembly

Breeze Catalog

Sydney_Cool Breeze

DB KAF S 2.3 en web · 2019-09-16 · HPC1461050/34963-16/TS EN 13445 AD 2000. Brief description A specially shaped ﬂ ushing disk gives rise to an increase in speed between the

California Breeze

Vision - Hydraulic Energy Australia · Large cylinder strip down and testing Accumulator internal and external inspection Pressure testing and ﬂ ushing of bladder and piston accumulators

Linear Algebra - Khoa Toán - Tin Học trường Đại Học …nvthuy/linear-algebra/Sol_Linear...Linear Algebra Jim Hefferon ¡ 2 1 ¢ ¡ 1 3 ¢ fl fl fl fl 1 2 3 1 fl fl

Breeze workflow

Shriram City News Letter - Breeze- 1st September 2019 Breeze/Sep 2019 Breeze/BREEZE... · June 2019 8 Shriram City—News Letter - Breeze- 1st September 2019 SEPTEMBER 2019 BADMINTON

Mynute i 20 20073574 1 - Vokera Ltdcdn0.vokera.co.uk/wp-content/uploads/2014/04/Mynute-i20-i30... · Design principles & operating sequence Page ... 5.8 Final ﬂ ushing of the heating

PF-KIT DIRECIONES is a ˜ushing solvent for Pro-Flushmedia.diversitech.com/doc/DOC32112.pdfATK-1 ATK-1P is a ˜ushing solvent for air conditioning and refrigeration systems, and is

Island Breeze

Breeze FPV Controller 5-ger-DE final - Breeze+FPV+ ...

PowerPoint 프레젠테이션 · 2020. 5. 29. · the breeze portfolio. 7 the breeze portfolio. 8 the breeze portfolio. 9 the breeze portfolio. 10 the breeze portfolio. 11 the breeze

Trekker Breeze

MS11039 OFC OBC - Timothy Seamantimothyseaman.com/images/albums/PDF/Gentle Breeze Beneath the Trees...... 2011, 127 Winter E., Williamsburg, ... Hammered dulcimer, ﬂ ute, harp and