Breeze Summer 2015 RICH · 2018-04-02 · 6 6 Breeze | Summer 2015 Click HERE to return to Table of...

BreezeBreezeBreezeA

me

ric

an

Wat

er

Wo

rks

Ass

oci

atio

n -

MN

Se

cti

on

701

Xe

nia

Ave

nu

e S

ou

th, S

uit

e 6

00,

Min

ne

ap

olis

, Min

ne

sota

55

416

Ad

dre

ss s

erv

ice

req

ue

ste

d

Can Mixing Systems Help Prevent Aging Surface Water?

Natural Organic Matter Removal and Disinfection By-Product Reduction

Water Main Replacement Helps Greater Cincinnati

Issue 162 • Summer 2015

Inside:

The Offi cial Publication of the Minnesota Section of the American Water Works Association

Winona’s Wincrest Water Tank Continues to Perform Well

647 Hale Ave. N, Oakdale, MN 55128 Ph: 651-777-4041 Fax: 651-777-5312 www.engamerica.com

Installed: 2008Tank Type: Composite Elevated TankStorage Capacity: 400,000 GallonsEngineer: Short Elliott HendricksonContractor: Engineering America

PROJECT OVERVIEW:Engineering America crews completed the Wincrest water tower in August 2008 for the city of Winona, Minnesota. The 143-foot-tall structure has a capacity of 400,000 gallons and serves the far southwest quadrant of the city.

A life cycle maintenance analysis studied the cost of painting a welded steel water tower over a 50-year life cycle. City officials awarded the project based on a present worth analysis that showed a substantial savings by using Engineering America’s Aquastore composite glass-fused-to-steel elevated tank.

CASE STUDY

In 1980 we made an innovative promise that Aquastore tanks would never have to be sandblasted or painted. No Aquastore tank has required sandblasting or painting since!

100% Employee-Owned

http://www.engamerica.com

Water professionals agree.

Medora Corporation Dickinson, ND 866-437-8076 www.medoraco.com Brands of Medora Corporation

Medora Corporation helps solve water quality problems and save money.

From California to New York, water operators and engineers trust Medora Corporation

to help reduce operating costs and achieve better compliance in their potable water

systems, wastewater lagoons and lakes. They depend on our electric, solar and

air-powered systems for fast, reliable results. And that’s just the beginning.

Year after year, our customer support and long-term product performance

ensure complete satisfaction.

To read the case studies and learn more, visit medoraco.com/betterwater

POTABLE WATER MIXING Reduce stratification, improve residual, prevent ice buildup

Concord, Massachusetts

WASTEWATER Reduce energy cost, improve nutrient removal, achieve compliance

St. Helens, Oregon

POTABLE WATER THM REMOVAL Achieve compliance

York, New York

LAKES AND RAW WATER Reduce WTP operating costs, control algae, increase hypolimnetic oxygenation

Pagosa Springs, Colorado

http://www.medoraco.com

http://www.medoraco.com/betterwater

FERGUSON.COM/WATERWORKS

The water meter technology race is on. Ferguson Waterworks is out in front.

With advanced metering technology, your business can be more efficient, more profitable and more service orientedthan ever before.

Automated Meter Reading (AMR) and Advanced Metering Infrastructure (AMI) are more than industry buzzwords – they provide a steady flow of valuable data to achieve your business goals, and provide consumers critical understanding of their own usage habits. The result is better business and improved stewardship of our water resources.

IowaSteven Brush

(651) 242-1221

MinnesotaTodd Phillips

(612) 850-9495

http://www.ferguson.com/waterworks

Message from the Chair 6Message from the Director 9Message from the Editor 10Governing Board Highlights 12Industry News 53News & Notes 56Professional Directory 60Ad Index 61

DisclaimerThe ideas, opinions, concepts, procedures, etc. expressed in this publication are those of the individual authors and not necessarily those of the MNAWWA section, its offi cers, general membership, or the editor. The mention of trade names for commercial products does not represent or imply the approval or endorsement of AWWA. This magazine is presented solely for informational purposes.

Minnesota Section American Water Works Association

©2015 Craig Kelman & Associates. All rights reserved. The contents of this publication may not be reproduced in whole or in part without the express consent of the publisher.

Executive Board of Directors

ChairJeff LarsonMarshall Municipal Utilities113 S. 4th StreetMarshall, MN 56258-1223

Vice ChairJim SadlerCity of Maple Grove12800 Arbor Lakes ParkwayMaple Grove, MN 55369

Section Past ChairSteve SchneiderSt. Paul Regional Water Services19000 Rice StreetSt. Paul, MN 55113

AWWA DirectorJon EatonCity of Eagan3419 Coachman PointEagan, MN 55122

AWWA DirectorUma Vempati HDR Engineering 701 Xenia Avenue South, Suite 600Minneapolis, MN 55416

Section Secretary-TreasurerLucas MartinMinnesota Department of HealthP.O. Box64975St. Paul, MN 55164-0975

Assistant Secretary-TreasurerBen FeldmanSt. Paul Regional Water Services1900 Rice StreetSt. Paul, MN 55113

FeaturesTable of Contents

BreezeIssue 162 • Summer 2015

Visit us at www.mnawwa.org

This document is printed on paper certifi ed to the standards of the Forest Stewardship Council® (FSC®).

page 59

Breeze Magazine is published by

Tel: 866-985-9780 Fax: 866-985-9799www.kelmanonline.com

Managing Editor - Scott KelmanDesign/layout - Daniel Goulet

Marketing Manager - Darrell [email protected]

Advertising Co-ordinator - Stefanie Hagidiakow

Evaluation of Water Main Replacement Program Helps Greater Cincinnati 17Can Mixing Systems Help Prevent Aging Surface Water? 25NOM Removal and Disinfection By-Product Reduction 292015 Membership Directory 352015 Buyers’ Guide 49

Departments

http://www.mnawwa.org

http://www.kelmanonline.com

mailto:[email protected]

6 Breeze | Summer 2015 Click HERE to return to Table of Contents6 Breeze | Summer 2015 Click HERE to return to Table of Contents

T he dirt is fl ying and hydrants are fl ushing. It’s a nice change from beating frost and routine water plant

maintenance. The primary reason I became involved with AWWA was assisting others in the Southwest operator schools. After this stint as Chair, it would be nice to get back to that more. Admittedly, part of the reason behind this is selfi sh. This reason is providing a relatively close opportunity for operators to obtain contact hours, take examinations, and not fall asleep. At the time this was written, the Metro and Southwest districts recently had their spring schools. It was reported the Metro school exceeded 250 attendees and the Southwest had 70. This is probably record (or near record) attendance for both. Thank you to the attendees, presenters, vendors, Minnesota Department of Health staff, and those who plan all our district schools.

Message from the Chair

Jeff Larson

Besides operator schools, Minne-sota AWWA offers other opportunities. Some have already happened but there are many yet to come. This list doesn’t include all that happens within the coun-cils and committees. It doesn’t include all the “hard” AWWA resources such as standards and other print or web based material. The events do offer another way for those in the industry to learn and grow.

Water For People• 5K Run/Walk, August 14• Motorcycle Ride, August 15

Midwest Water Utility Management InstituteThe Institute was held March 10-13 at Hamline University and had maximum attendance. About ten years ago I had the opportunity to attend. To this day, it wasthree of the best days I’ve spent at a work-related function.

AWWA Legislative Fly-InThis year’s Fly-In was March 18-19 in Washington, DC. Pat Shea and Bill Schlu-enz represented the Minnesota Section.

Regional Meeting of Section Offi cers (RMSO)The RMSO was April 24-25 in Chicago. The Minnesota Section had four members attending.

Summer Leadership WorkshopThe Leadership Workshop is July 21-24 in Denver. The Minnesota Section will have six members attending.

ACEThe Association’s Annual Conference and Exposition is June 7-10 in Anaheim. This will be the fi rst ACE for me, and, from what I’ve heard, it’s a must at least once. The convention center and hotel are across the street from Disneyland. For some awful reason I told this to my 8- and 10-year old daughters. It’s one of those things you want to retract imme-diately after saying it. They can’t believe ACE isn’t a kid’s event being so close to Disney. Since they can’t go I’m sup-posed to bring something back, “or be served with a side of ketchup.” Whatever that means is not quite certain.

MN AWWA Annual ConferenceI’m saving the best for last. This year it will be September 15 -18 in Duluth. It’s tough to beat Duluth in September. Our Annual Conference has a great loca-tion, facility, events, and presentations. If nothing else, you’ll get to see Mr. Chair publicly speak. That’s what we’ll call it for now. A new tie might be in order. That will make tie number four. After that, the tie quota will be full—one tie per each decade of life. •

Upcoming events

Extensive Experience & Client Service:Advanced & Innovative Treatment

Water Storage Tanks & NACE III Certified Inspection

Custom Renovations

Cost Saving Optimizations

Proficient Planning:Navigating Regulatory & Funding Requirements

Water Distribution System Analysis

Water System Planning Studies

Utility Rate Studies

www.bolton-menk.com | [email protected] Fourteen offices serving the Upper Midwest

DESIGNING FOR A BETTER TOMORROW

YOUR LOCAL WATER & WASTEWATER PROFESSIONALS

http://www.bolton-menk.com


––––––

AIRVAC vacuum sewer systems use smaller diameter pipes and shallower trenches which

reduces excavation and surface restoration resulting in significant cost savings compared to

conventional gravity sewers. The AIRVAC system requires only simple maintenance, is operator

friendly and is completely sealed which eliminates any possibility of infiltration and inflow.

––––––

BILFINGER WATER TECHNOLOGIES [email protected]

AIRVAC VACUUM SEWER SYSTEMS WILL SAVE YOU MONEY

http://www.water.bilfinger.com


8 Breeze | Summer 2015 Click HERE to return to Table of Contents

Thousands of quality water treatment installations since 1956. Represented in Minnesota by Great Northern Environmental.

Customized Systems with Guaranteed Results!

763.559.2837

[email protected]

WWW.TONKAWATER.COM

Main

Email

Great Northern Environmental

651.289.9100 | www.GNENV.com

Tonka Water offers a wide range of customized water treatment solutions

to meet specific application requirements.

Recommendations tailored for your needs and budget!

MembranesIon ExchangeFiltration

Design with community in mind

stantec.com

Helping communities tap into water’s potential

http://www.GNENV.com


http://www.stantec.com

9Summer 2015 | BreezeClick HERE to return to Table of Contents 9Summer 2015 | BreezeClick HERE to return to Table of Contents

Congratulations! With your help, AWWA grew in 2014. The Association had a total membership of 50,173 as of

12/31/2014.The Minnesota Section was a leader

in membership recruitment in 2014 with a 1.3% increase! The Section represents 1.9% of AWWA’s membership, ended the calendar year with a membership count of 955 (850 Individuals, 17 Utilities, and 88 Service Providers), and beat our membership goal…Yea! Only fi ve sections reached their retention goal; unfortunately Minnesota Section missed its goal by two members but still had the fi fth best reten-tion rate.

The Minnesota Section, along with 17 other sections will be recognized and awarded incentive checks for accom-plishing goals at the 2015 Membership Summit, February 4-6 in Denver, CO. •

Message from the Director

Jon EatonMembership challenge

800-437-1146 • www.pollardwater.com

CATALOG 174 COMING S

OON

!SL O

Put our Chemical Feed experts to work for you. We offer competitive pricing and fast shipping anywhere in the world.

Pollardwater is your source for Chemical Feed!

Call Nick at x171 for Tech Support and Free Shipping on Chemical Feed Pumps

r t

http://www.pollardwater.com

http://www.watertank.com


Message from the Editor

Stew’s thoughtsStew Thornley

In early March, a dispute between North St. Paul mayor Mike Kuehn and council member Scott Thorsen almost escalated to the two duking it out in the

parking lot after Kuehn asked Thorsen if he wanted to take it outside.

It’s good to know that Minnesota AWWA is more functional than North St. Paul, at least to the point that I’m not aware of the chair ever saying to the chair-elect, “Wanna take it outside, Bulldog?”

But even without Ali vs. Frazier, Minnesota AWWA meetings are fun and entertaining while being productive. I’ve been on the board a couple times—once as a council chair and the other time as secretary-

treasurer. In terms of the three-hour meetings I’ve attended in my life, these have been among the more enjoyable.

Work gets done, business gets pro-cessed, actions get taken, but, even sans fi sticuffs, a Minnesota AWWA board meet-ing mirrors the pleasure and satisfaction of the overall participation in the organization.

My predecessor as secretary-treasurer, Dave Brown, told a story of a board meet-ing he taped so he could review the pro-ceedings as he wrote the minutes. His wife overheard some of the recording and said, “Wow, you guys have way too much fun.”

Fun and productivity are big parts of everything we do, and Minnesota

AWWA does it as well as anyone or any organization.

I guess this is a call for volunteers, to join or get even more involved in carrying out our mis-sion of providing safe drinking water and having a good time doing it. Whether serving on the board as a trustee or council chair or joining a committee or getting involved in an activity such as the annual Splash Dash, consider exploring the opportunities for participation.

The folks listed on the page with the table of contents will be happy to help you out in fi nding ways to get even more out of your AWWA membership.

Minnesota AWWA—the most fun you can have with your clothes on. •

http://www.essbrothers.com

WWW.KODRU-EQUIPMENT.COM(952) 479-1045

YOUR TRUSTED SOURCE FOR VALVE & ACTUATOR SOLUTIONS

http://www.kodru-equipment.com


Governing Board Highlights

Board meeting highlightsBoard ElectionsThe President-elect candidates were Michael Simpson (Indiana Section and AWWA Vice-President) and Jeanne Ben-nett-Bailey (Virginia Section and AWWA Public Affairs Council Chair).

Jeanne is the Public Affairs Offi cer for Fairfax Water in Fairfax, Va., where she has worked in various capacities since 1981. Jeanne left Fairfax Water in 1999 to spend 2½ years working with AWWA on regulatory affairs, returning to Fairfax Water in 2002 as the Public Affairs Offi cer.

Michael is the CEO of M.E. Simpson Company, Inc. in Valparaiso, Ind. He oversees the company as a whole, con-centrating on fi nancial management and business development.

Both gave thoughtful, compelling speeches; the Board voted Jeanne Ben-nett-Bailey as the next President-elect.

There were ten candidates for four open vice-president positions. The Vice-Presidents elected were Steve Dennis (Cal-Nevada Section), Jon Eaton (Min-nesota Section), Martha Segal (Kentucky/Tennessee Section), and Brian Steglitz (Michigan Section). The elected VPs will join Brenda Lennox (Pacifi c Northwest Section) and Warner Palermo (Portico Section) as AWWA’s vice-presidents.

Three candidates competed for one open Director-At-Large position; the Board elected Sally Mills-Wright (Texas Section).

Congratulations to all!

AWWA Trustee to the Research FoundationEach year, the President-Elect of the American Water Works Association is re-sponsible for appointing or reappointing a trustee to the Water Research Founda-tion’s Board of Trustees. In June 2015, the fi rst term for Paul Rush will expire, and as such, he is eligible for reappoint-ment. Paul has indicated his willingness to serve another term and as such has been reappointed.

AWWA Liaison to the Association of Boards of Certifi cation (ABC)The Association of Boards of Certifi cation (ABC), formed by AWWA and WEF, is an organization through which certifying au-thorities may communicate and cooperate in order to better fulfi ll its responsibility to ensure competence of employees of environmental occupations and laborato-ries. The 2011 Memorandum of Under-standing with ABC states that AWWA will appoint one of its members with experi-ence certifi cation programs to serve as the offi cial liaison between AWWA and ABC for a two-year term, with a three term limit. Laurie Dougherty is currently serving her fi rst term which ends in June 2015 and has indicated her willingness to serve another term.

Section AllotmentsSection Allotments for 2015 are calcu-lated as 18% of the dues received for the period of September 1, 2013 through August 31, 2014. The Minnesota Section collected $168,665 in dues during the period. The 2015 approved allotment will be $30,360.

Section AssessmentsIn order to levy an assessment, 35% of a Section’s membership is required to vote in an assessment “referendum,” with two-thirds of those voting approving the assessment. If an assessment was approved by this method, future changes to the amount of the assessment could be determined by a vote of the Sec-tion’s Board of Trustees rather than of the whole membership.

Michigan and Ohio sections have raised a concern, stating the 35% or greater membership vote with a two-thirds approval could be too high of a threshold to meet. The Association Board will review the assessment approval percentage as part of the 21st Century Membership Model discussion.

Business Plan UpdatesAWWA CEO David LaFrance presented up-dates on various initiatives and where they fi t in the 2015 Business Plan (attached)

The AWWA Staff Business Plan is built upon department business plans (Five-Year Financial Model, International Strategic Plan, Membership Strategic Plan, Convention and Education Plan, Publishing Strategic Plan and the AWWA Tech-nology Roadmap), organized by the strategic objectives found in the AWWA Strategic Plan, and summarizes the actions and goals that will be undertaken in 2015.

AWWA2020: A Path to One AWWA - UpdateA resolution was adopted and approved by the Board in June 2014. The resolution views AWWA is the collective “Association” AND “Section” (“We Are One”). In addition, the resolution presents a vision and general guid-ance of how the association wants to operate in 2020 (the future).

The “Path to One AWWA” is broken into fi ve strategic themes. Each theme was discussed by subject matter commit-tees (SMCs…pronounced “smacks”). Below are the themes and some related programs/ideas.Communication• Timely, meaningful information/feedback

will better align AWWAEducation• EPA Grant (a model for the future – associa-

tion makes and sections deliver content)• Water X – Water Training and Educational

Resource Exchange• Education material inventory• Cost sharing of intellectual property (how

will that work?)Branding• Common logos to make AWWA look alike• Members will know they are connected

with AWWA content• Everyone is united around mission and visionMembership• Members ARE part of the association and

section (“We Are One”)

13Summer 2015 | BreezeClick HERE to return to Table of Contents

GOLDFLO WT® ECOFLO®100 INTEGRITY® STORMWATER UNDERGROUND FITTINGS QUALITY DETENTION

For over 35 years, Prinsco has been developing more than just plastic pipe. We’ve been developing a reputation that’s founded on one simple thing: INTEGRITY. It’s how we design our products, it’s how we treat our customers, it’s how we do business.

Look for our GOLD STRIPE of quality to ensure your pipe has been engineered with integrity.

water management solutions

800.992.1725 | prinsco.comAmanda Peterson | 320.444.7206

US: 9 plants & 6 yards Canada: Winkler, Manitoba & Taber, Alberta

http://www.prinsco.com

http://www.dixonengineering.net


Governing Board Highlights

• Clear and coordinated efforts to gather and retain members

• Membership guide (to be re-launched at the membership summit)

Finance• Resources put to the most effi cient use• Association has a bigger buying power

– can extend this to sections• Conference decorating• Business materials and supplies• Printing• Member management software

The Minnesota Section has completed the branding and strategic plan alignment.

21st Century Membership Model StructureThere was much discussion about the membership structure, its multiple options, and the confusion it creates for people looking to join or think they are members because their employer is either a Service Provider or Utility member. Everyone agreed that simplifying the structure would help but not to move away from the hybrid-membership structure (Individual, Utility, or Service Provider). Additional feedback was provided so a refi ned discussion can take place at June 2015 AWWA Board Meeting.

A little counter to the previous discussion, the Board approved adding an “International Member.” Currently, a member is not defi ned by his or her location of residence or business. Members residing outside of North America have typically represented one to two percent of total membership numbers. That statistic will change as AWWA extends its global focus. The new member designation will allow adjustable dues rates and benefi ts based on business and economic factors (World Bank economic indicators). Growth in new international markets, supported by the appropriate member structure for retention, would provide a greater likelihood of Association growth in terms of both fi nances and member count.

Total Water SolutionsAt the June 2013 AWWA Board meeting, a new strategic plan was adopted that in-cluded the following new strategic objec-tive for AWWA: “Expand the Association’s knowledge resources to include additional drinking water and total water solutions in response to member needs.”

To the Association, this means the development of knowledge resources not only in the core focus area of drinking water but also in the areas of wastewater, water reuse, and storm water. This decision was made because drinking water, wastewater, reuse, and storm water management is very closely linked in today’s world. Many water utilities provide a range of services including drinking water production, wastewater collection/treatment, and storm water management. Treated wastewater and storm water is not only discharged into our drinking water supplies but is also being looked at as a valuable resource on its own – either to supplement an existing water resource portfolio or to supplant a currently unsustainable supply. In addition, reuse water is a viable alternative for many utilities.

Staff continue to promote and monitor key metrics on this relatively new initiative (strategic planning, conferences, resource communities, technical programming, and standards)

India InitiativeUma is currently in India with other execu-tive AWWA staff presenting information on the Association and will write an initiative update in the upcoming Breeze.

Standard and Policy Updates…Twenty-three standards were approved.1. B102 Manganese Greensand for Filters2. B112 Microfi ltration and Ultrafi ltration

Membrane Systems3. B116 Electrodialysis and Ion-

Exchange Membrane Systems4. B305 Anhydrous Ammonia5. B306 Aqua Ammonia (Liquid

Ammonium Hydroxide)

6. B512 Sulfur Dioxide7. C213 Fusion-Bonded Epoxy Coat-

ings and Linings for Steel Water Pipe and Fittings

8. C216 Heat-Shrinkable Cross-Linked Polyolefi n Coatings for Steel Water Pipe and Fittings

9. C229 Fusion-Bonded Polyethylene Coatings for Steel Water Pipe and Fittings

10. C507 Ball Valves, 6 In. Through 60 In. (150 mm through 1,500 mm)

11. C560a Cast Iron Slide Gates12. C606 Grooved and Shouldered Joints13. C700 Cold-Water Meters—Displace-

ment Type, Metal Alloy Main Case14. C701 Cold-Water Meters—Turbine

Type, for Customer Service15. C702 Cold-Water Meters—Com-

pound Type16. C703 Cold-Water Meters—Fire-

Service Type17. C704 Propeller_Type Meters for

Waterworks Applications18. C708 Cold-Water Meters—

Multijet Type19. C710 Cold-Water Meters—

Displacement Type, Plastic Main Case20. C712 Cold-Water Meters—

Singlejet Type21. C713 Cold-Water Meters—

Fluidic-Oscillator Type22. C906 Polyethylene (PD) Pressure

Pipe and Fittings, 4 In. Through 65 In. (100 mm through 1,600 mm), for Waterworks

23. G200 Distribution Systems Operation and Management

Five policy statements were revised and approved.1. Assignment of the Continuing

Education Unit and Professional Development Hour Policy

2. Emergency Preparedness & Security Policy

3. Employee Compensation4. Protecting the Allocation of Surface

Water Reservoir Storage Capacity and Yield for Water Supply Purposes

5. Regional Collaboration by Water Utilities •


Since 1947, Brown and Caldwell

has helped municipal utilities

solve their toughest drinking water

challenges. Advance with us.

Engineers | Scientists | Consultants | Constructors | 100% Environmental | Employee Owned | BrownandCaldwell.com

Master Planning

Water Supply, Distribution and Treatment

Integrated Buried Infrastructure Management

Environmental Compliance

Instrumentation and Control Systems

Business Consulting

Facilities and Energy Optimization

Asset Management

©2013 Brown and Caldwell. All rights reserved. Brown and Caldwell, its logo, illustrations and “essential ingredients” are trademarks of Brown and Caldwell.

WATER ENGINEERING

WASTEWATER ENGINEERING

WATER RESOURCES ENGINEERING

ELECTRICAL ENGINEERING

FINANCIAL SERVICES

ASSET MANAGEMENT

INSTRUMENTATION & CONTROLS

OPERATIONS OPTIMIZATIONwww.ae2s.com

Advanced Engineering and Environmental Services, Inc. (AE2S)

Vision. Value. Passion. Integrity. Relationships. Attitude.

ELEMENTS OF YOUR SUCCESS

http://www.ae2s.com

http://www.brownandcaldwell.com


We represent Siemens Industry Inc. If you need to measure fl ow, level, pressure, temperature or other processes, we can provide solutions for

you applications. Call today to schedule a visit.

Jasper Engineering and Equipment CompanyWe offer a full line of Instrumentation solutions

Jasper Engineering & Equipment Co.700 Hamel Road

Medina, MN 55340Phone: 952-938-6504

Fax: 952-935-7772www.jaspereng.com

DependableAccurate &EXPERIENCEDLeak Detectors

http://www.jaspereng.com


http://www.bergersoncaswell.com

http://www.watermainleaklocator.com


he key goals of an asset management (AM) program are to maintain an acceptable level of service, maximize the useful life of infrastruc-ture, and minimize life-cycle costs. As water utilities implement their AM programs, they are faced with the challenges of rehabilitating and replacing aging water mains. In the process of

addressing these needs, “each utility’s objective is to make these investments at the optimal time for maintaining current service levels and to avoid replacing pipes while the repairs are still cost-effective.” (AWWA, 2012) Thus, two common hurdles these utilities encounter are determining the most cost-effective replacement rate and targeting the appropriate pipes for replacement.

Few water utilities have analytical processes in place that allow them to accurately measure the effectiveness of their water main replacement program (WMRP) to validate or improve upon the decision process by which water mains are selected and prioritized for replacement. Nonetheless, in order to optimize an AM program and ensure adequate ongoing funding, a defensible evaluation of a WMRP’s effectiveness is important. Assessing fail-ure causes, failure trends, risk factors, and impact of replacement

Bo Copeland, PE, Associate, Hazen and Sawyer, Cincinnati, OhioJamie Weinle, EIT, Assistant Engineer, Hazen and Sawyer, Cincinnati, OhioBecky Calder, PE, Senior Engineer, Greater Cincinnati Water Works, Cincinnati, Ohio

efforts can improve understanding of replacement dynamics and better inform decision-making. A well-tuned selection process for water main replacement helps maximize system reliability, mini-mize premature pipe replacements, and reduce life-cycle costs.

“… a crucial responsibility for utility managers now and in the future is to develop the processes to continually improve their understanding of the ‘replacement dynamics’ of their own water systems. Those dynamics should be refl ected in an Asset Management Plan (AMP) and, of course, in a long-term capital investment plan.” (AWWA, 2012)

The GCWW storyThis article reviews the successful effectiveness evaluation that was conducted by Hazen and Sawyer (New York, New York) for Greater Cincinnati Water Works (GCWW), a large water utility with 3,100 miles of water main. GCWW is owned and operated by the city of Cincinnati and serves a population of approximately 1.1 million through 247,000 retail and wholesale customer accounts in fi ve counties within southwest Ohio and northern Kentucky (Figure 1).

Reprinted with permission by the KY/TN AWWA from Straight from the Tap Winter/Spring 2015


The pipes in GCWW’s system are up to 150 years old with an average age of 46 years (Figure 2). GCWW has long recognized the importance of good asset management practices, including an ongoing WMRP, to help reduce occurrences of main failures and to prevent a signifi cant increase in failure rates as pipes age. As such, GCWW has maintained water main failure records and employed a proactive WMRP for 30 years while making a signifi -cant investment in replacement of aging and deteriorating water mains through its WMRP.

GCWW’s process for selecting and prioritizing mains for replacement has evolved since it began an organized, proactive program to replace aging and deteriorating water mains in 1985. Prior to that time, water main replacement was strictly reaction-ary based on emergency water main repairs. Initially, budget constraints limited water main replacement projects to an annual replacement rate around 0.25 percent of the entire distribution system. The goal was to address the worst maintenance prob-lems, usually limited to a few individual streets. In the late 1980s,

Figure 2. GCWW Annual Water Main InstallationFigure 1. GCWW Service Areas

Map Legend

City of Cincinnati (Retail Service Area)

GCWW Retail Service Areas

Wholesale Areas

County Boundaries

as a result of an effort by the mayor and council to restore the condition of the city’s assets, GCWW began to target an annual water main replacement rate of 1 percent. Replacement rates since the early 1990s have averaged slightly below the 1percent goal. Today, the WMRP budget allows GCWW to both react to failures and to actively plan the future of the water distribution system. Projects in the program now are multi-street projects which address more than just maintenance, but can also help with fl ow issues, system upgrades, etc. In the past 10 years, the average replacement rate has been 0.95%; and the 1% goal has been exceeded three times (Figure 3).

Evaluating water main failure ratesFor purposes of evaluating the effectiveness of GCWW’s WMRP, failure rates (including both breaks and leaks) were normalized (to number of failures per 100 miles of pipe) by pipe attributes (such as material, diameter, and installation decade) and by spatial attributes (such as soil corrosiveness and operating pressure) in order to identify failure causes and trends. This allowed GCWW to better understand which factors most infl uence water main fail-ure rates in its system, identify recent failure trends for individual pipe classes, and evaluate the effectiveness of nearly 30 years of water main replacement efforts.

http://www.summite.com


Failure rates from 1985–2003 trended upward (Figure 4). The analysis showed that the failure rates increased substan-tially in 1994, but this is likely due to better record-keeping as an electronic recordkeeping system was implemented and fewer breaks and leaks went unlogged. Except for 2007, which had atypical weather conditions (discussed later), failure rates have been trending downward in the last 10 years (Figure 4) as a result of more aggressive main replacement spending—especially in 2003 and 2004 (Figure 3). Since inception of the WMRP, the average failure rate has been 24 failures per 100 miles of pipe; but failure rates were reduced to 16 or less in 2012 and 2013 (the most recent year for which complete data are currently available), which is in line with the top quartile of comparable large water utilities. (AWWA, 2014) The AWWA Partnership for Safe Water Distribution System Optimization Program goal for a fully optimized distribution system is 15 breaks per 100 miles of pipe annually. (AWWA Partnership for Safe Water, 2011)

The detailed analysis confi rmed information that was already known either intuitively or from previous reviews, but it

Figure 4. GCWW Annual Water Main Failure RatesFigure 3. GCWW Annual Water Main Replacement

also revealed several new discoveries and clarifi ed some prior [mis]understandings about which pipes were failing at the highest rates. Ninety-eight percent of the water main failures in GCWW’s system have been on gray cast iron pipes, which still account for the majority of piping in the system, despite ongoing efforts to replace cast iron with ductile iron piping (Figure 5). Sixty-four percent and 25 percent of failures, respectively, have been on six-inch and eight-inch diameter pipes (Figure 6); and 60 percent of failures have been on pipes with leadite joints. There are at least two reasons for high failure rates associated with leadite joints: “First, leadite has a different coeffi cient of thermal expansion than cast iron and results in additional internal stresses that can ultimately lead to longitudinal splits in the pipe bell. Secondly, the sulfur in the leadite can facilitate pitting corrosion resulting in circumferential breaks on the spigot end of the pipe near the leadite joint. The failure rate in the industry for leadite joint pipe is signifi cantly higher than for lead joint pipe even though the pipe may not be as old.” (American Water Works Service Co., Inc. 2002, p3)

http://www.generalrepair.com


Pipe vintage – not to be confused with ageAn interesting fi nding of the evaluation was that pipe vintage (e.g., decade installed) affects failure rates more than does pipe age. In particular, pipe installed in the 1940s has, on average over the past 30 years, had a signifi cantly-higher failure rate than pipe installed in any other decade. Thus, as the system has aged over the last three decades, the median pipe age at failure (Figure 7), i.e., considering all failures to date, has increased from approxi-mately 48 years to approximately 53 years as a result of very low failure rates in pipes installed over the last fi ve decades (Figure 8).

Another observation of note is the average failure rate of 3.67 failures per 100 miles for pipes installed in the current decade (Figure 8), which is relatively high compared to pipes installed during the previous three decades. This is due to the high failure rate that sometimes occurs right after installation, when failures are typically associated with material defects and poor installa-tion. The same phenomenon occurred in the 1990s with pipe

Figure 5. GCWW System Composition by Water Main Pipe Material Figure 6. GCWW System Composition by Water Main Pipe Size

installed during that decade. This effect is described as the ‘burn-in’ phase by Kleiner and Rajani, who note, “The life cycle of a typical buried pipe is often described by a so-called ‘bathtub curve’ ... [which] often distinguishes between three phases in the life of a pipe. The fi rst phase, also known as the ‘burn-in’ phase ” (Kleiner et al, 2001).

Climatic and environmental impactsClimatic conditions—particularly sustained very-low temperatures or sustained hot, dry weather—were found to have a signifi cant effect on main failure rates. A seasonal trend (Table 1) is clearly evident in the historical failure data. Failures occur most frequently in December, January, February, July, and August. Individual years with very high failure rates can often be attributed to a very cold period in the winter and/or hot, dry weather in the summer. For example, 2007 was atypical with an unusually cold winter and prolonged hot, dry weather in late summer, which resulted

http://www.hydrodesignsinc.com

http://www.backflownews.com


in particularly high failure rates in February, March, September, and October (Table 1). GCWW staff have observed that main failure rates increase dramatically once water temperatures fall below approximately 38–39 degrees Fahrenheit, which occurred in February 2007, when the area experienced three consecutive weeks of average ambient temperatures below 22 degrees Fahr-enheit and again in early 2014. This phenomenon is discussed in a report by American Water Works Service Co., Inc. (American Water Works Service Co., Inc., 2002, p12)

Environmental conditions such as soil corrosiveness and frost potential also affect water main failure rates. Using NRCS soil map shapefi les, corresponding soil attributes were spatially joined to the failure records. As expected, there has been a correla-tion between soil corrosiveness and pipe failure rates. Since the

Figure 8 GCWW Water Main Failure Rates by Pipe Installation DecadeFigure 7. GCWW Pipe Age at Failure

majority of GCWW’s distribution network is located in highly cor-rosive soils, this is particularly disconcerting. However, in the past three years the correlation between failure rates and soil corro-siveness has been decreasing, which is thought to be the result of using polyethylene encasement on all new iron pipe, which has been GCWW’s standard since 1977. Hopefully, this practice will eventually eliminate the correlation between soil corrosiveness and water main failures.

Other fi ndingsFor purposes of this study, failures were classifi ed as either breaks or leaks as follows:• Breaks – Circumferential cracks, longitudinal cracks, bell

cracks, and corrosion holes.• Leaks – Joint leaks due to rusted bolts or failed gaskets/joint

material, leaks at couplings or clamps, and leaks at connec-tions between two pipelines (e.g., tee, tapping sleeve, etc.).

http://www.titanenergy.com


An unexpected fi nding of the study was that water main breaks occur much more frequently than leaks among known failures, with fi ve times as many break records as leak records in recent years. Also, the majority of the failures (greater than 54%) were circumferential or longitudinal cracks, and fewer than 20% of failures were attributed to corrosion (Figure 9).

Although most pipe classes have followed the overall trend of decreasing failure rates, there are some exceptions. Figure 10 shows one example of a community where the failure rate has actually increased in the last couple years.

Recordkeeping and other best practicesThrough this evaluation, the importance of compiling accurate, complete, and consistent records of all pipe failure incidents was very apparent. These records are essential to a proper under-standing of historical failures, risk factors, and the effects of water main replacement efforts. Not only do these records allow a utility

Table 1. GCWW Water Main Failures by Month, Average vs. 2007 Figure 9. GCWW Water Main Failures by Failure Type

to identify and understand the pipe attributes and risk factors that most infl uence pipe failure rates in its system, but they also provide the means by which to analyze the impact of water main replace-ment efforts over an extended period of time. In order to manage the data most effi ciently and ensure maximum usefulness, each failure record should include at least the following information:• Failure date• A unique Failure ID• GPS coordinates• Unique pipe Asset ID (e.g., from GIS or CMMS)• Classifi cation of failure, using standardized terminology• Pipe attributes

Asset, Materials, and Maintenance Management SoftwareeRPortal asset management

http://www.erportalsoftware.com


Some other lessons learned through this evaluation were: 1) water main replacement should not be prioritized based solely on pipe age; 2) do not be misled by the quantity of failures in a certain pipe class, when that pipe class represents a majority of the system—i.e., consider failure rates; and 3) it is important to identify and track all costs for emergency repairs in order to weigh these costs versus the cost of main replacement.

The futureGCWW has already successfully used the results of their WMRP effectiveness evaluation to infl uence their WMRP bud-geting process and refi ne the process by which water mains are targeted and prioritized for replacement. The fi ndings of this study will help maintain ongoing support for the WMRP and im-prove the program’s effi ciency. As budgets allow, future activities to enhance the study may include:• Investigate pipe classes with above-average failure rates.• Investigate pipe classes with a recent increase in failure rate.• Investigate how system and operational changes have im-

pacted failure rates.• Investigate the impacts of pipe rehabilitation on failure rates.• Estimate failure curves for major pipe classes.• Assess risk of failure (i.e., likelihood and consequence) for

individual water mains.• Determine target level(s) of service and key performance

indicators related to main failures and replacement efforts.• Predict long-term water main replacement funding needs.

AcknowledgementsThe authors would like to thank Greater Cincinnati Water Works and its staff (past and present) for their involvement in providing extensive documentation and anecdotal information, as well as compiling and validating copious data, all of which helped to make this study a success.

ReferencesAmerican Water Works Association (AWWA) (2012), Buried

No Longer: Confronting America’s Water Infrastructure Challenge.

AWWA (2014), 2012 Benchmarking: Performance Indicators for Water and Wastewater Utilities: Survey Data and Analyses Report.

AWWA Partnership for Safe Water Distribution Program (2011), Distribution System Optimization Program (Overview).

American Water Works Service Co., Inc. Engineering Dept. (2002), Deteriorating Buried Infrastructure Management Challenges and Strategies.

Kleiner, Y.; Rajani, B. (2001), Comprehensive review of structural deterioration of water mains: statistical models, Urban Water, 3 (2001) 131-150, Elsevier Science Ltd. •

Figure 10. Atypical Water Main Failure Trends for an Example Community

Through a network of 24 offices, KLJ provides integrated engineering, surveying, planning and

environmental services. We have the people and commitment to make a lasting difference in your

community. Learn more about our services and explore career opportunities at kljeng.com

k l j e n g . c o m

http://www.kljeng.com


Municipal Engineering for Greater Minnesota Communities.

WidsethSmithNolting.comAlexandria | Bemidji | Brainerd | Crookston East Grand Forks | Grand Forks | Rochester

Engineering | Architecture | Surveying | Environmental

CLEAN WATER IS EVERYBODY’S BUSINESS.

HR Green has tackled water challenges for over 100 years with a careful business approach at every step of the journey: design, construction, ownership and operation.

TRANSPORTATION | WATER | GOVERNMENTAL SERVICES SENIOR LIVING | ENERGY | LAND DEVELOPMENT

2550 University Ave W, Suite 400N | St. Paul, MNPhone 651.644.4389 | Learn more at HRGreen.com

WATER TREATMENT PLANT UPGRADESMcHenry, Illinois

I

Find us in your town and all over the globe.

There

Here

http://www.widsethsmithnolting.com


http://www.hrgreen.com

http://www.bv.com


I n the past, many water operators thought daily turnover and fluctuation of volume was enough to mix the water in a stor-age tank. Today, research and tests are showing more effort

may be needed to effectively mix storage tank water and improve water quality. Several water tank features can contribute to how effective water is mixed and the rate at which it ages.

A tank’s design, daily use, and location in the system should all be considered when deciding the best action for improv-ing water quality. Tanks with high height to diameter ratio, such as standpipes, are more susceptible to aging surface water because greater water variations can develop among the many layers. As the distance between surface and bottom water increases, more effort is required for the bottom layers to reach the distant top layers. Same thing applies when inlet and outlet pipes are both placed in the bottom ring of a tank: the new incoming water is also the first to exit the tank while surface water is left to continue aging. However, if the inlet pipe is extended to allow over-the-top filling, then surface water can be pushed to the bottom and mixed with incoming water. “Water quality is a significant concern to water distribution

system managers. Disinfection by-product (DBP) formation is largely dependent on reaction time, and it can continue for several days within the distribution system. At the same time, disinfectant residual must be maintained throughout the most remote components of the system to ensure pathogen-free water. Managing the residence time of water within storage tanks is one practice available to minimize water age within the distribution system. Water system managers and engi-neers should consider the need for circulation of water and residence time management within storage tanks during the design phase.” AWWA M42

Although, water quality and circulation are often discussed during the design phase, they are continuing concerns for water

By Erika Henderson, Director of ResearchPittsburg Tank & Tower

operators. Deaths and illnesses occur daily from unhealthy water, and water operators can lose their license to operate a water system if unhealthy water is found in their system. Great responsibility comes with being a water operator and many pride themselves on providing excellent water quality. A popular method for improving water quality is to install a mixing system. Mixing systems can help prevent aging surface water that often leads to stratification, accumulation of disinfectant by-products, water quality loss and ice formation.

StratificationStratification occurs when water has become separated into layers. Layers are arranged according to density, and density differences are created when variations of water temperature or pH exist. The warmer, less dense, older water sits above the cooler, denser, new water coming in creating layers. The incom-ing water stays near the bottom and is also the first to exit the tank if an over-the-top fill has not been installed. The top layer of older water is left to age even further. As water ages, the quality deteriorates and bacterial growth increases. The bacteria may not cause sample problems in the warmer months, but may show up when the older, surface water begins to cool and sink to the bottom in the cooler months.

Water temperature can be checked every five foot during an inspection to help determine whether stratification is a problem. If stratification is an issue, then a mixing system may be needed. Mixing systems should be designed according to the tank’s unique dimensions and needs. Most are designed to take the denser, newer water from the bottom and mixing it with the less dense, warmer surface water. Mixing helps maintain consistent water temperatures and pH levels throughout the tank thus prevent-ing stratification. However, mixing must occur regularly to prevent reoccurring stratification, sample inconsistences and inaccurate disinfection treatment.


Disinfectant By-ProductsDisinfectant decay occurs when chemicals used for disinfection react with other organic material, organisms, and surfaces. These reactions create carcinogenic disinfectant by-products known as Trihalomethanes (TTHMs) and halo-acetic acids (HAAs). By-prod-ucts are present in almost all chlorinated water supplies, but the

key is keeping these levels as low as possible. Mixing systems can help keep these levels low by effectively blending all water with disinfectants increasing the contact time. When disinfectant contact time is increased less chlorine concentration is needed and thus fewer by-products are produced.

Ice FormationMost compounds become denser as they change from a liquid to a solid because the molecules become more tightly packed. But water is most dense at 39.2°F (4° C), and becomes less dense at lower temperatures causing ice to float. Water in a tank is the same and according to NFPA 25, “the temperature of water tanks shall not be less than 40°F (4.4°C).” When temperatures fall below freezing, ice can form on the surface. The ice will con-tinue to expand and get thicker as the water temperature remains below freezing. Ice can cause serious damage to a tank: tank coatings are often damaged, pipes can become clogged, leaks and structural damage can result, and even tank failures have occurred from ice forming in water tanks. “When a tank freezes, one or more of the following conditions

usually results and cause leakage.• Inside overflow or other piping breaks occur. • Ladders or other attachments to the container are pulled out

by ice, making a hole at the point of attachment.• Ice pressure can expand and place hoop stress loads on

the steel and seams, which may cause the tank wall to yield or burst.

• Leaks due to corrosion become apparent.” AWWA M42 Mixing systems can provide regular water circulation to help maintain a consistent water temperature above freezing and prevent the water from separating into layers where dangerous ice can form on the surface and sides of tanks.

Maintaining Water QualityAll tanks should be regularly monitored for mixing efficiency, but tanks with low filling cycles, high volume, or at the end of a water system should be monitored more often. These types of tanks may not only require mixing system upgrades, but may also re-quire more frequent inspections and cleanings to maintain water quality and reduce aging surface water. Mixing systems can help prevent aging surface water, but they must be designed and installed properly to be effective. A reputable tank company with knowledge and experience in these types of upgrades should be contacted to perform the work. For further information on water tanks and mixing systems please contact Don Johnston at 270-748-1343 or [email protected].

ReferencesAmerican Water Works Association, 2013. Steel Water Storage

Tanks. Manual M42 Revised Edition, Chapter 5, Water Quality Issues.

American Water Works Association, 2013. Steel Water Storage Tanks. Manual M42 Revised Edition, Chapter 10, Results of Freezing.

National Fire Protection Association, 2011. Standard for the Inspection, Testing, and Maintenance of Water-Based Fire Protection Systems. NFPA 25 2011 Edition, Section 9.2.4.1. •



Architecture

Aviation Services

Civil Engineering

Community Development

Construction Services

Environmental Services

Planning

Project Funding

Structural Engineering

Surveying

Transportation Services

Water and Wastewater

Water Resources

Offices Located in Brainerd, Duluth,

Grand Rapids, Hutchinson, Mankato,

Minneapolis, Minnetonka, Rochester,

St. Cloud, St. Paul and Virginia.

800.325.2055 • sehinc.com

Engineers | Architects | Planners | Scientists

Building a Better World for All of Us®

wsbeng.com

Building a Legacy

(888) 541-4800

http://www.sehinc.com

http://www.wsbeng.com


24 Hour EmergencyService

651-765-0765interstatepm.com

Interstate Companies

1.855.84KLEAN Des Moines | Mankato | Rogers | Watertown | Sioux Falls

Experience the difference. One call. One experience. One service provider.

Visit Hydro-Klean.comto view our project library and learn

more about the valuable services Hydro-Klean has to offer.

Providing municipal services for water and wastewater utilities for over 30 years.

http://www.nwpeco.com


http://www.cla-val.com

http://www.interstatepm.com




M icrosand ballasted clarifi cation has long been used in drinking water treatment as a means for turbidity and total organic carbon (TOC) removal. However,

further reduction of disinfection by-products (DBPs) has been hampered due to the inability to remove TOC with coagulation, fl occulation, and settling alone. With the addition of powdered activated carbon (PAC) into a pre-contact chamber ahead of the ballasted clarifi cation system, adsorption properties aid in the removal of the natural organic matter (NOM) and in turn

By: Bryan Fincher, Matt Cotton, Jim Daugherty, and Rich Dimassimo

help to meet U.S. Environmental Protection Agency (EPA) limits for DBPs. PAC is an extremely porous material as a result of the activation step, and a single particle can range in size from 1–150 micrometer (μm). A single gram of activated carbon can have a surface area in excess of 500 m2. By recycling the PAC back through the system to an upfront contact tank, versus single pass PAC dosing, further use of the PAC adsorption ca-pacity can be achieved, thus lowering operating costs associ-ated with DBP reduction.

Figure 1. Microsand Ballasted Clarifi cation with PAC Recycle Flow Diagram

Reprinted with permission by the KY/TN AWWA from Straight from the Tap Winter/Spring 2015


Process descriptionThe microsand ballasted clarifi cation system with PAC recycle includes typical coagulation, fl occulation, and settling tanks with the addition of a PAC pre-contact tank upstream of the coagu-lation basin (Figure 1). Within the PAC pre-contact tank, fresh PAC is added at the inlet at a dose of 5–30 milligram/liter (mg/L). Recycled sludge and PAC is also re-injected back to the process in the pre-contact tank which has a hydraulic retention time of 8–10 minutes. The solids content within the pre-contact tank is maintained at 1–2 g/L by controlling the PAC waste rate. After ex-iting the PAC contact tank, fl ow enters the coagulation basin with a retention time of 2–3 minutes. Coagulant is injected into the coagulation basin where rapid mixing is occurring and micro-fl ocs are beginning to form. Flow then enters the fl occulation basin for a retention time of 3–4 minutes. Here, microsand ballast is re-injected back into the process from the hydrocyclone where it was separated from the sludge. A polymer is also added to bind the fl ocs to the ballast in order to aid in settling.

Once leaving the fl occulation basin, fl ow enters the set-tling tank where the ballasted fl oc settle to the bottom and are collected by a scraper mechanism, and clarifi ed water exits the process via lamella settlers and overfl ow weirs. Solids at the bottom of the tank are then extracted through a slurry pump and recirculated to a hydrocyclone that separates the microsand bal-last from the PAC and sludge. The PAC and sludge are sent to a PAC waste tank where a small waste stream is pulled from the waste tank at a rate of roughly 0.1% of the raw water fl ow and the rest of the fl ow is returned to the pre-contact tank. The waste stream will increase or decrease in order to maintain a system solids concentration within the PAC pre-contact tank.

Nashville, TN: Pilot testingPilot testing was conducted in Nashville, TN at the Harpeth Valley Utility District (HVUD) Water Treatment Plant in late 2011. The plant currently has a rated capacity of 51 million gallons per day (mgd). The goals of the pilot testing were to maintain effl uent TOC levels below 1.0 mg/L while reducing DBPs to less than 48 μg/L Trihalomethanes (TTHMs) and less than 36 μg/L Haloacetic Acids (HAA5). Pre-sedimentation basin effl uent served as the water source for the pilot.

The pilot was optimized using different fresh PAC doses rang-ing from 10–30 mg/L. The PAC contact tank total suspended solids (TSS) were monitored and ranged from 1.0–2.0 g/L. Table 1 shows the TOC results observed during the fresh PAC optimi-zation testing. During this portion of testing it was determined that

a target of 15–20 mg/L of fresh PAC would provide the best TOC removal while minimizing operating costs.

Following optimization of the PAC within the system, a 35-day extended run test (Figure 1) was performed as fresh PAC was added to the raw water stream ahead of the pre-contact tank at a dose of 18–19 mg/L. TSS was monitored in the pre-contact chamber with a target value of 1,000 mg/L which served as the system PAC concentration. As fl ow exited the pre-contact tank, Aluminum Chlorohydrate (ACH) was fed at a dose of 18– 7 mg/L as product. A dry anionic polymer was fed into the fl occulation zone of the ballasted clarifi cation system at a dose of 0.30–0.65 mg/L. PAC was recycled back to the pre-contact chamber and used PAC was wasted to maintain the 1,000 mg/L system concentration. Average settled water turbidity was maintained at < 1 nephelometric turbidity units (NTU) while operating at system hydraulic overfl ow rates of 10–16 gpm/sf. Effl uent TOC averaged less than 1.0 mg/L throughout the run.

DBPs were spot sampled throughout the testing. The results (Table 2) showed that the pilot was able to meet the goals set forth of less than 48 μg/L TTHM and less than 36 μg/L HAA5.

HLR (gpm/sf)Fresh PAC

(mg/L)Coagulant

(mg/L)Polymer (mg/L)

TSS (mg/L) PAC Tank

TOC

INF EFF % Rem

15 10 10 0.95 1578 3.18 1.42 55.3

15 15 10 0.95 1371 2.96 1.26 57.4

15 20 10 0.95 1398 2.83 1.04 63.3

15 30 10 0.95 1622 2.85 1.1 61.4

Table 1. Nashville, TN Fresh PAC Optimization

Table 2. Nashville, TN DBP Results

TTHM (μg/L) HAA5 (μg/L)

10/3/2011 12.1 8.17

10/10/2011 6.4 18.3

11/8/2011 3.2 3.43

Figure 2. Nashville, TN Extended Run TOC Results

MMMMMMMMMiiiiiiiiicccccccccrrrrrrrrooooooooosssssssssaaaaaaaaannnnnnnndddddddddd BBBBBBBBBaaaaaaaaallllllllllllllllllaaaaaaaaassssssssstttttttttteeeeeeeeedddddddddd CCCCCCCCCClllllllllaaaaaaaaarrrrrrrriiiiiiiiififififififififificccccccccaaaaaaaaattttttttttiiiiiiiiiooooooooonnnnnnnn wwwwwwwwiiiiiiiiitttttttttthhhhhhhhh PPPPPPPPPooooooooowwwwwwwwddddddddddeeeeeeeeerrrrrrrreeeeeeeeedddddddddd AAAAAAAAAcccccccccttttttttttiiiiiiiiivvvvvvvvaaaaaaaaatttttttttteeeeeeeeedddddddddd CCCCCCCCCCaaaaaaaaarrrrrrrrbbbbbbbbbbooooooooonnnnnnnn


Table 3. Spring Hill, TN Fresh PAC Optimization

HLR (gpm/sf)

Fresh PAC (mg/L)

Coagulant (mg/L)

Polymer (mg/L)

TSS (mg/L) PAC Tank

TOC (mg/L)

INF EFF % Rem

13.1 10 20 0.8 1355 2.50 1.40 44.0

13.1 10 30 0.8 1350 2.50 1.10 56.0

13.1 10 40 0.8 1350 2.50 1.10 56.0

13.1 10 50 0.8 1350 2.50 1.20 52.0

13.1 15 15 0.9 1120 2.20 1.20 45.5

13.1 15 30 0.9 1200 2.20 1.00 54.5

13.1 15 40 0.9 2.20 1.30 40.9

13.1 20 10 0.9 1379 1.80 0.83 53.9

13.1 20 15 0.9 1302 1.90 0.71 62.6

13.1 20 20 0.9 1335 1.80 0.78 56.7

13.1 20 25 0.9 1425 2.10 1.10 47.6

13.1 20 30 0.9 1420 2.00 0.63 68.5

Table 4. Spring Hill, TN DBP Results

(gpm/sf)Fresh PAC

(mg/L)

CoagulantPolymer (mg/L)

TSS (mg/L) PAC Tank

TOC (mg/L)TTHM (μg/L)

HAA5

(μg/L)Type (mg/L) INF EFF % Rem

13.1 20 Ferric 40 mg/L 0.9 1934 2.60 1.10 57.7 12.9 19.0

13.1 20 Ferric 30 mg/L 0.8 1643 2.90 1.10 62.1 19.8 23.3

13.1 20 PACI 40 mg/L 0.8 1394 3.60 1.40 61.1 30.0 32.8

16 20 ACH 10 mg/L 0.8 1032 2.20 1.30 57.7 25.6 25.0

Currently, HVUD is in phase one of a four phase ex-pansion that will provide a 23 mgd microsand ballasted clarification system with PAC recycle ahead of microfiltration (MF) hollow fiber PVDF membranes, with outside-in flow pattern, for removal of TOC and reduction of disinfection by-products. This system is scheduled for commissioning in 2015.

Springhill, TN: Pilot testingPilot testing was conducted in Springhill, Tennessee, at the Springhill Water Treatment Plant in early 2012. The plant currently has a rated capacity of 4 million gallons per day (mgd). The goals of the pilot testing were to improve efflu-ent TOC levels while reducing DBPs to fewer than 80 μg/L Trihalomethanes (TTHMs) and fewer than 60 μg/L Haloace-tic Acids (HAA5). The pilot was operated on plant raw water as well as effluent from an existing pre-sedimentation basin.

The pilot was optimized using different coagulants and fresh PAC doses ranging from 10–20 mg/L. The PAC contact tank total suspended solids (TSS) were monitored and ranged from 1.0–2.0 g/L. Table 3 shows the TOC results observed during the fresh PAC and ferric chloride optimization testing. During this por-tion of testing it was determined that a target of 20 mg/L of fresh PAC would provide the best TOC removal.

During the pilot study, DBPs were spot sampled using dif-ferent coagulants for comparison. The results (Table 4) showed that all coagulants tested were able to meet the goals set forth of fewer than 80 μg/L TTHM and fewer than 60 μg/L HAA5.

Fayette, GA: Pilot TestingPilot testing was conducted in Fayette, GA in mid-2010. The goals of the pilot testing were to improve effluent TOC levels while reducing DBPs to fewer than 80 μg/L Trihalomethanes (TTHMs) and fewer than 60 μg/L Haloacetic Acids (HAA5).

“Microsand ballasted clarification with PAC recycle has been accepted as a drinking water treatment alternative for removing TOC and reducing DBPs.”


The pilot was operated on plant raw water from a nearby res-ervoir. During the pilot, fresh PAC was added to the raw water stream ahead of the pre-contact tank at a dose of 10–30 mg/L. TSS was monitored in the pre-contact chamber with a target value of 1–2 g/L. As fl ow exited the pre-contact tank, aluminum sulfate was fed at a dose of 15–20 mg/L as product. A dry anionic polymer was fed into the fl occulation zone of the bal-lasted clarifi cation system at a dose of 0.60–0.90 mg/L. PAC was recycled back to the pre-contact chamber and used PAC was wasted to maintain a steady system concentration. Average settled water turbidity was maintained at < 1 NTU while operat-ing at system hydraulic overfl ow rates of 10–16 gpm/sf. Testing

was also conducted to compare PAC recycle to single pass dosing and the results can be seen in Table 5 below.

DBP results showed that similar TTHM and HAA levels could be achieved with a lower fresh PAC dose and lower coagulant dose when using the PAC recycle versus a single pass of dosing and wasting.

ConclusionMicrosand ballasted clarifi cation with PAC recycle has been accepted as a drinking water treatment alternative for removing TOC and reducing DBPs. Numerous pilot studies and data confi rm that a ballasted clarifi er with PAC recycle is signifi cantly more effi cient than single pass PAC dosing with respect to overall PAC usage. The pilot data also shows NOM removal capabilities in limiting DBP formations. With the increased utilization of the adsorption capacity of PAC through recycle, signifi cant operational savings can be achieved when trying to reduce DBPs and remove natural organic matter. •

Table 5. Fayette County, GA DBP Results of PAC Single Pass vs. Recycle

PAC SetupFresh PAC

(mg/L)Coagulant

(mg/L)TTHM (μg/L)

HAA5

(μg/L)

Single Pass 20 18 67 56

Recycle 10 15 60 47

MMMMMMMMMiiiiiiiiicccccccccrrrrrrrrooooooooosssssssssaaaaaaaaannnnnnnndddddddddd BBBBBBBBBaaaaaaaaallllllllllllllllllaaaaaaaaassssssssstttttttttteeeeeeeeedddddddddd CCCCCCCCCClllllllllaaaaaaaaarrrrrrrriiiiiiiiififififififififificccccccccaaaaaaaaattttttttttiiiiiiiiiooooooooonnnnnnnn wwwwwwwwiiiiiiiiitttttttttthhhhhhhhh PPPPPPPPPooooooooowwwwwwwwddddddddddeeeeeeeeerrrrrrrreeeeeeeeedddddddddd AAAAAAAAAcccccccccttttttttttiiiiiiiiivvvvvvvvaaaaaaaaatttttttttteeeeeeeeedddddddddd CCCCCCCCCCaaaaaaaaarrrrrrrrbbbbbbbbbbooooooooonnnnnnnn

“Numerous pilot studies and data confi rm that a ballasted clarifi er with PAC recycle is signifi cantly more effi cient than single pass PAC dosing with respect to overall PAC usage.”

water | transportation | municipal | facilities

ApexEngGroup.com

Celebrating four years of different.

If you set the bar at competence,

how do you reach excellence?

http://www.ApexEngGroup.com


Accurate, versatilechemical pumps

[email protected]

R E V O LU T I O N A R Y P E R I S TA LT I C P U M P H E A D

AECOM collaborates with its clients to provide comprehensive water and wastewater solutions to manage, protect and conserve water systems and resources. We provide a blend of global reach, local knowledge, innovation and technical excellence in delivering customized and creative solutions that meet the needs of clients’ projects.

www.aecom.com

CREATING A BETTER TOMORROW

http://www.aecom.com

http://www.vessco.com

http://www.qdospumps.com



Shakopee, MN8050 County Road 101 ast 888.320.4292

PROVEN POWER SOLUTIONS

• Prime, standby and emergency power• Diesel, natural gas and low BTU gas• Mobile and stationary units• Fuel analysis and switchgear maintenance • Emergency services available 24/7/365 • Preventive maintenance programs available on all makes

Sales. Service. Rental.

Hawkins Water TreatmentGroup has been meeting

the requirements ofcommercial, industrial,

municipal and institutionalorganizations since 1938.

Minneapolis612-331-6910

Fargo, ND701-293-9618

Sioux Falls, SD605-368-5793

Superior, WI715-392-5121

Water Treatmentis our Business

Complete Water ServicesWater Supply, Water Treatment, Storage, Distribution, Operations Support

Visit tkda.com or call 800.247.1714 for more information. Saint Paul | Duluth

Innovative & Sustainable

Engineering, Architecture, Planning

http://www.zieglercat.com/power


http://www.tkda.com



3M Corrosion Protection Products

3M Center Bldg 22302S24Saint Paul, MN 55144-1000P: 651-733-3103

ACorey AadalenCity of Red Wing229 Tyler Rd NRed Wing, MN 55066-1826P: [email protected]

Issac AfwerkeCity of Saint Paul Water Utility1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Steven AhlschlagerMoore Engineering, Inc.1808 E Fir Ave Fergus Falls, MN 56537-3974P: 218-998-4041sahlschlager@

mooreengineeringinc.com

Aitkin Public Utilities Comm.120 1st St NWAitkin, MN 56431-1306P: 218-927-3222

Buick AlavyCity of Minneapolis

Water Department4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

Todd AlcottWaterous Company125 Hardman Ave SSouth St Paul, MN 55075-2421P: [email protected]

Alexandria Light & PowerPO Box 609Alexandria, MN 56308-0609P: 320-763-6501

Jaclyn Alm3235 Santa Fe TrlSaint Cloud, MN 56301-9167P: [email protected]

Mike AlmstedMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: 612-673-5600

Richard AltCity of Cottage Grove8635 W Point Douglas Rd SCottage Grove, MN 55016-3318P: 651-458-2842

American Water Works Association

6666 W Quincy AveDenver, CO 80235-3098P: 303-794-7711

Jeff AmyWells Public UtilitiesPO Box 96Wells, MN 56097-0096P: [email protected]

William Anderl3132 Edgewood Ave NCrystal, MN 55427-3019P: [email protected]

Thomas Anderson4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4947Thomas.Anderson@

minneapolismn.gov

Gary Anderson6320 142nd Ln NWRamsey, MN [email protected]

Todd Anderson2826 Mill St NEBemidji, MN 56601-8403P: [email protected]

Scott AndersonCity of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3027

Doug AndersonCity of Hopkins11100 Excelsior BlvdHopkins, MN 55343-3435P: [email protected]

Anita AndersonMinnesota Department of Health11 E Superior St Ste 290Duluth, MN 55802-2225P: [email protected]

Michael AndersonSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Heidi AndristRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: [email protected]

Matt AnfangSaint Paul Board of Water1900 Rice StSaint Paul, MN [email protected]

William AngermanWHKS & Co.2905 S BroadwayRochester, MN 55904-5515P: [email protected]

Michael AppelwickNortheast Technical Services, Inc.PO Box 1142Virginia, MN 55792-1142P: [email protected]

Todd Arlander6188 Rome Cir NWRochester, MN 55901-4846P: [email protected]

Steve ArndtCity of Farmington19650 Municipal DrFarmington, MN 55024-8445P: [email protected]

Marie AsgianMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: [email protected]

Ken AshfeldCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: [email protected]

Justin Attipou7849 Colorado Ave NBrooklyn Park, MN 55443-2926P: 612-661-4949attiogbe.attipou@

minneapolismn.gov

Austin Utilities400 4th St NEAustin, MN 55912-3495P: 507-433-8886

BBabbitt Public Utilities71 South DrBabbitt, MN 55706-1232P: 218-827-3292

Tim BagstadSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Corbin Baker815 Fox CtYoung America, MN 55397-4524P: [email protected]

Tejpal BalaBolton and Menk, Inc.7533 Sunwood Dr NW Ste 206Ramsey, MN 55303-5191P: [email protected]

Bassam BanatMinnesota Dept. of HealthPO Box 64975Saint Paul, MN 55164-0975P: [email protected]

Annika BankstonMN Div of Wtr

Treatment and Dist Srvcs4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4975Annika.bankston@

minneapolismn.gov

Randy BartzCoating Resources Inc.625 St Louis St Ste 12Hopkins, MN 55343-4427P: [email protected]

J. BatesCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707

Matt BauerCarleton College1 N College StNorthfi eld, MN 55057-4044P: [email protected]

Wade BaumbergerMinnesota Pipe & EquipmentPO Box 249Farmington, MN 55024-0249P: [email protected]

Phillip Baxter529 16th Ave NSaint Cloud, MN 56303-3954P: 320-298-2577

Abbie BeaudryAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: [email protected]

Steve BeckelCity of Jackson80 W Ashley StJackson, MN 56143-1669P: 507-847-4410

Harold BeckerDelano Municipal UtilitiesPO Box 65Delano, MN 55328-0065P: [email protected]

Richard Bednar11155 Robinson Dr NWCoon Rapids, MN 55433-3761P: 763-767-6576

James BeemanE. Grand Forks Water Plant801 2nd St NEEast Grand Forks, MN 56721-3100P: [email protected]

Anthony BeldenEngineering America Inc.647 Hale Ave NOakdale, MN 55128-7534P: [email protected]

Doug BendorfStaples Public Works Commission122 6th St NEStaples, MN 56479-2932P: [email protected]

James BenningDuluth Public Works & Utilities520 Garfi eld AveDuluth, MN 55802-2610

Robert BensonCity of Stillwater Water Dept.PO Box 242Stillwater, MN 55082-0242P: [email protected]

Tony BensonRochester Public Utilities4000 E River Rd NERochester, MN [email protected]

Bruce BergSt Paul Regional Water Services1900 Rice StSaint Paul, MN 55113P: [email protected]

Brian BergantineAE2S3101 S Frontage Rd Ste 100Moorhead, MN 56560-2545P: [email protected]

Justin BergersonSt. Cloud Technical College8950 296th Ave NENorth Branch, MN 55056-6452P: [email protected]

Membership DirectoryMN AWWA 2015










































Bob BergsgaardCarbonair1480 County Road C WSaint Paul, MN 55113-3159P: [email protected]

David BerkowitzCity of Andover1685 Crosstown Blvd NWAndover, MN 55304-2612P: [email protected]

Timothy BerquamBergerson Caswell Inc.5115 Industrial StMaple Plain, MN 55359-8610P: 763-479-3121tim.berquam@

bergersoncaswell.com

John BerriganTKDA444 Cedar St Ste 1500Saint Paul, MN 55101-2110P: [email protected]

David BerrymanRodeberg & Berryman, Inc.PO Box 55Montevideo, MN 56265-0055P: [email protected]

Bruce BerthiaumeSt. Louis Park Water Department7305 Oxford StMinneapolis, MN 55426-4512P: [email protected]

Doug Besendorf535 3rd StFrost, MN 56033-6344P: 507-878-3149

Dragoljub BilanovicBemidji State University1500 Birchmont Dr NEBemidji, MN 56601-2600P: [email protected]

Bilfinger Water Technologies1950 Old Highway 8 NWNew Brighton, MN 55112651-638-3134

Josephine Bitzan10185 County Road 12 NWGarfield, MN 56332-8130P: [email protected]

Duane BjellandRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: [email protected]

Dana BjorkCity of Lakeville Water Department20195 Holyoke AveLakeville, MN 55044-8339P: [email protected]

Jeff BlakelyAmerican Cast Iron Pipe Co.21695 Highview AveLakeville, MN 55044-7539P: [email protected]

Nick BleessBlue Earth Light & Water125 E 7th StBlue Earth, MN 56013-2022P: [email protected]

John BlommeMinnesota Department of Health1400 E Lyon St Ste 102Marshall, MN 56258-2504P: [email protected]

Jordan Blommel2100 Morningside Dr NESaint Cloud, MN 56304-9618P: [email protected]

Carol Blommel JohnsonCity of Apple Valley7100 147th St WApple Valley, MN 55124-7519P: [email protected]

Todd BlomstromCity of Apple Valley7100 147th St WApple Valley, MN 55124-6562P: [email protected]

Douglas BodeCity of Waconia310 E 10th StWaconia, MN 55387-4551P: [email protected]

Jim BodeSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Boerger LLC2860 Water Tower PlChanhassen, MN 55317-8004P: 612-435-7300

Brad BoiceCity of EyotaPO Box 328Eyota, MN 55934-0328P: [email protected]

Scott BollerCity of New Brighton700 5th St NWSaint Paul, MN 55112-2724P: [email protected]

Gregory BonaMinneapolis Water Works4300 Marshall St NEFridley, MN 55421-2510P: [email protected]

Jeanette BootheMinnesota Department of Health625 Robert St NSaint Paul, MN 55155-2538P: [email protected]

Charlie BoraohCity of Eagan3419 Coachman PtSaint Paul, MN 55122-1202P: [email protected]

Bradley BordersPO Box 140Sartell, MN 56377-0140P: [email protected]

Luke BotzekSt. Cloud Technical College8170 155th Ave NEFoley, MN 56357-8901P: [email protected]

Adam BourassaSt. Cloud Public Utilities400 2nd St SSaint Cloud, MN 56301-3622

Michael BouthiletCity Of Lake Elmo3800 Laverne Ave NLake Elmo, MN 55042-9699P: [email protected]

Dan BoyceE. Grand Forks

Water & Light DepartmentPO Box 322East Grand Forks, MN 56721-0322P: [email protected]

Darren BraegelmanCity of BelgradePO Box 296Belgrade, MN 56312-0296P: [email protected]

Joel BraegelmanWillmar Municipal Utility704 Litchfield Ave SWWillmar, MN 56201-3111P: 320-235-4422

Brainerd Public UtilitiesPO Box 373Brainerd, MN 56401-0373P: 218-825-3220

Michael BramwellCity of Champlin11955 Champlin DrChamplin, MN 55316-2379P: [email protected]

Katherine Bray9778 170th StMilaca, MN 56353-3447P: [email protected]

Scott BredehoftWonderware Midwest5850 Opus Pkwy Ste 140Minnetonka, MN 55343-4400P: 866-826-9725scott.bredehoft@

wonderwaremidwest.com

Todd BredesenHD Supply Waterworks15800 W 79th StEden Prairie, MN 55344-1894P: [email protected]

Dustin BremnessPlant & Flanged Equipment LLC10101 Xylite St NEMinneapolis, MN 55449-5227P: [email protected]

Matt BrinkMinneapolis Water Works350 S 5th St Ste 203Minneapolis, MN [email protected]

George Brown1427 Heinenhill StNew Ulm, MN 56073-2027P: 785-309-3122

Robert BrownBolton & Menk Inc.1960 Premier DrMankato, MN 56001-5900P: [email protected]

Larry BrownCity of Shorewood5755 Country Club RdExcelsior, MN 55331-8926P: [email protected]

David BrownProgressive Consulting Engineers6120 Earle Brown Dr Ste 629Brooklyn Center, MN 55430-4102P: [email protected]

Terrance BrueckEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: [email protected]

Bernie BullertTKDA444 Cedar St Ste 1500Saint Paul, MN 55101-2110P: [email protected]

Martha BurckhardtSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Michael BurdorfWSB & Associates, Inc.701 Xenia Ave S Ste 300Minneapolis, MN 55416-1030P: [email protected]

Michael BurgdorfCity of Plainview241 W BroadwayPlainview, MN 55964-1253P: 507-534-3701

Steve BurianAE2S4050 Gardenview Dr Ste 200Grand Forks, ND 58201-7215P: [email protected]

Steve BurklundCity of Milaca255 1st St EMilaca, MN 56353-1609P: [email protected]

Scott BurnellMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: [email protected]

Burns & McDonnell Engineering Co. Inc.

9400 Ward PkwyKansas City, MO 64114-3319P: 816-822-3218

Thomas ButhSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Todd ButzTreatment Resources, Inc.11670 Fountains Dr Ste 200Minneapolis, MN 55369-7195P: [email protected]

CRyan CapelleStantec Inc.2335 Highway 36 WSaint Paul, MN 55113-3819P: [email protected]

Wade CardinalThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Jacquelynn CareySt. Paul Water Utility1900 Rice StRoseville, MN 55113-6810P: [email protected]

Mike CarrTherma-Stor, LLC4201 Lien RdMadison, WI 53704-3606P: [email protected]

Peter CartwrightCartwright Consulting Co.8324 16th Ave SMinneapolis, MN 55425-1742P: [email protected]

Chris Catlin2612 Hidden Valley LnStillwater, MN [email protected]

Mona Cavalcoli207 Depew StDumont, NJ 07628-2523P: [email protected]

Karen CavettSEH, Inc.12 Civic Center Plz Ste 2088Mankato, MN 56001-7787P: [email protected]

Qigang ChangAdvanced Engineering and

Environmental Services Inc. (AE2S)3101 S Frontage RdMoorhead, MN 56560P: [email protected]

Bill ChangMSA Professional Services60 Plato Blvd E Ste 140Saint Paul, MN 55107-1835P: [email protected]

B

C






















































http://[email protected]


Che Fei ChenSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Donald CheneySaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

James Chidester4700 Harbor Ln NPlymouth, MN 55446-3440P: [email protected]

Damon ChmelaAdvanced Engineering

& Env. Svcs., Inc.6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: [email protected]

Mark ChristMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: 612-875-1243

Jarrod Christen14879 Woodland DrDetroit Lakes, MN 56501-7407P: 218-846-7778

Paul ChristensenPeopleServicePO Box 94Lester Prairie, MN 55354-0094P: [email protected]

Don ChristiansonMinnesota Rural Water Assn.217 12th Ave SEElbow Lake, MN 56531-4741P: [email protected]

Matthew ChumleyCity of Burnsville13713 Frontier CtBurnsville, MN 55337-4720P: 952-845-4550

City of Albert Lea221 E Clark StAlbert Lea, MN 56007-2421P: 507-377-4378

City of Aurora16 W 2nd Ave NAurora, MN 55705-1389P: 218-229-2624

City of BaxterPO Box 2626Baxter, MN 56425-2626P: 218-454-5115

City of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3071P: 952-563-8774

City of Brooklyn Center Water Dept.

6844 Shingle Creek PkwyBrooklyn Center, MN 55430-1418P: 763-585-7103

City of Brooklyn Park8300 Noble Ave NBrooklyn Park, MN 55443-2400P: 763-315-8412

City of Circle Pines200 Civic Heights CirCircle Pines, MN 55014-1788P: 763-784-5898

City of Cottage Grove8635 W Point Douglas Rd SCottage Grove, MN 55016-3318P: 651-458-2808

City of Crookston Water Department

124 N BroadwayCrookston, MN 56716-1731P: 218-281-5711

City of Detroit LakesPO Box 647Detroit Lakes, MN 56502-0647P: 218-846-7102

City of Eagan3419 Coachman PtEagan, MN 55122-1202P: 651-675-5215

City of Excelsior339 3rd StExcelsior, MN 55331-1809P: 952-474-3464

City of Fergus Falls112 W Washington AveFergus Falls, MN 56537-2568P: 218-332-5435

City of Glencoe1107 11th St E Ste 107Glencoe, MN 55336-2327P: 320-864-6954

City of Golden Valley7800 Golden Valley RdGolden Valley, MN 55427-4508P: 763-593-3981

City of Granite Falls641 Prentice StGranite Falls, MN 56241-1517P: 320-564-2530

City of Hutchinson Water Department

111 Hassan St SEHutchinson, MN 55350-2522P: 320-234-4222

City of Inver Grove Heights8168 Barbara AveInver Grove Heights, MN 55077-3410P: 651-450-2565

City of Lake City205 W Center StLake City, MN 55041-1609P: 651-345-6850

City of Le Sueur- Water/Wastewater

1500 Commerce StLe Sueur, MN 56058-1118P: 507-665-9941

City of Lino Lakes600 Town Center PkwyLino Lakes, MN 55014-1182P: 651-982-2452

City of Little Canada515 Little Canada Rd ELittle Canada, MN 55117-1633P: 651-766-4049

City of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: 763-494-6371

City of Medina2052 County Road 24Medina, MN 55340-9790P: 763-473-4643

City of Monticello505 Walnut St Ste 1Monticello, MN 55362-8822P: 763-271-3274

City of Mound Water Department

2415 Wilshire BlvdMound, MN 55364-1668P: 952-472-0614

City of Northfield801 Washington StNorthfield, MN 55057-2565P: 507-645-3088

City of Paynesville221 Washburne AvePaynesville, MN 56362-1642P: 320-243-3714

City of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707P: 763-509-5999

City of Prior Lake17073 Adelmann St SEPrior Lake, MN 55372-3968P: 952-447-9890

City of Richfield1901 E 66th StRichfield, MN 55423-2711P: 612-221-6170

City of Roseville2660 Civic Center DrSaint Paul, MN 55113-1815P: 651-792-7003

City of S. St. Paul125 3rd Ave N Ste 1South Saint Paul, MN 55075-2097P: 651-554-3210

City of Shoreview4600 Victoria St NShoreview, MN 55126-5817P: 651-490-4651

City of SpicerPO Box 656Spicer, MN 56288-0656P: 320-796-5562

City of St. Francis4058 Saint Francis Blvd NWSaint Francis, MN 55070-9701P: 763-235-2304

City of Waconia310 E 10th StWaconia, MN 55387-4551P: 952-442-2615

City of Warren120 E Bridge AveWarren, MN 56762-1510P: 218-745-5343

City of Waseca508 State St SWaseca, MN 56093-3033P: 507-835-9713

City of Woodbury2301 Tower DrWoodbury, MN 55125-1642P: 651-714-3720

City of WyomingPO Box 188Wyoming, MN 55092-0188P: 651-462-0580

City of Zimmerman12980 Fremont AveZimmerman, MN 55398-9414P: 763-856-4088

Brian Clausen8558 Holland TrlFaribault, MN 55021-7446P: [email protected]

Gary Cline11115 E Desert Vista DrScottsdale, AZ 85255-8063P: [email protected]

Dave CluffAitkin Public Utilities Comm.120 1st St NWAitkin, MN 56431-1395

Michael CoauetteEast Grand Forks Wtr. & Light Dept.1010 5th Ave NEEast Grand Forks, MN 56721-1616P: 218-773-0515

Robert CockrielCity of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3027P: [email protected]

Larry Cole1200 Lakeview Ave SMinneapolis, MN 55416-3631P: 612-374-4362

Gregory CookCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707P: [email protected]

Brandon CoombsAEROMIX Systems, Inc7135 Madison Ave WGolden Valley, MN 55427-3601P: 763-746-9289

Paul CooneCity of Roseville2701 Lexington Ave NRoseville, MN [email protected]

Richard CorbettVessco, Inc.8217 Upland CirChanhassen, MN 55317-9626P: [email protected]

Ramsey Coronado1990 Burns Ave Apt 118Saint Paul, MN [email protected]

Country Enterprises Inc.PO Box 157Lucan, MN 56255-0157P: 507-747-2574

Lynda CowellMountain Lake Water DepartmentPO Box CMountain Lake, MN 56159-0320P: 507-427-2633lyndacowell@

mountainlake.govoffice.com

Patti CraddockShort Elliott Hendrickson3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5108P: [email protected]

Kevin CrooksCity of Chanhassen Utility Dept7901 Park PlChanhassen, MN 55317-9237P: [email protected]

John CrooksShakopee Public Utilites255 Sarazin StShakopee, MN 55379-3942P: [email protected]

Allen CrowserAlexandria Light & PowerPO Box 609Alexandria, MN 56308-0609P: [email protected]

Steve Crumley4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

Marc CulverCity of Roseville2660 Civic Center DrSaint Paul, MN 55113-1899P: [email protected]

Daniel CurleyCity of Shoreview4600 Victoria St NShoreview, MN 55126-5817P: [email protected]

Randolph Czech23857 180th StHutchinson, MN 55350-6618P: 320-234-5617

DJason Dahl1541 Aspen DrSaint Peter, MN 56082-1586P: [email protected]

Dustin DaleAdvanced Engineering &

Enviroment Services, Inc.3101 S Frontage Rd Ste 100Moorhead, MN 56560-2545P: [email protected]

Jeff DaleMinnesota Rural Water Assn.217 12th Ave SEElbow Lake, MN 56531-4741P: [email protected]

C

D


























Bill DaleyLake Crystal Municipal Utils.PO Box 86Lake Crystal, MN 56055-0086P: [email protected]

Jason DarcoThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Peter DavisSaint Paul Regional Water Services8565 Jewell Ave NStillwater, MN 55082-9351P: [email protected]

Thomas DavisTonka Water13305 Water Tower CirPlymouth, MN 55441P: [email protected]

Daniel DawsonCity of St. Augusta1914 250th StSaint Cloud, MN 56301-7706P: [email protected]

James de LambertLiesch Associates, Inc.13400 15th Ave N Ste APlymouth, MN 55441-4532P: [email protected]

Don DebelakLiqTech NA1804 Buerkle RdWhite Bear Lake, MN 55110-5245P: [email protected]

Jeff DegroteCity of CokatoPO Box 1030Cokato, MN 55321-1030P: 320-286-2327

Christopher DeHaan559 246th St SHawley, MN [email protected]

Delano Municipal UtilitiesPO Box 65Delano, MN 55328-0065P: 763-972-0557

John DeMarMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

Harold DesautelPreferred Controls, Inc.PO Box 487Albany, MN 56307-0487P: [email protected]

Dillon DevittSambatek10601 Smetana Rd Apt 109Minnetonka, MN 55343-8000P: [email protected]

Brian DeWolfVessco, Inc.8217 Upland CirChanhassen, MN 55317-9626P: [email protected]

Dezurik, Inc250 Riverside Ave NSartell, MN 56377-2129

Herman DharmarajahBolton & Menk, Inc.1960 Premier DrMankato, MN 56001-5900P: [email protected]

Costa Dimitracopoulos4340 Hemlock Ln NPlymouth, MN 55442-2730P: [email protected]

Bill DircksCity of Little Canada515 Little Canada Rd ELittle Canada, MN 55117-1600P: [email protected]

Dixon Engineering, Inc.1104 3rd AveLake Odessa, MI 48849-1191P: 616-374-3221

Craig Doeden21695 Highview AveLakeville, MN 55044-7539P: [email protected]

William DoughertyMinneapolis Water Works935 5th Ave SEMinneapolis, MN 55414-1205P: 612-673-5600william.dougherty@

minneapolismn.gov

Drew Downhour6441 Barclay AveInver Grove Heights, MN 55077-2165P: 651-238-2465drew.downhour@

wolves.northern.edu

Dennis DoylePublic Utilities CommissionPO Box 658Grand Rapids, MN 55744-0658P: [email protected]

Dennis DuCheneCity of Faribault208 1st Ave NWFaribault, MN 55021-5180P: [email protected]

David DudinskyCity of Wayzata Public Works299 Wayzata Blvd WWayzata, MN 55391-9595P: [email protected]

Duluth Public Works & Utilities520 Garfield AveDuluth, MN 55802-2610P: 218-730-4061

Jennifer Dunn324 Vinewood Ln NPlymouth, MN 55441-5530P: [email protected]

Pat DunnCity of S. St. Paul125 3rd Ave N Ste 1South Saint Paul, MN 55075-2097

Robert DunnCity of Winona Water Department1 Johnson StWinona, MN 55987-3419P: [email protected]

Steven Duvall21655 Weber WayRogers, MN 55374-4516P: [email protected]

Samuel DyrudVan Bergen & Markson9366 Deerwood Ln NMaple Grove, MN 55369-3634P: 763-546-4340

EE. Grand Forks Water & Light801 2nd St NEE Grand Forks, MN 56721-3100P: 218-773-1511

Jon EatonCity of Eagan3419 Coachman PtEagan, MN 55122-1202P: [email protected]

Richard EbertCity of Hutchinson20383 248th CirHutchinson, MN 55350-4147P: [email protected]

Klayton EcklesCity of Woodbury2301 Tower DrWoodbury, MN [email protected]

Ismail EddhiCity of Hopkins11100 Excelsior BlvdHopkins, MN 55343-3435P: 958-298-2885

Ismail EddihiCity of Hopkins11100 Excelsior BlvdHopkins, MN 55343-3435P: [email protected]

Randy EggertKenyon Municipal Utilities709 2nd StKenyon, MN 55946-1339P: [email protected]

Bradley Eilts7910 Guild CtSaint Paul, MN 55124-7678P: [email protected]

Bill EisenmengerCity of WyomingPO Box 188Wyoming, MN 55092-0188P: [email protected]

Craig EldredCity of Waconia310 E 10th StWaconia, MN [email protected]

Joel ElferingWillmar Municipal UtilitiesPO Box 937Willmar, MN 56201-0937P: [email protected]

Ali ElhassanMetropolitan Council390 Robert St NSaint Paul, MN [email protected]

Elk River Municipal UtilitiesPO Box 430Elk River, MN 55330-0430P: 763-441-2020

Matt EllingsonTKDA444 Cedar St Ste 1500Saint Paul, MN 55101-2110P: [email protected]

Todd ElliottCH2M HILL1295 Northland Dr Ste 200Mendota Heights, MN 55120-1380P: [email protected]

Bob ElstonSleepy Eye Public UtilitiesPO Box 408Sleepy Eye, MN 56085-0408P: [email protected]

EMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: 651-639-5600

Steven EmeryWidsith Smith Nolting & Associate1600 Central Ave NEEast Grand Forks, MN 56721-1335P: [email protected]

William EmmersJohnson Screens1950 Old Highway 8 NWNew Brighton, MN 55112P: 651-638-3151william.emmers@

johnsonscreens.com

Gary Englund4554 Ches Mar DrEagan, MN 55123-1868P: [email protected]

Daniel EngstrandEngineered Sales Co.8912 Wentworth Ave SBloomington, MN 55420-2814P: [email protected]

Michael EnstadCity of Granite Falls641 Prentice StGranite Falls, MN 56241-1517P: [email protected]

John Erickson3823 Kipling AveSt Louis Park, MN 55416-4945P: [email protected]

Andy EricksonSt. Anthony Falls Lab, Univ. of MN2 3rd Ave SEMinneapolis, MN 55414-2125P: [email protected]

Robert ErvinMinneapolis Water Works935 5th Ave SEMinneapolis, MN [email protected]

Brenda EschenbacherMinnesota Dept. of HealthPO Box 64975Saint Paul, MN 55164-0975P: [email protected]

Tannie EshenaurMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: [email protected]

Zeke EtukudoMinnesota Department of Health625 Robert St NSaint Paul, MN 55155-2538P: [email protected]

Kent ExnerCity of Hutchinson Water Department111 Hassan St SEHutchinson, MN 55350-2522P: [email protected]

FBenjamin FeldmanSaint Paul Regional Water Services1900 Rice StSaint Paul, MN [email protected]

Benjamin FinneganCDM Smith125 S Wacker Dr Ste 600Chicago, IL 60606-4437P: [email protected]

Colin FitzgeraldSEH3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5118P: [email protected]

Dale FolenMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

Brad ForesterEngineering America, Inc647 Hale Ave NOakdale, MN 55128-7534P: [email protected]

D

E

F






















































James ForslundCity of Minneapolis4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

Richard FottMueller Systems MN 11228 W River RdChamplin, MN [email protected]

Tim FoxMetropolitan Airports Commision6045 28th Ave SMinneapolis, MN 55450-2702P: [email protected]

Mary FralishCity of MankatoPO Box 3368Mankato, MN 56002-3368P: [email protected]

Wayne FrankPO Box 247Lyle, MN 55953-0247P: 507-325-2311

Anthony FranzRick Lake Construction Group22360 County Road 12Deerwood, MN 56444-6113P: 763-229-1172

Douglas Frederickson19 Joy Ave SWMadelia, MN 56062-1105P: [email protected]

Eric FreihammerMinnesota Dept. of Health985 Shady Oak CirMonticello, MN 55362-7907P: [email protected]

John FrielSEH Inc.3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5118P: [email protected]

Matthew FritzeGreat Northern Environmental643 Hale Ave NSaint Paul, MN 55128-7534P: [email protected]

Scott FronekBlack & Veatch7760 France Ave S Ste 1200Minneapolis, MN 55435-3215P: [email protected]

Paul FrostSL-Serco2817 Anthony Ln S Ste 104St Anthony, MN 55418-2489P: [email protected]

Kenneth Funt3851 2nd St NEMinneapolis, MN 55421-3733P: [email protected]

GKristian Gaasland8016 Garfield St NESpring Lake Park, MN 55432-2163P: [email protected]

Jackie GallagherParker Hannifin

Process Filtration Division10531 Cedar Lake Rd Apt 314Minnetonka, MN 55305-3323P: [email protected]

Gary GanserCity of Two Harbors522 1st AveTwo Harbors, MN 55616-1535P: 218-834-5572

Jimmie GatesCity Of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3027P: [email protected]

Steven GatlinCity of Coon Rapids11155 Robinson Dr NWCoon Rapids, MN 55433-3761P: [email protected]

Todd Gatz1460 Highway 1Ely, MN 55731-8207P: [email protected]

Katy GehlerCity of Prior Lake17073 Adelmann St SEPrior Lake, MN [email protected]

Justin GeorgeKLJ Engineering2611 Gabel RdBillings, MT 59102-7329P: [email protected]

Glen GeradsCity of Minneapolis350 S 5th St Ste 203Minneapolis, MN 55415-1355P: [email protected]

Craig GeyerDeZURIK Water Controls250 Riverside Ave NSartell, MN 56377-2129P: [email protected]

Jamal Ghauri1905 43rd Ave SMoorhead, MN 56560-7112P: [email protected]

Joe Gherity1744 Ashland AveSaint Paul, MN 55104-6159P: [email protected]

Nathan GieskeMinnesota Department of Health11 E Superior St Ste 290Duluth, MN [email protected]

Steve GilbergCity of Eagan3419 Coachman PtEagan, MN [email protected]

Gary GileCity of KelloggPO Box 147Kellogg, MN 55945-0147P: [email protected]

Christopher GlassingAMERICAN Cast Iron Pipe Company21695 Highview AveLakeville, MN 55044-7539P: [email protected]

Stephen GleasonSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Gary GleisnerNew Ulm Public Utilities310 1st St NNew Ulm, MN 56073-1675P: [email protected]

Ryan GodfreyTonka Water13305 Water Tower CirPlymouth, MN 55441-3819P: [email protected]

David GoergenCity of Edina7450 Metro BlvdEdina, MN 55439-3037P: [email protected]

David GomanCity of Spring Park4349 Warren AveSpring Park, MN 55384-9711P: [email protected]

Christa Gomez1482 Edmund AveSaint Paul, MN 55104-2409P: [email protected]

Jeremy GosewischShakopee Mdewakanton

Sioux Community2330 Sioux Trl NWPrior Lake, MN 55372-9077P: 952-496-6176jeremy.gosewisch@

shakopeedakota.org

Grand Rapids Public Utilities Commission

PO Box 658Grand Rapids, MN 55744-0658P: 218-326-7024

John Grant3M224 3E 30 3M CtrSaint Paul, MN 55144-1000P: [email protected]

Jerry GrantDezurik, Inc250 Riverside Ave NSartell, MN [email protected]

John GraupmanBolton & Menk, Inc.1960 Premier DrMankato, MN 56001-5900P: [email protected]

James GraupmannSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Scott GravsethE. Grand Forks Water & Light Dept.1010 5th Ave NEEast Grand Forks, MN 56721-1616P: 218-773-0515mswingen@

ci.east-grand-forks.mn.us

William GreggSummit Envirosolutions, Inc1217 Bandana Blvd NSaint Paul, MN 55108-5114P: [email protected]

Stephanie GretschMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: [email protected]

Mike GriebelNew Ulm Public Utilities310 1st St NNew Ulm, MN [email protected]

James GrilloSensus USA, Inc19598 Quinn Cir NWElk River, MN 55330-4113P: [email protected]

Tim GroganTonka Water13305 Water Tower CirPlymouth, MN 55441-3819P: [email protected]

Greg GuerreroDuluth Public Works & Utilities520 Garfield AveDuluth, MN [email protected]

Mark Guisfredi417 W Owatonna StDuluth, MN 55803-1748P: [email protected]

Brian GuldanBolton & Menk, Inc7533 Sunwood Dr NW Ste 206Ramsey, MN [email protected]

Geoff GussMcWane Ductile-Ohio2266 S 6th StCoshocton, OH 43812-8906P: [email protected]

HDaniel HaatsCity of SpicerPO Box 656Spicer, MN 56288-0656P: [email protected]

Matthew HaefnerCity of Chaska660 Victoria DrChaska, MN 55318-1440P: [email protected]

Ronald HagemeierGreen Lake

Sanitary Sewer & Water Dist.14403 138th Ave NESpicer, MN 56288-8501P: [email protected]

David HagenShanopee Public Utilites255 Sarazin StShakopee, MN 55379-3942P: [email protected]

Jay HallSt. Louis Park Water Department7305 Oxford StMinneapolis, MN 55426-4512P: [email protected]

Mark HallanWidseth Smith Nolting Assoc.7804 Industrial Park RdBaxter, MN 56425-8267P: [email protected]

Paul Halvorson5777 Longboat Rd NWRochester, MN 55901-0152P: [email protected]

Mike HamernikCity of Winona1 Johnson StWinona, MN 55987-3419

Abdelsalam HamidSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Steven HamsPO Box 202Red Lake Falls, MN 56750-0202218-253-2267

Kevin HansenCity of Columbia Heights637 38th Ave NEColumbia Heights, MN 55421-3806P: 763-706-3705

Dan HansenCity of Woodbury2301 Tower DrSaint Paul, MN [email protected]

Ray HansonCity of Mound Water Department2415 Wilshire BlvdMound, MN 55364-1668P: [email protected]

F

G

H



























































Mark HansonSt. Louis Park Water Department7305 Oxford StMinneapolis, MN 55426-4512P: [email protected]

Adrian HansonUniversity of Minnesota-DuluthSwenson Civil Eng. BldgDuluth, MN 55812P: [email protected]

Matt HarderTetra TechPO Box 124Mountain Lake, MN 56159P: [email protected]

John Harren27148 County Road 39Freeport, MN 56331-9605P: [email protected]

David HarrisFischer, Harris & Associates5865 Neal Ave NStillwater, MN 55082-2177P: [email protected]

Jay HartmanSt. Anthony Village3301 Silver Lake Rd NE Ste AMinneapolis, MN 55418-1668P: 612-782-3314

Charles HaupertAdvanced Engineering

and Enviromental Services, Inc6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: [email protected]

James HauthCity of Eagan3419 Coachman PtEagan, MN 55122-1202P: [email protected]

Mike HeckerTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: [email protected]

Mike HeimerRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: [email protected]

Jared HellerAdvanced Engineering

and Enviromental Services3170 43rd St S Ste 100Fargo, ND 58104-8908P: [email protected]

Dan HellingCity of Inver Grove Heights8168 Barbara AveInver Grove Heights, MN 55077-3410P: 651-450-2565dhelling@

ci.inver-grove-heights.mn.us

Jack HendricksonDSG4557 15th Ave NFargo, ND 58102-2840P: [email protected]

James HenryHenry’s Waterworks, Inc.510 9th Ave SSauk Rapids, MN 56379-1360P: [email protected]

Cara HesseCity of Buffalo212 Central AveBuffalo, MN 55313-1699P: [email protected]

Tim HewettSt. Cloud Public Utilities400 2nd St SSaint Cloud, MN 56301-3622

Rich HibbardSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Hibbing Public Utility Comm.PO Box 249Hibbing, MN 55746-0249P: 218-262-7725

Matt HillbrandKodru - Mooney3650 N Chestnut St Ste 102Chaska, MN 55318-3045P: [email protected]

Tim HillesheimCity of Lino Lakes600 Town Center PkwyLino Lakes, MN 55014-1182P: [email protected]

Jason HillmanMarshall & Polk

Rural Water System401 N Main StWarren, MN [email protected]

Joseph HillstromShakopee Public UtilitiesPO Box 470Shakopee, MN 55379-0470P: [email protected]

Kyle HinrichsCity of Mankato109 Jade LnMankato, MN 56001-6846P: [email protected]

Robert HintgenCity Of Richfield1901 E 66th StRichfield, MN 55423-2711P: [email protected]

Phu Hoang7740 Carnelian LnEden Prairie, MN 55346-4347P: [email protected]

Joseph HobanDixon Engineering, Inc.845 Terrace AveMenasha, WI 54952-1438P: [email protected]

Tracy HodelSt. Cloud Public Utilities400 2nd St SSaint Cloud, MN 56301-3622P: [email protected]

Robyn Hoerr10641 184th Ct NWElk River, MN 55330-6106P: [email protected]

Paul HoeschenCity of Cold Spring27 Red River Ave SCold Spring, MN 56320-2536P: 320-685-3524phoeschen@

coldspring.govoffice.com

Joe HoffmanPreston Public Utilities CommissionPO Box 657Preston, MN 55965-0657P: [email protected]

David HollandDalton Scientific Inc.7567 Debbie LnEden Prairie, MN 55346-4004P: [email protected]

C. HolterCity of Onalaska415 Main StOnalaska, WI 54650-2953P: [email protected]

Michael HolwegerCity of East Grand Forks

Water & Light Dept.1010 5th Ave NEEast Grand Forks, MN 56721-1616P: 218-773-0515

Dave HorvathCity of Zimmerman12980 Fremont AveZimmerman, MN 55398-9414P: [email protected]

Jeffery Hovlid5583 Jefferson Ave SWHoward Lake, MN 55349-5009P: 320-543-2024

Deborah Howard-RyburnAe2s6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: [email protected]

Mike HowellBilfinger Water Technologies1950 Old Highway 8 NWNew Brighton, MN 55112P: [email protected]

Raymond HozalskiUniversity of Minnesota500 Pillsbury Dr SEMinneapolis, MN 55455-0233P: [email protected]

Ruth HubbardMinnesota Rural Water Association217 12th Ave SEElbow Lake, MN 56531-4741P: [email protected]

John HudakHydro Designs, Inc.5700 Crooks Rd Ste 100Troy, MI 48098-2826P: [email protected]

David HumeLeggette, Brashears & Graham Inc.8 Pine Tree Dr Ste 250Saint Paul, MN 55112-3781P: [email protected]

Henry HuntLayne Christensen -

Ranney Collector Wells6360 Huntley RdColumbus, OH 43229-1008P: [email protected]

Renee HusetSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Binh HuynhSPRWS1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Indian Health Service - Bemidji Area DSFC

522 Minnesota Ave Fed Bldg Rm 216Bemidji, MN 56601P: 218-444-0502

IRobert IsabelCDM Smith Inc.7650 Currell Blvd Ste 300Saint Paul, MN 55125-8209P: [email protected]

JAnton Jachim3M3M Center # 201Saint Paul, MN 55144-1001P: [email protected]

Steve JacksonCity of Onalaska415 Main StOnalaska, WI 54650-2953P: [email protected]

Verne JacobsenTKDA332 Summit AveSaint Paul, MN 55102-2124P: [email protected]

Howard JacobsonCity of Duluth520 Garfield AveDuluth, MN 55802-2610P: [email protected]

Kelley JanesCity of Golden Valley7800 Golden Valley RdGolden Valley, MN 55427-4508P: [email protected]

Sunidh Jani3M Company3M Center Bldg 22302S24Saint Paul, MN [email protected]

Daniel JanishCity of Rogers Public Works22350 S Diamond Lake RdRogers, MN 55374-4773P: [email protected]

Loren JansonCity of Duluth Pub. Wks. & Utilities8130 Congdon BlvdDuluth, MN 55804-3138P: 218-730-4160

Scott JensenCity of Lake City205 W Center StLake City, MN 55041-1609P: [email protected]

Cory JensenCountry Enterprises Inc.PO Box 157Lucan, MN 56255-0157P: [email protected]

Karen JensenHawkins, Inc.2381 RosegateRoseville, MN 55113-2625P: [email protected]

Miles JensenShort-Elliott-Hendrickson, Inc.3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5108P: [email protected]

2Adam JirakCity of Medford4645 Halstad AveWebster, MN 55088-2019P: [email protected]

Wayne Johnson10339 150th Ave SESaint Hilaire, MN 56754-9756P: [email protected]

Gregory Johnson5655 Newell Cir NStillwater, MN 55082-5493P: [email protected]

Randie JohnsonCity of East Grand Forks/

Water & Light Dept.801 2nd St NEEast Grand Forks, MN 56721-3100P: [email protected]

H

I

J

























































Todd JohnsonMinnesota Department of Health705 5th St NW Ste ABemidji, MN 56601-2933P: [email protected]

Ronnie JohnsonOwatonna Public UtilitiesPO Box 800Owatonna, MN 55060-0800P: [email protected]

Cary JohnsonRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: [email protected]

Kurt JohnsonStantec3616 Oak Creek TerVadnais Heights, MN 55127-7034P: [email protected]

Wayne JohnsonThe Ford Meter Box Co., Inc.13685 Couchtown AveRosemount, MN 55068-4711P: [email protected]

Bo JohnstonBlack & Veatch7760 France Ave S Ste 1200Minneapolis, MN 55435-3215P: [email protected]

Kathryn JonesHDR Engineering, Inc.701 Xenia Ave S Ste 600Minneapolis, MN 55416-3636P: [email protected]

Kory JorgensenCity of Fridley11877 Alder St NWMinneapolis, MN 55448-2427P: 763-572-3546

Todd JorgensonAustin Utilities400 4th St NEAustin, MN 55912-3495P: [email protected]

Ben JulsonAE2S3101 Frontage Road SMoorhead, MN 56560P: [email protected]

KNancy KadrlikMinnesota Department of Health625 Robert St NSaint Paul, MN 55155-2538P: [email protected]

Richard KakachCity of Golden Valley7800 Golden Valley RdGolden Valley, MN 55427-4508P: [email protected]

Timothy KampaCity of Bloomington Utilities1700 W 98th StBloomington, MN 55431-2501P: [email protected]

Steve KariTonka Water13305 Water Tower CirPlymouth, MN 55441-3819P: [email protected]

John KarwackiSambatek, Inc.12800 Whitewater Dr Ste 300Minnetonka, MN 55343-9347P: [email protected]

Sophie Kasahara9049 Kell Ave SBloomington, MN 55437-1807P: [email protected]

Sreerama Murthy Kasi Somayajula

Moore Engineering925 10th Ave EWest Fargo, ND 58078-5211P: [email protected]

Carol KaszynskiCity of Bloomington1700 W 98th StMinneapolis, MN 55431-2501P: [email protected]

Chad Katzenberger416 S 6th St Ste 200Brainerd, MN 56401-3580P: [email protected]

Kevin KawlewskiWSB & Associates, Inc.701 Xenia Ave S Ste 300Minneapolis, MN 55416-1030P: [email protected]

Kyle KedrowskiMinnesota Rural Water Association216 12th Ave SEElbow Lake, MN 56531-4737P: [email protected]

Karl KeelCity of Bloomington1800 W Old Shakopee RdMinneapolis, MN 55431-3027P: [email protected]

Jack KegelMinnesota Municipal

Utilities Association3025 Harbor Ln N Ste 400Plymouth, MN 55447-5142P: [email protected]

Andrew KegleyCity of Oak Park Heights14168 Oak Park BlvdOak Park Heights, MN 55082-6476P: [email protected]

Travis Keller17436 85th St SWBecker, MN 55308P: [email protected]

Thomas KellerHawkins Water Treatment Group2381 RosegateRoseville, MN 55113-2625P: [email protected]

Pat KellyCity of Crookston124 N BroadwayCrookston, MN 56716-1731P: [email protected]

Shawn KellyCity of Int’L Falls600 4th StIntl Falls, MN 56649-2442P: 218-283-2990

Scott KetchmarkPrescott Water Operations1481 Sundog Ranch RdPrescott, AZ 86301-5507P: [email protected]

Mary KimlingerUponor5925 148th St WApple Valley, MN 55124-8197P: [email protected]

Kinetrol USA, Inc.1085 Ohio DrPlano, TX 75093-5320P: 972-835-7917

Richard KittelsonBlooming Prairie Public Utils.PO Box 55Blooming Prairie, MN 55917-0055P: [email protected]

Kent KjellbergKjellberg’s, Incorporated1000 Kjellberg Park WMonticello, MN 55362-9139P: 763-295-2931

Douglas Klamerus14264 Cosette Ln NHugo, MN 55038-4424P: [email protected]

Kathryn KlarichBarr Engineering Co.850 Washington Ave SE Apt 309Minneapolis, MN 55414-3070P: [email protected]

Michael KlimersCity of Savage Utilities Services13770 Dakota AveSavage, MN 55378-4431P: [email protected]

Wade KlingspornVermillion College1900 E Camp StEly, MN 55731-1996P: [email protected]

Randy KloepperCity of Crystal4141 Douglas Dr NCrystal, MN 55422-1609P: [email protected]

Robert Klug21544 Nebish Rd NEBlackduck, MN 56630-5196P: [email protected]

Kristofer KnutsonMoorhead Public ServicePO Box 779Moorhead, MN 56561-0779P: [email protected]

Charles KocourekMinneapolis Water Treatment &

Distribution Services4500 Marshall St NEFridley, MN 55421-2508P: 612-799-0895charlie.kocourek@

minneapolismn.gov

Jennifer KoenigMinnesota Rural Water Assn.217 12th Ave SEElbow Lake, MN 56531-4741P: [email protected]

Jim KoepLakefield Public UtilitiesPO Box 1023Lakefield, MN [email protected]

Curt KoivistoBabbitt Public Utilities71 South DrBabbitt, MN 55706-1232P: [email protected]

Tim KosekCity of Howard LakePO Box 736Howard Lake, MN 55349-0736P: 320-543-2318

Larry KoshireRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1605

Jason KosmatkaAE2S3101 S Frontage Rd Ste 100Moorhead, MN 56560-2545P: [email protected]

Brian KraabelCity of Andover1685 Crosstown Blvd NWAndover, MN 55304-2612P: [email protected]

Adam Kramer5464 Needham Ave NESaint Michael, MN 55376-8602P: [email protected]

George KraynickMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 412-331-4723george.kraynick@

minneapolismn.gov

Teresa KreckowMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 763-432-3301Teresa.Kreckow@

minneapolismn.gov

Raymond Kristiansen624 University Dr SSaint Cloud, MN 56301-5301P: [email protected]

Joseph KroeningMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4989joseph.kroening@

minneapolismn.gov

Herbert Krueger5766 County 12 BlvdKenyon, MN 55946-4015P: 507-964-2231

Sidney KrugerDeZurik, Inc.250 Riverside Ave NSartell, MN 56377-2129P: [email protected]

Ben KuchtaPlant & Flanged Equipment Co.10101 Xylite St NEMinneapolis, MN 55449-5227P: [email protected]

Paul Kuhn18042 62nd Ave NMaple Grove, MN 55311-4681P: [email protected]

LAlan LaisCity of Luverne305 E Luverne StLuverne, MN 56156-1611P: [email protected]

Lake Crystal Municipal Utilities

PO Box 86Lake Crystal, MN 56055-0086P: 507-726-2536

Lakefield Public UtilitiesPO Box 1023Lakefield, MN 56150-1023P: 507-662-5457

Bill LalondeCity of Richfield6700 Portland AveRichfield, MN 55423-2560P: 612-861-9165

Allen Lamm45200 Jeremy DrNew Ulm, MN 56073-5501P: [email protected]

Andrew Landman720 Main StCold Spring, MN 56320-2152P: [email protected]

J

K

L























































Craig LangbehnRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414

Kelly Lange-HaiderDow Water & Process Solutions7600 Metro BlvdMinneapolis, MN 55439-3048P: [email protected]

Timothy LaPara11137 Nassau Cir NEBlaine, MN 55449-5488P: [email protected]

John Lapointe4412 Drew Ave NRobbinsdale, MN [email protected]

Kim LarsenMinnesota Department of Health3333 W Division St Ste 212Saint Cloud, MN 56301-4557P: [email protected]

Larry LarsenSaint Paul Regional Water Services1900 Rice StSaint Paul, MN [email protected]

Stephen Larson456 2nd St NBayport, MN 55003-1021P: [email protected]

Jeff LarsonMarshall Municipal Utilities113 S 4th StMarshall, MN 56258-1223P: [email protected]

Christopher LarsonSEH, Inc.3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5118P: [email protected]

John LaumannSt. Louis Park Water Department7305 Oxford StMinneapolis, MN 55426-4512P: [email protected]

Richard LavellCity of Circle Pines200 Civic Heights CirCircle Pines, MN 55014-1788P: [email protected]

Jeff LedinShort Elliott Hendrickson416 S 6th St Ste 200Brainerd, MN 56401-3580P: [email protected]

Matthew Lee1115 6th Ave NEDilworth, MN 56529-1536P: [email protected]

Brian LeMonBarr Engineering Company4700 W 77th St Ste 200Minneapolis, MN 55435-4820P: [email protected]

Randy LeppalaAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: [email protected]

Corey LerbsTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: [email protected]

A.W. Libke250 Riverside Ave NSartell, MN [email protected]

Mike LienCity of Hutchinson440 School Rd NWHutchinson, MN 55350-1406

Liesch Associates - A Terracon Company

13400 15th Ave NPlymouth, MN 55441-4532P: 763-489-3100

Lincoln Pipestone Rural WaterPO Box 188Lake Benton, MN 56149-0188P: 507-368-4248

Alison LingBarr Engineering4700 W 77th St Ste 200Minneapolis, MN [email protected]

Krystal Lingofelt1390 Broadway St WCold Spring, MN 56320-4802P: [email protected]

LiqTech NA1804 Buerkle RdWhite Bear Lake, MN 55110-5245P: 651-773-5850

Litchfield Water Department126 N Marshall AveLitchfield, MN 55355-2110P: 320-593-4400

Little FallsPO Box 244Little Falls, MN 56345-0244P: 320-616-5500

Bin Liu13025 Dahlia Cir Apt 314Eden Prairie, MN 55344-7637P: [email protected]

James Long2468 E Catalina DrSalt Lake City, UT 84121-3911P: [email protected]

Steven LorbachSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Gena LoudenMoorhead Public ServicePO Box 779Moorhead, MN 56561-0779P: [email protected]

Douglas LubbenCH2M HILL1295 Northland Dr Ste 200Mendota Heights, MN 55120-1373P: [email protected]

Corey LubovichHibbing Public Utilities1902 6th Ave EHibbing, MN 55746-1663P: [email protected]

Richard LuckowCity of Brooklyn Park8300 Noble Ave NBrooklyn Park, MN [email protected]

Jerome LuddenSt Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Dolly LuddenSt. Paul Regional Water1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Justin Lueck1226 Woodlawn Acres DrSaint Cloud, MN 56301-9525P: [email protected]

Shane LundCity of St. Cloud400 2nd St SSaint Cloud, MN 56301-3622P: [email protected]

Russ LupkesCity of Richfield6221 Portland AveRichfield, MN 55423-2560P: [email protected]

Noel LutseyAnoka Technical College1355 W Highway 10Anoka, MN 55303-1590P: [email protected]

Amy LynchMinnesota Department of Health12 Civic Center Plz Ste 2105Mankato, MN 56001-7789P: [email protected]

Seth LynneApex Engineering Group4733 Amber Valley Parkway SouthFargo, ND 58104-8647P: [email protected]

MM.E. Simpson Company, Inc.3406 Enterprise AveValparaiso, IN 46383-6953P: 800-255-1521

Ben MaUniversity Of Minnesota420 Delaware St SEMinneapolis, MN 55455-0341P: [email protected]

Mark MachacekTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: [email protected]

Shelly MaguireSJE RhombusPO Box 1708Detroit Lakes, MN 56502-1708P: [email protected]

Charlie MahadyTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: [email protected]

Gerald Mahon901 Heritage Dr Apt 306Sartell, MN 56377-4789P: [email protected]

Danica MaierPVS Chemicals32391 N Cambridge DrFraser, MI 48026-2333P: [email protected]

Patrick MalayQuality Flow Systems, Inc.800 6th St NWNew Prague, MN 56071-1148P: [email protected]

Brian MalmBolton & Menk, Inc.2778 Commerce Dr NW Ste CRochester, MN 55901-2262P: [email protected]

Jim MaloneCity of Minnetonka11522 Minnetonka BlvdHopkins, MN 55305-4370P: [email protected]

Mark MaloneyCity of Shoreview4600 Victoria St NShoreview, MN 55126-5817P: [email protected]

Douglas Mandy2545 Bobolink RdLong Lake, MN 55356-9265P: [email protected]

Mankato UtilitiesPO Box 3368Mankato, MN 56002-3368P: 507-387-8624

Richard MannTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: [email protected]

Pat MarinelloThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Adam MarkosBlack & Veatch7760 France Ave S Ste 1200Minneapolis, MN 55435-3215P: [email protected]

Michael MarshCity of Brooklyn Center Water Dept6844 Shingle Creek PkwyBrooklyn Center, MN [email protected]

Marshall & Polk Rural Water System

401 N Main StWarren, MN 56762-1119P: 218-745-5471

Marshall Municipal Utilities113 S 4th StMarshall, MN 56258-1223P: 507-537-7005

Brent MarsolekSaint Pual Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Dennis MartensonSelf-Employed100 Clydesdale Trl Apt 225Medina, MN 55340-4581P: [email protected]

Lucas Martin4618 1/2 Penkwe WaySaint Paul, MN 55122-3718P: [email protected]

Brent Massmann7197 Cambridge RdShakopee, MN 55379-7014P: [email protected]

Master Electric CO.8555 W 123rd StSavage, MN 55378-1150P: 952-201-3043

Kevin MasteyCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707

Kyle MattsonNYM Public WorksPO Box HNew York Mills, MN 56567-0368P: [email protected]

Richard MaurisCity of Winnebago463 2nd Ave SWWinnebago, MN 56098-2036P: [email protected]

Ross Mayer3618 Rainbow DrMinnetonka, MN 55345-1035P: 952-476-6642

Ronald McCabeMinnesota Pipe & Equipment5145 211th St WFarmington, MN 55024-8919P: [email protected]

L

M
























































Lauren McClanahanCity of Columbia Heights637 38th Ave NEColumbia Hts, MN 55421-3806P: 763-706-3700

Danette McCulleyMinneapolis Water Works350 S 5th St Ste 203Minneapolis, MN 55415-1355

Steve McCuskeyHach Company9268 Queensland Ln NMaplegrove, MN 55311-4444P: [email protected]

Marc McDanielW.W. Goetsch Associates, Inc.5250 W 74th StEdina, MN 55439-2227P: [email protected]

Greg McGillisLittle FallsPO Box 244Little Falls, MN [email protected]

Dan McGrane1197 Dawn LnSaint Paul, MN 55125-8507P: 952-890-3811

Clifford McLain2710 17th St SMoorhead, MN 56560-4807P: [email protected]

Gary McLarenHydro Designs, Inc.2665 S Moorland Rd Ste 209New Berlin, WI 53151-2900P: [email protected]

Michael McNabbBadger Meter12916 2nd Ave SBurnsville, MN [email protected]

Bob McNuttCLOW12735 24th Ave NPlymouth, MN 55441-3946P: [email protected]

MDOT395 John Ireland BlvdSaint Paul, MN 55155-1800P: 651-366-3567

Merle MeeceCity of PerhamPO Box 130Perham, MN 56573-0130P: [email protected]

Kelly MeighanEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: [email protected]

Duane MelizaCity of Dundas213 Railway St SDundas, MN 55019-4014P: [email protected]

Amy MellCity of RushPO Box 556Rush City, MN 55069-0556P: [email protected]

David MendelSt. Cloud Public Utilities400 2nd St SSaint Cloud, MN [email protected]

Steven MerenessMetering & Technology Solutions11551 Rupp DrBurnsville, MN 55337-1248P: [email protected]

Ron MergenCity of Paynesville221 Washburne AvePaynesville, MN 56362-1697P: [email protected]

Scott MerkleyCity of St. Louis Park7305 Oxford StSaint Louis Park, MN 55426-4512P: [email protected]

Thomas MettlerWaterous Company125 Hardman Ave SSouth St Paul, MN 55075-2456P: [email protected]

Gary MetzlerVan Bergen & Markson, Inc.9366 Deerwood Ln NMaple Grove, MN 55369-3634P: [email protected]

Grant MeyerAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: [email protected]

George MihelichBois Forte Lake

Vermilian Reservation1342 Tibbetts TrlTower, MN 55790-8168P: [email protected]

Hanna Miller2076 Como Ave Apt 4Saint Paul, MN 55108-2026P: [email protected]

James MillerFoth I&E, LLC300 Douglas DrBuffalo, MN 55313-9239P: [email protected]

Minneapolis Water Works350 S 5th St Ste 203Minneapolis, MN 55415-1355P: 612-673-2418

Minnesota Department of Health

PO Box 64975Saint Paul, MN 55164-0975P: 651-201-4679

Gregory MitzigaKittson-Marshall Rural Water, Inc.410 Commercial StDonaldson, MN 56720-9998P: [email protected]

Martin MoegleinThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: [email protected]

Nicole Mohapp2179 Stewart AveSaint Paul, MN 55116-3148P: [email protected]

Joseph MomsenCity of Vadnais Heights800 County Road E EVadnais Heights, MN 55127-7117P: [email protected]

Matthew MontgomeryTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: [email protected]

Eric MooreCity of Hutchinson Water Department1300 Adams St SEHutchinson, MN 55350-7009P: [email protected]

Michael MooreCopperhead Industries, LLCPO Box 1081Monticello, MN 55362-1081P: [email protected]

Moorhead Public ServicePO Box 779Moorhead, MN 56561-0779P: 218-299-5400

Shannon MortensonCity of Warren120 E Bridge AveWarren, MN 56762-1510P: [email protected]

Gayle MoserSaint Paul Regional Water Service1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Adam MoultonMinnesota Pipe & Equipment5145 211th St WFarmington, MN 55024-8919P: [email protected]

Pete MoultonSt. Peter Public Works405 Saint Julien StSaint Peter, MN 56082-1874P: [email protected]

Mountain Lake Water Department

PO Box CMountain Lake, MN 56159-0320P: 507-427-2633

Shawn MulhernKLM Engineering, Inc.PO Box 897Lake Elmo, MN 55042-0497P: [email protected]

Linda MullenCity of Burnsville13713 Frontier CtBurnsville, MN 55337P: [email protected]

Joseph MunnCity of Crookston Water

Department124 N BroadwayCrookston, MN 56716-1731P: [email protected]

Anna MunsonBlack & Veatch12632 Dover DrApple Valley, MN 55124-5237P: [email protected]

Jerry MyersDN Tanks4247 Grove AveGurnee, IL 60031-2134P: [email protected]

Rick MyskewitzAmerican Flow Control21695 Highview AveLakeville, MN 55044-7539P: [email protected]

NRichard NagyCity of Hutchinson Water Dept.111 Hassan St SEHutchinson, MN 55350-2522P: [email protected]

James NavratilPO Box 117Silver Lake, MN 55381-0117P: [email protected]

Doug NeidCity of Brooklyn Park8300 Noble Ave NBrooklyn Park, MN 55443-2400P: 763-493-8099

Steven NelsonBolton & Menk, Inc.7533 Sunwood Dr NW Ste 206Ramsey, MN 55303-5191P: [email protected]

Thomas NelsonCity of Grand MaraisPO Box 600Grand Marais, MN 55604-0600P: [email protected]

Mark NelsonCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: 763-494-6000

Jerome NelsonCity of Newfolden35930 140th Ave NWNewfolden, MN 56738-9212P: [email protected]

Craig NelsonCity of Sauk Rapids360 Summit Ave NSauk Rapids, MN 56379-2670P: [email protected]

Shawn NelsonOakdale Water Department1900 Hadley Ave NOakdale, MN 55128-5412P: [email protected]

Kimberly NelsonWigen Water Technologies302 Lake Hazeltine DrChaska, MN 55318-1034P: [email protected]

Terry NeumanCity Of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3027P: [email protected]

Kurt Neumann13850 Rosewood Ln NDayton, MN 55327-9574P: [email protected]

New Prague Utilities Commission

118 Central Ave N Ste 2New Prague, MN 56071-5514P: 952-758-4401

New Ulm Public Utilities310 1st St NNew Ulm, MN 56073-1675P: 507-359-8279

Scott NewbergerCity of Plymouth14900 23rd Ave NPlymouth, MN 55447P: [email protected]

Richelle NicosiaSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Diane NielsenMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

Adrian Nino De Rivera Frost15407 McGinty Rd WWayzata, MN 55391-2365P: [email protected]

Brian NomaMinnesota Dept. of HealthPO Box 64975Saint Paul, MN [email protected]

M

N























































Yoko NomuraProgressive Consulting

Engineers, Inc.6120 Earle Brown Dr Ste 629Minneapolis, MN [email protected]

Todd NordineNorth Kittson Rural WaterPO Box 99Lake Bronson, MN 56734-0099P: [email protected]

Jeffrey NylandCity of Brooklyn Center6844 Shingle Creek PkwyMinneapolis, MN 55430-1418P: 763-585-7100

Paul O’BrienCity of HayfieldPO Box 53Hayfield, MN [email protected]

Ruth O’BrienSaint Paul Regional Water1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Oakdale Water Department1900 Hadley Ave NOakdale, MN 55128-5412P: 651-730-2740

OScott OberaignerCity of OronoPO Box 66Crystal Bay, MN 55323-0066P: [email protected]

Mark OberhelmanHawkins, Inc.2381 RosegateRoseville, MN 55113-2625P: [email protected]

Sarah Oftedahl BrownSaint Paul Regional Water Services1900 Rice StSaint Paul, MN [email protected]

Andrew OhrtARCADIS US, Inc.430 1st Ave N Ste 720Minneapolis, MN 55401-1746P: [email protected]

Todd OlmschenkMulcahy2700 Blue Waters Rd Ste 100Saint Paul, MN 55121-1429P: [email protected]

Brian OlsonCity of Minneapolis

Water Department935 5th Ave SEMinneapolis, MN 55414-1205P: [email protected]

Scott OlsonCity of Thief River FallsPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Jeff OlsonEGF1010 5th Ave NEEast Grand Forks, MN 56721-1616P: [email protected]

Travis Olufson2760 Ocarina DrSauk Rapids, MN 56379-4609P: [email protected]

Lucian OsujiMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

John OswaldLeggette Brashears & Graham8 Pine Tree Dr Ste 250Saint Paul, MN 55112-3792

Todd OsweilerRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: [email protected]

Jason OverbyLincoln Pipestone Rural WaterPO Box 188Lake Benton, MN 56149-0188P: [email protected]

Owatonna Public UtilitiesPO Box 800Owatonna, MN 55060-0800P: 507-451-2839

Rodney Owens901 E 66th St Apt 6Richfield, MN 55423-2543P: [email protected]

PJohn PackardCulligan Water Conditioning6030 Culligan WayMinnetonka, MN 55345-5917P: [email protected]

Paul PalzerCity of Centerville1880 Main StCenterville, MN 55038-9794P: [email protected]

Thomas Pankaw995 Jefferson Commons CirSaint Paul, MN 55114P: [email protected]

Richard Parr4931 Lilac Way NLake Elmo, MN 55042-8531P: [email protected]

Philip ParsonsParsons Engineered ProductsPO Box 16507Saint Louis Park, MN 55416-0507P: [email protected]

Robert PaschkeCity of New Hope5500 International PkwyNew Hope, MN 55428-3606P: [email protected]

Sam Paske2118 Wellesley AveSaint Paul, MN 55105-1231P: [email protected]

David PaulsonWater Think Tank, LLC16929 Creek Ridge PlMinnetonka, MN 55345-6303P: [email protected]

Timothy Paustian4709 Woodhaven St SFargo, ND 58104-4246P: [email protected]

Barry PawelekAmerican Water Company18066 Dane DrEden Prairie, MN 55347-3496P: [email protected]

Richard PawlickiA.Y. Mcdonald Mfg. Co12725 Laurie LnChaska, MN 55318-9270P: 952-448-5664

Mark PedersenCountry Enterprises Inc.PO Box 157Lucan, MN [email protected]

Eric Pederson10117 Harriet Ave SBloomington, MN 55420-4728P: [email protected]

Brittany PentekCity of Minneapolis Public Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4912brittany.pentek@

minneapolismn.gov

Robert PeplinSambatek12800 Whitewater Dr Ste 300Minnetonka, MN 55343-9347P: [email protected]

Timothy PeschmanEvoqa Water Technologies LLC2430 Rose PlSaint Paul, MN 55113-2511P: [email protected]

Gary PetersWadena Light & Water Dept.104 Jefferson St NWadena, MN 56482-1369P: 218-631-5734

Michael PetersenBarr Engineering Co.4700 W 77th St Ste 200Minneapolis, MN 55435-4820P: [email protected]

Kira Peterson1934 Hayes St NE Apt 1Minneapolis, MN 55418-4859P: [email protected]

Kirk Peterson13860 54th Ave N Unit 4Plymouth, MN 55446-1156P: [email protected]

Jon PetersonBolton & Menk, Inc.1960 Premier DrMankato, MN 56001-5900P: [email protected]

Seth PetersonBolton & Menk, Inc.12224 Nicollet AveBurnsville, MN 55337-1649P: [email protected]

Eric PetersonCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707

Doug PetersonCity of Woodbury2301 Tower DrWoodbury, MN 55125-1642P: [email protected]

Karla PetersonMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: [email protected]

Christopher PetreeCity of Lakeville20195 Holyoke AveLakeville, MN 55044-9047P: [email protected]

Peter PfisterMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

Todd PhillipsFerguson Waterworks16905 Xylite St NEHam Lake, MN 55304-5030P: [email protected]

Dan PinceCity of S. St. Paul400 Richmond St ESouth Saint Paul, MN 55075-5940P: [email protected]

Jeff PinkowskiCambridge Brass242 Golden Pheasant DrGetzville, NY 14068-1488P: [email protected]

Brad PirsigCity of Albert Lea221 E Clark StAlbert Lea, MN 56007-2496P: [email protected]

Mike PlanteLBG8 Pine Tree Dr Ste 250Saint Paul, MN 55112-3792P: [email protected]

Jerry PleinCity of Red Wing229 Tyler Rd NRed Wing, MN 55066-1826P: [email protected]

Thomas PletcherCity of Minnetonka11522 Minnetonka BlvdHopkins, MN 55305-4370P: [email protected]

Angelo PolsinelliDakota Pump & Control705 Quadee DrWatertown, SD 57201-4075P: [email protected]

Randy PooreCity of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3071P: [email protected]

Daniel PortlockMoore Engineering, Inc.925 10th Ave EWest Fargo, ND 58078-5211P: [email protected]

Brent PowersCity of DawsonPO Box 552Dawson, MN 56232-0552P: 320-769-2154

Lynne PowersEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: [email protected]

Preload Inc.Preload, LLC2613 Industrial LnGarland, TX 75041-2302P: 972-994-0550

Preston Public Utilities Commission

PO Box 657Preston, MN 55965-0657P: 507-765-2491

Jim PrindleCity of Onalaska415 Main StOnalaska, WI 54650-2953P: [email protected]

Jim PritchardMinnesota Pipe & EquipmentPO Box 249Farmington, MN 55024-0249P: [email protected]

Amy Prok11003 Dalton Ave SEDelano, MN 55328-8330P: [email protected]

O

P
























































Mark ProulxPO Box 169001Duluth, MN 55816-9001P: 952-240-2023

James PrusakCity of Cloquet

Municipal Water Supply1307 Cloquet AveCloquet, MN 55720-1657P: 218-879-6758

Ben PrzybillaCity of Plymouth14900 23rd Ave NPlymouth, MN 55447-4707P: 763-509-5996

QNaeem QureshiProgressive Consulting

Engineers, Inc.6120 Earle Brown Dr Ste 629Minneapolis, MN 55430-4102P: [email protected]

Nuzhat QureshiProgressive Consulting

Engineers, Inc.6120 Earle Brown Dr Ste 629Minneapolis, MN 55430-4102P: [email protected]

RDuane RaderNorth Mankato Water Department1001 Belgrade AveNorth Mankato, MN 56003-3501P: [email protected]

Jeffrey RadickCity of Burnsville100 Civic Center PkwyBurnsville, MN 55337-3817P: [email protected]

Raj Rajagopal3M Company3M Center # 2013E03Saint Paul, MN 55144-0001P: [email protected]

Terry RandallCity of Spring Lake Park1301 81st Ave NEMinneapolis, MN 55432-2188P: 763-782-2893

Randall Rapacz1427 5th Ave NWE Grand Forks, MN 56721-1410P: [email protected]

Red Flint Sand and GravelPO Box 688Eau Claire, WI 54702-0688P: 800-238-9139

Nathan ReedGreen Lake

Sanitary Sewer & Water Dist14403 138th Ave NESpicer, MN 56288-8501P: [email protected]

Dale ReedWhite Bear Township1281 Hammond RdWhite Bear Township, MN 55110P: 651-747-2777dale.reed@

ci.white-bear-township.mn.us

Curtis ReetzPO Box 1033Arlington, MN 55307-1033P: [email protected]

Neile ReiderMDOT395 John Ireland BlvdSaint Paul, MN 55155-1800P: [email protected]

Bruce ReimersNew Prague Utilities Commission118 Central Ave N Ste 2New Prague, MN 56071-5514P: [email protected]

Terry ReischCity of LuvernePO Box 659Luverne, MN 56156-0659P: [email protected]

Roger RennerE. H. Renner & Sons, Inc.15688 Jarvis St NWElk River, MN 55330-6220P: [email protected]

Melanie RettieEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: [email protected]

Terry Rewertz421 Chicago Ave SWRed Lake Falls, MN 56750-4523P: [email protected]

Shahin RezaniaMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 612-661-4902Shahin.rezania@

minneapolismn.gov

Lih-In RezaniaMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: [email protected]

Scott RichardsonKinetrol USA, Inc.1112 Wildwood WayChaska, MN 55318-9732P: [email protected]

Donn RichardsonRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: [email protected]

David RindalPO Box 141135Minneapolis, MN 55414-6135P: [email protected]

Jim RingMinneapolis Water Dept.4500 Marshall St NEMinneapolis, MN 55421-2508P: [email protected]

Kent RittermanMoore Engineering, Inc.925 10th Ave EWest Fargo, ND 58078-5211P: 701-282-4692kritterman@

mooreengineeringinc.com

Mark RobbinsESRI880 Blue Gentian Rd Ste 200Saint Paul, MN 55121-1670P: [email protected]

Allen Robeck828 Armstrong Ave NGlencoe, MN 55336-2712P: [email protected]

Vernell RobertsCity of Detroit LakesPO Box 647Detroit Lakes, MN 56502-0647P: [email protected]

Stephen RobertsS. Roberts Co.17575 Bearpath TrlEden Prairie, MN 55347-3488P: [email protected]

Rick Robinson13878 Eagle View Lake RdBig Stone City, SD 57216-8238P: [email protected]

Phillip RobinsonPO Box 152Winsted, MN 55395-0152P: 712-297-5630

Charles RobinsonStantec Consulting Services2335 Highway 36 WRoseville, MN 55113-3819P: [email protected]

David RobinsonTonka Water13305 Water Tower CirPlymouth, MN 55441-3819P: [email protected]

Rochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: 507-280-1605

Justine RoeSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Jerry RoehlCity of Golden Valley13175 Gray Fox TrlRogers, MN 55374-8742P: [email protected]

Steven RoepkeCity of Bloomington1800 W Old Shakopee RdBloomington, MN 55431-3071P: [email protected]

Michael RoersMinnesota Rural Water217 12th Ave SEElbow Lake, MN 56531-4737P: [email protected]

Eric RoosWorthington Public UtilitiesPO Box 458Worthington, MN 56187-0458P: [email protected]

George Rosati206 Woodhaven LnMankato, MN 56001-5706P: [email protected]

Dennis RosemarkSaint Paul Regional Water Services1900 Rice StSaint Paul, MN [email protected]

Samuel RosenbergFederal Cartridge900 Bob Ehlen DrAnoka, MN 55303-7502P: [email protected]

C.W. Ross13218 Findlay WayApple Valley, MN 55124-7935P: 952-431-8800

Holly Ross645 Franklin St SWHutchinson, MN 55350-2803P: [email protected]

Steve Ross8333 Kentucky Ave NMinneapolis, MN 55445-2241P: [email protected]

Alexis RossowSaint Paul Regional Water Services1900 Rice StSaint Paul, MN [email protected]

Thomas RousharWSB & Associates, Inc.701 Xenia Ave S Ste 300Minneapolis, MN 55416-1030P: [email protected]

Douglas RovangRochester Public Utilities4000 E River Rd NERochester, MN 55906-3414P: [email protected]

Matt Rowedder5817 34th Ave NCrystal, MN 55422-2553P: [email protected]

Camille RubeizPPI2839 Maple LnFairfax, VA 22031-1425P: [email protected]

Daniel RuizCity of Brooklyn Park8300 Noble Ave NBrooklyn Park, MN 55443-2400

Joel RuterWillmar Municipal UtilitiesPO Box 937Willmar, MN 56201-0937P: 320-235-4422

Rose Rutherford425 University Ave SE Apt 205Minneapolis, MN 55414-1730P: [email protected]

Theresa RyanInterstate Companies20920 Forest Rd NForest Lake, MN 55025-9767P: [email protected]

Chris RydellMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: 952-543-8577christopher.rydell@

ci.minneapolis.mn.us

SJohn SachiCity of South St. Paul125 3rd Ave N Ste 1South St Paul, MN 55075-2097P: [email protected]

James SadlerCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: [email protected]

Paul SaffertBolton & Menk7533 Sunwood Dr NW Ste 206Ramsey, MN 55303-5191P: [email protected]

Saint Paul Regional Water Services

1900 Rice StSaint Paul, MN 55113-6810P: 651-266-6815

Saint Peter Water Utilities405 Saint Julien StSaint Peter, MN 56082-1874P: 507-934-0670

Adam SaloHR Green20875 Independence AveLakeville, MN 55044-5878P: [email protected]

Q

R

S

















































[email protected]



Kyle Sandberg581 Pascal St NSaint Paul, MN 55104-2412P: [email protected]

Robert SandillaIn Control, Inc.10350 Jamestown St NEMinneapolis, MN 55449-4524P: [email protected]

Andrew SantiHD Supply Waterworks12357 Ethan Ave NWhite Bear Lake, MN 55110-5965P: [email protected]

David SappBrown and Caldwell30 7th St E Ste 2500Saint Paul, MN 55101-4924P: [email protected]

Michael Savelli2318 115th Ave NWMinneapolis, MN 55433-3023P: [email protected]

Scott SchaeferAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: [email protected]

Roger ScharfCH2M HILL1295 Northland Dr Ste 200Mendota Heights, MN 55120-1380P: [email protected]

Jake Scheffler18850 Fairbanks AveFaribault, MN 55021-8807P: [email protected]

Lon SchemelShakopee Public

Utilities CommissionPO Box 470Shakopee, MN 55379-0470P: [email protected]

Steven SchererCity of Medina2052 County Road 24Medina, MN 55340-9790P: [email protected]

Terry SchiroVessco Inc.8217 Upland CirChanhassen, MN 55317-9626P: [email protected]

William SchluenzCity of Waite ParkPO Box 339Waite Park, MN 56387-0339P: [email protected]

Scott Schmitz1304 2nd St NCold Spring, MN 56320-1069P: [email protected]

Steve SchneiderSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Alan SchneiderTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: [email protected]

Thomas SchneidermanCity of East Grand Forks Water &

Light Dept.1010 5th Ave NEEast Grand Forks, MN 56721-1616P: [email protected]

Harold SchollerCity of International Falls4211 Highway 11International Falls, MN56649-9104P: [email protected]

Tony SchrantzWater Conservation Services, Inc.6251 W Shadow Lake DrLino Lakes, MN 55014-3327P: [email protected]

Gary Schreifels1107 11th St E Ste 107Glencoe, MN 55336-2327P: [email protected]

Kevin SchubertCity of Onalaska415 Main StOnalaska, WI 54650-2953P: [email protected]

David Schultz1309 Northway CirSaint Cloud, MN 56303-1752P: [email protected]

Scott SchultzWillmar Municipal Utility704 Litchfield Ave SWWillmar, MN 56201-3111P: 320-235-4422

Jennifer SchumannPO Box 270082Golden Valley, MN 55427-6082P: [email protected]

Thomas SchurPublic UtilitiesPO Box 384Mountain Iron, MN 55768-0384P: 218-735-8475

Todd SchwabCity of Cambridge300 3rd Ave NECambridge, MN 55008-1281P: [email protected]

William SchwandtMoorhead Public Service Dept.PO Box 779Moorhead, MN 56561-0779P: [email protected]

Duane SchwartzCity of Roseville2701 Lexington Ave NSaint Paul, MN 55113-2007P: [email protected]

Corey SchweichCity Of Elko New MarketPO Box 99Elko New Market, MN 55020-0099P: [email protected]

Brandon ScottWillmar Municipal UtilityPO Box 937Willmar, MN 56201-0937P: 507-445-3139

Allen SeebeckLiqTech NA1804 Buerkle RdWhite Bear Lake, MN [email protected]

John SeifertCity of Rogers22350 S Diamond Lake RdRogers, MN 55374-4773P: [email protected]

Michael Semmens2163 Goodrich AveSaint Paul, MN 55105-1021P: [email protected]

Jim SeppMoore Engineering, Inc.934 16th Ave WWest Fargo, ND 58078-4621P: [email protected]

Eric ShafferDuluth Public Works & Utilities520 Garfield AveDuluth, MN 55802-2610

Patrick SheaCity of St. Cloud400 2nd St SSaint Cloud, MN 56301-3622P: [email protected]

Bryce Shearen918 Woodlynn AveRoseville, MN 55113-1938P: [email protected]

Shorewood Public Water5755 Country Club RdExcelsior, MN 55331-8926P: 952-960-7913

Prashant ShrikhandeGE Water5951 Clearwater DrMinnetonka, MN 55343-8990P: [email protected]

Jessica Shu1151 Devonshire CurvBloomington, MN [email protected]

Louis Sigtermans22 Raymond Pl Apt 5Saint Paul, MN 55114-1163P: [email protected]

Ron SikMankato UtilitiesPO Box 3368Mankato, MN 56002-3368

SJE-Primex Controls, Inc.PO Box 1708Detroit Lakes, MN 56502-1708P: 218-847-1317

Gary SkallmanCity of Int’l FallsPO Box 831Intl Falls, MN 56649-0831P: 218-240-1412

Robert SkibnessCity of Fergus Falls112 W Washington AveFergus Falls, MN 56537-2568P: [email protected]

Brian SkokCity of CarverPO Box 147Carver, MN 55315-0147P: [email protected]

Sleepy Eye Municipal UtilityPO Box 408Sleepy Eye, MN 56085-0408P: 507-794-4371

Dean Sletten3527 110th Ave NMoorhead, MN 56560-7221P: [email protected]

Mark SloanMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: [email protected]

Pete Smith26795 Pat Clark RdOgema, MN 56569-9590P: [email protected]

Sharon SmithMinnesota Department of Health1505 Pebble Lake Rd Ste 300Fergus Falls, MN 56537-3800P: [email protected]

Stuart SmithSpring Valley Public Utilities104 S Section AveSpring Valley, MN 55975-1646P: [email protected]

Racquel SmrzSaint Paul Regional Water Services1900 Rice StSaint Paul, MN [email protected]

Scott SnellIndian Health Service -

Bemidji Area DSFC522 Minnesota Ave Fed Bldg Rm 216Bemidji, MN 56601P: [email protected]

Don SolgaCity of Pelican RapidsPO Box 350Pelican Rapids, MN 56572-0350P: [email protected]

Carl SonnenbergWaseca Water & Light Dept.508 State St SWaseca, MN 56093-3033P: [email protected]

William SpainSt. Cloud Technical

& Community College1540 Northway DrSaint Cloud, MN 56303-1240P: [email protected]

Luke SpaljRice Lake Construction GroupPO Box 517Deerwood, MN 56444-0517P: [email protected]

Spring Valley Public Utilities104 S Section AveSpring Valley, MN 55975-1646P: 507-346-7622

Cael Sprute9850 Cromwell DrEden Prairie, MN 55347-2945P: [email protected]

St. Cloud Public Utilities400 2nd St SSaint Cloud, MN 56301-3622P: 320-255-7225

St. James Water DepartmentPO Box 70Saint James, MN 56081-0070P: 507-375-1229

St. Louis Park Water Department

7305 Oxford StMinneapolis, MN 55426-4512P: 952-924-2557

Lyle Stai1185 160th Ave SEKerkhoven, MN 56252-9566P: [email protected]

Russell StammerISG3645 Arbor Dr NWRochester, MN 55901-4158P: [email protected]

Staples Public Works Commission

122 6th St NEStaples, MN 56479-2932P: 218-894-2550

Robert Stark1531 Hill View CtRed Wing, MN 55066-4230P: [email protected]

Andrew StephesCity of Prior Lake17073 Adelmann St SEPrior Lake, MN 55372-3968P: [email protected]

S























































Larry StierMaster Companies8555 W 123rd StSavage, MN 55378-1150

Razvan StoicescuEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3819P: 651-639-5600

Gregory StonehouseHDR Engineering701 Xenia Ave S Ste 600Minneapolis, MN 55416-3636P: [email protected]

Thomas StordahlMinnesota Pipe & EquipmentPO Box 249Farmington, MN 55024-0249P: [email protected]

Leslee Storlie8700 Ironwood Ave SCottage Grove, MN 55016-4725P: [email protected]

Jacqueline Strait2517 Bryant Ave S Apt 203Minneapolis, MN [email protected]

Ted StrandCity of Crosslake37028 County Road 66Crosslake, MN 56442-2528P: [email protected]

Scott StrebelFer-Pal Construction USA LLC1350 Gasket DrElgin, IL 60120-7543P: 847-214-0103scott.strebel@

ferpalinfrastructure.com

Karl Streed2306 Lincoln St NEMinneapolis, MN 55418-3826P: [email protected]

T.J. StroeblTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: [email protected]

Mark SturmCity of St. JamesPO Box 70Saint James, MN 56081-0070P: [email protected]

Tom SullivanMaster Companies8555 W 123rd StSavage, MN 55378-1150P: [email protected]

Summit Envirosolutions, Inc1217 Bandana Blvd NSaint Paul, MN 55108-5114P: 651-644-8080

Kristopher SwansonBolton & Menk1960 Premier DrMankato, MN 56001-5900P: [email protected]

Mark SweersMinnesota Dept. of Health12 Civic Center Plz Ste 2105Mankato, MN 56001-7789P: [email protected]

John SzymanskiSzymanski’s S.I., Inc.65910 267th StAlden, MN 56009-4211P: [email protected]

TCharles Taflin12650 Elm Creek XingChamplin, MN 55316-1167P: [email protected]

Anthony TalamantezMankato Public Works

Utilities InfrastructurePO Box 3368Mankato, MN 56002-3368P: [email protected]

Harvey TamCity of Richfield6700 Portland AveRichfield, MN 55423-2560P: 612-861-9165

Harold TaylorCity of Cottage Grove8635 W Point Douglas Rd SCottage Grove, MN 55016-3318P: [email protected]

Len TaylorCity of Fergus Falls112 W Washington AveFergus Falls, MN 56537-2568P: [email protected]

Paul TeicherCity of St. Francis4058 Saint Francis Blvd NWSaint Francis, MN 55070-9701P: [email protected]

David TetzloffCity of LewisvillePO Box 13Lewisville, MN 56060-0013P: [email protected]

Zack TheinThein Well CompanyPO Box 778Spicer, MN 56288-0778P: [email protected]

Thief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-3809

Paul ThomHD Supply Waterworks1630 Woodlawn CirWaconia, MN 55387-1242P: [email protected]

John ThomSEH, Inc.3535 Vadnais Center Dr Ste 200Saint Paul, MN 55110-5118P: [email protected]

Anthony ThompsonMinneapolis Water Works4500 Marshall St NEMinneapolis, MN 55468P: 612-661-4930Anthony.thompson@

minneapolismn.gov

Steve ThomsCity of Red Wing229 Tyler Rd NRed Wing, MN 55066-1826P: [email protected]

Stew ThornleyMinnesota Department of HealthPO Box 64975Saint Paul, MN 55164-0975P: [email protected]

Wayne ThuringerCity of AuroraPO Box 160Aurora, MN 55705-0160P: [email protected]

Chris TolbertSt Paul Regional Water1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Tonka WaterPO Box 41126Plymouth, MN 55441-0126763-559-2837

Bert TracyCity of Golden Valley7800 Golden Valley RdGolden Valley, MN 55427-4508P: [email protected]

James TraenDownhole Well Services, LLC8145 Long Lake RdMounds View, MN 55112-6033P: [email protected]

Dale TranterFoth & Van Dyke8550 Hudson Blvd N Ste 100Lake Elmo, MN 55042-8706P: [email protected]

Dave TrautMark J. Traut Wells, Inc.141 28th Ave SWaite Park, MN 56387-1085P: [email protected]

Kathy TravisSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Chad TroitteE. Grand Forks Wtr. & Light De801 2nd St NEEast Grand Forks, MN 56721-3100P: [email protected]

Nicholas TrudeauThief River Falls WaterPO Box 528Thief River Falls, MN 56701-0528P: 218-681-6809

William TschidaSt. Paul Water Utility1900 Rice StSaint Paul, MN 55113-6810P: 651-292-6583

Tara TurchEMA, Inc.2355 Highway 36 W Ste 200Roseville, MN [email protected]

Jerry Tveit4561 232nd Ln NWSaint Francis, MN 55070-8785P: [email protected]

Curtis Tvinnereim3420 Urbandale Ln NPlymouth, MN 55447-1018P: 763-475-1828

UIlhan UlkemValspar1101 S 3rd StMinneapolis, MN 55415-1211P: [email protected]

Michael UlrichCity of Blaine1801 101st Ave NEBlaine, MN 55449-4408P: 763-785-6167

USABlueBookPO Box 9006Gurnee, IL 60031-9006P: 800-548-1234

VTim ValleyCity of Northfield - WWTP1450 Highway 3 NNorthfield, MN [email protected]

Steven Valtinson1606 Cedar Knoll PlSaint Cloud, MN 56301-5727

Lawrence Van Hout123 Linden AveAlexandria, MN 56308-8902P: [email protected]

Jordan VandalRCAP-Midwest Assistance ProgramPO Box 32Knife River, MN 55609-0032P: [email protected]

Kou Vang4036 Scheuneman RdSaint Paul, MN 55110-4113P: [email protected]

George Vania2200 Oak Glen CirStillwater, MN 55082-9613P: [email protected]

Harlan VanWyheCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: [email protected]

Charles VeinAE2S4050 Gardenview Dr Ste 200Grand Forks, ND 58201-7215P: [email protected]

Uma Vempati17664 69th Pl NOsseo, MN 55311-3027P: [email protected]

Robert VerkeMinneapolis Water Works4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

Chris VoeltzSaint Peter Water Utilities405 Saint Julien StSaint Peter, MN 56082-1874P: [email protected]

Thomas VogelOrder of Saint BenedictPO Box 7299Collegeville, MN 56321-7299P: [email protected]

Cindy VoigtCity of Duluth411 W 1st St Rm 211Duluth, MN 55802-1191P: [email protected]

Eric VolkElk River Municipal Utilities1705 Main St NWElk River, MN 55330-1830P: [email protected]

Greg VolkartCity of Goodview4140 W 5th StWinona, MN 55987-1599P: [email protected]

Rodney VolkerImage Communications17783 220th AveDetroit Lakes, MN 56501-7915P: [email protected]

Myron VolkerOwatonna Public Utilities208 S Walnut AveOwatonna, MN 55060-2940P: [email protected]

Lisa VollbrechtSt. Cloud Public Utilites/ City Hall400 2nd St SSaint Cloud, MN 56301-3622P: [email protected]

S

T

U

V























































Kevin VranicarMangney Construction, Inc.1401 Park RdChanhassen, MN 55317-9592P: [email protected]

WMichael WaakUniversity of Minnesota500 Pillsbury Dr SEMinneapolis, MN 55455-0233P: [email protected]

Wadena Light & Water Dept.104 Jefferson St NWadena, MN 56482-1369P: 218-631-5734

Richard WagnerAE2S3101 S Frontage Rd Ste 100Moorhead, MN 56560-2545P: [email protected]

Justin WagnerCity of Northfield801 Washington StNorthfield, MN 55057-2598P: [email protected]

Jeff WagnerSaint Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

David WagnerSt. Paul Regional Water Services1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Brian WagstromCity of Minnetonka11522 Minnetonka BlvdMinnetonka, MN 55305-4370P: [email protected]

David WaldochAmerican Cast Iron Pipe21695 Highview AveLakeville, MN 55044-7539P: [email protected]

Jodi WallinSt Paul Regional Water Service1900 Rice StSaint Paul, MN 55113-6810P: [email protected]

Mark WallisSEH418 W Superior StDuluth, MN 55802-1512P: [email protected]

Trevor WalterCity of BaxterPO Box 2626Baxter, MN 56425-2626P: [email protected]

Connie WangenPrinceton Public Utilities907 1st StPrinceton, MN 55371-1559P: [email protected]

Joseph WardWSB & Associates701 Xenia Ave S Ste 300Minneapolis, MN 55416-1030P: [email protected]

Gary WarnerTonka Water13305 Water Tower CirPlymouth, MN 55441-3803P: [email protected]

Water Remediation Technology LLC

5525 W 56th Ave Ste 100Arvada, CO 80002P: 303-424-5355

Herbert WatryLitchfield Public Utilities126 N Marshall AveLitchfield, MN 55355-2110P: [email protected]

Jonathan Watson8300 Noble Ave NBrooklyn Park, MN 55443-2400P: [email protected]

Paul Webber15801 Nursery DrMinnetonka, MN [email protected]

Tom WelleApex Engineering Group, Inc4733 Amber Valley Parkway S.Fargo, ND 58104P: [email protected]

Chet WelleCity Of Rochester301 37th St NWRochester, MN 55901-3403P: [email protected]

Austin Weltzin17590 Eureka Ave WFarmington, MN 55024-9090P: [email protected]

Deborah WeltzinCity of Bloomington Water

Treatment Plant9300 Poplar Bridge RdBloomington, MN 55437P: [email protected]

Norman WenckWenck Associates, Inc.PO Box 249Maple Plain, MN 55359-0249P: [email protected]

Tom WesoloskiCity of Shoreview4600 Victoria St NShoreview, MN 55126-5817P: [email protected]

Jim WestermanCity of Woodbury8301 Valley Creek RdWoodbury, MN [email protected]

Richard Wetzel2800 Fox Run NWPrior Lake, MN 55372-3238P: [email protected]

David WeumMinnesota Dept. of HealthPO Box 64975Saint Paul, MN 55164-0975P: [email protected]

Andrew WeyerMinneapolis Water Works4300 Marshall St NEFridley, MN 55421-2510P: [email protected]

Tony WhiteCity of Burnsville13713 Frontier CtBurnsville, MN 55337-4720P: [email protected]

Wendy WicheltEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: [email protected]

Todd WicklundBrainerd Public UtilitiesPO Box 373Brainerd, MN 56401-0373P: [email protected]

Widseth Smith Nolting Assoc.7804 Industrial Park RdBaxter, MN 56425-8267P: 218-829-5117

Jason WiehleCity of Fridley6431 University Ave NEMinneapolis, MN 55432-4303P: [email protected]

Wigen Water TechnologiesGenevieve Hutchens302 Lake Hazeltine DrChaska, MN 55318-1034P: 952-448-4884

Willmar Municipal UtilityPO Box 937Willmar, MN 56201-0937P: 320-235-4422

Jason WilmHawkins Inc.2381 RosegateRoseville, MN 55113-2625P: [email protected]

Jordan Wilson905 Kilian Blvd SE Apt 7Saint Cloud, MN [email protected]

Bruce WilsonCity of International FallsPO Box 831International Falls, MN 56649-0831P: [email protected]

William WiltseCity of KinneyPO Box 307Kinney, MN 55758-0307P: [email protected]

Dave WisdorfCity of Excelsior339 3rd StExcelsior, MN 55331-1809P: [email protected]

Brian WiseNanostone Water10250 Valley View Rd Ste 143Eden Prairie, MN 55344-3534P: [email protected]

Joesph WoksonCity of Maple GrovePO Box 1180Maple Grove, MN 55311-6180P: [email protected]

Nate WoldMinneapolis Water Works935 5th Ave SEMinneapolis, MN [email protected]

Worthington Public UtilitiesPO Box 458Worthington, MN 56187-0458P: 507-372-8680

Jeremy WurptsTonka Water13305 Water Tower CirMinneapolis, MN 55441-3819P: [email protected]

Marvin WurzerCity of Long LakePO Box 606Long Lake, MN 55356-0606P: [email protected]

XJosh XiongLiqTech NA1804 Buerkle RdWhite Bear Lake, MN 55110-5245

YCraig YokopenicEMA, Inc.2355 Highway 36 W Ste 200Saint Paul, MN 55113-3903P: [email protected]

Kevin Young1131 37th Ave SMoorhead, MN 56560-6144P: [email protected]

ZMike ZaborowskiCity of Winona1 Johnson StWinona, MN 55987-3419P: 507-457-8272

Joe ZaunerFischer, Harris & Associates5865 Neal Ave NStillwater, MN [email protected]

Carol ZehrerTonka Equipment Company13305 Water Tower CirPlymouth, MN 55441-3819P: [email protected]

Nancy ZeiglerAE2S6901 E Fish Lake Rd Ste 184Maple Grove, MN 55369-5457P: [email protected]

Li ZhangMinneapolis Div. Wtr.

Treatment and Distribution Svcs.4300 Marshall St NEMinneapolis, MN 55421-2510P: [email protected]

Paul ZimmerCity of MankatoPO Box 3368Mankato, MN 56002-3368P: [email protected]

Steve ZwiefelTruman Public UtilitiesPO Box 397Truman, MN 56088-0397P: 507-776-6501 •

V

W

X

Y

Z


















































Buyers’ GuideMN AWWA 2015

AccessoriesGeneral Repair ServiceMid America Meter, Inc

Activated CarbonCEI-Carbon Enterprises Inc.

Algae ControlMedora Corporation, home of SolarBee and GridBee brands

AMR Systems and Meters /AMI SolutionsFerguson Waterworks HD Supply WaterworksMid America Meter, Inc

AnthraciteCEI-Carbon Enterprises Inc.

Backfl ow Prevention ProgramsHydroCorp

Chemical Processing & Feed SystemsPollardwater.com

Contractors Bergerson Caswell Inc Hydro-KleanInterstate Companies

Cross Connection ControlHydroCorp

DechlorinationPollardwater.com

Design-Build ContractorBergerson Caswell Inc Black & VeatchBrown and Caldwell

Electrical Instrumentation/Controls/GeneratorsMid America Meter, IncMinnesota Pump WorksTitan Energy Systems Inc.Ziegler Power Systems

Engineers/ConsultantsAE2S AECOMApex Engineering Group Banner Associates, Inc.Black & VeatchBolton & Menk, Inc.Brown and CaldwellDixon Engineering, Inc.

HR Green, Inc.KLJLeggette, Brashears & Graham, Inc.Moore Engineering, Inc. Progressive Consulting Engineers, Inc. Short Elliott Hendrickson Inc. (SEH)Stantec Consulting ServicesSummit Envirosolutions, Inc.TKDAWidseth Smith NoltingWSB & Associates, Inc.

Environmental DrillingBergerson Caswell IncSummit Envirosolutions, Inc.Thein Well Company

Filter Media Remove/Supply & InstallCEI-Carbon Enterprises Inc.Tonka Water

Filtration CEI-Carbon Enterprises Inc.Hawkins Water Treatment GroupProgressive Consulting Engineers, Inc. Tonka WaterVan Bergen & Markson, Inc.Vessco, Inc.

General IndustrialHydro-KleanProfessional Workforce Training

GISAE2S Bolton & Menk, Inc.Moore Engineering, Inc.Stantec Consulting ServicesSummit Envirosolutions, Inc.

Greensand PlusCEI-Carbon Enterprises Inc.

Industrial Wireless Data CommunicationsShort Elliott Hendrickson Inc. (SEH)

Inspector/LocatorsPollardwater.com

Land SurveyingAE2S KLJMoore Engineering, Inc.Stantec Consulting ServicesWidseth Smith Nolting

Leak Detection/Correlator Services M.E. Simpson Co., Inc.Water Conservation Services, Inc-Water Leak Detection

Manhole and Catch Basin CastingsESS Brothers & Sons Inc.Ferguson Waterworks

MembranesProgressive Consulting Engineers, Inc. Tonka WaterVan Bergen & Markson, Inc.Vessco, Inc.

Meters/Meter TestingM.E. Simpson Co., Inc.Mid America Meter, Inc

Mixing EquipmentMedora Corporation, home of SolarBee and GridBee brands

Odor Control SolutionsHawkins Water Treatment GroupMedora Corporation, home of SolarBee and GridBee brandsPollardwater.com

Odor & Corrosion ControlVessco, Inc.

Operation ServicesBolton & Menk, Inc.eRPortal Software Group Mid America Meter, IncProfessional Workforce TrainingStantec Consulting Services

Pipe & AppurtenancesAmerican Cast Iron Pipe CompanyHD Supply Waterworks

Pipelines (Steel/Concrete)AECOM

Process MechanicalBrown and CaldwellVan Bergen & Markson, Inc.WSB & Associates, Inc.

When making purchasing decisions about products and services in the wastewater industry throughout Minnesota and beyond, please support the companies whose advertising makes the Breeze magazine possible. You will fi nd them quickly with our convenient, easy to use Buyers’ Guide. On the following pages, you will fi nd information that will help you meet your purchasing requirements throughout the year ahead. The initial section of this Guide lists categories of products and services along with the various companies that can provide them to you. The following section provides an alphabetical listing of those companies, as well as the contact information you will need to reach them.

Categories

Click HERE to return to Table of Contents50 Breeze | Summer 2015

Pumps/Pump Systems AECOMBergerson Caswell Inc E.H. Renner & Sons, Inc.General Repair ServiceHawkins Water Treatment GroupMinnesota Pump WorksNorthwestern Power Equipment Co.Pollardwater.comThein Well CompanyVan Bergen & Markson, Inc.W. W. Goetsch Associates, Inc.WSB & Associates, Inc.

Storage Tanks/Reservoir SystemsDixon Engineering, Inc.Engineering America Northwestern Power Equipment Co.Pittsburg Tank & Tower Maintenance Co.Short Elliott Hendrickson Inc. (SEH)Widseth Smith NoltingWSB & Associates, Inc.

StormwaterAE2SAECOMBrown and CaldwellESS Brothers & Sons Inc.Ferguson Waterworks General Repair ServiceKLJKODRU-MOONEYMinnesota Pump WorksNorthwestern Power Equipment Co.Prinsco Widseth Smith Nolting

Tanks - Inspection, Painting, RestorationBolton & Menk, Inc.KLJMaguire Iron Pittsburg Tank & Tower Maintenance Co.Short Elliott Hendrickson Inc. (SEH)

Tanks/Pre-Stressed ConcretePittsburg Tank & Tower Maintenance Co.

Valve Assessments/Hydrant Flow Testing/Smoke Testing

KODRU-MOONEYM.E. Simpson Co., Inc.

ValvesAmerican Cast Iron Pipe CompanyBilfi nger Water Technologies-AIRVACHD Supply WaterworksKODRU-MOONEYVessco, Inc.Wastewater CollectionBilfi nger Water Technologies-AIRVAC

Wastewater ConveyanceBilfi nger Water Technologies-AIRVAC

Water QualityMedora Corporation, home of SolarBee and GridBee brands

Water Treatment InstrumentationAE2S

Water Treatment InstrumentationNorthwestern Power Equipment Co.

Water/Wastewater Treatment Systems AE2S AECOMBlack & VeatchBolton & Menk, Inc.Brown and CaldwellCEI-Carbon Enterprises Inc.Dixon Engineering, Inc.General Repair ServiceHawkins Water Treatment GroupHD Supply WaterworksKLJMedora Corporation, home of SolarBee and GridBee brandsNorthwestern Power Equipment Co.Pittsburg Tank & Tower Maintenance Co.Progressive Consulting Engineers, Inc. Short Elliott Hendrickson Inc. (SEH)Tonka WaterVan Bergen & Markson, Inc.Vessco, Inc. Widseth Smith NoltingWSB & Associates, Inc.

Water Utilities Products ManufactureHawkins Water Treatment GroupNorthwestern Power Equipment Co.

Water WellsBergerson Caswell IncE.H. Renner & Sons, Inc.Progressive Consulting Engineers, Inc. Summit Envirosolutions, Inc.Thein Well Company

Welded Steel Elevated TanksPittsburg Tank & Tower Maintenance Co.

Well DrillersBergerson Caswell IncE.H. Renner & Sons, Inc.Thein Well Company

Wellhead ProtectionSummit Envirosolutions, Inc.

Well Sitting and DesignSummit Envirosolutions, Inc.

AAE2S

6901 East Fish Lake Road, Suite 184Maple Grove, MN 55369763-463-5036 F: 763-463-5037www.ae2s.com

AECOM

800 LaSalle Avenue, Suite 500Minneapolis, MN 55402612-376-2000 F: [email protected]

American Cast Iron Pipe Company

1501 31st Ave. NorthBirmingham, AL [email protected]

Apex Engineering Group

1265 Highway 10 West - Suite 4Detroit Lakes, MN 56501218-844-2580 F: [email protected]

BBanner Associates, Inc.424 ½ South Minnesota AveSaint Peter, MN 56082855-323-6342 F: [email protected]

Bergerson Caswell Inc5115 Industrial StreetMaple Plain, MN 55359763-479-3121 F: [email protected]

Bilfi nger Water Technologies-AIRVAC

200 Tower Drive, Suite AOldsmar, FL 34677813-855-6297 F: 813-855-9093dave.elias@bilfi nger.comwww.water.bilfi nger.com

Black & Veatch7760 France Ave., Suite 1200Minneapolis, MN 55435952-896-0500 F: [email protected]

Bolton & Menk, Inc.1960 Premier DriveMankato, MN 56001507-625-4171 F: [email protected]

ListingsCategories (continued)

http://www.ae2s.com




http://www.American-usa.com


http://www.ApexEngGroup.com


http://www.bannerassociates.com



http://www.water.bilfi


http://www.bv.com



http://www.ceifiltration.com


Click HERE to return to Table of Contents 51Summer 2015 | Breeze

Brown and Caldwell

30 7th Street East, Suite 2500Saint Paul, MN 55101-2201651-298-0710 F: [email protected]

CCEI-Carbon Enterprises Inc.28205 Scippo Creek RdCircleville, OH 43113800-344-5770 F: 888-204-9656sales@ceifi ltration.comwww.ceifi ltration.com

DDixon Engineering, Inc.

5307 S. 92nd Street, Suite 125Hales Corners, WI 53130414-529-1859 F: 414-529-3120joehoban@dixonengineering.netwww.dixonengineering.net

EE.H. Renner & Sons, Inc.15688 Jarvis Street NWElk River, MN 55330763-427-6100 F: [email protected]

Engineering America647 Hale Ave NOakdale, MN 55128651-777-4041 F: [email protected]

eRPortal Software Group 59 Interstate DriveWest Springfi eld, MA 01089413-233-5400 F: [email protected]

ESS Brothers & Sons Inc.

9350 County Rd 19Loretto, MN 55340763-478-2027 F: [email protected]

FFerguson Waterworks

1694 91st Avenue NEBlaine, MN 55449763-560-5200 F: [email protected]

GGeneral Repair Service3535 International DriveVadnais Heights, MN 55110651-766-0874 F: [email protected]

HHawkins Water Treatment Group2381 RosegateRoseville, MN 55113612-331-6910 F: [email protected]

HD Supply Waterworks

Hdswaterworks.com

HR Green, Inc.2550 University Avenue West, Suite 400NSt. Paul, MN 55114651-644-4389 F: [email protected]

HydroCorp2665 S. Moorland Rd., Ste. #209New Berlin, WI [email protected]

Hydro-Klean333 N.W. 49th PlaceDes Moines, IA 50313515-283-0500 F: [email protected]

IInterstate CompaniesPO Box 1028 Forest Lake, MN 55025651-765-0765 F: [email protected]

KKLJ1505 S 30th AveMoorhead, MN 56560218-287-0300 F: 855-288-8055www.kljeng.com

KODRU-MOONEY

3650 N. Chestnut StChaska, MN 55318952-479-1045 F: [email protected]

Your Partner in Clean Water!

Training at your site or ours!Contact us today to register yourself or your employees.

(763) 576-4108; proworktraining.com; [email protected]

Electrical Training

Training onsite and at our campuses when you need it.

Technical Training for facilities personnel

OSHA Required






http://www.ehrenner.com








http://www.ferguson.com




http://www.hawkinsinc.com





http://www.hydro-klean.com








http://www.ceifiltration.com

http://www.hydrocorpinc.com

Click HERE to return to Table of Contents52 Breeze | Summer 2015

LLeggette, Brashears & Graham, Inc.8 Pine Tree Drive, Suite 250St. Paul, MN 55112651-490-1405 F: [email protected]

MM.E. Simpson Co., Inc.3406 Enterprise Ave.Valparaiso, IN 46383800-255-1521 F: [email protected]

Maguire Iron Box 1446Sioux Falls, SD 57105605-334-9749 F: [email protected]

Medora Corporation, home of SolarBee and GridBee brands

3225 Highway 22Dickinson, ND [email protected]

Mid America Meter, Inc

710 Hamel RoadMedina, MN 55340763-478-8041 F: [email protected]

Minnesota Pump Works1 Cannon Street WDundas, MN 55019877-645-8004 F: 507-645-7533info@minnesotapumpworks.comwww.minnesotapumpworks.com

Moore Engineering, Inc.

1808 E. Fir AvenueFergus Falls, MN 56537218-998-4041 F: 218-998-4042hveit@mooreengineeringinc.comwww.mooreengineeringinc.com

NNorthwestern Power Equipment Co.2740 Patton RdRoseville, MN 55113651-628-0683 F: [email protected]

PPittsburg Tank & Tower Maintenance Co.PO Box 913Henderson, KY 42419270-826-9000 F: [email protected]

Pollardwater.com17515 NE 67th CTRedmond, WA 98052800-437-1146 F: [email protected]

Prinsco

1717 16th Street NE Willmar, MN 56201800-992-1725 F: [email protected]

Professional Workforce Training1355 West Highway 10Anoka, MN 55303763-576-4108 F: [email protected]

Progressive Consulting Engineers, Inc. 6120 Earle Brown Drive, Suite 629Minneapolis, MN 55422763-560-9133 F: [email protected]

SShort Elliott Hendrickson Inc. (SEH)

3535 Vadnais Center DriveSt. Paul, MN 55110651-490-2000 F: [email protected]

Stantec Consulting Services

2335 Highway 36 WestSaint Paul, MN 55113651-636-4600 F: [email protected]

Summit Envirosolutions, Inc.1217 Bandana Boulevard NorthSt. Paul, MN 55108612-750-4024 F: [email protected]

TThein Well CompanyPO Box 778Spicer, MN 56288800-450-8000 F: [email protected]

Titan Energy Systems Inc.6321 Bury Drive, Suite 8Eden Prairie, MN 55346952-960-2371 F: 952-938-3290www.titanenergy.com

TKDA444 Cedar Street, Suite 1500Saint Paul, MN 55101651-292-4400 F: [email protected]

Tonka Water

13305 Watertower CirclePlymouth, MN 55441763-559-2837 F: [email protected]

VVan Bergen & Markson, Inc.9366 Deerwood Ln NMaple Grove, MN 55369763-546-4340 F: [email protected]

Vessco, Inc.

8217 Upland CircleChanhassen, MN 55317952-941-2678 F: [email protected]

WW. W. Goetsch Associates, Inc.5250 W 74th St, #24Minneapolis, MN 55439952-831-4340 F: [email protected]

Water Conservation Services, Inc-Water Leak Detection

6251 West Shadow Lake DriveLino Lakes, MN 55014612-600-8716 F: [email protected]

Widseth Smith Nolting7804 Industrial Park RdBaxter, MN 56425218-829-5117 F: [email protected]

WSB & Associates, Inc.

701 Xenia Avenue South, Suite 300Minneapolis, MN 55416763-541-4800 [email protected]

ZZiegler Power Systems8050 County Road 101 EastShakopee, MN 55379800-320-4292www.zieglercat.com/power-systems/ •

Listings (continued)


http://www.lbgweb.com


http://www.mesimpson.com


http://www.maguireiron.com




http://www.midamericameter.com


http://www.minnesotapumpworks.com


http://www.mooreengineeringinc.com






http://www.Pollardwater.com





http://www.pce.com








http://www.theinwell.com



http://www.tkda.com


http://www.tonkawater.com








http://www.zieglercat.com/power-systems/

http://www.vbinc.com

http://www.wwgoetsch.com


http://www.sidethsmithnolting.com


Click HERE to return to Table of ContentsClick HERE to return to Table of Contents 53Summer 2015 | Breeze 53Summer 2015 | Breeze

Industry News

Gina McCarthy, head of the U. S. Environmental Protection Agency, spoke at a press conference at St. Paul Regional Water Services on April 8 on the importance of clean and safe water. With St. Paul mayor Chris Coleman on her right, McCarthy noted that St. Paul and Minneapolis recognize not only the public-health value related to safe drinking water but also the importance of safe water for economic vital-ity. “These two cities rock,” she proclaimed to the applause of the audience. McCarthy’s St. Paul stop was part of a Midwest tour to focus on the need to protect water sources, particularly rivers and streams that are vulnerable to pollution. She also received a tour of the St. Paul treatment plant (with Minnesota Department of Health commissioner Ed Ehlinger to her right).

Reprinted from the Waterline

Gina McCarthy speaks on importance of clean and safe water

Two members of the student senate had proposed the action to foster environmental sustainability and to promote access to free water. A former senate member objected to

the action on the grounds it would “infringe on personal liberty by imposing the senators’ environmental beliefs on others.”

Bemidji State offers non-disposable water bottles at no charge and has bottle-fi lling stations in its buildings

Click HERE to return to Table of Contents


Industry News

Minneapolis Water Works received the Sustainable Water Utility Management Award from the Association of Metropolitan Water Agencies. Only nine public drinking water systems nationally received the award, which recognizes water utilities that have made a commitment to management that achieves a balance of innovative and successful efforts in economic, social, and environmental efforts.

Minneapolis has incorporated strategies and fi nancial procedures that include requiring the water division to main-tain a minimum cash balance equal to approximately three months of operating expenses to keep cash fl ow available. It also implemented a fi ve-year capital improvement program that documents each construction project, its estimated cost, and the source of funding as well as the use of a fi xed rate in utility

Erin Briggeman of Black & Veatch wrote about the history of on-site sodium hypochlorite generation in a book edited by Black & Veatch Corporation, White’s Handbook of Chlorination and Alternative Disinfectants, 5th edition (copyright 2010 John Wiley & Sons, Inc):

“On-site generation of hypochlorite in the United States was largely inspired by the use of hypochlorite solution during World War I. . . . Its success as an antiseptic for treatment of open wounds led to on-site generation of it in hospitals. . . . Wallace & Tiernan (now part of Evoqua Water Technologies) fi rst made electrolytic chlorinators to provide a safe means of chlorinating swimming pools in buildings where people slept. . . . The chlori-nator aroused the interest of Pan American Airways, which, at the time (1936), was establishing refueling sites on its San Francisco-to-Sydney and Orient fl ights.

“After World War II, the enthusiasm for on-site generation of chlorine disappeared until the hazard potential of chlorine gas stored in containers was evaluated, owing to the proliferation of

Minneapolis Water Works Honoredbilling, which helps stabilize revenues from fl uctuations in water use due to weather conditions and the declining water demand by customers. Minneapolis has encouraged its customers to use water wisely and has been engaged in other environmental stewardship initiatives, including sustainable design in capi-tal projects, effi cient vehicles, collaboration on source water protection, support of urban farms and community gardens, promotion of the value of drinking water, and reduction of the use of disposable water bottles.

The Association of Metropolitan Water Agencies —an organi-zation of the largest publicly owned water utilities in the country—has recognized Minneapolis twice before, in 2002 with the Gold Award for Exceptional Utility Performance and in 2011 with the Platinum Award for Utility Excellence.

History of On-Site Sodium Hypochlorite Generation

chlorine gas installations at wastewater and potable water treat-ment plants. . . . In the 1970s the popularity of on-site genera-tion began to rise once again, largely because of the potential hazards of liquid-gas systems using chlorine stored in containers. . . . Starting in the 1990s, after the advent of the Uniform Fire Code, there has been a great surge in the interest of on-site generation of chlorine. The product is inherently safer because of its lower concentration. . . . Current on-site generation systems produce chlorine solutions containing only 0.8% chlorine, and this concentration is not classifi ed as hazardous.”

Briggeman said more interest in the system was sparked by the terrorist attacks on September 11, 2001. “After the attacks, the risk associated with chlorine gas systems was reevalu-ated. In addition, with a culture more attuned to risk and safety of operators and surrounding communities, interest in and installa-tion of on-site generation sodium hypochlorite units have seen a signifi cant increase.”

Portland ReboundsThe water utility in Portland, Oregon, has been in the news in recent years, but not for the most savory of reasons. Twice the utility has had to drain a reservoir after someone had been seen However, the city has rebounded with headlines focus-ing on how it is generating electricity from turbines installed in its water pipes. Portland has replaced a section of its water distribution system with pipes containing 42-inch turbines with power-attached generators. The energy produced is fed back

to the city’s electrical grip. The turbines and generators are installed in pipes in which the water doesn’t have to be pumped (pipes where the water fl ows downhill, for example). Eventually the system may generate more than 2 million dollars’ worth of renewable energy capacity over 20 years, projected as enough electricity to power to 150 homes.

More information, including a video, is available at http://tinyurl.com/kynz4wk. •

http://tinyurl.com/kynz4wk


AMERICAN AmarilloFast-Grip Gaskets

It’s More Than Just A Color – It’s Confidence

AMERICAN has been in the business of bright ideas for over 110 years. The bright yellow Amarillo Fast-Grip gasket is just the latest example of a water works innovation that benefits our customers and the public. Designed to the same specifications as the previous generation of Fast-Grips, the Amarillo model gives you added confidence that you’ve selected the proper gasket for the Fastite bell, that the gasket seated properly during installation and that it’s an AMERICAN product – made in America, The Right Way.

A M E R I C A N - U S A . C O M1 - 8 0 0 - 4 4 2 - 2 3 4 7

EOE/Minority/Female/Veteran/Disability

Chance Curtis | 763-856-0110 | [email protected]

http://www.sensus.com/aquasense


http://www.american-usa.com


News & Notes

Water Works! A Drinking Water Institute for Educators will be held at the Minneapolis Water Works ultrafi ltration treatment plant this summer from Monday, August 3 to Wednesday, August 5. Each year Minnesota science teachers attend the three-day Institute, learning about drinking water and ways to develop inquiry-based activities that can be incorporated into their existing science curriculum. The program is free to

2015 Drinking Water Institute to be Held in Minneapolis

interested teachers, who will receive college credit for their participation.

Water Works! is sponsored by the Minnesota Department of Health and the Minnesota Section of AWWA and is conducted through a partnership with Hamline University’s Center for Global Environmental Education. More information is available on the MDH website at www.health.mn.gov/water/institute/index.htm.

Mike Albrecht, who retired as superintendent of the water system in LaCrescent about a year ago, died last September 24. Albrecht had worked for the city’s maintenance department for 40 years. He retired as maintenance supervisor in 2013. The city has renamed its radium treatment plant, built in 2008, the Mike Albrecht Memorial Building.

Former Water Operators Mike Albrecht and Gerry “Boot” Butenhoff Die

Another recently retired operator, Gerry “Boot” Butenhoff of Red Wing, died March 26. Butenhoff had retired on November 1, 2014 after 37 years in the city’s utilities department. “He was a true lone wolf, going about life his own way but was always there when needed,” read his obituary.

DES MOINES, IOWA, April 20 – Hydro-Klean announced today that it has acquired Infratech. This acquisition allows Hydro-Klean to offer additional specialized trenchless rehabilitation services to municipal clients throughout the Midwest.

Infratech has built a reputation over 20 years for its superior collection system inspection and restoration services. Addi-tional services include pipeline cleaning and inspection, sealing and structural point repair systems, manhole sealing and rehabilitation, structural, restoration and protective coatings. Infratech’s extensive line of services, products and equipment complement Hydro-Klean’s wide range of municipal and indus-trial services.

Hydro-Klean Acquires Infratech“Infratech has developed a strong reputation for their trench-

less rehabilitation services,” said Paul Govoni, vice president of Hydro-Klean. “We strive to provide effective, effi cient and safe services to our clients. We know that by bringing together the Infractech team with Hydro-Klean, we will be able to provide even more to customers.”

The Infratech facility will remain in Rogers, Minn. For more information, please visit Hydro-Klean’s website.

Hydro-Klean provides an array of services to industrial and municipal clients throughout the Midwest. It’s headquartered in Des Moines, Iowa, with locations also in North Mankato, Minn., Sioux Falls, S.D. and Watertown, S.D.

MN AWWA is currently seeking nominations for two of our most prestigious awards: Operators’ Meritorious Service and Volunteer of the Year. This is your opportunity to help recognize the outstanding

Now Seeking Nominations for Volunteer of the Year and Operators’ Meritorious Service Awards

efforts of colleagues and peers in the Minnesota Section AWWA. For more information about the awards to download a nomination forms, go to https://mnawwa.site-ym.com/?AwardApplications.

http://www.health.mn.gov/water/institute/index.htm

https://mnawwa.site-ym.com/?AwardApplications


Trisha Sisto has joined the Drinking Water Protection Section of the Minnesota Department of Health as a public health sanitarian working on the groundwater monitoring virus study.

A native of Clinton Township in Michigan, Trisha has worked in biomedical, water, and tick research and most recently at a veterinary clinic. She is familiar with animals as she and her hus-band, Michael, have a dog, Tucker, and cats Cooper and Bonzai, in addition to Scarlett, a service dog in training who will be placed in a K9 service-dog program for veterans with post-traumatic stress disorders.

As for hobbies, Trisha loves to travel, enjoys outdoor sports, and is training for her fi rst triathlon. She also likes reading and trying new types of yoga. •

News & Notes

Trisha Sisto joins Drinking Water Protection Section of MDH

To reach water professionals through Breeze magazine and its targeted readership, contact

Darrell at your earliest convenience to discuss your company’s promotional plans for 2015.

Darrell Harris, Marketing Manager

Ph: 1-877-985-9793Fax: 1-866-985-9799 [email protected]

Visit us online

www.mnawwa.org

Call us for your fluid handling needs. Toll Free: 877-645-8004

2 Locations: One Cannon Street West

Dundas, MN 55019

1036B Aspen Avenue SE Menahga, MN 56464

w w w . m i n n e s o t a p u m p w o r k s . c o m

http://www.mnawwa.org


http://www.m

http://www.minnesotapumpworks.com


Neptune’s R900 and E-CoderTwo Proven Technologies Integrated Into One Device

• Single, Wireless AMR Solution

• High 8-Digit Resolution

• Leak Detection

• Tamper Detection

• Reverse Flow Detection

• Reduced Material & Labor Costs

Contact Ferguson Waterworks for complete details on the Neptune E-Coder) R900i . . . and take the next step in meter reading technology.

Bismarck, ND Blaine, MN DeKalb, IL Fargo, ND Madison, WI Belfield, ND Superior, WI 701-258-9700 763-560-5200 815-756-2800 701-293-5511 608-271-1770 701-258-9700 715-392- 3288800-932-8759 800-844-8334 866-759-2800 800-437-4362 800-833-0880 800-932-8759

www.ferguson.com

E-Coder) R900i

http://www.ferguson.com



What an exciting time for AWWA and its members!!! We are on our way to becoming a premier non-profi t global organization focusing on total water solutions. AWWA is going to establish its fi rst international community (outside of North America) in India. In an effort to achieve Association’s vision of a “better world through better water,” the International Council of AWWA has analyzed the publication sales and membership and registration metrics of our international members/customers. It is also evaluated demographically along with environmental and political aspects of the countries with which AWWA would make a difference. After this analysis, India emerged as the top country to investigate an in-country presence.

The primary purpose of AWWA India is to serve the needs of the Indian AWWA members and act as a resource for helping the Indian water professionals improve water and wastewater supply and distribution, build a community to support educational needs, and advance a sustainable future in India.

As a part of the AWWA India initiative, David LaFrance (AWWA Chief Executive Offi cer), John Donohue (AWWA President), and Nilaksh Kothari (AWWA Past President) represented AWWA at the Indian Water Works Association (IWWA) Conference, which was held from January 30-February 1, 2015 in Kolkata, India. As I mentioned in the Fall 2014 Breeze, my family and I planned our India vacation around the same time, which gave me an opportunity to join the AWWA delegation at the IWWA Conference. In addition to delivering technical presentations at the conference, we met with various groups and government entities in India over the two week period of time. With an eye toward AWWA India’s training mission, LaFrance, Donohue, and Kothari have hosted three half-day seminars in New Delhi, Bangalore, and Mumbai that touched on important water issues such as asset management,

News & Notes

AWWA India

leak detection, and rate issues. During this time, I was able to conduct two workshops for the Hyderabad Water Sanitation Board on the water treatment plant optimization.

Since we came back from our successful India trip, the AWWA India membership increased from 25 to 100 members. At this rate, we are anticipating that the membership will reach 250 members by the end of this year. An AWWA India delega-tion containing 25-40 members is planning on coming to ACE 2015 conference in Anaheim.

During our India trip, some of the water treatment utilities in India have expressed interest in receiving operator training from AWWA. AWWA is anticipating similar requests from some more utilities in the near future. To address these requests and modify the existing AWWA training modules to more India-centric training modules, President John Donohue has formed a North American Advisory Group. This group will act as the bridge between AWWA and AWWA India volunteer leaders for delivering the training modules to the water utilities in India. I felt honored and privileged when President Donohue asked me to chair this group. I am very happy to be a part of this historic initiative of AWWA.

AWWA anticipates introducing AWWA India’s fi rst execu-tive manager in the coming months. In addition to opening an offi ce, the executive manager’s initial focus will be on building a community of water professionals who collaborate to support public health, environmental protection, and best management practices. AWWA India will also develop training for engineers and utility managers.

The AWWA India initiative will serve as the model for AWWA to grow its presence and be the premier non-profi t global organization for total water xolutions. I will keep you posted on AWWA India updates in the future. Until next time . . . •


Professional Directory

Offi ce: (763) 427-6100Direct: (763) 427-6101Mobile: (763) 286-5283

Project ManagerSubmersible & Lineshaft Turbine Sales & Service

15688 Jarvis Street N.W. • Elk River, MN 55330

KATIE RENNER WELLE

INCORPORATEDWELL DRILLING FOR FIVE GENERATIONS

E.H. Renner & Sons

[email protected]: (763) 427-0533

Water Treatment

Storage & Collection

Wastewater

Collection & Treatment

Hydraulics | Hydrology

Pipestone, MN Sioux Falls, SD Brookings, SD Toll Free 855.323.6342

BANNEREngineering | Architecture | Surveying

www.bannerassociates.com









http://www.DownholeWellServices.com




Company Page Phone Number Web Address

ABC Waterline Specialists 16 218-220-0166 [email protected]

ACIPCO 55 205-325-7701 american-usa.com

AE2S 15 701-364-9111 www.ae2s.com

AECOM 33 763-473-0400 www.aecom.com

ANOKA Technical College 51 763-576-4948 www.anokatech.edu

Apex Engineering Group 32 701-373-7980 www.apexenggroup.com

Badger State Inspection, LLC 24 [email protected]

Banner Associates, Inc. 60 507-931-0930 www.bannerassociates.com

Bergerson-Caswell, Inc. 16 763-479-3121 www.bergersoncaswell.com

Bilfi nger Water Technologies - Airvac 7 813-855-6297 www.water.bilfi nger.com

Black & Veatch Corporation 24 952-896-0500 www.bv.com

Bolton & Menk, Inc 6 507-625-4171 www.bolton-menk.com

Brown and Caldwell 15 800-727-2224 www.brownandcaldwell.com

CEI 50 800-344-5770 www.ceifi ltration.com

Dixon Engineering, Inc. 13 800-968-5488 www.dixonengineering.net

Downhole Well Services, LLC. 60 651-238-1198 www.DownholeWellServices.com

E.H. Renner & Sons 60 763-427-6100 www.ehrenner.com

Engineering America 2 651-777-4041 www.engamerica.com

eRPortal Software Group 22 413-233-5400 www.erportalsoftware.com

Ess Brothers and Sons Inc 10 763-478-2027 www.essbrothers.com

Ferguson Waterworks 4, 58 612-850-9495 www.ferguson.com/waterworks

General Repair Service 19 800-767-5151 www.generalrepair.com

Hawkins, Inc. 34 612-331-6910 www.hawkinsinc.com

HD Supply Waterworks 63 952-937-9666 www.waterworks.hdsupply.com

HR Green, Inc. 24 800-728-7805 www.hrgreen.com

Hydro Design, Inc. 20 800-315-4305 www.hydrodesignsinc.com

Hydro-Klean 28 515-283-0500 www.hydro-klean.com

Interstate Companies 28 651-765-0765 www.interstatepm.com

Jasper Engineering & Equipment Co. 16 952-938-6504 www.jaspereng.com

KLJ 23 800-213-3860 www.kljeng.com

Company Page Phone Number Web Address

Kodru-Mooney 11 952-479-1045 www.kodru-equipment.com

Leggette, Brashears & Graham, Inc. 60 203-944-5010 www.lbgweb.com

M.E. Simpson Co.Inc. 60 800-255-1521 www.mesimpson.com

Maguire Iron 58 605-334-9749 www.maguireiron.com

Medora Corporation (SolarBee and GridBee brands)

3 866 437 8076 www.medoraco.com

Mid America Meter Inc. 60 800-324-0365 www.midamericameter.com

Minnesota Pipe & Equipment 57 800-325-5636 www.minnesotapipe.com

Moore Engineering Inc. 64 701-282-4692 www.mooreengineering.com

Northwestern Power Equipment Company

28 651-628-0683 www.nwpeco.com

Pittsburg Tank & Tower Maintenance Co. Inc.

9 270-826-9000 www.watertank.com

Pollardwater.com 9 800-437-1146 www.pollardwater.com

Prinsco 13 320-222-6800 www.prinsco.com

Progressive Consulting Engineers, Inc. 60 763-560-9133 [email protected]

Quality Flow Systems Inc. 62 952-758-9445 www.qfsi.net

Sensus USA. Inc. 55 715-634-4000 www.sensus.com

Short Elliott Hendrickson Inc. 27 651-490-2000 www.sehinc.com

Stantec 8 651-636-4600 www.stantec.com

Summit Envirosolutions 18 612-750-4024 www.summite.com

Thein Well Company 60 800-450-8000 www.theinwell.com

Titan Energy Systems 21 952-960-2371 www.titanenergy.com

TKDA 34 651-292-4621 www.tkda.com

Tonka Water 8 763-559-2837 www.tonkawater.com

Van Bergen & Markson, Inc. 34 763-546-4340 [email protected]

Vessco 33 952-941-2678 www.vessco.com

W. W. Goetsch Associates, Inc. 28 952-831-4340 [email protected]

Water Conservation Services, Inc. 16 612-600-8716 www.watermainleaklocator.com

Widseth Smith Nolting 24 218-829-5117 www.widsethsmithnolting.com

WSB & Associates, Inc. 27 763-541-4800 www.wsbeng.com

Ziegler Power Systems 34 888-320-4292 www.zieglercat.com/power

Ad Index

The Breeze would not be possible without the adver tising suppor t of the following companies and organizations. Please think of them when you require a product or service.

Darrell Harris, Marketing ManagerTo reach water professionals through Breeze

magazine and its targeted readership, contact

Darrell at your earliest convenience to discuss

your company’s promotional plans for 2015.

Ph: 1-877-985-9793Fax: 1-866-985-9799 [email protected]


http://www.ae2s.com


http://www.anokatech.edu

http://www.apexenggroup.com



http://www.water.bilfi

http://www.bv.com



http://www.ceifi


http://www.DownholeWellServices.com





http://www.ferguson.com/waterworks


http://www.hawkinsinc.com

http://www.waterworks.hdsupply.com



http://www.hydro-klean.com


http://www.jaspereng.com








http://www.minnesotapipe.com

http://www.mooreengineering.com



http://www.pollardwater.com



http://www.qfsi.net

http://www.sensus.com






http://www.tkda.com

http://www.tonkawater.com





http://www.widsethsmithnolting.com


http://www.zieglercat.com/power




The cycle of solutions - water and wastewater technology

Water is crucial for our survival. Clean water supplies and efficient sewage

treatment have never been more important. KSB’s know-how and extensive

product range help you meet all water supply and treatment requirements,

efficiently and effectively. We offer end-to-end solutions addressing all

stages of the water cycle from water extraction to sewage treatment.

www.ksbusa.com

KSB Authorized Distributor

800 6th Street NW, New Prague, MN 56071Ph. (952) 758-9445 Fax. (952) 758-9661www.qfsi.net [email protected]

http://www.ksbusa.com


http://www.qfsi.net

http://www.hdswaterworks.com

Breeze Summer 2015 RICH · 2018-04-02 · 6 6 Breeze | Summer 2015 Click HERE to return to Table of...

Documents

Transcript of Breeze Summer 2015 RICH · 2018-04-02 · 6 6 Breeze | Summer 2015 Click HERE to return to Table of...