Post on 04-Apr-2018
1
TITLE 1
2
AcMNPV LEF-2 is a Capsid Protein Required for 3
Amplification but not Initiation of Viral DNA Replication 4
5
AUTHORS 6
Carol P. Wu1,2,3
, Yi-Ru Huang3, Jen-Yeu Wang
3, Yueh-Lung Wu
3, Huei-Ru Lo
3, Jui-7
Ching Wang3, and Yu-Chan Chao
3,4,5∗ 8
1. Department of Chemistry, National Tsing-Hua University, Hsinchu 300; 9
2. Chemical Biology and Molecular Biophysics, Taiwan International Graduate 10
Program, Academia Sinica, Taipei 115; 11
3. Institute of Molecular Biology, Academia Sinica, Taipei 115; 12
4. Department of Plant Pathology and Microbiology, National Taiwan University, 13
Taipei 106; 14
5. Department of Life Sciences, National Chung-Hsing University, Taichung 403, 15
Taiwan, ROC. 16
17
Running title: LEF-2 is a capsid protein required for DNA amplification 18
∗ Correspondence to Yu-Chan Chao, e-mail: mbycchao@gate.sinica.edu.tw 19
Tel: +886-2-2788-2697, FAX: +886-2-2782-6085 20
21
Word Count for abstract: 208 22
Word count for the text: 23
Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Virol. doi:10.1128/JVI.02423-09 JVI Accepts, published online ahead of print on 10 March 2010
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
2
ABSTRACT 24
The late expression factor 2 (lef-2) gene of baculovirus Autographa californica 25
multiple nucleopolyhedrovirus (AcMNPV) has been identified as one of the factors 26
essential for origin-dependent DNA replication in transient expression assays and has 27
been shown to be involved in the late/very late gene expression. To study the function of 28
lef-2 in the life cycle of AcMNPV, a lef-2 knockout mutant and repair bacmids were 29
generated by homologous recombination in Escherichia coli. Growth curve analysis 30
showed that lef-2 was essential for virus production. Interestingly, DNA replication assay 31
indicated that lef-2 is not required for the initiation of viral DNA replication; rather, it is 32
required for the amplification of DNA replication. lef-2 is also required for the expression 33
of late and very late genes, as the expression of these genes were abolished in the lef-2 34
knockout bacmid. Temporal and spatial distribution of LEF-2 protein in infected cells 35
was also analyzed and the data showed that LEF-2 protein was localized to the virogenic 36
stroma in the nuclei of the infected cells. Analysis of purified virus particles revealed that 37
LEF-2 is a new viral protein component of both budded and occlusion-derived virions, 38
predominantly in the nucleocapsids of the virus particles. This observation suggests that 39
LEF-2 may be required immediately after virus entry into host cells for efficient viral 40
DNA replication. 41
42
43
Keywords: Autographa californica multiple nucleopolyhedrovirus; late expression 44
factor-2 (lef-2); gene knockout. 45
46
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
3
INTRODUCTION 47
The Baculoviridae family consists of a group of invertebrate-specific viruses that 48
contain a circular double-stranded DNA genome with sizes between 82-180 kb (15). 49
Among them, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is the 50
best-studied baculovirus. The genome size of AcMNPV is ~ 134kb and sequence analysis 51
of its genome showed that it contains 155 open reading frames (ORFs) with protein-52
coding potential (3). AcMNPV produces two forms of virus progeny during its infection 53
cycle, budded viruses (BVs) and occlusion-derived viruses (ODVs). Although both 54
contain identical genetic materials, they are produced at different stages of virus infection 55
and mediate baculovirus infection through different routes. BVs are produced during the 56
early stage of baculovirus infection and mediate systematic infection within the hosts. 57
BVs obtain their envelopes as they bud off the plasma membranes of the infected cells, 58
which contain baculovirus GP64 protein. GP64 is important for BV entry into 59
neighboring cells (5). ODVs are produced during the very late stage of baculovirus 60
infection and are embedded within a crystalline structure made up of polyhedrin proteins, 61
forming occlusion bodies (OB). OBs are very stable in the natural environment and are 62
disintegrated only under alkaline conditions, e.g., the mid-guts of insects after ingestion 63
by the host, releasing ODVs for primary infection. 64
Based on the temporal expression of the viral genes, the baculovirus infection 65
cycle is divided into three phases: early, late, and very late. Early genes are transcribed by 66
host RNA polymerase; late and very late genes are transcribed by a virus-encoded RNA 67
polymerase during or after viral DNA replication. Most early gene products are involved 68
in DNA replication and the expression of late and very late genes depend on DNA 69
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
4
replication and viral transactivators. Baculovirus late gene expression requires 20 virus-70
encoded factors, termed late expression factors (lefs) (23, 33, 37). Six of these 20 factors, 71
ie-1, lef-1, lef-2, lef-3, p143 and dnapol, were required for the replication of the origin-72
containing plasmid in transient expression experiments (16). They were also capable of 73
indirectly triggering apoptosis through DNA replication events in virus-infected cells, 74
leading to host translational shutoff (35). Because all the late expression factors were 75
transiently expressed during these experiments, it was possible to overlook the functional 76
importance of some factors whose expression was regulated by other viral factors during 77
the course of virus infection. The development of bacmid technology has enabled the 78
generation of viral DNA lacking genes essential for virus viability in Escherichia coli, 79
which was impossible to achieve in the past in insect cells. Based on this technique, the 80
functional importance of viral genes in the virus lifecycle can be studied in the context of 81
the virus genome and consequently provide new insights into the functions of the genes 82
of interest. For example, analysis of viral DNA lacking lef-11, which was previously 83
thought to be non-essential for DNA replication, demonstrated that lef-11 was, in fact, 84
essential for viral DNA replication as lef-11 deletion virus did not undergo viral DNA 85
replication (17); hence lef-11 became an essential replicative lef in addition to those 86
identified by plasmid-based replication assays. It was also reported that ie-0 can 87
functionally substitute for ie-1 (37) and therefore there are a total of 8 replicative lefs. 88
lef-2 was initially identified as one of the lefs required for origin-dependent DNA 89
replication based on transient expression experiments (16). It was also demonstrated to be 90
one of the three genes essential for late and very late gene expression (32) and its 91
expression level was found to have a positive effect on the strength of the very late 92
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
5
polyhedrin promoter (41). A single mutation at the 3′ end of lef-2 gene was also shown to 93
abolish very late polyhedrin and p10 promoter activities (27). In addition, the lef-2 94
sequence is part of the polyhedrin upstream sequence (pu), which functions as a 95
transcriptional enhancer (1, 22, 39). LEF-2 was also demonstrated to interact with LEF-1, 96
another lef gene required for viral DNA replication, through yeast-two-hybrid analysis 97
(10). The region encompassing amino acids 20 to 60 of LEF-2 was found required for its 98
interaction with LEF-1 and their interaction was a pre-requisite for origin-dependent 99
DNA replication. Because LEF-1 is a DNA primase (28), LEF-2 was thus termed a 100
“primase associated factor”. These previous reports suggest that lef-2 is involved in at 101
least two processes during baculovirus infection: DNA replication and late/very late gene 102
expression. Nevertheless, the exact functions of LEF-2 in these two processes and its role 103
in the life cycle of the virus are not yet clear. 104
In this study, we examined the effects of lef-2 deletion on the various stages of 105
baculovirus infection by generation of a lef-2 knockout bacmid. The results showed that 106
lef-2 deletion virus was deficient in budded virus production. Further dissection of lef-2’s 107
role in viral DNA replication showed that lef-2 is not essential for the initiation of viral 108
DNA replication, rather, it is crucial for efficient viral DNA amplification. lef-2 deletion 109
severely impaired late vp39 and very late p10 gene expressions but the onset of 110
immediate early ie-1 expression was not compromised. Interestingly, LEF-2 was found 111
incorporated into the nucleocapsids of BVs and ODVs, suggesting that the function of 112
LEF-2 may be required immediately after virus entry into the cells. 113
114
MATERIALS AND METHODS 115
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
6
Cell Culture and viruses. The Spodoptera frugiperda IPLB-Sf21 (Sf21) cell line was 116
cultured as a monolayer in TC-100 insect medium containing 10% heat-inactivated fetal 117
bovine serum (FBS) (19). It was used for the generation and propagation of recombinant 118
baculoviruses. All viral stocks were prepared and their titers determined by 50% tissue 119
culture infection dose (TCID50) and quantitative PCR (Q-PCR) (21). 120
121
Construction of lef-2 knockout and repair bacmids. To generate the lef-2 deletion 122
bacmid, a CAT cassette was first generated in which chloramphenicol gene was flanked 123
by ~ 500 nucleotides homologous to the upstream and downstream regions of lef-2 124
coding sequence. This cassette was introduced into DH10Bac™ Competent E. coli cells 125
carrying wild-type AcMNPV genomic DNA (bMON14272) for the generation of lef-2 126
knockout bacmid, bAc∆lef2
, by λ Red recombination as previously described (38). A 127
reporter cassette containing heat-shock 70 promoter driving the expression of egfp was 128
inserted into pFastBac1 (Invitrogen), yielding pFashE. pFashE was used to introduce egfp 129
into wild-type AcMNPV bacmid, bAcwt
, and bAc∆lef2
by site-specific transposition, 130
generating reporter bacmids bAcwt-hE
and bAc∆lef2-hE
. To introduce lef-2 back to bAc∆lef2
, a 131
lef-2 repair plasmid was constructed. The rabbit β-globin terminator sequence was 132
amplified from pTriEx-3 (Novagen) with primers Glu-F and Glu-R (Table 1) and 133
subsequently cloned into pGL3-basic vector digested with BamHI and NcoI, yielding 134
pGlobin. The region containing lef-2 gene sequence and its putative promoter was 135
amplified from AcMNPV genomic DNA with orf4-F and lef-2-BamHI-R primers (Table 136
1). The PCR product was digested with XhoI and BamHI and cloned into pGlobin 137
linearized with SalI and BamHI, generating pLef2-globin. pLef2-globin was digested 138
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
7
with SphI and NheI and the resulting lef2-globin fragment was inserted into pFashE, 139
yielding pFhElef2-repair. pFhElef2-repair was used to insert egfp and lef-2 into 140
polyhedrin locus of bAc∆lef2
, yielding repair bacmid bAc∆lef2-Rep-hE
. Confirmation of 141
deletion at lef-2 locus was performed by PCR with ko-A and ko-B (Table 1) and 142
subsequent digestion of the PCR product by AscI, which has two unique cutting sites in 143
cat and none in lef-2. Intact lef-2 would yield a 945-bp product and replacement of lef-2 144
by CAT reporter cassette would yield a 1,400-bp fragment (data not shown). 145
To generate HA-tagged lef-2 repair bacmid, a fragment containing the lef-2 146
promoter region was amplified from AcMNPV genomic DNA with orf4-SacI-F and orf5-147
KpnI-R (Table 1) and inserted into an HA-tag-containing plasmid pGL3HA, yielding 148
pGLp3HA. The lef-2 coding sequence and β-globin terminator sequence were amplified 149
from pLef2-globin with lef2-AvrII-F and RVprimer3 (Table 1) and the resulting PCR 150
fragment was inserted downstream of lef-2 putative promoter in pGLp3HA and in frame 151
with HA tag sequence, generating pG3HA-repair. lef-2 repair fragment (lef-2 promoter + 152
coding region + β-globin terminator) was released from pG3HA-repair by digestion with 153
SphI and NheI and inserted into pFashE to yield pFhElef2-HA. A fragment containing 154
polyhedrin and its own promoter and transcriptional terminator was amplified with 155
polh/SphI-F and polh/NotI-R (Table 1). The PCR product was digested with SphI and 156
NotI and inserted into pFhElef2-HA to yield pFhElef2-HApolh. This plasmid was used to 157
insert egfp reporter, HA-tagged lef-2, and polyhedrin into the polyhedrin locus of bAc∆lef-
158
2, yielding bAc
hE-lef2HA-polh. 159
160
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
8
Bacmid DNA purification and transfection. Bacmid DNA was first purified with 161
PureLink HiPure Plasmid DNA purification Kit (Invitrogen) and subsequently re-162
transformed into ElectroMAX DH10B T1 phage resistant cells (Invitrogen). Bacterial 163
colonies were selected on sensitivity to tetracycline and resistance to kanamycin and 164
gentamycin, an indication that the bacterial clones contain only the desired bacmid DNA 165
and no helper plasmid, and purified for subsequent experiments. Sf-21 cells (2 × 106) 166
were transfected with 2 µg of purified bacmid DNA using Cellfectin (Invitrogen) as 167
transfection reagent following manufacturer’s protocol. 168
169
Growth curve assay. Sf-21 cells were transfected with indicated bacmid DNA or 170
infected with recombinant virus at a multiplicity of infection (MOI) of 5. Five hours after 171
transfection or 1 hour after infection, cells were washed with phosphate-buffered saline 172
(PBS) and replenished with fresh 10% FBS-containing TC-100 culture medium. This 173
time point was designated as time zero. Supernatants were collected from transfected - or 174
infected - Sf-21 cells at indicated time points and cleared by centrifugation at 1,000 × g 175
for 5 minutes. The titers were determined by TCID50 and then double checked with Q-176
PCR (21). The data points were plotted as average infection results from triplicate assays 177
of three independent experiments. 178
179
Dpn-I replication assay. One microgram of bAc∆gp64
, bAc∆lef2-hE
, or bAc∆p143-pETLE
180
bacmid DNA was transfected into 1 × 106 Sf-21 cells and, at the indicated time points, 181
transfected cells were washed with PBS and collected. pETLE indicated that the egfp 182
coding region is driven by the etl promoter (20). The cell pellets were lysed with 500µl of 183
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
9
lysis buffer (10 mM Tris, pH = 8; 100 mM EDTA; 20 µg/ml RNase A; 0.5% SDS; 80 184
µg/ml proteinase K) and incubated overnight at 37°C. The samples were extracted once 185
with phenol, once with phenol/chloroform, and once with chloroform. Total cellular 186
DNA was precipitated with 0.5 volume of 7.5M ammonium acetate and 2 volumes of ice-187
cold ethanol, washed with 70% ice-cold ethanol, and re-suspended in 100 µl of TE buffer. 188
Two micrograms of total DNA were treated with 20U of EcoRI or EcoRI/DpnI, resolved 189
on a 0.8% agarose gel, and subsequently transferred to a Hybond-N+ nylon membrane 190
(Amersham Bioscience). The membrane was probed with DIG-labeled lef-1 gene 191
sequence synthesized with PCR DIG Probe Synthesis Kit (Roche) using lef1p-F and 192
lef1p-R (Table 1) and detected with DIG detection kit (Roche). 193
194
Northern blot analysis. Sf-21 cells (1 × 106) were infected with vAc
wt-hE or vAc
∆lef2-Rep-195
hE at MOI = 10. Infected cells were harvested at the indicated time points and total RNA 196
was extracted with an RNeasy Mini Kit (Qiagen, Venlo, Netherlands). Five micrograms 197
of total RNA was resolved on a 1% formaldehyde agarose gel and subsequently 198
transferred to a Hybond-N+ nylon membrane. The membrane was probed with DIG-199
labeled anti-sense strand of lef-2 transcripts and detected with DIG detection kit (Roche). 200
To study ie1, vp39, and p10 expression, 1 µg of bAcwt-hE
, bAc∆lef2-hE
, or bAc∆lef2-Rep-hE
201
bacmid DNA was transfected into 5 × 105 Sf-21 cells. Transfected cells were harvested at 202
24, 48, and 72 hours post transfection. Total RNA was extracted and 5 µg (for vp39 and 203
p10 transcripts) or 15 µg (for ie1 transcript) of total RNA were resolved on a 1% 204
formaldehyde agarose gel. RNA samples were transferred to a Hybond-N+ nylon 205
membrane and hybridized with DIG-labeled anti-sense RNA probes for ie-1, vp39, and 206
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
10
p10 transcripts respectively. The presence of target RNA was detected with a DIG 207
detection kit (Roche) (42). The primers used to synthesize DIG-labeled lef-2, ie-1, vp39, 208
and p10 RNA probes were listed in Table 1. 209
210
Cellular localization of LEF-2 in nucleus and cytoplasm. 2 × 106 cells were infected 211
with vAchE-lef-2HA-polh
at MOI = 10. Infected cells were harvested at 0, 6, 12, 16, 20, 24, 30, 212
36, and 48 hours post infection. Cytoplasmic and nuclear fractions of the infected cells 213
were prepared as described by Fang et al. (11). One fifth of each fraction was analyzed 214
on 10% SDS-PAGE and by Western blotting with: a) primary mouse monoclonal 215
antibody against HA (1:1,000, Cell Signaling) and horseradish peroxidase (HRP)-216
conjugated secondary antibody against mouse (1:5,000); and b) primary mouse 217
monoclonal antibody against baculovirus GP64 (1:3,000, eBioscience) and HRP-218
conjugated antibody against mouse (1:5,000). 219
220
Immunofluorescence microscopy. Sf-21 cells were seeded on chamber slides (Nalge 221
Nunc International) and infected with HA-tagged repair virus vAchE-lef2HA-polh
at MOI = 222
20. At 16 hours post infection, infected cells were washed three times with phosphate 223
saline buffer (PBS) and fixed with 2% paraformaldehyde for 10 minutes at room 224
temperature. Fixed cells were washed three times with PBS, permeabilized with 0.2% 225
Triton X-100 for 15 minutes at room temperature, and rinsed three times with PBS-T 226
(PBS containing 0.1% Tween 20). Cells were incubated in blocking buffer (1% normal 227
goat serum in PBS-T) for one hour at room temperature before incubation with primary 228
mouse monoclonal antibody against HA diluted in blocking buffer (Covance, 1:200) at 229
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
11
4°C overnight. Cells were washed four times with PBS-T; 5 minutes each wash; followed 230
by incubation with Alexa Fluor
405 goat anti-mouse IgG antibody (Molecular Probes, 231
1:200) diluted in blocking buffer for 1 hour at room temperature. Following 4 washes 232
with PBS-T, cellular and viral DNAs were stained with propidium iodine (Molecular 233
Probes, 1:10,000 in PBS) for 5 minutes at room temperature. Cells were rinsed three 234
times with PBS before the chamber slides were disassembled, covered with cover slips, 235
and sealed with mounting medium. Cells were viewed with a 63× oil immersion lens on a 236
confocal laser-scanning microscope (LSM510 META; Zeiss). Images were taken, viewed, 237
and analyzed with LSM Image software (Zeiss). 238
239
Purification of virus particles from BV and ODV. Sf-21 cells were infected with 240
recombinant baculovirus vAchE-lef2HA-polh
at an MOI of 5. At 4 days post infection, the 241
cells were collected and used to extract ODVs as described previously (7). For BV 242
purification, Sf-21 cells were infection with vAchE-lef2HA-polh
at an MOI of 0.5 and the 243
supernatant was collected at 5 days post infection and subjected to low-speed 244
centrifugation at 3,000g for 10 minutes. The supernatant was then subjected to high-245
speed centrifugation at 80,000g (24,000rpm, SW28, Beckmann) for 90 minutes. The 246
virus pellet was re-suspended in protease inhibitor-containing PBS and loaded onto a 247
25 – 60% sucrose gradient. The sample was centrifuged at 96,000g (27,900 rpm, SW41) 248
at 4°C for 3 hours. The virus particles were collected, diluted with PBS, and centrifuged 249
again at 80,000g (21,600 rpm, SW41) for 90 minutes to pellet the budded viruses. The 250
purified budded-virus particles were re-suspended in Tris-HCl (pH = 8.5). 251
252
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
12
Separation of nucleocapsid and envelope proteins of BV and ODV. To separate 253
nucleocapsids from the envelopes, the purified BVs and ODVs were incubated in 254
separation buffer (1 % Nonidet P-40 and 10 mM Tris-HCl, pH 8.5) on a rotating platform 255
for 30 minutes at room temperature (11). The mixture was overlaid onto 4 ml of 30% 256
glycerol (W/V) and centrifuged at 150,000g (34,000 rpm, SW60) at 4°C for one hour. 257
The pellet obtained after centrifugation contained the nucleocapsids of the virus particles 258
and was resuspended in 10 mM Tris-HCl, pH 7.5. The fraction above the interface at the 259
top of the supernatant contained the envelope proteins and was collected and precipitated 260
with 4 volumes of acetone. The precipitated envelope proteins were resuspended in 10 261
mM Tris-HCl, pH 7.5. 262
263
Western blot analysis. To detect the presence of HA-tagged LEF-2 in BV and ODV, 10 264
µg of BV or ODV and 5 µg of the nucleocapsid and envelope fractions of purified virus 265
particles were mixed with 2× SDS sample buffer and resolved in a 10% SDS-PAGE gel. 266
The protein samples were probed with the following antibodies: 1) primary mouse 267
monoclonal antibody against HA tag (1:1,000) and horseradish peroxidase-conjugated 268
secondary antibody against mouse (1:5,000); 2) primary mouse monoclonal antibody 269
against baculovirus GP64 (1:3,000, eBioscience) and HRP-conjugated antibody against 270
mouse (1:5,000); and 3) primary rabbit polyclonal antibody against baculovirus VP39 271
(1:2,500, Abnova) and HRP-conjugated antibody against rabbit (1:5,000). The membrane 272
was detected with enhanced chemiluminescence system (Immobilon Western, Millipore). 273
274
275
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
13
RESULTS 276
Generation of lef-2 knockout and repair AcMNPV bacmids. To generate the lef-2 277
deletion bacmid DNA, the E. coli λ Red recombination system was exploited to replace 278
the lef-2 gene with a chloramphenical acetyltransferase (CAT) expression cassette in the 279
lef-2 locus through homologous recombination in E. coli. Replacement at the lef-2 locus 280
of wild-type bacmid (bMON14272) was confirmed by PCR as mentioned in Materials 281
and Methods. 282
In order to follow the progression of virus infection, the eGFP expression cassette 283
was inserted into the polyhedrin locus of wild-type bacmid (bAcwt
) and lef-2KO bacmid 284
(bAc∆lef2
) by site-specific transposition, yielding bAcwt-hE
and bAc∆lef2-hE
(Fig. 1). A lef-2 285
repair bacmid was constructed in which the lef-2 coding sequence and its own promoter 286
region, along with eGFP reporter cassette, were inserted into the polyhedrin locus of 287
bAc∆lef2
to obtain bAc∆lef2-Rep-hE
. To monitor the distribution of LEF-2 in infected cells, an 288
additional lef-2 repair bacmid, bAchE-lef2HA-polh
, was constructed in which the HA tag 289
sequence was added to the 5′-end of lef-2 coding sequence. All clones were checked by 290
PCR at both lef-2 and polyhedrin loci (data not shown). 291
292
Analysis of wt, lef-2KO, and repair bacmids in Sf-21 cells. In order to determine the 293
effects of lef-2 deletion on virus growth, Sf-21 cells were transfected with bAcwt-hE
, 294
bAc∆lef2-hE
, or bAc∆lef2-Rep-hE
. At 24 hours post transfection, green fluorescence could be 295
observed in transfected cells (Fig. 2A). No obvious difference in the number of green 296
fluorescent cells was observed among these three viruses indicating equal transfection 297
efficiency even though the intensity of green fluorescence was noticeably lower in 298
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
14
bAc∆lef2-hE
-transfected cells. At 48 hours post transfection, almost all cells transfected 299
with bAcwt-hE
fluoresced green suggesting generation of budded viruses for secondary 300
infections. The intensity of green fluorescence reached maximum at 72 hours post 301
transfection and then started to decline most likely due to cell lysis as a result of virus 302
infection. The number of green fluorescent cells and the intensity of green fluorescence in 303
bAc∆lef2-hE
-transfected cells also increased from 24 to 48 hours post transfection but to a 304
much lesser extent than the wild-type virus. No further significant changes in the number 305
of green fluorescent cells and the intensity of green fluorescence were observed after 48 306
hours post transfection. Small aggregates of green fluorescent cells were occasionally 307
observed in bAc∆lef2-hE
-transfected cells after 72 hours post transfection, which did not 308
develop further into infection foci (data not shown). Sf-21 cells transfected with repair 309
virus bAc∆lef2-Rep-hE
exhibited similar virus growth to cells transfected with wild-type 310
virus. The similarity in infection pattern between wild-type and repair viruses suggested 311
that the phenotype observed in lef-2 deletion virus was due to the absence of lef-2. 312
313
lef-2 deletion abolished budded virus production. To quantify the effect of lef-2 314
deletion on budded virus production, virus growth curves were determined for bAcwt-hE
, 315
bAc∆lef2-hE
and bAc∆lef2-Rep-hE
. The supernatants were collected from transfected cells at 316
the indicated time points post transfection and the titers were determined. The results 317
showed that no budded viruses were produced in cells transfected with lef-2 knockout 318
viruses up to 120 hours post transfection (Fig. 2B). On the other hand, bAcwt-hE
and 319
bAc∆lef2-Rep-hE
exhibited normal virus growth curves that reached a plateau at 48 and 96 320
hours post transfection, respectively (Fig. 2B). These results indicate that lef-2 deletion 321
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
15
impaired budded virus production in transfected cells. This was in agreement with the 322
green fluorescence observation in transfected cells where green fluorescence expression 323
was restricted to initially bAc∆lef2-hE
-transfected cells. 324
After 12 hours post transfection, the titer of bAc∆lef2-Rep-hE
was consistently around 325
1 order of magnitude lower than that of bAcwt-hE
. To confirm that the virus progeny 326
produced by the repair virus and that produced by the wild-type virus was equally 327
infectious, fresh Sf-21 cells were infected with budded viruses collected from bAcwt-hE
or 328
bAc∆lef2-Rep-hE
-transfected cells at MOI = 5. No significant phenotypic difference was 329
observed with fluorescence microscope (data not shown). The virus growth curve in 330
vAcwt-hE
and vAc∆lef2-Rep-hE
-infected cells was determined (Fig. 2C). Virus titer in repair 331
virus-infected cells was still lower than that in wild-type virus-infected cells at all time 332
points, nevertheless by a much smaller margin than in transfection experiments and both 333
generated similar virus growth curves. This demonstrated that the repair virus was as 334
infectious as wild-type virus. 335
The slightly inferior growth of the repair virus may indicate that the temporal 336
expression of lef-2 was altered in the repair virus since lef-2 was re-inserted into the 337
polyhedrin locus instead of its original locus. To compare the transcriptional profile of 338
lef-2 in wild-type and repair virus-infected cells, northern blot analysis was performed 339
with anti-sense RNA probe of lef-2 transcripts. The onset of lef-2 expression in repair 340
virus was delayed by ~ 4 hours compared to that in wild-type virus (Fig. 3). The lef-2-341
specific transcript in repair virus was somewhat larger in size as compared to that in wild-342
type virus (indicated by arrows). This was probably due to the presence of β-globin 343
terminator sequence in place of lef-2 putative terminator sequence in repair virus. The 344
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
16
amounts of lef-2-specific transcripts continued to accumulate and the appearance of 345
transcripts of higher molecular weights were detected as virus infection progressed in 346
both wild-type and repair viruses. Detection of transcripts of high molecular weight in 347
this region of AcMNPV genome during the late stage of virus infection has been reported 348
(24) (see discussion). We also noted that wild-type and repair viruses showed slightly 349
different expression time for lef-2 transcript, which may have contributed to the slower 350
growth curve of the repair virus. 351
352
DpnI-sensitivity DNA replication assay. lef-2 was previously identified as one of the 353
lefs required for origin-dependent DNA replication (16). To further dissect the role of lef-354
2 in viral DNA replication, the ability of lef-2-deletion virus to support viral DNA 355
replication was investigated. DpnI-sensitive DNA replication assay was performed to 356
measure viral DNA replication in Sf-21 cells. DpnI can recognize and digest transfected 357
viral DNA whereas viral DNA that replicates in transfected cells is resistant to DpnI 358
digestion. Sf-21 cells were transfected with bAc∆gp64
, bAc∆p143-ETLE
, or bAc∆lef2-hE
, and 359
the transfected cells were harvested at indicated time points. gp64 knockout virus 360
(bAc∆gp64
) can replicate viral DNA normally and is only impaired in cell-to-cell 361
transmission of the virus particles (17, 29); therefore gp64 knockout virus can serve as a 362
positive control in DNA replication assay. Total cellular DNA was extracted and 2 µg of 363
extracted DNA were digested with 20U of EcoRI or EcoRI+DpnI and probed with 364
labeled lef-1 sequence (Fig. 4). Digestion with EcoRI would yield a 2.6 kb fragment 365
containing lef-1 and double digestion with EcoRI and DpnI would yield a 1.1 kb 366
fragment containing lef-1. The result showed that viral DNA replication was detected in 367
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
17
gp64 knockout virus and continued to accumulate up to 120 hours post transfection (Fig. 368
4A). On the other hand, no viral DNA replication could be detected in bAc∆lef2-hE
-369
transfected cells until 72 hours post transfection and there was a slight and gradual 370
accumulation in the DpnI-resistant bands in bAc∆lef2-hE
from 72 hours onward, indicating 371
that initiation of DNA replication was possible in the absence of lef-2, though greatly 372
delayed and inefficient (Fig. 4B). 373
To further confirm that the viral DNA replication detected in lef-2 knockout virus 374
was not resulted from non-specific replication by host DNA polymerase, viral DNA 375
replication was also analyzed in p143 knockout virus. Both lef-2 and p143 were 376
previously demonstrated essential for viral DNA replication in transient expression assay 377
(16). No DpnI-resistant band, an indication of viral DNA replication, could be detected in 378
p143 knockout virus even at 120 hours post transfection (Fig. 4C). The absence of DpnI-379
resistant band in p143 knockout virus suggested that viral DNA replication did occur, 380
though at extremely low level, in lef-2 knockout virus. This result indicated that lef-2 is 381
not absolutely required for the initiation of viral DNA replication; nevertheless; it is 382
required for timely and efficient viral DNA amplification. 383
384
Analysis of baculovirus early, late, and very late gene expressions in lef-2 knockout 385
virus. Ample evidence has implied that baculovirus late and very late gene expression 386
depends on viral DNA replication (23, 32, 34). Origin-dependent DNA replication could 387
not take place without lef-2 in transient expression assays (16) and, as a consequence, the 388
baculovirus late vp39 promoter was inactive (23). However, most of the factors in these 389
prior experiments were transiently expressed and may not represent the real scenario in 390
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
18
the context of the virus genome. Since viral DNA replication can still be initiated in lef-2 391
deletion virus, it was necessary to examine whether late and very late gene expression 392
was turned on as a result of viral DNA replication. 393
To estimate the transcriptional activities of early, late, and very late genes in lef-2 394
knockout virus, the expression of baculovirus early ie-1, late vp39, and very late p10 395
transcripts were measured by northern blot analysis in wild-type, lef-2 knockout, and lef-396
2 repair virus. Total RNA harvested from bacmid-transfected cells were hybridized with 397
DIG-labeled anti-sense RNA probes specifically for ie-1, vp39, and p10 transcripts, 398
respectively. The data showed that vp39 or p10 transcripts could not be detected in lef-2 399
knockout virus even at 72 hours post transfection (Fig. 5), suggesting that late and very 400
late gene expression was impaired upon lef-2 deletion. ie-1 transcripts could be detected 401
in lef-2 knockout virus at 24 hours post transfection, due to its use of host transcription 402
machinery. The northern blot analysis showed that late vp39 and very late p10 gene 403
transcriptions were severely impaired in lef-2 knockout virus. These results indicate that, 404
without amplification, initiation of viral DNA replication is not sufficient to support late 405
and very late viral gene expression from the genome of baculovirus. 406
407
Spatial distribution of LEF-2. The temporal and spatial distributions of LEF-2 protein 408
were analyzed by biochemical separation of infected cells into cytoplasmic and nuclear 409
fractions and detection with western blot analysis. LEF-2 protein was initially detected in 410
the cytoplasm at 16 hours post infection and clearly detectable in both nucleus and 411
cytoplasm starting at 20 hours post infection (Fig. 6A). In another experiment we found 412
that its expression continued to accumulate in both cytoplasm and nucleus up to 72 hours 413
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
19
post infection and declined at 96 hours post infection (data not shown). About equal 414
amounts of LEF-2 were detected in cytoplasm and in nucleus at later time points post 415
infection; this may be due to the relatively small size of LEF-2 and the lack of a known 416
nuclear localization sequence in this protein (9, 13). 417
LEF-2 is one of the virally-encoded proteins required for viral DNA replication; 418
however; its localization relative to viral DNA replication sites has not yet been 419
investigated. To study the localization of LEF-2 relative to the sites of viral DNA 420
replication in vivo, localization of LEF-2 in infected cells was visualized by 421
immunofluorescence staining. Cellular and newly-replicated viral DNAs were visualized 422
with propidium iodine (PI) staining. At 16 hours post infection, cellular chromatin was 423
marginalized and lined the periphery of the cell nucleus (30) and the heavy PI staining in 424
the central region of the nucleus represented the newly-synthesized viral DNAs and viral 425
DNA replication foci (Fig. 6B). LEF-2 was shown to co-localize well with the newly-426
synthesized viral DNAs. This further indicates the involvement of LEF-2 in viral DNA 427
replication processes. 428
429
Association of LEF-2 with nucleocapsids of both BVs and ODVs. Previous analysis of 430
the purified ODV revealed that five (IE-1, LEF-1, LEF-3, DNAPOL, and P143) of the 431
viral proteins involved in DNA replication were associated with the nucleocapsids of 432
ODVs (6). This confers virus the ability to efficiently initiate viral DNA replication as 433
soon as it enters host cells. Because LEF-2 was also required for viral DNA replication, it 434
became a question whether LEF-2 was also associated with the nucleocapsid of the virus 435
particles along with the other replication LEFs. To this end, a lef-2 repair virus, vAchE-
436
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
20
lef2HA-PH, was generated in which HA tags were added to the N-terminus of LEF-2 along 437
with polyhedrin. BVs were purified from the supernatant of vAchE-lef2HA-PH
- infected cells 438
and ODVs were extracted from vAchE-lef2HA-PH
- infected cells. LEF-2 protein could be 439
detected in both purified BVs and ODVs, demonstrating that LEF-2 is a component of 440
virus particles (Fig. 7). To further elucidate the localization of LEF-2 in virus particles, 441
biochemical fractionation of the purified virus particles was undertaken and western blot 442
analysis showed that LEF-2 protein was localized predominantly in the nucleocapsids of 443
both BVs and ODVs (Fig. 7). To assess whether fractionation was successful, 444
localization of GP64 protein, an envelope protein, and VP39, a capsid protein, in the 445
purified virus particles were also analyzed and detected with antibody specifically for 446
GP64 and VP39. GP64 protein was mainly detected in the envelope fraction of BVs with 447
a trace amount being detected in the nucleocapsid fraction. This was considered 448
acceptable envelope contamination of the nucleocapsid preparation (< 10%) (4, 7). On 449
the other hand, VP39 protein was detected primarily in nucleocapsid fraction of the 450
purified virus particles, indicating that fractionation process was successful. 451
452
DISCUSSION 453
In this report we studied the effects of lef-2 deletion on the baculovirus infection 454
cycle. We found that in the absence of lef-2, no infectious virus particles could be 455
produced. It is reasonable to attribute the defects in virus progeny production to lef-2 456
deletion as the repair virus exhibited a wild-type virus growth curve (Fig. 2B and 2C). 457
Previous reports showed that LEF-2 was essential for origin-dependent DNA replication 458
(16, 23), however, our experiment showed that without LEF-2, DNA replication can still 459
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
21
be initiated, though at an extremely low level (Fig. 4B). On the other hand, deletion of 460
p143, which is an essential gene for viral DNA replication and encodes a helicase, 461
completely abolishes viral DNA replication as no viral DNA replication could be 462
detected (Fig. 4C). This implies that the replicated DNA detected in lef-2 knockout virus 463
is not likely the result of non-specific DNA replication. Therefore, our results suggest 464
that LEF-2 may be stimulatory rather than essential, as opposed to the transient 465
expression assays (16), for viral DNA replication in the course of virus infection. 466
There are a couple possible explanations for this discrepancy. In previous studies, 467
all the viral factors were expressed transiently which could alter their temporal expression 468
in comparison with those in the context of the virus. In addition, those viral factors were 469
expressed from sub-genomic fragments which may accidently exclude the 5’ or 3’ end or 470
cis-acting elements essential for gene regulation by other viral factors. The transient 471
expression system may not have mimicked the real scenario during the normal course of 472
virus infection. Secondly, the replication of a plasmid containing the standard replication 473
origin, the homologous region (hr), was used as an indicator for DNA replication in those 474
studies. However, plasmids containing viral sequences other than hr have been shown to 475
replicate in the presence of virus (40) and their ability to initiate DNA replication may 476
not rely on the co-presence of replication lefs. Another possibility is that segments of the 477
viral DNA were incorporated into the host genome and therefore replicated along with 478
cellular DNA, which could also yield DpnI-resistant products. Integration of segments of 479
baculoviral genomic DNA into the host genome has been demonstrated in mammalian 480
cells (26). However, this possibility may not be the case because we also used a DIG-481
labeled DNA probe for vp39 gene sequence DIG-labeled DNA probe for lef-1 gene 482
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
22
sequence. Since vp39 is located on the opposite end of lef-1 on the viral genome, it 483
suggested that the whole genome, rather than segments, had replicated. Therefore, 484
integration may not be the reason for the DpnI resistant products observed in the DpnI 485
replication assay in this report (Fig. 4). 486
Previous reports have implicated that baculovirus late and very late gene 487
expression depends on viral DNA replication (23, 34). Most of the viral late and very late 488
genes encode viral structural proteins, which are components of budded viruses and 489
occlusion-derived viruses. As a consequence of low-level viral DNA replication, viral 490
late and very late gene expression were abolished in lef-2 knockout virus (Fig. 5), 491
indicating a total shutdown of the viral transcription system. The observation that low 492
levels of viral DNA replication were not sufficient to turn on late and very late gene 493
expression suggests that either vigorous viral DNA replication activity is required to turn 494
on viral transcription or LEF-2 itself is involved in the transcription of late and very late 495
genes, as being previously suggested (32). We also noticed that the repair virus (bAc∆lef2-
496
Rep-hE) had a slower virus growth curve in transfected cells in comparison with the wild-497
type virus (bAcwt-hE
) (Fig. 2B). This was possibly because lef-2 was located in a different 498
context on the viral genome in repair virus, which resulted in an altered temporal 499
transcription profile of lef-2 in the repair virus as compared to the wild-type virus and 500
subsequently slowed the virus growth rate (Fig. 3). Multiple transcripts, which run 501
through the lef-2 coding sequence, were detected in both repair and wild-type viruses 502
toward late time points post infection. The presence of high-molecular-weight transcripts 503
in lef-2 coding region and other viral genomic regions have also been reported previously 504
(12, 24), and the transcription of these transcripts were either initiated at regions further 505
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
23
upstream or terminated at regions further downstream of the target sequence. Anti-sense 506
probes recognizing the upstream and downstream sequences, respectively, of lef-2 will 507
help to elucidate the exact identities of the high-molecular-weight transcripts detected in 508
Fig. 3. 509
In vivo immunofluorescence staining showed that LEF-2 co-localized with newly-510
synthesized viral DNA (Fig. 6B). Several replicative lefs have been shown to localize to 511
the sites of viral DNA replication in vivo, including IE-1, LEF-3, P143, and DBP (14, 25, 512
30, 31). Our results provide indirect evidence that LEF-2 does serve some important 513
functions at the sites of viral DNA replication, i.e., virogenic stroma. Nevertheless, the 514
exact functions of LEF-2 during viral DNA replication are yet to be elucidated. It was 515
also observed that co-localization of newly-synthesized viral DNA and LEF-2 was more 516
readily detectible after the replication foci have passed the initial formation stage and 517
enlarged (data not shown). Since late and very late gene expression also takes place in the 518
virogenic stroma, the immunofluorescence staining data here may also implicate the 519
involvement of LEF-2 in late and very late gene expression. 520
The incorporation of LEF-2 into the nucleocapsids of both BVs and ODVs is one 521
of the important findings in the present report (Fig. 7). Previously, all of the baculovirus 522
replication lef gene products (IE-1, LEF-1, LEF-3, DNAPOL, and P143), except LEF-2, 523
have been shown to associate with nucleocapsids of the occlusion-derived viruses (6). 524
Our result here adds LEF-2 to the list, meaning that essentially all the replication lef gene 525
products are present in the nucleocapsids of the ODVs. This finding raises the possibility 526
that viral DNA replication may be initiated and amplified by these capsid proteins even 527
prior to the expression of these replication-related lefs from the newly invading viral 528
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
24
genome. More recently LEF-11 was also found to be involved in viral DNA replication 529
based on the genomic-knock out experiments (17). Whether this gene product is also a 530
component of the nucleocapsid of virus particles or not remains as an interesting issue for 531
further studies. 532
LEF-2 is generally viewed as the primase-associated factor due to its interaction 533
with baculovirus-encoded DNA primase LEF-1 (10, 28). No known function has been 534
assigned to LEF-2 besides its requirement for viral DNA replication, though LEF-2 has 535
been suggested to possess a single-stranded DNA binding ability (28). The primase-536
associated factor of another double-stranded DNA virus, UL8 of herpes simplex virus 537
type 1 (HSV-1), was a component of the helicase-primase complex, which forms part of 538
the pre-replicative sites (18). UL8 was also shown to be involved in efficient nuclear 539
uptake of the other two proteins of the helicase-primase complex, UL5 and UL52, that 540
function as a helicase and primase, respectively (8). This is not quite the case for 541
baculovirus as LEF-2 is not required for the nuclear transport of baculovirus-encoded 542
helicase, P143. Instead, a virus-encoded single strand binding protein, LEF-3, is required 543
for this process (2, 9). UL8 of HSV-1 is also required for efficient primer utilization 544
during lagging-strand synthesis (36). LEF-2 may serve a similar function to UL8 in this 545
regard if binding of LEF-2 to ssDNA and LEF-1 occurs during DNA synthesis on the 546
lagging strand (28). The validation of this hypothesis may further help define the exact 547
functions of LEF-2 during baculovirus replication processes. Moreover, elucidation of the 548
mechanism by which LEF-2 affects late and very late gene expression would further our 549
understanding in baculovirus transcriptional regulation. 550
551
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
25
ACKNOWLEDGEMENTS 552
We thank Drs. Gary Blissard and Oliver Lung for giving us gp64-knockout 553
bacmid as a necessary control, and Dr. David Theilmann for valuable discussions and 554
suggestions. We also thank Ms. Miranda Loney and Dr. Harry Wilson for revision. This 555
research is funded by grants 098-2811-B-001-025, 098-2811-B-001-036, and 98-2321-B-556
001-031-MY3 from the National Science Council, and 94S-1303 from Academia Sinica, 557
Taiwan. 558
559
REFERENCES 560
1. Acharya, A., and K. P. Gopinathan. 2001. Identification of an enhancer-like 561
element in the polyhedrin gene upstream region of Bombyx mori 562
nucleopolyhedrovirus. J Gen Virol 82:2811-9. 563
2. Au, V., M. Yu, and E. B. Carstens. 2009. Characterization of a baculovirus 564
nuclear localization signal domain in the late expression factor 3 protein. Virology 565
385:209-17. 566
3. Ayres, M. D., S. C. Howard, J. Kuzio, M. Lopez-Ferber, and R. D. Possee. 567
1994. The complete DNA sequence of Autographa californica nuclear 568
polyhedrosis virus. Virology 202:586-605. 569
4. Beniya, H., S. C. Braunagel, and M. D. Summers. 1998. Autographa 570
californica nuclear polyhedrosis virus: subcellular localization and protein 571
trafficking of BV/ODV-E26 to intranuclear membranes and viral envelopes. 572
Virology 240:64-75. 573
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
26
5. Blissard, G. W., and J. R. Wenz. 1992. Baculovirus gp64 envelope glycoprotein 574
is sufficient to mediate pH-dependent membrane fusion. J Virol 66:6829-35. 575
6. Braunagel, S. C., W. K. Russell, G. Rosas-Acosta, D. H. Russell, and M. D. 576
Summers. 2003. Determination of the protein composition of the occlusion-577
derived virus of Autographa californica nucleopolyhedrovirus. Proc Natl Acad 578
Sci U S A 100:9797-802. 579
7. Braunagel, S. C., and M. D. Summers. 1994. Autographa californica nuclear 580
polyhedrosis virus, PDV, and ECV viral envelopes and nucleocapsids: structural 581
proteins, antigens, lipid and fatty acid profiles. Virology 202:315-28. 582
8. Calder, J. M., E. C. Stow, and N. D. Stow. 1992. On the cellular localization of 583
the components of the herpes simplex virus type 1 helicase-primase complex and 584
the viral origin-binding protein. J Gen Virol 73 ( Pt 3):531-8. 585
9. Chen, Z., and E. B. Carstens. 2005. Identification of domains in Autographa 586
californica multiple nucleopolyhedrovirus late expression factor 3 required for 587
nuclear transport of P143. J Virol 79:10915-22. 588
10. Evans, J. T., D. J. Leisy, and G. F. Rohrmann. 1997. Characterization of the 589
interaction between the baculovirus replication factors LEF-1 and LEF-2. J Virol 590
71:3114-9. 591
11. Fang, M., X. Dai, and D. A. Theilmann. 2007. Autographa californica multiple 592
nucleopolyhedrovirus EXON0 (ORF141) is required for efficient egress of 593
nucleocapsids from the nucleus. J Virol 81:9859-69. 594
12. Friesen, P. D., and L. K. Miller. 1985. Temporal regulation of baculovirus RNA: 595
overlapping early and late transcripts. J Virol 54:392-400. 596
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
27
13. Hicks, G. R., and N. V. Raikhel. 1995. Protein import into the nucleus: an 597
integrated view. Annu Rev Cell Dev Biol 11:155-88. 598
14. Ito, E., D. Sahri, R. Knippers, and E. B. Carstens. 2004. Baculovirus proteins 599
IE-1, LEF-3, and P143 interact with DNA in vivo: a formaldehyde cross-linking 600
study. Virology 329:337-47. 601
15. Jehle, J. A., G. W. Blissard, B. C. Bonning, J. S. Cory, E. A. Herniou, G. F. 602
Rohrmann, D. A. Theilmann, S. M. Thiem, and J. M. Vlak. 2006. On the 603
classification and nomenclature of baculoviruses: a proposal for revision. Arch 604
Virol 151:1257-66. 605
16. Kool, M., C. H. Ahrens, R. W. Goldbach, G. F. Rohrmann, and J. M. Vlak. 606
1994. Identification of genes involved in DNA replication of the Autographa 607
californica baculovirus. Proc Natl Acad Sci U S A 91:11212-6. 608
17. Lin, G., and G. W. Blissard. 2002. Analysis of an Autographa californica 609
nucleopolyhedrovirus lef-11 knockout: LEF-11 is essential for viral DNA 610
replication. J Virol 76:2770-9. 611
18. Liptak, L. M., S. L. Uprichard, and D. M. Knipe. 1996. Functional order of 612
assembly of herpes simplex virus DNA replication proteins into prereplicative site 613
structures. J Virol 70:1759-67. 614
19. Liu, C. Y., C. H. Wang, W. K. Hsiao, H. R. Lo, C. P. Wu, and Y. C. Chao. 615
2009. RING and coiled-coil domains of baculovirus IE2 are critical in strong 616
activation of the cytomegalovirus major immediate-early promoter in mammalian 617
cells. J Virol 83:3604-16. 618
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
28
20. Liu, Y. K., C. C. Chu, and T. Y. Wu. 2006. Baculovirus ETL promoter acts as a 619
shuttle promoter between insect cells and mammalian cells. Acta Pharmacol Sin 620
27:321-7. 621
21. Lo, H. R., and Y. C. Chao. 2004. Rapid titer determination of baculovirus by 622
quantitative real-time polymerase chain reaction. Biotechnol Prog 20:354-60. 623
22. Lo, H. R., C. C. Chou, T. Y. Wu, J. P. Yuen, and Y. C. Chao. 2002. Novel 624
baculovirus DNA elements strongly stimulate activities of exogenous and 625
endogenous promoters. J Biol Chem 277:5256-64. 626
23. Lu, A., and L. K. Miller. 1995. The roles of eighteen baculovirus late expression 627
factor genes in transcription and DNA replication. J Virol 69:975-82. 628
24. Mainprize, T. H., K. Lee, and L. K. Miller. 1986. Variation in the temporal 629
expression of overlapping baculovirus transcripts. Virus Res 6:85-99. 630
25. Mainz, D., I. Quadt, and D. Knebel-Morsdorf. 2002. Nuclear IE2 structures are 631
related to viral DNA replication sites during baculovirus infection. J Virol 632
76:5198-207. 633
26. Merrihew, R. V., W. C. Clay, J. P. Condreay, S. M. Witherspoon, W. S. 634
Dallas, and T. A. Kost. 2001. Chromosomal integration of transduced 635
recombinant baculovirus DNA in mammalian cells. J Virol 75:903-9. 636
27. Merrington, C. L., P. A. Kitts, L. A. King, and R. D. Possee. 1996. An 637
Autographa californica nucleopolyhedrovirus lef-2 mutant: consequences for 638
DNA replication and very late gene expression. Virology 217:338-48. 639
28. Mikhailov, V. S., and G. F. Rohrmann. 2002. Baculovirus replication factor 640
LEF-1 is a DNA primase. J Virol 76:2287-97. 641
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
29
29. Monsma, S. A., A. G. Oomens, and G. W. Blissard. 1996. The GP64 envelope 642
fusion protein is an essential baculovirus protein required for cell-to-cell 643
transmission of infection. J Virol 70:4607-16. 644
30. Nagamine, T., Y. Kawasaki, A. Abe, and S. Matsumoto. 2008. Nuclear 645
marginalization of host cell chromatin associated with expansion of two discrete 646
virus-induced subnuclear compartments during baculovirus infection. J Virol 647
82:6409-18. 648
31. Okano, K., V. S. Mikhailov, and S. Maeda. 1999. Colocalization of baculovirus 649
IE-1 and two DNA-binding proteins, DBP and LEF-3, to viral replication 650
factories. J Virol 73:110-9. 651
32. Passarelli, A. L., and L. K. Miller. 1993. Three baculovirus genes involved in 652
late and very late gene expression: ie-1, ie-n, and lef-2. J Virol 67:2149-58. 653
33. Rapp, J. C., J. A. Wilson, and L. K. Miller. 1998. Nineteen baculovirus open 654
reading frames, including LEF-12, support late gene expression. J Virol 655
72:10197-206. 656
34. Rice, W. C., and L. K. Miller. 1986. Baculovirus transcription in the presence of 657
inhibitors and in nonpermissive Drosophila cells. Virus Res 6:155-72. 658
35. Schultz, K. L., and P. D. Friesen. 2009. Baculovirus DNA Replication-specific 659
Expression Factors Trigger Apoptosis and Shutoff of Host Protein Synthesis 660
During Infection. J Virol 83:11123-32. 661
36. Sherman, G., J. Gottlieb, and M. D. Challberg. 1992. The UL8 subunit of the 662
herpes simplex virus helicase-primase complex is required for efficient primer 663
utilization. J Virol 66:4884-92. 664
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
30
37. Stewart, T. M., I. Huijskens, L. G. Willis, and D. A. Theilmann. 2005. The 665
Autographa californica multiple nucleopolyhedrovirus ie0-ie1 gene complex is 666
essential for wild-type virus replication, but either IE0 or IE1 can support virus 667
growth. J Virol 79:4619-29. 668
38. Vanarsdall, A. L., K. Okano, and G. F. Rohrmann. 2004. Characterization of a 669
baculovirus with a deletion of vlf-1. Virology 326:191-201. 670
39. Wu, C. P., J. Y. Wang, T. Y. Huang, H. R. Lo, and Y. C. Chao. 2008. 671
Identification of baculoviral factors required for the activation of enhancer-like 672
polyhedrin upstream (pu) sequence. Virus Res 138:7-16. 673
40. Wu, Y., and E. B. Carstens. 1996. Initiation of baculovirus DNA replication: 674
early promoter regions can function as infection-dependent replicating sequences 675
in a plasmid-based replication assay. J Virol 70:6967-72. 676
41. Wu, Y. L., and Y. C. Chao. 2008. The establishment of a controllable expression 677
system in baculovirus: stimulated overexpression of polyhedrin promoter by LEF-678
2. Biotechnol Prog 24:1232-40. 679
42. Wu, Y. L., C. P. Wu, S. T. Lee, H. Tang, C. H. Chang, H. H. Chen, and Y. C. 680
Chao. The early gene hhi1 reactivates Heliothis zea nudivirus 1 in latently 681
infected cells. J Virol 84:1057-65. 682
683
FIGURE LEGENDS 684
Figure 1. Schematic drawing of wild-type, lef-2 knockout and repair bacmids used in this 685
study. lef-2 gene sequence was replaced by the chloramphenicol (CAT) gene flanked by 686
50-nt sequences homologous to the 5′- and 3′- end sequences of the lef-2 gene. Reporter 687
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
31
cassettes containing egfp gene under the control of the heat shock 70 promoter were 688
inserted into the polyhedrin locus by site specific transposition in E. coli to yield a 689
bacmid backbone for further modifications. The 1st bacmid, bAc
wt-hE, contains a wild-690
type bacmid backbone inserted with egfp; in the 2nd
bacmid bAc∆lef2-hE
, lef-2 was deleted; 691
in the 3rd bacmid bAc∆lef2-Rep-hE
, a lef-2 expression cassette was re-inserted for repairing; 692
in the 4th
bacmid bAchElef2HA-polh
, the HA tag sequence was inserted at the 5′ end of lef-2, 693
followed by a complete polyhedrin expression cassette. p-hsp70: heat shock 70 promoter; 694
p-lef2: putative lef-2 promoter; p-polh: polyhedrin promoter; egfp: enhanced green 695
fluorescence protein gene. Black boxes: homologous sequences to the 5′- and 3′- ends of 696
lef-2; shaded boxes: HA tag sequence. 697
698
Figure 2. Budded virus production is impaired in lef-2 knockout virus. (A) Fluorescence 699
microscopic images of Sf-21 cells transfected with bAcwt-hE
, bAc∆lef2-hE
, or bAc∆lef2-Rep-hE
700
at 24, 48, 72, 96, and 120 hours post transfection. (B) Virus growth curve analysis. Sf21 701
cells were transfected with bAcwt-hE
, bAc∆lef2-hE
, or bAc∆lef2-Rep-hE
and virus titers at 702
indicated time points were determined by TCID50. (C) Growth curve analysis of vAcwt-hE
703
and vAc∆lef2-Rep-hE
in infected Sf-21 cells. Supernatants of the infected cells were collected 704
up to 120 hours post infection and virus titers were determined by TCID50. 705
706
Figure 3. Temporal expression of lef-2 transcripts in infected cells. Sf-21 cells were 707
infected with either vAcwt-hE
or vAc∆lef2-Rep-hE
at MOI = 5. Total cellular RNA was 708
extracted from infected cells harvested at 0, 4, 8, 12, 16, 24, 36, and 48 hours post 709
infection. Five micrograms of total RNA from each sample were resolved on a 1% 710
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
32
formaldehyde gel and stained with ethidium bromide to visualize 18s rRNA to ensure 711
equal sample loading. The samples were then transferred to a Hybond-N+ membrane 712
(Amersham) and hybridized with DIG-labeled lef-2 anti-sense RNA probes and detected 713
with DIG detection kit. 714
715
Figure 4. Timely initiation and efficiency of viral DNA replication was affected in lef-2 716
knockout virus. Sf-21 cells were transfected with 1 µg of (A) bAc∆gp64
, (B) bAc∆lef2-hE
, or 717
(C) bAc∆p143-ETLE
, Total cellular DNA was extracted from transfected cells collected at 0, 718
24, 48, 72, 96, and 120 hours post transfection. Two micrograms of extracted DNA was 719
digested with 20 U of EcoRI or 20 U of EcoRI + DpnI and resolved on a 0.8 % agarose 720
gel. Samples were hybridized with DIG-labeled lef-1 gene sequence and detected with 721
DIG detection kit. “-”: digestion with EcoRI only; “+”: double digestion with EcoRI and 722
DpnI. The upper bands (indicated by arrows) represent DpnI-resistant signal, while the 723
lower bands represent DpnI-sensitive signal. Due to the active DNA replication in the 724
bAc∆gp64
-transfected cells, the exposure time in panel A is much shorter than those in 725
other panels. 726
727
Figure 5. Late and very late gene expressions were abolished in lef-2 knockout virus. Sf-728
21 cells (1 × 106 cells) were transfected with 1 µg of bAc
wt-hE, bAc
∆lef2-hE, or bAc
∆lef2-Rep-729
hE DNA. Total cellular RNA was extracted from transfected cells collected at 24, 48, and 730
72 hours post transfection. Five micrograms (for vp39 and p10 transcripts) or 15 µg (for 731
ie1 transcript) of total RNA were resolved on a 1% formaldehyde gel and transferred to a 732
Hybond-N+ membrane. The membrane was subsequently hybridized with DIG-labeled 733
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
33
ie1, vp39, or p10 anti-sense RNA probes respectively and detected with DIG detection kit. 734
Ethidium Bromide staining of 18s rRNA demonstrated equal sample loading. Arrows 735
indicate the expected sizes of ie1, vp39, and p10 transcripts. M: mock-transfected cells; 736
W: cells transfected with bAcwt-hE
; K: cells transfected with lef-2 knockout bacmid 737
bAc∆lef2-hE
; R: cells transfected with lef-2 repair bacmid bAc∆lef2-Rep-hE
. 738
739
Figure 6. Localization of LEF-2 in infected Sf-21 cells. (A) LEF-2 is localized to both 740
cytoplasmic and nuclear regions in infected cells. Localization of GP-64 is shown as a 741
control. (B) LEF-2 co-localizes with the active viral DNA replication sites, i.e., virogenic 742
stroma, in the nuclei of the infected cells. Localization of LEF-2 was stained with 743
Alexa405 (blue) and DNA was stained with propidium iodine (red). 744
745
Figure 7. LEF-2 is incorporated into nucleocapsids of both BV and ODV. BVs and ODVs 746
were purified from infected cells by sucrose gradient and separated into nucleocapsid and 747
envelope fractions by glycerol cushion. Ten micrograms of purified BVs (lane 1) or 748
ODVs (lane 4) and 5 µg of nucleocapsid (lanes 2, 5) and envelope (lanes 3, 6) proteins 749
were separated on a 10 % polyacrylamide gel and transferred to a PVDF membrane 750
(Millipore). The presence of LEF-2 protein was detected with mouse monoclonal 751
antibody against the HA tags. The same blot was also probed with rabbit anti-serum 752
against baculovirus envelope protein GP64 and rabbit anti-serum against baculovirus 753
nucleocapsid protein VP39. 754
755
Table 1. Primer sequences used in this report. 756
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
orf5 lef2 orf603
orf5 orf603CAT
egfp
egfp lef2
egfp lef2 polyhedrin
p-hsp70
p-hsp70 p-lef2
p-hsp70 p-lef2 p-polh
bMON 14272
WT lef2 locus:
lef2 KO locus:
bAc∆lef2-Rep-hE:
bAchElef2HA-polh:
bAcwt-hE, bAc∆lef2-hE:
lef2 locus
polh locus
Fig. 1
HA
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
bAcwt-hE bAc∆lef2-hE bAc∆lef-2-Rep-hE
24hpt
48hpt
72hpt
96hpt
120hpt
A)
B)
bAcwt-hE
bAc∆lef2-hE
bAc∆lef2-Rep-hE
0 12 24 48 72 96 120 hpt
Fig. 2
0
1
2
3
4
5
6
7
8
9
pfu
/ml, log10
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
vAcwt-hE
vAc∆lef2-Rep-hE
0 12 24 48 72 96 120 hpi
0
1
2
3
4
5
6
7
8
9
10
pfu
/ml,
Lo
g10
C)
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
0 4 8 12 16 20 24 36 48 hpi
18s rRNA
vAcwt-hE
6.04.03.02.01.5 1.0
0.5
0.2
6.04.03.02.01.51.0
0.5
0.2
Fig. 3
1 2 3 4 5 6 7 8 9 LaneKb
Kb
18s rRNA
vAc∆∆∆∆lef2-Rep-hE
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
120 hpt
- + - + - + - + - + - +DpnI:
96 hpt72 hpt48 hpt24 hpt0 hpt
bAc∆∆∆∆lef2-hE:
bAc∆∆∆∆gp64:
Fig. 4
A
B
bAc∆∆∆∆p143-ETLE :
C
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
2.3-kb
2.2-kb
0.35-kb
18s rRNA
ie1
vp39
p10
W K R
24 hpt 48 hpt 72 hpt
W K R W K RM
Fig. 5
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
0 6 12 16 20 24 30 36 48 hpi
0 6 12 16 20 24 30 36 48 hpi
Nucleus
Cytoplasm
Nucleus
Cytoplasm
LEF-2
GP64
Fig. 6
A)
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
LEF-2 Propidium iodine Merge
Fig. 6
B)
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
LEF-2
GP64
1 2 3
NC
ENV
BV
4 5 6
NC
ENV
ODV
VP39
Fig. 7
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
5' - TAATACGACTCACTATAGGGTTACTTGGAACTGCGTTTACCA - 3'p10-R
5' - ATAAGAATTATTATCAAATCAT - 3'p10-F
5' - CAACCAATTACCAAGACGTGTT - 3'vp39-R
5' - TAATACGACTCACTATAGGGGCAAACGATTGGGTTGACTTCT - 3'vp39-F
5' - TAATACGACTCACTATAGGGTCACAAATGTGGTTTGCACGTA - 3'ie1-R
5' - ATCACAACAGCAACATTTGCAC - 3'ie1-F
5' - CGACAAGGCGTCTAGTTTATGTG - 3'ko-B
5' - CATGACCCCCGTAGTGACAACGATC - 3'ko-A
5' - GTGAGCGCGTCCAAGTTTGAATC - 3'lef1p-R
5' - CAACCGTGGATTTCATTTGTGGT - 3'lef1p-F
5' - GTCGAGCTCTTCGCGGCTTCTCGCACCA - 3'orf5-SacI-R
5' - CGGGGTACCGTTGGGCATGTACGTCCGAA - 3'orf4-KpnI-F
5' - CGCGGATCCTCAATAATTACAAATAGG - 3'lef2-BamHI-R
5' - GTTATGACGCCTACAACTCCCCG - 3'orf4-F
5' - TAGTTACCCATGGGCATATGTTGCCAAACTC - 3'Glu-R
5' - AATACCGGATCCATCGATCTTTTTCCCTCTG - 3'Glu-F
5' - TATGCGCAGCGGTACTATACAC - 3'orf603-R
5' - CGCATCTCAACACGACTATGAT - 3'orf5-F
Primer SequencePrimer Name
Table 1.
on May 29, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from