1

TITLE 1

2

AcMNPV LEF-2 is a Capsid Protein Required for 3

Amplification but not Initiation of Viral DNA Replication 4

5

AUTHORS 6

Carol P. Wu1,2,3

, Yi-Ru Huang3, Jen-Yeu Wang

3, Yueh-Lung Wu

3, Huei-Ru Lo

3, Jui-7

Ching Wang3, and Yu-Chan Chao

3,4,5∗ 8

1. Department of Chemistry, National Tsing-Hua University, Hsinchu 300; 9

2. Chemical Biology and Molecular Biophysics, Taiwan International Graduate 10

Program, Academia Sinica, Taipei 115; 11

3. Institute of Molecular Biology, Academia Sinica, Taipei 115; 12

4. Department of Plant Pathology and Microbiology, National Taiwan University, 13

Taipei 106; 14

5. Department of Life Sciences, National Chung-Hsing University, Taichung 403, 15

Taiwan, ROC. 16

17

Running title: LEF-2 is a capsid protein required for DNA amplification 18

∗ Correspondence to Yu-Chan Chao, e-mail: mbycchao@gate.sinica.edu.tw 19

Tel: +886-2-2788-2697, FAX: +886-2-2782-6085 20

21

Word Count for abstract: 208 22

Word count for the text: 23

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Virol. doi:10.1128/JVI.02423-09 JVI Accepts, published online ahead of print on 10 March 2010

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

2

ABSTRACT 24

The late expression factor 2 (lef-2) gene of baculovirus Autographa californica 25

multiple nucleopolyhedrovirus (AcMNPV) has been identified as one of the factors 26

essential for origin-dependent DNA replication in transient expression assays and has 27

been shown to be involved in the late/very late gene expression. To study the function of 28

lef-2 in the life cycle of AcMNPV, a lef-2 knockout mutant and repair bacmids were 29

generated by homologous recombination in Escherichia coli. Growth curve analysis 30

showed that lef-2 was essential for virus production. Interestingly, DNA replication assay 31

indicated that lef-2 is not required for the initiation of viral DNA replication; rather, it is 32

required for the amplification of DNA replication. lef-2 is also required for the expression 33

of late and very late genes, as the expression of these genes were abolished in the lef-2 34

knockout bacmid. Temporal and spatial distribution of LEF-2 protein in infected cells 35

was also analyzed and the data showed that LEF-2 protein was localized to the virogenic 36

stroma in the nuclei of the infected cells. Analysis of purified virus particles revealed that 37

LEF-2 is a new viral protein component of both budded and occlusion-derived virions, 38

predominantly in the nucleocapsids of the virus particles. This observation suggests that 39

LEF-2 may be required immediately after virus entry into host cells for efficient viral 40

DNA replication. 41

42

43

Keywords: Autographa californica multiple nucleopolyhedrovirus; late expression 44

factor-2 (lef-2); gene knockout. 45

46

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

3

INTRODUCTION 47

The Baculoviridae family consists of a group of invertebrate-specific viruses that 48

contain a circular double-stranded DNA genome with sizes between 82-180 kb (15). 49

Among them, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is the 50

best-studied baculovirus. The genome size of AcMNPV is ~ 134kb and sequence analysis 51

of its genome showed that it contains 155 open reading frames (ORFs) with protein-52

coding potential (3). AcMNPV produces two forms of virus progeny during its infection 53

cycle, budded viruses (BVs) and occlusion-derived viruses (ODVs). Although both 54

contain identical genetic materials, they are produced at different stages of virus infection 55

and mediate baculovirus infection through different routes. BVs are produced during the 56

early stage of baculovirus infection and mediate systematic infection within the hosts. 57

BVs obtain their envelopes as they bud off the plasma membranes of the infected cells, 58

which contain baculovirus GP64 protein. GP64 is important for BV entry into 59

neighboring cells (5). ODVs are produced during the very late stage of baculovirus 60

infection and are embedded within a crystalline structure made up of polyhedrin proteins, 61

forming occlusion bodies (OB). OBs are very stable in the natural environment and are 62

disintegrated only under alkaline conditions, e.g., the mid-guts of insects after ingestion 63

by the host, releasing ODVs for primary infection. 64

Based on the temporal expression of the viral genes, the baculovirus infection 65

cycle is divided into three phases: early, late, and very late. Early genes are transcribed by 66

host RNA polymerase; late and very late genes are transcribed by a virus-encoded RNA 67

polymerase during or after viral DNA replication. Most early gene products are involved 68

in DNA replication and the expression of late and very late genes depend on DNA 69

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

4

replication and viral transactivators. Baculovirus late gene expression requires 20 virus-70

encoded factors, termed late expression factors (lefs) (23, 33, 37). Six of these 20 factors, 71

ie-1, lef-1, lef-2, lef-3, p143 and dnapol, were required for the replication of the origin-72

containing plasmid in transient expression experiments (16). They were also capable of 73

indirectly triggering apoptosis through DNA replication events in virus-infected cells, 74

leading to host translational shutoff (35). Because all the late expression factors were 75

transiently expressed during these experiments, it was possible to overlook the functional 76

importance of some factors whose expression was regulated by other viral factors during 77

the course of virus infection. The development of bacmid technology has enabled the 78

generation of viral DNA lacking genes essential for virus viability in Escherichia coli, 79

which was impossible to achieve in the past in insect cells. Based on this technique, the 80

functional importance of viral genes in the virus lifecycle can be studied in the context of 81

the virus genome and consequently provide new insights into the functions of the genes 82

of interest. For example, analysis of viral DNA lacking lef-11, which was previously 83

thought to be non-essential for DNA replication, demonstrated that lef-11 was, in fact, 84

essential for viral DNA replication as lef-11 deletion virus did not undergo viral DNA 85

replication (17); hence lef-11 became an essential replicative lef in addition to those 86

identified by plasmid-based replication assays. It was also reported that ie-0 can 87

functionally substitute for ie-1 (37) and therefore there are a total of 8 replicative lefs. 88

lef-2 was initially identified as one of the lefs required for origin-dependent DNA 89

replication based on transient expression experiments (16). It was also demonstrated to be 90

one of the three genes essential for late and very late gene expression (32) and its 91

expression level was found to have a positive effect on the strength of the very late 92

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

5

polyhedrin promoter (41). A single mutation at the 3′ end of lef-2 gene was also shown to 93

abolish very late polyhedrin and p10 promoter activities (27). In addition, the lef-2 94

sequence is part of the polyhedrin upstream sequence (pu), which functions as a 95

transcriptional enhancer (1, 22, 39). LEF-2 was also demonstrated to interact with LEF-1, 96

another lef gene required for viral DNA replication, through yeast-two-hybrid analysis 97

(10). The region encompassing amino acids 20 to 60 of LEF-2 was found required for its 98

interaction with LEF-1 and their interaction was a pre-requisite for origin-dependent 99

DNA replication. Because LEF-1 is a DNA primase (28), LEF-2 was thus termed a 100

“primase associated factor”. These previous reports suggest that lef-2 is involved in at 101

least two processes during baculovirus infection: DNA replication and late/very late gene 102

expression. Nevertheless, the exact functions of LEF-2 in these two processes and its role 103

in the life cycle of the virus are not yet clear. 104

In this study, we examined the effects of lef-2 deletion on the various stages of 105

baculovirus infection by generation of a lef-2 knockout bacmid. The results showed that 106

lef-2 deletion virus was deficient in budded virus production. Further dissection of lef-2’s 107

role in viral DNA replication showed that lef-2 is not essential for the initiation of viral 108

DNA replication, rather, it is crucial for efficient viral DNA amplification. lef-2 deletion 109

severely impaired late vp39 and very late p10 gene expressions but the onset of 110

immediate early ie-1 expression was not compromised. Interestingly, LEF-2 was found 111

incorporated into the nucleocapsids of BVs and ODVs, suggesting that the function of 112

LEF-2 may be required immediately after virus entry into the cells. 113

114

MATERIALS AND METHODS 115

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

6

Cell Culture and viruses. The Spodoptera frugiperda IPLB-Sf21 (Sf21) cell line was 116

cultured as a monolayer in TC-100 insect medium containing 10% heat-inactivated fetal 117

bovine serum (FBS) (19). It was used for the generation and propagation of recombinant 118

baculoviruses. All viral stocks were prepared and their titers determined by 50% tissue 119

culture infection dose (TCID50) and quantitative PCR (Q-PCR) (21). 120

121

Construction of lef-2 knockout and repair bacmids. To generate the lef-2 deletion 122

bacmid, a CAT cassette was first generated in which chloramphenicol gene was flanked 123

by ~ 500 nucleotides homologous to the upstream and downstream regions of lef-2 124

coding sequence. This cassette was introduced into DH10Bac™ Competent E. coli cells 125

carrying wild-type AcMNPV genomic DNA (bMON14272) for the generation of lef-2 126

knockout bacmid, bAc∆lef2

, by λ Red recombination as previously described (38). A 127

reporter cassette containing heat-shock 70 promoter driving the expression of egfp was 128

inserted into pFastBac1 (Invitrogen), yielding pFashE. pFashE was used to introduce egfp 129

into wild-type AcMNPV bacmid, bAcwt

, and bAc∆lef2

by site-specific transposition, 130

generating reporter bacmids bAcwt-hE

and bAc∆lef2-hE

. To introduce lef-2 back to bAc∆lef2

, a 131

lef-2 repair plasmid was constructed. The rabbit β-globin terminator sequence was 132

amplified from pTriEx-3 (Novagen) with primers Glu-F and Glu-R (Table 1) and 133

subsequently cloned into pGL3-basic vector digested with BamHI and NcoI, yielding 134

pGlobin. The region containing lef-2 gene sequence and its putative promoter was 135

amplified from AcMNPV genomic DNA with orf4-F and lef-2-BamHI-R primers (Table 136

1). The PCR product was digested with XhoI and BamHI and cloned into pGlobin 137

linearized with SalI and BamHI, generating pLef2-globin. pLef2-globin was digested 138

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

7

with SphI and NheI and the resulting lef2-globin fragment was inserted into pFashE, 139

yielding pFhElef2-repair. pFhElef2-repair was used to insert egfp and lef-2 into 140

polyhedrin locus of bAc∆lef2

, yielding repair bacmid bAc∆lef2-Rep-hE

. Confirmation of 141

deletion at lef-2 locus was performed by PCR with ko-A and ko-B (Table 1) and 142

subsequent digestion of the PCR product by AscI, which has two unique cutting sites in 143

cat and none in lef-2. Intact lef-2 would yield a 945-bp product and replacement of lef-2 144

by CAT reporter cassette would yield a 1,400-bp fragment (data not shown). 145

To generate HA-tagged lef-2 repair bacmid, a fragment containing the lef-2 146

promoter region was amplified from AcMNPV genomic DNA with orf4-SacI-F and orf5-147

KpnI-R (Table 1) and inserted into an HA-tag-containing plasmid pGL3HA, yielding 148

pGLp3HA. The lef-2 coding sequence and β-globin terminator sequence were amplified 149

from pLef2-globin with lef2-AvrII-F and RVprimer3 (Table 1) and the resulting PCR 150

fragment was inserted downstream of lef-2 putative promoter in pGLp3HA and in frame 151

with HA tag sequence, generating pG3HA-repair. lef-2 repair fragment (lef-2 promoter + 152

coding region + β-globin terminator) was released from pG3HA-repair by digestion with 153

SphI and NheI and inserted into pFashE to yield pFhElef2-HA. A fragment containing 154

polyhedrin and its own promoter and transcriptional terminator was amplified with 155

polh/SphI-F and polh/NotI-R (Table 1). The PCR product was digested with SphI and 156

NotI and inserted into pFhElef2-HA to yield pFhElef2-HApolh. This plasmid was used to 157

insert egfp reporter, HA-tagged lef-2, and polyhedrin into the polyhedrin locus of bAc∆lef-

158

2, yielding bAc

hE-lef2HA-polh. 159

160

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

8

Bacmid DNA purification and transfection. Bacmid DNA was first purified with 161

PureLink HiPure Plasmid DNA purification Kit (Invitrogen) and subsequently re-162

transformed into ElectroMAX DH10B T1 phage resistant cells (Invitrogen). Bacterial 163

colonies were selected on sensitivity to tetracycline and resistance to kanamycin and 164

gentamycin, an indication that the bacterial clones contain only the desired bacmid DNA 165

and no helper plasmid, and purified for subsequent experiments. Sf-21 cells (2 × 106) 166

were transfected with 2 µg of purified bacmid DNA using Cellfectin (Invitrogen) as 167

transfection reagent following manufacturer’s protocol. 168

169

Growth curve assay. Sf-21 cells were transfected with indicated bacmid DNA or 170

infected with recombinant virus at a multiplicity of infection (MOI) of 5. Five hours after 171

transfection or 1 hour after infection, cells were washed with phosphate-buffered saline 172

(PBS) and replenished with fresh 10% FBS-containing TC-100 culture medium. This 173

time point was designated as time zero. Supernatants were collected from transfected - or 174

infected - Sf-21 cells at indicated time points and cleared by centrifugation at 1,000 × g 175

for 5 minutes. The titers were determined by TCID50 and then double checked with Q-176

PCR (21). The data points were plotted as average infection results from triplicate assays 177

of three independent experiments. 178

179

Dpn-I replication assay. One microgram of bAc∆gp64

, bAc∆lef2-hE

, or bAc∆p143-pETLE

180

bacmid DNA was transfected into 1 × 106 Sf-21 cells and, at the indicated time points, 181

transfected cells were washed with PBS and collected. pETLE indicated that the egfp 182

coding region is driven by the etl promoter (20). The cell pellets were lysed with 500µl of 183

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

9

lysis buffer (10 mM Tris, pH = 8; 100 mM EDTA; 20 µg/ml RNase A; 0.5% SDS; 80 184

µg/ml proteinase K) and incubated overnight at 37°C. The samples were extracted once 185

with phenol, once with phenol/chloroform, and once with chloroform. Total cellular 186

DNA was precipitated with 0.5 volume of 7.5M ammonium acetate and 2 volumes of ice-187

cold ethanol, washed with 70% ice-cold ethanol, and re-suspended in 100 µl of TE buffer. 188

Two micrograms of total DNA were treated with 20U of EcoRI or EcoRI/DpnI, resolved 189

on a 0.8% agarose gel, and subsequently transferred to a Hybond-N+ nylon membrane 190

(Amersham Bioscience). The membrane was probed with DIG-labeled lef-1 gene 191

sequence synthesized with PCR DIG Probe Synthesis Kit (Roche) using lef1p-F and 192

lef1p-R (Table 1) and detected with DIG detection kit (Roche). 193

194

Northern blot analysis. Sf-21 cells (1 × 106) were infected with vAc

wt-hE or vAc

∆lef2-Rep-195

hE at MOI = 10. Infected cells were harvested at the indicated time points and total RNA 196

was extracted with an RNeasy Mini Kit (Qiagen, Venlo, Netherlands). Five micrograms 197

of total RNA was resolved on a 1% formaldehyde agarose gel and subsequently 198

transferred to a Hybond-N+ nylon membrane. The membrane was probed with DIG-199

labeled anti-sense strand of lef-2 transcripts and detected with DIG detection kit (Roche). 200

To study ie1, vp39, and p10 expression, 1 µg of bAcwt-hE

, bAc∆lef2-hE

, or bAc∆lef2-Rep-hE

201

bacmid DNA was transfected into 5 × 105 Sf-21 cells. Transfected cells were harvested at 202

24, 48, and 72 hours post transfection. Total RNA was extracted and 5 µg (for vp39 and 203

p10 transcripts) or 15 µg (for ie1 transcript) of total RNA were resolved on a 1% 204

formaldehyde agarose gel. RNA samples were transferred to a Hybond-N+ nylon 205

membrane and hybridized with DIG-labeled anti-sense RNA probes for ie-1, vp39, and 206

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

10

p10 transcripts respectively. The presence of target RNA was detected with a DIG 207

detection kit (Roche) (42). The primers used to synthesize DIG-labeled lef-2, ie-1, vp39, 208

and p10 RNA probes were listed in Table 1. 209

210

Cellular localization of LEF-2 in nucleus and cytoplasm. 2 × 106 cells were infected 211

with vAchE-lef-2HA-polh

at MOI = 10. Infected cells were harvested at 0, 6, 12, 16, 20, 24, 30, 212

36, and 48 hours post infection. Cytoplasmic and nuclear fractions of the infected cells 213

were prepared as described by Fang et al. (11). One fifth of each fraction was analyzed 214

on 10% SDS-PAGE and by Western blotting with: a) primary mouse monoclonal 215

antibody against HA (1:1,000, Cell Signaling) and horseradish peroxidase (HRP)-216

conjugated secondary antibody against mouse (1:5,000); and b) primary mouse 217

monoclonal antibody against baculovirus GP64 (1:3,000, eBioscience) and HRP-218

conjugated antibody against mouse (1:5,000). 219

220

Immunofluorescence microscopy. Sf-21 cells were seeded on chamber slides (Nalge 221

Nunc International) and infected with HA-tagged repair virus vAchE-lef2HA-polh

at MOI = 222

20. At 16 hours post infection, infected cells were washed three times with phosphate 223

saline buffer (PBS) and fixed with 2% paraformaldehyde for 10 minutes at room 224

temperature. Fixed cells were washed three times with PBS, permeabilized with 0.2% 225

Triton X-100 for 15 minutes at room temperature, and rinsed three times with PBS-T 226

(PBS containing 0.1% Tween 20). Cells were incubated in blocking buffer (1% normal 227

goat serum in PBS-T) for one hour at room temperature before incubation with primary 228

mouse monoclonal antibody against HA diluted in blocking buffer (Covance, 1:200) at 229

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

11

4°C overnight. Cells were washed four times with PBS-T; 5 minutes each wash; followed 230

by incubation with Alexa Fluor

405 goat anti-mouse IgG antibody (Molecular Probes, 231

1:200) diluted in blocking buffer for 1 hour at room temperature. Following 4 washes 232

with PBS-T, cellular and viral DNAs were stained with propidium iodine (Molecular 233

Probes, 1:10,000 in PBS) for 5 minutes at room temperature. Cells were rinsed three 234

times with PBS before the chamber slides were disassembled, covered with cover slips, 235

and sealed with mounting medium. Cells were viewed with a 63× oil immersion lens on a 236

confocal laser-scanning microscope (LSM510 META; Zeiss). Images were taken, viewed, 237

and analyzed with LSM Image software (Zeiss). 238

239

Purification of virus particles from BV and ODV. Sf-21 cells were infected with 240

recombinant baculovirus vAchE-lef2HA-polh

at an MOI of 5. At 4 days post infection, the 241

cells were collected and used to extract ODVs as described previously (7). For BV 242

purification, Sf-21 cells were infection with vAchE-lef2HA-polh

at an MOI of 0.5 and the 243

supernatant was collected at 5 days post infection and subjected to low-speed 244

centrifugation at 3,000g for 10 minutes. The supernatant was then subjected to high-245

speed centrifugation at 80,000g (24,000rpm, SW28, Beckmann) for 90 minutes. The 246

virus pellet was re-suspended in protease inhibitor-containing PBS and loaded onto a 247

25 – 60% sucrose gradient. The sample was centrifuged at 96,000g (27,900 rpm, SW41) 248

at 4°C for 3 hours. The virus particles were collected, diluted with PBS, and centrifuged 249

again at 80,000g (21,600 rpm, SW41) for 90 minutes to pellet the budded viruses. The 250

purified budded-virus particles were re-suspended in Tris-HCl (pH = 8.5). 251

252

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

12

Separation of nucleocapsid and envelope proteins of BV and ODV. To separate 253

nucleocapsids from the envelopes, the purified BVs and ODVs were incubated in 254

separation buffer (1 % Nonidet P-40 and 10 mM Tris-HCl, pH 8.5) on a rotating platform 255

for 30 minutes at room temperature (11). The mixture was overlaid onto 4 ml of 30% 256

glycerol (W/V) and centrifuged at 150,000g (34,000 rpm, SW60) at 4°C for one hour. 257

The pellet obtained after centrifugation contained the nucleocapsids of the virus particles 258

and was resuspended in 10 mM Tris-HCl, pH 7.5. The fraction above the interface at the 259

top of the supernatant contained the envelope proteins and was collected and precipitated 260

with 4 volumes of acetone. The precipitated envelope proteins were resuspended in 10 261

mM Tris-HCl, pH 7.5. 262

263

Western blot analysis. To detect the presence of HA-tagged LEF-2 in BV and ODV, 10 264

µg of BV or ODV and 5 µg of the nucleocapsid and envelope fractions of purified virus 265

particles were mixed with 2× SDS sample buffer and resolved in a 10% SDS-PAGE gel. 266

The protein samples were probed with the following antibodies: 1) primary mouse 267

monoclonal antibody against HA tag (1:1,000) and horseradish peroxidase-conjugated 268

secondary antibody against mouse (1:5,000); 2) primary mouse monoclonal antibody 269

against baculovirus GP64 (1:3,000, eBioscience) and HRP-conjugated antibody against 270

mouse (1:5,000); and 3) primary rabbit polyclonal antibody against baculovirus VP39 271

(1:2,500, Abnova) and HRP-conjugated antibody against rabbit (1:5,000). The membrane 272

was detected with enhanced chemiluminescence system (Immobilon Western, Millipore). 273

274

275

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

13

RESULTS 276

Generation of lef-2 knockout and repair AcMNPV bacmids. To generate the lef-2 277

deletion bacmid DNA, the E. coli λ Red recombination system was exploited to replace 278

the lef-2 gene with a chloramphenical acetyltransferase (CAT) expression cassette in the 279

lef-2 locus through homologous recombination in E. coli. Replacement at the lef-2 locus 280

of wild-type bacmid (bMON14272) was confirmed by PCR as mentioned in Materials 281

and Methods. 282

In order to follow the progression of virus infection, the eGFP expression cassette 283

was inserted into the polyhedrin locus of wild-type bacmid (bAcwt

) and lef-2KO bacmid 284

(bAc∆lef2

) by site-specific transposition, yielding bAcwt-hE

and bAc∆lef2-hE

(Fig. 1). A lef-2 285

repair bacmid was constructed in which the lef-2 coding sequence and its own promoter 286

region, along with eGFP reporter cassette, were inserted into the polyhedrin locus of 287

bAc∆lef2

to obtain bAc∆lef2-Rep-hE

. To monitor the distribution of LEF-2 in infected cells, an 288

additional lef-2 repair bacmid, bAchE-lef2HA-polh

, was constructed in which the HA tag 289

sequence was added to the 5′-end of lef-2 coding sequence. All clones were checked by 290

PCR at both lef-2 and polyhedrin loci (data not shown). 291

292

Analysis of wt, lef-2KO, and repair bacmids in Sf-21 cells. In order to determine the 293

effects of lef-2 deletion on virus growth, Sf-21 cells were transfected with bAcwt-hE

, 294

bAc∆lef2-hE

, or bAc∆lef2-Rep-hE

. At 24 hours post transfection, green fluorescence could be 295

observed in transfected cells (Fig. 2A). No obvious difference in the number of green 296

fluorescent cells was observed among these three viruses indicating equal transfection 297

efficiency even though the intensity of green fluorescence was noticeably lower in 298

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

14

bAc∆lef2-hE

-transfected cells. At 48 hours post transfection, almost all cells transfected 299

with bAcwt-hE

fluoresced green suggesting generation of budded viruses for secondary 300

infections. The intensity of green fluorescence reached maximum at 72 hours post 301

transfection and then started to decline most likely due to cell lysis as a result of virus 302

infection. The number of green fluorescent cells and the intensity of green fluorescence in 303

bAc∆lef2-hE

-transfected cells also increased from 24 to 48 hours post transfection but to a 304

much lesser extent than the wild-type virus. No further significant changes in the number 305

of green fluorescent cells and the intensity of green fluorescence were observed after 48 306

hours post transfection. Small aggregates of green fluorescent cells were occasionally 307

observed in bAc∆lef2-hE

-transfected cells after 72 hours post transfection, which did not 308

develop further into infection foci (data not shown). Sf-21 cells transfected with repair 309

virus bAc∆lef2-Rep-hE

exhibited similar virus growth to cells transfected with wild-type 310

virus. The similarity in infection pattern between wild-type and repair viruses suggested 311

that the phenotype observed in lef-2 deletion virus was due to the absence of lef-2. 312

313

lef-2 deletion abolished budded virus production. To quantify the effect of lef-2 314

deletion on budded virus production, virus growth curves were determined for bAcwt-hE

, 315

bAc∆lef2-hE

and bAc∆lef2-Rep-hE

. The supernatants were collected from transfected cells at 316

the indicated time points post transfection and the titers were determined. The results 317

showed that no budded viruses were produced in cells transfected with lef-2 knockout 318

viruses up to 120 hours post transfection (Fig. 2B). On the other hand, bAcwt-hE

and 319

bAc∆lef2-Rep-hE

exhibited normal virus growth curves that reached a plateau at 48 and 96 320

hours post transfection, respectively (Fig. 2B). These results indicate that lef-2 deletion 321

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

15

impaired budded virus production in transfected cells. This was in agreement with the 322

green fluorescence observation in transfected cells where green fluorescence expression 323

was restricted to initially bAc∆lef2-hE

-transfected cells. 324

After 12 hours post transfection, the titer of bAc∆lef2-Rep-hE

was consistently around 325

1 order of magnitude lower than that of bAcwt-hE

. To confirm that the virus progeny 326

produced by the repair virus and that produced by the wild-type virus was equally 327

infectious, fresh Sf-21 cells were infected with budded viruses collected from bAcwt-hE

or 328

bAc∆lef2-Rep-hE

-transfected cells at MOI = 5. No significant phenotypic difference was 329

observed with fluorescence microscope (data not shown). The virus growth curve in 330

vAcwt-hE

and vAc∆lef2-Rep-hE

-infected cells was determined (Fig. 2C). Virus titer in repair 331

virus-infected cells was still lower than that in wild-type virus-infected cells at all time 332

points, nevertheless by a much smaller margin than in transfection experiments and both 333

generated similar virus growth curves. This demonstrated that the repair virus was as 334

infectious as wild-type virus. 335

The slightly inferior growth of the repair virus may indicate that the temporal 336

expression of lef-2 was altered in the repair virus since lef-2 was re-inserted into the 337

polyhedrin locus instead of its original locus. To compare the transcriptional profile of 338

lef-2 in wild-type and repair virus-infected cells, northern blot analysis was performed 339

with anti-sense RNA probe of lef-2 transcripts. The onset of lef-2 expression in repair 340

virus was delayed by ~ 4 hours compared to that in wild-type virus (Fig. 3). The lef-2-341

specific transcript in repair virus was somewhat larger in size as compared to that in wild-342

type virus (indicated by arrows). This was probably due to the presence of β-globin 343

terminator sequence in place of lef-2 putative terminator sequence in repair virus. The 344

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

16

amounts of lef-2-specific transcripts continued to accumulate and the appearance of 345

transcripts of higher molecular weights were detected as virus infection progressed in 346

both wild-type and repair viruses. Detection of transcripts of high molecular weight in 347

this region of AcMNPV genome during the late stage of virus infection has been reported 348

(24) (see discussion). We also noted that wild-type and repair viruses showed slightly 349

different expression time for lef-2 transcript, which may have contributed to the slower 350

growth curve of the repair virus. 351

352

DpnI-sensitivity DNA replication assay. lef-2 was previously identified as one of the 353

lefs required for origin-dependent DNA replication (16). To further dissect the role of lef-354

2 in viral DNA replication, the ability of lef-2-deletion virus to support viral DNA 355

replication was investigated. DpnI-sensitive DNA replication assay was performed to 356

measure viral DNA replication in Sf-21 cells. DpnI can recognize and digest transfected 357

viral DNA whereas viral DNA that replicates in transfected cells is resistant to DpnI 358

digestion. Sf-21 cells were transfected with bAc∆gp64

, bAc∆p143-ETLE

, or bAc∆lef2-hE

, and 359

the transfected cells were harvested at indicated time points. gp64 knockout virus 360

(bAc∆gp64

) can replicate viral DNA normally and is only impaired in cell-to-cell 361

transmission of the virus particles (17, 29); therefore gp64 knockout virus can serve as a 362

positive control in DNA replication assay. Total cellular DNA was extracted and 2 µg of 363

extracted DNA were digested with 20U of EcoRI or EcoRI+DpnI and probed with 364

labeled lef-1 sequence (Fig. 4). Digestion with EcoRI would yield a 2.6 kb fragment 365

containing lef-1 and double digestion with EcoRI and DpnI would yield a 1.1 kb 366

fragment containing lef-1. The result showed that viral DNA replication was detected in 367

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

17

gp64 knockout virus and continued to accumulate up to 120 hours post transfection (Fig. 368

4A). On the other hand, no viral DNA replication could be detected in bAc∆lef2-hE

-369

transfected cells until 72 hours post transfection and there was a slight and gradual 370

accumulation in the DpnI-resistant bands in bAc∆lef2-hE

from 72 hours onward, indicating 371

that initiation of DNA replication was possible in the absence of lef-2, though greatly 372

delayed and inefficient (Fig. 4B). 373

To further confirm that the viral DNA replication detected in lef-2 knockout virus 374

was not resulted from non-specific replication by host DNA polymerase, viral DNA 375

replication was also analyzed in p143 knockout virus. Both lef-2 and p143 were 376

previously demonstrated essential for viral DNA replication in transient expression assay 377

(16). No DpnI-resistant band, an indication of viral DNA replication, could be detected in 378

p143 knockout virus even at 120 hours post transfection (Fig. 4C). The absence of DpnI-379

resistant band in p143 knockout virus suggested that viral DNA replication did occur, 380

though at extremely low level, in lef-2 knockout virus. This result indicated that lef-2 is 381

not absolutely required for the initiation of viral DNA replication; nevertheless; it is 382

required for timely and efficient viral DNA amplification. 383

384

Analysis of baculovirus early, late, and very late gene expressions in lef-2 knockout 385

virus. Ample evidence has implied that baculovirus late and very late gene expression 386

depends on viral DNA replication (23, 32, 34). Origin-dependent DNA replication could 387

not take place without lef-2 in transient expression assays (16) and, as a consequence, the 388

baculovirus late vp39 promoter was inactive (23). However, most of the factors in these 389

prior experiments were transiently expressed and may not represent the real scenario in 390

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

18

the context of the virus genome. Since viral DNA replication can still be initiated in lef-2 391

deletion virus, it was necessary to examine whether late and very late gene expression 392

was turned on as a result of viral DNA replication. 393

To estimate the transcriptional activities of early, late, and very late genes in lef-2 394

knockout virus, the expression of baculovirus early ie-1, late vp39, and very late p10 395

transcripts were measured by northern blot analysis in wild-type, lef-2 knockout, and lef-396

2 repair virus. Total RNA harvested from bacmid-transfected cells were hybridized with 397

DIG-labeled anti-sense RNA probes specifically for ie-1, vp39, and p10 transcripts, 398

respectively. The data showed that vp39 or p10 transcripts could not be detected in lef-2 399

knockout virus even at 72 hours post transfection (Fig. 5), suggesting that late and very 400

late gene expression was impaired upon lef-2 deletion. ie-1 transcripts could be detected 401

in lef-2 knockout virus at 24 hours post transfection, due to its use of host transcription 402

machinery. The northern blot analysis showed that late vp39 and very late p10 gene 403

transcriptions were severely impaired in lef-2 knockout virus. These results indicate that, 404

without amplification, initiation of viral DNA replication is not sufficient to support late 405

and very late viral gene expression from the genome of baculovirus. 406

407

Spatial distribution of LEF-2. The temporal and spatial distributions of LEF-2 protein 408

were analyzed by biochemical separation of infected cells into cytoplasmic and nuclear 409

fractions and detection with western blot analysis. LEF-2 protein was initially detected in 410

the cytoplasm at 16 hours post infection and clearly detectable in both nucleus and 411

cytoplasm starting at 20 hours post infection (Fig. 6A). In another experiment we found 412

that its expression continued to accumulate in both cytoplasm and nucleus up to 72 hours 413

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

19

post infection and declined at 96 hours post infection (data not shown). About equal 414

amounts of LEF-2 were detected in cytoplasm and in nucleus at later time points post 415

infection; this may be due to the relatively small size of LEF-2 and the lack of a known 416

nuclear localization sequence in this protein (9, 13). 417

LEF-2 is one of the virally-encoded proteins required for viral DNA replication; 418

however; its localization relative to viral DNA replication sites has not yet been 419

investigated. To study the localization of LEF-2 relative to the sites of viral DNA 420

replication in vivo, localization of LEF-2 in infected cells was visualized by 421

immunofluorescence staining. Cellular and newly-replicated viral DNAs were visualized 422

with propidium iodine (PI) staining. At 16 hours post infection, cellular chromatin was 423

marginalized and lined the periphery of the cell nucleus (30) and the heavy PI staining in 424

the central region of the nucleus represented the newly-synthesized viral DNAs and viral 425

DNA replication foci (Fig. 6B). LEF-2 was shown to co-localize well with the newly-426

synthesized viral DNAs. This further indicates the involvement of LEF-2 in viral DNA 427

replication processes. 428

429

Association of LEF-2 with nucleocapsids of both BVs and ODVs. Previous analysis of 430

the purified ODV revealed that five (IE-1, LEF-1, LEF-3, DNAPOL, and P143) of the 431

viral proteins involved in DNA replication were associated with the nucleocapsids of 432

ODVs (6). This confers virus the ability to efficiently initiate viral DNA replication as 433

soon as it enters host cells. Because LEF-2 was also required for viral DNA replication, it 434

became a question whether LEF-2 was also associated with the nucleocapsid of the virus 435

particles along with the other replication LEFs. To this end, a lef-2 repair virus, vAchE-

436

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

20

lef2HA-PH, was generated in which HA tags were added to the N-terminus of LEF-2 along 437

with polyhedrin. BVs were purified from the supernatant of vAchE-lef2HA-PH

- infected cells 438

and ODVs were extracted from vAchE-lef2HA-PH

- infected cells. LEF-2 protein could be 439

detected in both purified BVs and ODVs, demonstrating that LEF-2 is a component of 440

virus particles (Fig. 7). To further elucidate the localization of LEF-2 in virus particles, 441

biochemical fractionation of the purified virus particles was undertaken and western blot 442

analysis showed that LEF-2 protein was localized predominantly in the nucleocapsids of 443

both BVs and ODVs (Fig. 7). To assess whether fractionation was successful, 444

localization of GP64 protein, an envelope protein, and VP39, a capsid protein, in the 445

purified virus particles were also analyzed and detected with antibody specifically for 446

GP64 and VP39. GP64 protein was mainly detected in the envelope fraction of BVs with 447

a trace amount being detected in the nucleocapsid fraction. This was considered 448

acceptable envelope contamination of the nucleocapsid preparation (< 10%) (4, 7). On 449

the other hand, VP39 protein was detected primarily in nucleocapsid fraction of the 450

purified virus particles, indicating that fractionation process was successful. 451

452

DISCUSSION 453

In this report we studied the effects of lef-2 deletion on the baculovirus infection 454

cycle. We found that in the absence of lef-2, no infectious virus particles could be 455

produced. It is reasonable to attribute the defects in virus progeny production to lef-2 456

deletion as the repair virus exhibited a wild-type virus growth curve (Fig. 2B and 2C). 457

Previous reports showed that LEF-2 was essential for origin-dependent DNA replication 458

(16, 23), however, our experiment showed that without LEF-2, DNA replication can still 459

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

21

be initiated, though at an extremely low level (Fig. 4B). On the other hand, deletion of 460

p143, which is an essential gene for viral DNA replication and encodes a helicase, 461

completely abolishes viral DNA replication as no viral DNA replication could be 462

detected (Fig. 4C). This implies that the replicated DNA detected in lef-2 knockout virus 463

is not likely the result of non-specific DNA replication. Therefore, our results suggest 464

that LEF-2 may be stimulatory rather than essential, as opposed to the transient 465

expression assays (16), for viral DNA replication in the course of virus infection. 466

There are a couple possible explanations for this discrepancy. In previous studies, 467

all the viral factors were expressed transiently which could alter their temporal expression 468

in comparison with those in the context of the virus. In addition, those viral factors were 469

expressed from sub-genomic fragments which may accidently exclude the 5’ or 3’ end or 470

cis-acting elements essential for gene regulation by other viral factors. The transient 471

expression system may not have mimicked the real scenario during the normal course of 472

virus infection. Secondly, the replication of a plasmid containing the standard replication 473

origin, the homologous region (hr), was used as an indicator for DNA replication in those 474

studies. However, plasmids containing viral sequences other than hr have been shown to 475

replicate in the presence of virus (40) and their ability to initiate DNA replication may 476

not rely on the co-presence of replication lefs. Another possibility is that segments of the 477

viral DNA were incorporated into the host genome and therefore replicated along with 478

cellular DNA, which could also yield DpnI-resistant products. Integration of segments of 479

baculoviral genomic DNA into the host genome has been demonstrated in mammalian 480

cells (26). However, this possibility may not be the case because we also used a DIG-481

labeled DNA probe for vp39 gene sequence DIG-labeled DNA probe for lef-1 gene 482

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

22

sequence. Since vp39 is located on the opposite end of lef-1 on the viral genome, it 483

suggested that the whole genome, rather than segments, had replicated. Therefore, 484

integration may not be the reason for the DpnI resistant products observed in the DpnI 485

replication assay in this report (Fig. 4). 486

Previous reports have implicated that baculovirus late and very late gene 487

expression depends on viral DNA replication (23, 34). Most of the viral late and very late 488

genes encode viral structural proteins, which are components of budded viruses and 489

occlusion-derived viruses. As a consequence of low-level viral DNA replication, viral 490

late and very late gene expression were abolished in lef-2 knockout virus (Fig. 5), 491

indicating a total shutdown of the viral transcription system. The observation that low 492

levels of viral DNA replication were not sufficient to turn on late and very late gene 493

expression suggests that either vigorous viral DNA replication activity is required to turn 494

on viral transcription or LEF-2 itself is involved in the transcription of late and very late 495

genes, as being previously suggested (32). We also noticed that the repair virus (bAc∆lef2-

496

Rep-hE) had a slower virus growth curve in transfected cells in comparison with the wild-497

type virus (bAcwt-hE

) (Fig. 2B). This was possibly because lef-2 was located in a different 498

context on the viral genome in repair virus, which resulted in an altered temporal 499

transcription profile of lef-2 in the repair virus as compared to the wild-type virus and 500

subsequently slowed the virus growth rate (Fig. 3). Multiple transcripts, which run 501

through the lef-2 coding sequence, were detected in both repair and wild-type viruses 502

toward late time points post infection. The presence of high-molecular-weight transcripts 503

in lef-2 coding region and other viral genomic regions have also been reported previously 504

(12, 24), and the transcription of these transcripts were either initiated at regions further 505

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

23

upstream or terminated at regions further downstream of the target sequence. Anti-sense 506

probes recognizing the upstream and downstream sequences, respectively, of lef-2 will 507

help to elucidate the exact identities of the high-molecular-weight transcripts detected in 508

Fig. 3. 509

In vivo immunofluorescence staining showed that LEF-2 co-localized with newly-510

synthesized viral DNA (Fig. 6B). Several replicative lefs have been shown to localize to 511

the sites of viral DNA replication in vivo, including IE-1, LEF-3, P143, and DBP (14, 25, 512

30, 31). Our results provide indirect evidence that LEF-2 does serve some important 513

functions at the sites of viral DNA replication, i.e., virogenic stroma. Nevertheless, the 514

exact functions of LEF-2 during viral DNA replication are yet to be elucidated. It was 515

also observed that co-localization of newly-synthesized viral DNA and LEF-2 was more 516

readily detectible after the replication foci have passed the initial formation stage and 517

enlarged (data not shown). Since late and very late gene expression also takes place in the 518

virogenic stroma, the immunofluorescence staining data here may also implicate the 519

involvement of LEF-2 in late and very late gene expression. 520

The incorporation of LEF-2 into the nucleocapsids of both BVs and ODVs is one 521

of the important findings in the present report (Fig. 7). Previously, all of the baculovirus 522

replication lef gene products (IE-1, LEF-1, LEF-3, DNAPOL, and P143), except LEF-2, 523

have been shown to associate with nucleocapsids of the occlusion-derived viruses (6). 524

Our result here adds LEF-2 to the list, meaning that essentially all the replication lef gene 525

products are present in the nucleocapsids of the ODVs. This finding raises the possibility 526

that viral DNA replication may be initiated and amplified by these capsid proteins even 527

prior to the expression of these replication-related lefs from the newly invading viral 528

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

24

genome. More recently LEF-11 was also found to be involved in viral DNA replication 529

based on the genomic-knock out experiments (17). Whether this gene product is also a 530

component of the nucleocapsid of virus particles or not remains as an interesting issue for 531

further studies. 532

LEF-2 is generally viewed as the primase-associated factor due to its interaction 533

with baculovirus-encoded DNA primase LEF-1 (10, 28). No known function has been 534

assigned to LEF-2 besides its requirement for viral DNA replication, though LEF-2 has 535

been suggested to possess a single-stranded DNA binding ability (28). The primase-536

associated factor of another double-stranded DNA virus, UL8 of herpes simplex virus 537

type 1 (HSV-1), was a component of the helicase-primase complex, which forms part of 538

the pre-replicative sites (18). UL8 was also shown to be involved in efficient nuclear 539

uptake of the other two proteins of the helicase-primase complex, UL5 and UL52, that 540

function as a helicase and primase, respectively (8). This is not quite the case for 541

baculovirus as LEF-2 is not required for the nuclear transport of baculovirus-encoded 542

helicase, P143. Instead, a virus-encoded single strand binding protein, LEF-3, is required 543

for this process (2, 9). UL8 of HSV-1 is also required for efficient primer utilization 544

during lagging-strand synthesis (36). LEF-2 may serve a similar function to UL8 in this 545

regard if binding of LEF-2 to ssDNA and LEF-1 occurs during DNA synthesis on the 546

lagging strand (28). The validation of this hypothesis may further help define the exact 547

functions of LEF-2 during baculovirus replication processes. Moreover, elucidation of the 548

mechanism by which LEF-2 affects late and very late gene expression would further our 549

understanding in baculovirus transcriptional regulation. 550

551

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

25

ACKNOWLEDGEMENTS 552

We thank Drs. Gary Blissard and Oliver Lung for giving us gp64-knockout 553

bacmid as a necessary control, and Dr. David Theilmann for valuable discussions and 554

suggestions. We also thank Ms. Miranda Loney and Dr. Harry Wilson for revision. This 555

research is funded by grants 098-2811-B-001-025, 098-2811-B-001-036, and 98-2321-B-556

001-031-MY3 from the National Science Council, and 94S-1303 from Academia Sinica, 557

Taiwan. 558

559

REFERENCES 560

1. Acharya, A., and K. P. Gopinathan. 2001. Identification of an enhancer-like 561

element in the polyhedrin gene upstream region of Bombyx mori 562

nucleopolyhedrovirus. J Gen Virol 82:2811-9. 563

2. Au, V., M. Yu, and E. B. Carstens. 2009. Characterization of a baculovirus 564

nuclear localization signal domain in the late expression factor 3 protein. Virology 565

385:209-17. 566

3. Ayres, M. D., S. C. Howard, J. Kuzio, M. Lopez-Ferber, and R. D. Possee. 567

1994. The complete DNA sequence of Autographa californica nuclear 568

polyhedrosis virus. Virology 202:586-605. 569

4. Beniya, H., S. C. Braunagel, and M. D. Summers. 1998. Autographa 570

californica nuclear polyhedrosis virus: subcellular localization and protein 571

trafficking of BV/ODV-E26 to intranuclear membranes and viral envelopes. 572

Virology 240:64-75. 573

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

26

5. Blissard, G. W., and J. R. Wenz. 1992. Baculovirus gp64 envelope glycoprotein 574

is sufficient to mediate pH-dependent membrane fusion. J Virol 66:6829-35. 575

6. Braunagel, S. C., W. K. Russell, G. Rosas-Acosta, D. H. Russell, and M. D. 576

Summers. 2003. Determination of the protein composition of the occlusion-577

derived virus of Autographa californica nucleopolyhedrovirus. Proc Natl Acad 578

Sci U S A 100:9797-802. 579

7. Braunagel, S. C., and M. D. Summers. 1994. Autographa californica nuclear 580

polyhedrosis virus, PDV, and ECV viral envelopes and nucleocapsids: structural 581

proteins, antigens, lipid and fatty acid profiles. Virology 202:315-28. 582

8. Calder, J. M., E. C. Stow, and N. D. Stow. 1992. On the cellular localization of 583

the components of the herpes simplex virus type 1 helicase-primase complex and 584

the viral origin-binding protein. J Gen Virol 73 ( Pt 3):531-8. 585

9. Chen, Z., and E. B. Carstens. 2005. Identification of domains in Autographa 586

californica multiple nucleopolyhedrovirus late expression factor 3 required for 587

nuclear transport of P143. J Virol 79:10915-22. 588

10. Evans, J. T., D. J. Leisy, and G. F. Rohrmann. 1997. Characterization of the 589

interaction between the baculovirus replication factors LEF-1 and LEF-2. J Virol 590

71:3114-9. 591

11. Fang, M., X. Dai, and D. A. Theilmann. 2007. Autographa californica multiple 592

nucleopolyhedrovirus EXON0 (ORF141) is required for efficient egress of 593

nucleocapsids from the nucleus. J Virol 81:9859-69. 594

12. Friesen, P. D., and L. K. Miller. 1985. Temporal regulation of baculovirus RNA: 595

overlapping early and late transcripts. J Virol 54:392-400. 596

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

27

13. Hicks, G. R., and N. V. Raikhel. 1995. Protein import into the nucleus: an 597

integrated view. Annu Rev Cell Dev Biol 11:155-88. 598

14. Ito, E., D. Sahri, R. Knippers, and E. B. Carstens. 2004. Baculovirus proteins 599

IE-1, LEF-3, and P143 interact with DNA in vivo: a formaldehyde cross-linking 600

study. Virology 329:337-47. 601

15. Jehle, J. A., G. W. Blissard, B. C. Bonning, J. S. Cory, E. A. Herniou, G. F. 602

Rohrmann, D. A. Theilmann, S. M. Thiem, and J. M. Vlak. 2006. On the 603

classification and nomenclature of baculoviruses: a proposal for revision. Arch 604

Virol 151:1257-66. 605

16. Kool, M., C. H. Ahrens, R. W. Goldbach, G. F. Rohrmann, and J. M. Vlak. 606

1994. Identification of genes involved in DNA replication of the Autographa 607

californica baculovirus. Proc Natl Acad Sci U S A 91:11212-6. 608

17. Lin, G., and G. W. Blissard. 2002. Analysis of an Autographa californica 609

nucleopolyhedrovirus lef-11 knockout: LEF-11 is essential for viral DNA 610

replication. J Virol 76:2770-9. 611

18. Liptak, L. M., S. L. Uprichard, and D. M. Knipe. 1996. Functional order of 612

assembly of herpes simplex virus DNA replication proteins into prereplicative site 613

structures. J Virol 70:1759-67. 614

19. Liu, C. Y., C. H. Wang, W. K. Hsiao, H. R. Lo, C. P. Wu, and Y. C. Chao. 615

2009. RING and coiled-coil domains of baculovirus IE2 are critical in strong 616

activation of the cytomegalovirus major immediate-early promoter in mammalian 617

cells. J Virol 83:3604-16. 618

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

28

20. Liu, Y. K., C. C. Chu, and T. Y. Wu. 2006. Baculovirus ETL promoter acts as a 619

shuttle promoter between insect cells and mammalian cells. Acta Pharmacol Sin 620

27:321-7. 621

21. Lo, H. R., and Y. C. Chao. 2004. Rapid titer determination of baculovirus by 622

quantitative real-time polymerase chain reaction. Biotechnol Prog 20:354-60. 623

22. Lo, H. R., C. C. Chou, T. Y. Wu, J. P. Yuen, and Y. C. Chao. 2002. Novel 624

baculovirus DNA elements strongly stimulate activities of exogenous and 625

endogenous promoters. J Biol Chem 277:5256-64. 626

23. Lu, A., and L. K. Miller. 1995. The roles of eighteen baculovirus late expression 627

factor genes in transcription and DNA replication. J Virol 69:975-82. 628

24. Mainprize, T. H., K. Lee, and L. K. Miller. 1986. Variation in the temporal 629

expression of overlapping baculovirus transcripts. Virus Res 6:85-99. 630

25. Mainz, D., I. Quadt, and D. Knebel-Morsdorf. 2002. Nuclear IE2 structures are 631

related to viral DNA replication sites during baculovirus infection. J Virol 632

76:5198-207. 633

26. Merrihew, R. V., W. C. Clay, J. P. Condreay, S. M. Witherspoon, W. S. 634

Dallas, and T. A. Kost. 2001. Chromosomal integration of transduced 635

recombinant baculovirus DNA in mammalian cells. J Virol 75:903-9. 636

27. Merrington, C. L., P. A. Kitts, L. A. King, and R. D. Possee. 1996. An 637

Autographa californica nucleopolyhedrovirus lef-2 mutant: consequences for 638

DNA replication and very late gene expression. Virology 217:338-48. 639

28. Mikhailov, V. S., and G. F. Rohrmann. 2002. Baculovirus replication factor 640

LEF-1 is a DNA primase. J Virol 76:2287-97. 641

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

29

29. Monsma, S. A., A. G. Oomens, and G. W. Blissard. 1996. The GP64 envelope 642

fusion protein is an essential baculovirus protein required for cell-to-cell 643

transmission of infection. J Virol 70:4607-16. 644

30. Nagamine, T., Y. Kawasaki, A. Abe, and S. Matsumoto. 2008. Nuclear 645

marginalization of host cell chromatin associated with expansion of two discrete 646

virus-induced subnuclear compartments during baculovirus infection. J Virol 647

82:6409-18. 648

31. Okano, K., V. S. Mikhailov, and S. Maeda. 1999. Colocalization of baculovirus 649

IE-1 and two DNA-binding proteins, DBP and LEF-3, to viral replication 650

factories. J Virol 73:110-9. 651

32. Passarelli, A. L., and L. K. Miller. 1993. Three baculovirus genes involved in 652

late and very late gene expression: ie-1, ie-n, and lef-2. J Virol 67:2149-58. 653

33. Rapp, J. C., J. A. Wilson, and L. K. Miller. 1998. Nineteen baculovirus open 654

reading frames, including LEF-12, support late gene expression. J Virol 655

72:10197-206. 656

34. Rice, W. C., and L. K. Miller. 1986. Baculovirus transcription in the presence of 657

inhibitors and in nonpermissive Drosophila cells. Virus Res 6:155-72. 658

35. Schultz, K. L., and P. D. Friesen. 2009. Baculovirus DNA Replication-specific 659

Expression Factors Trigger Apoptosis and Shutoff of Host Protein Synthesis 660

During Infection. J Virol 83:11123-32. 661

36. Sherman, G., J. Gottlieb, and M. D. Challberg. 1992. The UL8 subunit of the 662

herpes simplex virus helicase-primase complex is required for efficient primer 663

utilization. J Virol 66:4884-92. 664

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

30

37. Stewart, T. M., I. Huijskens, L. G. Willis, and D. A. Theilmann. 2005. The 665

Autographa californica multiple nucleopolyhedrovirus ie0-ie1 gene complex is 666

essential for wild-type virus replication, but either IE0 or IE1 can support virus 667

growth. J Virol 79:4619-29. 668

38. Vanarsdall, A. L., K. Okano, and G. F. Rohrmann. 2004. Characterization of a 669

baculovirus with a deletion of vlf-1. Virology 326:191-201. 670

39. Wu, C. P., J. Y. Wang, T. Y. Huang, H. R. Lo, and Y. C. Chao. 2008. 671

Identification of baculoviral factors required for the activation of enhancer-like 672

polyhedrin upstream (pu) sequence. Virus Res 138:7-16. 673

40. Wu, Y., and E. B. Carstens. 1996. Initiation of baculovirus DNA replication: 674

early promoter regions can function as infection-dependent replicating sequences 675

in a plasmid-based replication assay. J Virol 70:6967-72. 676

41. Wu, Y. L., and Y. C. Chao. 2008. The establishment of a controllable expression 677

system in baculovirus: stimulated overexpression of polyhedrin promoter by LEF-678

2. Biotechnol Prog 24:1232-40. 679

42. Wu, Y. L., C. P. Wu, S. T. Lee, H. Tang, C. H. Chang, H. H. Chen, and Y. C. 680

Chao. The early gene hhi1 reactivates Heliothis zea nudivirus 1 in latently 681

infected cells. J Virol 84:1057-65. 682

683

FIGURE LEGENDS 684

Figure 1. Schematic drawing of wild-type, lef-2 knockout and repair bacmids used in this 685

study. lef-2 gene sequence was replaced by the chloramphenicol (CAT) gene flanked by 686

50-nt sequences homologous to the 5′- and 3′- end sequences of the lef-2 gene. Reporter 687

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

31

cassettes containing egfp gene under the control of the heat shock 70 promoter were 688

inserted into the polyhedrin locus by site specific transposition in E. coli to yield a 689

bacmid backbone for further modifications. The 1st bacmid, bAc

wt-hE, contains a wild-690

type bacmid backbone inserted with egfp; in the 2nd

bacmid bAc∆lef2-hE

, lef-2 was deleted; 691

in the 3rd bacmid bAc∆lef2-Rep-hE

, a lef-2 expression cassette was re-inserted for repairing; 692

in the 4th

bacmid bAchElef2HA-polh

, the HA tag sequence was inserted at the 5′ end of lef-2, 693

followed by a complete polyhedrin expression cassette. p-hsp70: heat shock 70 promoter; 694

p-lef2: putative lef-2 promoter; p-polh: polyhedrin promoter; egfp: enhanced green 695

fluorescence protein gene. Black boxes: homologous sequences to the 5′- and 3′- ends of 696

lef-2; shaded boxes: HA tag sequence. 697

698

Figure 2. Budded virus production is impaired in lef-2 knockout virus. (A) Fluorescence 699

microscopic images of Sf-21 cells transfected with bAcwt-hE

, bAc∆lef2-hE

, or bAc∆lef2-Rep-hE

700

at 24, 48, 72, 96, and 120 hours post transfection. (B) Virus growth curve analysis. Sf21 701

cells were transfected with bAcwt-hE

, bAc∆lef2-hE

, or bAc∆lef2-Rep-hE

and virus titers at 702

indicated time points were determined by TCID50. (C) Growth curve analysis of vAcwt-hE

703

and vAc∆lef2-Rep-hE

in infected Sf-21 cells. Supernatants of the infected cells were collected 704

up to 120 hours post infection and virus titers were determined by TCID50. 705

706

Figure 3. Temporal expression of lef-2 transcripts in infected cells. Sf-21 cells were 707

infected with either vAcwt-hE

or vAc∆lef2-Rep-hE

at MOI = 5. Total cellular RNA was 708

extracted from infected cells harvested at 0, 4, 8, 12, 16, 24, 36, and 48 hours post 709

infection. Five micrograms of total RNA from each sample were resolved on a 1% 710

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

32

formaldehyde gel and stained with ethidium bromide to visualize 18s rRNA to ensure 711

equal sample loading. The samples were then transferred to a Hybond-N+ membrane 712

(Amersham) and hybridized with DIG-labeled lef-2 anti-sense RNA probes and detected 713

with DIG detection kit. 714

715

Figure 4. Timely initiation and efficiency of viral DNA replication was affected in lef-2 716

knockout virus. Sf-21 cells were transfected with 1 µg of (A) bAc∆gp64

, (B) bAc∆lef2-hE

, or 717

(C) bAc∆p143-ETLE

, Total cellular DNA was extracted from transfected cells collected at 0, 718

24, 48, 72, 96, and 120 hours post transfection. Two micrograms of extracted DNA was 719

digested with 20 U of EcoRI or 20 U of EcoRI + DpnI and resolved on a 0.8 % agarose 720

gel. Samples were hybridized with DIG-labeled lef-1 gene sequence and detected with 721

DIG detection kit. “-”: digestion with EcoRI only; “+”: double digestion with EcoRI and 722

DpnI. The upper bands (indicated by arrows) represent DpnI-resistant signal, while the 723

lower bands represent DpnI-sensitive signal. Due to the active DNA replication in the 724

bAc∆gp64

-transfected cells, the exposure time in panel A is much shorter than those in 725

other panels. 726

727

Figure 5. Late and very late gene expressions were abolished in lef-2 knockout virus. Sf-728

21 cells (1 × 106 cells) were transfected with 1 µg of bAc

wt-hE, bAc

∆lef2-hE, or bAc

∆lef2-Rep-729

hE DNA. Total cellular RNA was extracted from transfected cells collected at 24, 48, and 730

72 hours post transfection. Five micrograms (for vp39 and p10 transcripts) or 15 µg (for 731

ie1 transcript) of total RNA were resolved on a 1% formaldehyde gel and transferred to a 732

Hybond-N+ membrane. The membrane was subsequently hybridized with DIG-labeled 733

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

33

ie1, vp39, or p10 anti-sense RNA probes respectively and detected with DIG detection kit. 734

Ethidium Bromide staining of 18s rRNA demonstrated equal sample loading. Arrows 735

indicate the expected sizes of ie1, vp39, and p10 transcripts. M: mock-transfected cells; 736

W: cells transfected with bAcwt-hE

; K: cells transfected with lef-2 knockout bacmid 737

bAc∆lef2-hE

; R: cells transfected with lef-2 repair bacmid bAc∆lef2-Rep-hE

. 738

739

Figure 6. Localization of LEF-2 in infected Sf-21 cells. (A) LEF-2 is localized to both 740

cytoplasmic and nuclear regions in infected cells. Localization of GP-64 is shown as a 741

control. (B) LEF-2 co-localizes with the active viral DNA replication sites, i.e., virogenic 742

stroma, in the nuclei of the infected cells. Localization of LEF-2 was stained with 743

Alexa405 (blue) and DNA was stained with propidium iodine (red). 744

745

Figure 7. LEF-2 is incorporated into nucleocapsids of both BV and ODV. BVs and ODVs 746

were purified from infected cells by sucrose gradient and separated into nucleocapsid and 747

envelope fractions by glycerol cushion. Ten micrograms of purified BVs (lane 1) or 748

ODVs (lane 4) and 5 µg of nucleocapsid (lanes 2, 5) and envelope (lanes 3, 6) proteins 749

were separated on a 10 % polyacrylamide gel and transferred to a PVDF membrane 750

(Millipore). The presence of LEF-2 protein was detected with mouse monoclonal 751

antibody against the HA tags. The same blot was also probed with rabbit anti-serum 752

against baculovirus envelope protein GP64 and rabbit anti-serum against baculovirus 753

nucleocapsid protein VP39. 754

755

Table 1. Primer sequences used in this report. 756

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

orf5 lef2 orf603

orf5 orf603CAT

egfp

egfp lef2

egfp lef2 polyhedrin

p-hsp70

p-hsp70 p-lef2

p-hsp70 p-lef2 p-polh

bMON 14272

WT lef2 locus:

lef2 KO locus:

bAc∆lef2-Rep-hE:

bAchElef2HA-polh:

bAcwt-hE, bAc∆lef2-hE:

lef2 locus

polh locus

Fig. 1

HA

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

bAcwt-hE bAc∆lef2-hE bAc∆lef-2-Rep-hE

24hpt

48hpt

72hpt

96hpt

120hpt

A)

B)

bAcwt-hE

bAc∆lef2-hE

bAc∆lef2-Rep-hE

0 12 24 48 72 96 120 hpt

Fig. 2

0

1

2

3

4

5

6

7

8

9

pfu

/ml, log10

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

vAcwt-hE

vAc∆lef2-Rep-hE

0 12 24 48 72 96 120 hpi

0

1

2

3

4

5

6

7

8

9

10

pfu

/ml,

Lo

g10

C)

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

0 4 8 12 16 20 24 36 48 hpi

18s rRNA

vAcwt-hE

6.04.03.02.01.5 1.0

0.5

0.2

6.04.03.02.01.51.0

0.5

0.2

Fig. 3

1 2 3 4 5 6 7 8 9 LaneKb

Kb

18s rRNA

vAc∆∆∆∆lef2-Rep-hE

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

120 hpt

- + - + - + - + - + - +DpnI:

96 hpt72 hpt48 hpt24 hpt0 hpt

bAc∆∆∆∆lef2-hE:

bAc∆∆∆∆gp64:

Fig. 4

A

B

bAc∆∆∆∆p143-ETLE :

C

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

2.3-kb

2.2-kb

0.35-kb

18s rRNA

ie1

vp39

p10

W K R

24 hpt 48 hpt 72 hpt

W K R W K RM

Fig. 5

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

0 6 12 16 20 24 30 36 48 hpi

0 6 12 16 20 24 30 36 48 hpi

Nucleus

Cytoplasm

Nucleus

Cytoplasm

LEF-2

GP64

Fig. 6

A)

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

LEF-2 Propidium iodine Merge

Fig. 6

B)

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

LEF-2

GP64

1 2 3

NC

ENV

BV

4 5 6

NC

ENV

ODV

VP39

Fig. 7

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

5' - TAATACGACTCACTATAGGGTTACTTGGAACTGCGTTTACCA - 3'p10-R

5' - ATAAGAATTATTATCAAATCAT - 3'p10-F

5' - CAACCAATTACCAAGACGTGTT - 3'vp39-R

5' - TAATACGACTCACTATAGGGGCAAACGATTGGGTTGACTTCT - 3'vp39-F

5' - TAATACGACTCACTATAGGGTCACAAATGTGGTTTGCACGTA - 3'ie1-R

5' - ATCACAACAGCAACATTTGCAC - 3'ie1-F

5' - CGACAAGGCGTCTAGTTTATGTG - 3'ko-B

5' - CATGACCCCCGTAGTGACAACGATC - 3'ko-A

5' - GTGAGCGCGTCCAAGTTTGAATC - 3'lef1p-R

5' - CAACCGTGGATTTCATTTGTGGT - 3'lef1p-F

5' - GTCGAGCTCTTCGCGGCTTCTCGCACCA - 3'orf5-SacI-R

5' - CGGGGTACCGTTGGGCATGTACGTCCGAA - 3'orf4-KpnI-F

5' - CGCGGATCCTCAATAATTACAAATAGG - 3'lef2-BamHI-R

5' - GTTATGACGCCTACAACTCCCCG - 3'orf4-F

5' - TAGTTACCCATGGGCATATGTTGCCAAACTC - 3'Glu-R

5' - AATACCGGATCCATCGATCTTTTTCCCTCTG - 3'Glu-F

5' - TATGCGCAGCGGTACTATACAC - 3'orf603-R

5' - CGCATCTCAACACGACTATGAT - 3'orf5-F

Primer SequencePrimer Name

Table 1.

on May 29, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from