Update On Avian Influenza Wallace Greene, PhD, ABMM Director, Diagnostic Virology Laboratory Department of Pathology M. S. Hershey Medical Center Hershey,
2013 alumni-webinar
What Killed The Dinosaurs?
Dengue fever final
Reconstructing the social network of viruses in wild ducks
IBC’s Recombinant Protein & Complex Biologic Development and Purification, March 5, 2010
2010 Pep Talk Presentation
Journal club presentation 10 07 2015
Rabies Nahed Abdel-Haq, M.D Division of infectious Diseases Children’s Hospital of Michigan.
An Introduction to Phylogenetics > Sequence 1 GAGGTAGTAATTAGATCCGAAA… > Sequence 2 GAGGTAGTAATTAGATCTGAAA… > Sequence 3 GAGGTAGTAATTAGATCTGTCA… Anton E.
Chapter 19 – Viruses (structure, reproduction, pathogens) HIV infection (TEM) (CDC) T4 bacteriophages infecting E. coli (colorized SEM) Phages (TEM)
Computational Biology at Carnegie Mellon University A Quick Tour Jaime Carbonell Carnegie Mellon University December, 2008.
