Computer Science and Reconstructing Evolutionary Trees Tandy Warnow Department of Computer Science University of Illinois at Urbana-Champaign.
Face Detection, Pose Estimation, and Landmark Localization in the Wild Xiangxin Zhu Deva Ramanan Dept. of Computer Science, University of California, Irvine.
Real-Time Human Pose Recognition in Parts from Single Depth Images Presented by: Mohammad A. Gowayyed.
Javad Lavaei Department of Electrical Engineering Columbia University Graph-Theoretic Algorithm for Nonlinear Power Optimization Problems.
Locality Sensitive Distributed Computing Exercise Set 2 David Peleg Weizmann Institute.
Rapid Global Alignments How to align genomic sequences in (more or less) linear time.
1 Chapter 3 Graphs Slides by Kevin Wayne. Copyright © 2005 Pearson-Addison Wesley. All rights reserved.
1 Conditional XPath, the first order complete XPath dialect Maarten Marx Presented by: Einav Bar-Ner.
1 Greedy 2 Jose Rolim University of Geneva. Algorithmique Greedy 2Jose Rolim2 Examples Greedy Minimum Spanning Trees Shortest Paths Dijkstra.
GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.
CSE 780 Algorithms Advanced Algorithms Minimum spanning tree Generic algorithm Kruskal’s algorithm Prim’s algorithm.
1 Policy Disputes in Path-Vector Protocols A Safe Path-Vector Protocol Zacharopoulos Dimitris ([email protected])
