ViST: a dynamic index method for querying XML data by tree structures Authors: Haixun Wang, Sanghyun Park, Wei Fan, Philip Yu Presenter: Elena Zheleva,
Rapid Global Alignments How to align genomic sequences in (more or less) linear time.
GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State.
Comparison of large sequences
Bioinformatics PhD. Course
Database Index to Large Biological Sequences Ela Hunt, Malcolm P. Atkinson, and Robert W. Irving Proceedings of the 27th VLDB Conference,2001 Presented.
