University of Groningen
WNT signaling in airway remodeling in asthmaKumawat, Kuldeep
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2015
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Kumawat, K. (2015). WNT signaling in airway remodeling in asthma: novel roles for WNT-5A in airwaysmooth muscle. [S.n.].
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 30-04-2022
117 | P a g e
WNT-5A and WNT-11 drive TGF-β-
induced α-sm-actin expression in
smooth muscle via Rho kinase-actin-
MRTF-A signaling
Kuldeep Kumawat
Mark H. Menzen
Alita Prins
Marieke Smit
Andrew J. Halayko
Reinoud Gosens
4
Chapter 4
118 | P a g e
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
119 | P a g e
Abstract
Airway smooth muscle (ASM) remodeling is a key feature in asthma which includes changes
in smooth muscle specific gene and protein expression. The mechanisms governing ASM
remodeling are poorly understood. We have recently demonstrated increased abundance of
the noncanonical WNT ligand WNT-5A in ASM cells derived from asthmatics as compared
to healthy subjects. Here, we studied the functional interaction between noncanonical WNT
signaling and TGF-β in ASM cells and demonstrate that WNT-5A and WNT-11 are
preferentially expressed in contractile mycocytes and regulate α-sm-actin expression in ASM
cells. Knock-down of WNT-5A or WNT-11 attenuated TGF-β-induced α-sm-actin expression
in ASM cells and the presence of exogenous recombinant WNT-5A or WNT-11 augmented α-
sm-actin levels in the absence of TGF-β. Further, we demonstrate that TGF-β-induced α-sm-
actin expression is mediated by WNT-5A- and WNT-11-regulated induction of RhoA
activation and subsequent actin cytoskeletal remodeling as pharmacological inhibition of
either Rho kinase by Y27632 or actin remodeling by latrunculin A attenuated α-sm-actin
induction. Moreover, we show that TGF-β upregulates the expression and induces Rho
GTPase-dependent nuclear translocation of MRTF-A which, in turn, mediates α-sm-actin
expression in ASM cells. Finally, we demonstrate that MRTF-A nuclear translocation is
dependent on noncanonical WNT ligands. The present study, thus, demonstrates a WNT-
5A- and WNT-11-dependent Rho kinase-actin-MRTF-A signaling axis that regulates the
expression of α-sm-actin in ASM cells.
Introduction
Airway remodeling is a hallmark pathological feature of individuals with asthma and is
associated with airway obstruction [1], airway hyperresponsiveness [2] and declining lung
function in severe disease [3]. It is characterized by extensive structural changes in the
airway wall which include increased airway smooth muscle (ASM) mass, subepithelial
fibrosis, mucus hypersecretion, neovascularization and increased and altered extracellular
matrix (ECM) expression, contributing to airway wall thickening [4].
Increased ASM mass is a predominant feature of airway remodeling in asthma and correlates
with the severity of disease [5-7]. ASM cells show a remarkable phenotypic plasticity where
they can exist in a synthetic proliferative phenotype actively undergoing cell divisions and
also releasing a number of inflammatory and other mediators and growth factors. In
contrast, mature ASM cells have low proliferation index and high abundance of contractile
apparatus like sm-MHC, SM-22 and α-smooth muscle-actin (α-sm-actin) [8-10]. Increased
ASM mass and increased expression of contractile and contraction regulatory proteins are
important features of the asthmatic airway [7,11].
WNT signaling regulates a myriad of functions from embryonic development extending
throughout the lifespan of humans [12]. Intracellular WNT signaling is broadly classified
into canonical (β-catenin-dependent) and non-canonical (β-catenin-independent) branches.
The activation of canonical WNT signaling results in the cytosolic accumulation of the
transcriptional co-activator β-catenin which, in turn, translocates to the nucleus and
activates WNT-target gene transcription in association with the T-cell factor/lymphoid
Chapter 4
120 | P a g e
enhancer-binding factor (TCF/LEF) transcription factors. Noncanonical WNT signaling, on
the other hand, activates various signaling cascades independent of β-catenin and regulates
cell polarity, cell movements, cytoskeletal reorganization and gene transcription. WNT/Ca2+
and WNT/planar cell polarity (PCP) pathways are the best characterized members of
noncanonical WNT signaling. The WNT/Ca2+ signaling is transduced by activation of
calcium-dependent signaling molecules, including protein kinase C (PKC), Ca2+/calmodulin-
dependent protein kinase II (CaMKII) and nuclear factor of activated T-cell (NFAT), whereas
the WNT/PCP pathway is relayed by RhoA or activation of c-Jun N-terminal Kinases (JNKs)
via small Rho-GTPases [12].
We have recently reported high abundance of WNT-5A in asthmatic ASM cells as compared
to healthy subjects and demonstrated that WNT-5A mediates TGF-β-induced ECM
expression. Also, we have shown that noncanonical WNTs such as WNT-5A and WNT-11 are
transcriptional targets of TGF-β in ASM cells (Chapter 3). TGF-β is a potent inducer of
contractile proteins including α-sm-actin in ASM cells and regulates ASM maturation [13].
Whether noncanonical WNT signaling also participates in ASM maturation is unknown.
However, noncanonical WNT signaling induces extensive actin cytoskeletal reorganization
which can alter the G-actin/F-actin ratio [14,15]. In addition, WNT-11 has been shown to
mediate TGF-β-induced α-sm-actin expression in renal epithelial cells [16].
Here, we investigated the role of WNT-5A and WNT-11 in TGF-β-induced α-sm-actin
expression in ASM cells and demonstrate that the expression of these noncanonical WNT
ligands increases during maturation. Furthermore, we show that WNT-5A and WNT-11
mediate TGF-β-induced actin remodeling and activate Rho kinase signaling in ASM cells.
Finally, we demonstrate that WNT-5A and WNT-11 regulate myocardin-related
transcription factor –A (MRTF-A) dynamics and mediate α-sm-actin expression.
Materials and Methods
Reagents- Recombinant human TGF-β1, recombinant human WNT-5A and recombinant
human WNT-11 were from R&D systems (Abingdon, UK). siRNA specific for human WNT-
11 and human MRTF-A, rabbit anti-MRTF-A antibody, mouse anti-Lamin A/C antibody and
mouse anti-GAPDH were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
Anti-phospho-MYPT1 (Thr850) antibody was obtained from Cell Signaling Technology
(Beverly, MA, USA) and anti-β-actin antibody, anti-α-sm-actin antibody, HRP-conjugated
goat anti-mouse antibody and HRP-conjugated goat anti-rabbit antibody were obtained
from Sigma (St. Louis, MO, USA). Alexa Fluor 488-conjugated Phalloidin, Alexa Fluor 594-
conjugated DNAse I, Hoechst 33342 stain and ProLong Gold Antifade reagent were from
Life Technologies (Bleiswijk, The Netherlands). Fluorescein isothiocyanate (FITC)-
conjugated donkey anti-rabbit antibody and Cy3-conjugated donkey anti-mouse antibody
was procured from Jackson Immunoresearch Europe (Suffolk, UK). Human non-specific
control and human WNT-5A siRNAs were procured from Qiagen (Venlo, The Netherlands)
and X-tremeGENE siRNA transfection reagent was purchased from Roche Applied Science
(Mannheim, Germany). LL-Z1640-2, Y-27632 dihydrochloride and latrunculin A were from
Tocris (Bristol, UK). All other chemicals were of analytical grade.
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
121 | P a g e
Cell culture- Human ASM cell lines, immortalized by human telomerase reverse
transcriptase (hTERT) and primary ASM cells were used for all the experiments. The
primary cultured human ASM cells used to generate each hTERT immortalized cell line were
prepared as described previously [17]. All procedures were approved by the Human Research
Ethics Board (University of Manitoba). hTERT-ASM cell lines were maintained on uncoated
plastic dishes in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with
antibiotics (50 U/ml streptomycin, 50 µg/ml penicillin) and 10% (v/v) fetal bovine serum
(FBS). For each experiment, hTERT-ASM cell lines (ASM cells) derived from two to three
different donors were used for repeated measurements. Cells were serum-deprived in
DMEM supplemented with antibiotics and ITS (5 µg/ml insulin, 5 µg/ml transferrin, and 5
ng/ml selenium) before each experiment. When applied, inhibitors were added 30 min
before the TGF-β stimulation.
Primary ASM tissue and cells were derived from trachea and mainstem bronchus obtained
from healthy transplant donors. Selection criteria for healthy lung transplant donors are
listed in the Eurotransplant guidelines and include the absence of primary lung disease such
as asthma and COPD and no more than 20 pack years of smoking history. The ASM tissue
was snap frozen after isolation and stored at -80°C till further use. The primary ASM cell
cultures derived from the trachea and mainstem bronchus were prepared as described
previously (Chapter 3) and were cultured on uncoated plastic dishes in DMEM
supplemented with antibiotics, 1% MEM essential vitamins and 10% FBS.
siRNA transfection- ASM cells were grown to ~90% confluence in 6-well cluster plates
and transfected with 200 pmol of specific siRNA in serum and antibiotic free DMEM with
X-tremeGENE siRNA transfection reagent. Control transfections were performed using a
non-targeting control siRNA. After 6 hours of transfection, medium was replaced with
DMEM supplemented with antibiotics and ITS for a period of 42 hours before TGF-β
stimulation.
RNA isolation and real-time PCR- Total RNA was extracted using the Nucleospin
RNAII kit (Macherey-Nagel, Duren, Germany) as per the manufacturer’s instructions. Equal
amounts of total RNA were then reverse transcribed using the Reverse Transcription System
(Promega, Madison, USA). 1 µl of 1:2 diluted cDNA was subjected to real-time PCR, which
was performed with the Illumina Eco Personal QPCR System (Westburg, Leusden, the
Netherlands) using FastStart Universal SYBR Green Master Mix from Roche Applied Science
(Mannheim, Germany). Real time PCR was performed with denaturation at 94°C for 30
seconds, annealing at 59°C for 30 seconds and extension at 72°C for 30 seconds for 40 cycles
followed by 10 minutes at 72°C. Real time PCR data was analyzed using the comparative
cycle threshold (Cq: amplification cycle number) method. The amount of target gene was
normalized to the endogenous reference gene 18S ribosomal RNA (∆Cq). Relative differences
were determined using the equation 2(-∆∆Cq). Primers used to analyze gene expression are: α-
sm-actin Fwd 5’- GACCCTGAAGTACCCGATAGAAC -3’ and Rev 5’-
GGGCAACACGAAGCTCATTG -3’, MRTF-A Fwd 5’- GCCAGGTGAACTATCCCAAA -3’ and
Rev 5’- CACAGAACCCTGGGACTCAT -3’ and 18S rRNA Fwd 5’-
CGCCGCTAGAGGTGAAATTC -3’and Rev 5’- TTGGCAAATGCTTTCGCTC -3’.
Chapter 4
122 | P a g e
Immunofluorescence- Phalloidin was used to stain F-actin and DNAse I was used to stain
G-actin. ASM cells were cultured on coverslips or in Labtek 8-chamber slides. Post-
stimulation, cells were washed in warm PBS and fixed in 4% paraformaldehyde (PFA) plus
4% sucrose in PBS for 15 min. Cells were then incubated with 0.3% Triton X-100 in PBS for
2 min and blocked in 5% BSA in PBS for 1 hour following which cells were incubated with
Alexa Fluor 488-conjugated Phalloidin (1:500) plus Alexa Fluor 594-conjugated DNAse I
(1:500) in 1% BSA for 1 hour. Nuclei were stained with Hoechst stain (1:10000) diluted in
ddH2O. After staining, coverslips were mounted in ProLong Gold Antifade reagent.
Immunofluorescence was analyzed using a Leica microscope. For MRTF-A and α-sm-actin
immunofluorescence was done as described earlier [18] using specific antibodies (dilution
1:100) and donkey anti-rabbit FITC or donkey anti-mouse cy3 antibodies (dilution: 1:50).
Nuclear extract preparation- Nuclear extracts were prepared as described previously
(Chapter 3).
Preparation of cell lysates- The whole cell extracts were either prepared as described
previously (Chapter 3) using SDS lysis buffer or by direct lysis in 2X Laemmli loading
buffer.
Western analysis- Protein samples were subjected to electrophoresis, transferred to
nitrocellulose membranes, and analyzed for the proteins of interest using specific primary
and HRP-conjugated secondary antibodies. Bands were subsequently visualized using the G-
box gel documentation system (Syngene, Cambridge, UK) using enhanced
chemiluminescence reagents and were quantified by densitometry using Genetools software.
Data Analysis- Values reported for all data are represented as mean ± SEM. The statistical
significance of differences between means was determined by Student’s t-test or by 1-way
ANOVA followed by Student-Newman Keuls multiple comparisons test. Differences were
considered to be statistically significant when p<0.05.
Results
WNT-5A and WNT-11 in contractile ASM cells. Noncanonical WNT signaling is
implicated in cytoskeletal reorganization and cell movements. We first investigated whether
there is any possible link between noncanonical WNT ligands and the contractile phenotype
of ASM cells. We approached this question using human tracheal smooth muscle tissue,
cultured hTERT-ASM cells and a previously reported model of contractile phenotype
maturation in primary human ASM cells [19].
We cultured cells in serum-containing medium until 50% confluence and used these as the
serum-fed group expressing a proliferative smooth muscle phenotype or until 100%
confluence followed by a serum-deprivation for 7 days labeling these as the serum-starved
group expressing a contractile phenotype [19]. Accordingly, we found that serum-starved
primary human ASM cells showed increased expression of α-sm-actin in comparison to
serum-fed cells (Figure 1A). Interestingly, expression of both WNT-5A and WNT-11 were also
augmented significantly in serum-starved cells in comparison to serum-fed cells (Figure 1A).
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
123 | P a g e
ASM cells in culture tend to lose contractile characteristics and are less contractile than fresh
ASM tissue. In line with this, expression of α-sm-actin was significantly higher in fresh
tracheal smooth muscle tissue in comparison to cultured hTERT-ASM cells (Figure 1B).
Corroborating the link between the contractile phenotype and expression of WNTs, mRNA
abundance of WNT-11 was significantly higher in human tracheal smooth muscle tissue than
in the hTERT-ASM cells in culture (Figure 1B). WNT-5A, however, showed similar
expression levels in both the experimental samples (Figure 1B).
Our data, thus, suggest a link between contractile phenotype and the expression of WNT-5A
and WNT-11 in ASM cells.
Figure 1. WNT-5A and WNT-11 expression in contractile ASM cells. (A) Primary human ASM
cells were cultured with (proliferative phenotype) or without serum (contractile phenotype) as
described in the materials and methods section. α-sm-actin, WNT-5A and WNT-11 mRNA were
determined by qRT-PCR, corrected for 18S rRNA and expressed relative to the serum-fed culture
condition. Data represent mean ± SEM of 5 independent experiments. *p<0.05, ***p<0.001 compared
to serum-fed; 1-way ANOVA followed by Newman-Keuls multiple comparisons test. (B) α-sm-actin,
WNT-5A and WNT-11 mRNA expression were determined in hTERT-ASM cells in culture and in
freshly-isolated human ASM tissue by qRT-PCR and expressed as 18S rRNA corrected values. Note
that data are expressed as threshold cycle (Cq) values with highest values representing lowest mRNA
expression. Data represent mean ± SEM of 3-4 independent experiments. *p<0.05, ***p<0.001
compared to fresh ASM tissue; 1-tailed Student’s t test for unpaired observations.
WNT-5A and WNT-11 mediate TGF-β-induced expression of α-sm-actin. To
investigate the link between the co-expression of α-sm-actin and WNT ligands, we first
analyzed the effect of TGF-β on these genes in hTERT-ASM cells. TGF-β is known to induce
the expression of α-sm-actin in various cell types including ASM cells [13]. We have
previously shown that TGF-β-induces time- and dose-dependent increase in WNT-5A in
hTERT-ASM cells. We also confirmed expression kinetics of α-sm-actin and WNT-11 in
hTERT-ASM cells and observed the time- and dose-dependent increases in the expression
levels (Figure 2). We have earlier reported a similar time- and dose-dependent increase in
WNT-5A expression by TGF-β (Chapter 3).
α-sm-actin WNT-5A WNT-11
Re
lative
mR
NA
exp
ressio
n(f
old
of
se
rum
-fe
d)
0
1
2
3
4Serum-fed
Serum-deprived
***
* *
A
α-sm-actin WNT-5A WNT-11
Cq V
alu
es (
corr
ecte
d f
or
18S
)
0
5
10
15
20
25
Fresh ASM tissue
hTERT-ASM cell line
*
***
B
Chapter 4
124 | P a g e
WNT-11 has been shown to mediate TGF-β-induced expression of α-sm-actin in renal
epithelial cells [16]. We investigated whether WNT-5A and WNT-11 are involved in α-sm-
actin expression in ASM cells. Indeed, siRNA-mediated knock-down of WNT-5A or WNT-11
significantly attenuated TGF-β-induced expression of α-sm-actin in hTERT-ASM cells
(Figure 3A).
Having confirmed the requirement for WNT-5A and WNT-11 in TGF-β-induced α-sm-actin
expression, we wondered whether WNT-5A and WNT-11 can induce α-sm-actin in ASM cells.
We observed that recombinant WNT-5A and WNT-11 induce α-sm-actin in ASM cells (Figure
3B).
We have previously shown that TGF-β activated kinase 1 (TAK1) is required for the induction
of WNT-5A in hTERT-ASM cells (Chapter 5). Accordingly, TAK1 inhibition by LL-Z1640-2
attenuated TGF-β-induced expression of α-sm-actin mRNA and protein (Figure 3C, D).
Altogether, our data shows that both WNT-5A and WNT-11 are required for and mediate
TGF-β-induced α-sm-actin expression in ASM cells.
TGF-β-induced actin cytoskeleton remodeling is required for α-sm-actin
expression. As both TGF-β and noncanonical WNT signaling can induce cytoskeleton
reorganization, we hypothesized that actin remodeling is required for α-sm-actin induction
in response to TGF-β in ASM cells. To test this hypothesis, we pretreated hTERT-ASM cells
with an inhibitor of actin polymerization- latrunculin A which binds to and stabilizes the G-
actin fraction of actin pool. The stabilized G-actin fails to incorporate into the polymerizing
F-actin, preventing actin polymerization and thus inhibiting actin cytoskeletal remodeling.
We performed immunofluoroscence microscopy to visualize actin polymerization and
stained F-actin using fluorescently-labelled phalloidin and G-actin using fluorescently-
labelled DNAse I. The microscopy analysis revealed that TGF-β induces increase in actin
polymerization as reflected by an increased staining of phalloidin and appearance of more
filamentous structures in the hTERT-ASM cells (Figure 4A). In addition, a decrease in the
G-actin pool can be observed (Figure 4A). In line with its role in actin polymerization,
latrunculin A pretreatment abrogated TGF-β induction of phalloidin-stained F-actin
filaments and increased DNAse I-stained G-actin (Figure 4A).
We next addressed the requirement of actin polymerization in α-sm-actin expression in
hTERT-ASM cells. Interestingly, the presence of latrunculin A completely abrogated TGF-β-
induced α-sm-actin expression in hTERT-ASM cells as demonstrated by western blotting
(Figure 4B) and microcopy analysis (Figure 4C). The inhibition of actin polymerization,
however, had no effect on the expression levels of the β-actin pool of cytoskeleton (data not
shown). Collectively, our data suggest that TGF-β-induced actin cytoskeleton remodeling is
essential for α-sm-actin expression in ASM cells.
WNT-5A and WNT-11 mediate TGF-β-induced actin cytoskeleton remodeling
via Rho kinase signaling. Next, we investigated the role of WNT-5A and WNT-11 in the
regulation of TGF-β-induced cytoskeletal remodeling in ASM cells using various strategies.
TAK1 inhibition attenuates WNT-5A induction (Chapter 5) and accordingly, α-sm-actin
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
125 | P a g e
Figure 2. Expression kinetics of α-sm-actin and WNT-11 in ASM cells. (A, E) hTERT-ASM
cells were either left unstimulated or stimulated with TGF-β (2 ng/ml) for the indicated duration. α-
sm-actin mRNA (A) and WNT-11 mRNA (E) expression was determined by qRT-PCR, corrected for
18S rRNA and expressed relative to untreated cultures. Data represent mean ± SEM of 4 independent
experiments. *p<0.05, **p<0.01 compared to basal; 2-tailed Student’s t test for unpaired
observations. (B) hTERT-ASM cells were treated as mentioned above. Whole cell extracts (WCE) were
α-sm-actin
GAPDH
TGF-β concentration (ng/ml)
0 0.1 0.2 1.0 2.0 10.0
24h 48h
- + - +TGF-β
α-sm-actin
GAPDH
A B
C D
F
Duration of TGF-β stimulation (in hours)
0 4 8 12 16 20 24
α-s
m-a
ctin
mR
NA
exp
ress
ion
(fo
ld o
f co
ntr
ol)
0
1
2
3
4
5
**
****
Duration of TGF-β stimulation (in hours)
0 4 8 12 16 20 24
WN
T-1
1 m
RN
A e
xp
ressio
n(f
old
of
co
ntr
ol)
0
20
40
60
80
100
120
140
**
**
*
*
*
**
Basal 0.1 0.2 1.0 2.0 10.0
α-s
m-a
ctin
mR
NA
exp
ressio
n(f
old
of
ba
sa
l)
0
5
10
15
20
25
**
***
**
TGF-β (ng/ml)
**
***
E
Basal 0.1 0.2 1.0 2.0 10.0
WN
T-1
1 m
RN
A e
xpre
ssi
on
(fold
of
ba
sal)
0
1
2
3
4
5
**
TGF-β (ng/ml)
** ***
*
Chapter 4
126 | P a g e
analysed by western anaylsis to determine α-sm-actin abundance. Expression of GAPDH was used to
verify equal loading. (C, F) hTERT-ASM cells were either left unstimulated or stimulated with TGF-β
at the indicated concentrations for 24 hours. α-sm-actin mRNA (C) and WNT-11 mRNA (F) expression
was determined by qRT-PCR, corrected for 18S rRNA and expressed relative to untreated cultures.
Data represent mean ± SEM of 4 independent experiments. *p<0.05, **p<0.01, ***p<0.001 compared
to basal; 2-tailed Student’s t test for unpaired observations. (D) hTERT-ASM cells were either left
unstimulated or stimulated with TGF-β at indicated concentrations for 48 hours. WCE were analysed
by western anaylsis to determine α-sm-actin abundance. Expression of GAPDH was used to verify
equal loading.
induction by TGF-β (Figure 3B, C). In line with these observations, TAK1 inhibition also
attenuated TGF-β-induced augmentation in F-actin appearance indicating a requirement of
WNT-5A in this process (Figure 5A).
We next performed knock down of WNT-5A and WNT-11 and analyzed F-actin and G-actin
abundance in response to TGF-β. Interestingly, the presence of either WNT-5A- or WNT-11-
specific siRNA attenuated TGF-β-induced F-actin abundance confirming an upstream role
for WNT-5A and WNT-11 in TGF-β-induced actin remodeling in hTERT-ASM cells (Figure
5B).
Rho kinase signaling has been intrinsically linked to both cytoskeletal remodeling and α-sm-
actin expression. We confirmed the essential role of the Rho kinase cascade in TGF-β-
induced actin remodeling. Microscopy analysis of F- and G-actin further confirmed this
observation as the presence of Y27632 attenuated the TGF-β-induced increase in appearance
of F-actin filaments (Figure 6A). Also, pharmacological inhibition of Rho kinase by Y27632
completely reversed the TGF-β-induced increase in F-actin/G-actin ratio (data not shown).
Accordingly, Rho kinase inhibition also attenuated TGF-β-induced α-sm-actin expression
(Figure 6B).
Noncanonical WNT signaling also activates RhoA as part of the planar cell polarity pathway.
We next investigated whether WNT-5A and WNT-11 utilize the Rho signaling arm to mediate
actin remodeling. Interestingly, the presence of exogenous WNT-5A or WNT-11 induced
actin cytoskeletal remodeling as revealed by increase in the F-actin staining (Figure 6C). Of
note, pharmacological inhibition of Rho kinase attenuated WNT-5A- and WNT-11-induced
actin remodeling (Figure 6C). Our data thus shows that WNT-5A and WNT-11 mediate TGF-
β-induced actin remodeling in ASM cells by activation of Rho kinase signaling.
WNT-5A- and WNT-11-mediated MRTF-A nuclear translocation is required for
TGF-β-induced α-sm-actin expression. Our observations coupling actin remodeling to
α-sm-actin expression intrigued us to investigate the underlying mechanistic link. MRTF-A
is a transcription factor which is released from G-actin following actin polymerization and
translocates to the nucleus. Earlier reports have also shown its role in smooth muscle-
specific gene expression including α-sm-actin [20]. We found that TGF-β induced
upregulation of MRTF-A at both the mRNA and protein levels in hTERT-ASM cells (Figure
7A, B). Interestingly, TGF-β also induced nuclear translocation of MRTF-A as demonstrated
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
127 | P a g e
Figure 3. WNT-5A and WNT-11 are required for TGF-β-induced α-sm-actin expression.
(A) hTERT-ASM cells were transfected with a negative control siRNA or WNT-5A-specific or WNT-
11-specific siRNA. Subsequently, cells were stimulated with TGF-β (2 ng/ml) for 48 hours and WCE
were analyzed for α-sm-actin protein abundance by western blotting. Equal loading was verified by
analysis of GAPDH. Graph represents quantification of band intensities of α-sm-actin corrected for
GAPDH as percentage of TGF-β-induced expression in control siRNA-transfected cells. Data
represent mean ± SEM of 4-5 independent experiments. *p<0.05 compared to control siRNA-
transfected, untreated cells, #p<0.05 compared to negative control siRNA-transfected, TGF-β-
stimulated cells; 1-way ANOVA followed by Newman-Keuls multiple comparisons test. (B) hTERT-
ASM cells were either left untreated or stimulated with recombinant WNT-5A (100 ng/ml) or WNT-
11 (100 ng/ml) for 24 hours. WCE were analysed for α-sm-actin protein abundance. GAPDH
expression was used to verify equal loading. (C) hTERT-ASM cells were either left unstimulated or
stimulated with TGF-β (2 ng/ml) in the presence or absence of LL-Z1640-2 at the indicated
concentrations for 24 hours. α-sm-actin mRNA expression was determined by qRT-PCR, corrected
for 18S rRNA and expressed relative to vehicle treated cultures. Data represent mean ± SEM of 4
independent experiments. ***p<0.001 compared to vehicle basal, ###p<0.001 compared to TGF-β-
stimulated cells; 1-way ANOVA followed by Newman-Keuls multiple comparisons test. (D) WCE from
cells stimulated with TGF-β (2 ng/ml) in the presence or absence of LL-Z1640-2 (0.5 µM) were
analyzed for α-sm-actin protein abundance. GAPDH expression was verified for equal loading.
C
Basal TGF-β
α-s
m-a
ctin
mR
NA
expre
ssio
n
( fo
ld o
f b
asal ve
hic
le)
0
5
10
15
20
25Vehicle
LL-Z1640-2 (0.5 µM)
LL-Z1640-2 (1.0 µM)
***
# # #
# # #
Chapter 4
128 | P a g e
by its increasing abundance in the nuclear lysate (Figure 7C) confirming a functional effect
of TGF-β on MRTF-A.
To elucidate the requirement of MRTF-A in TGF-β-induced α-sm-actin expression, we
performed knock down of MRTF-A using specific siRNA. While TGF-β induced MRTF-A
expression in the presence of non-specific negative siRNA, its expression was reduced in the
presence of MRTF-A-specific siRNA (Figure 7D) confirming an efficient knock down.
Interestingly, MRTF-A knock down also abrogated TGF-β-induced α-sm-actin expression in
hTERT-ASM cells (Figure 7D) confirming the requirement of MRTF-A in α-sm-actin
induction.
We next sought to identify the upstream mediators and mechanisms of MRTF-A nuclear
translocation. As WNT-5A and WNT-11 activate Rho-kinase signaling and mediated TGF-β-
induced actin remodeling, the presence of Rho kinase inhibitor Y27632 attenuated TGF-β-
induced MRTF-A nuclear translocation (Figure 7E). More importantly, knock down of WNT-
11 completely abrogated TGF-β-induced nuclear translocation of MRTF-A confirming a role
for noncanonical WNT ligands in this phenomenon (Figure 7F).
Altogether, our data suggest that WNT-5A and WNT-11 mediate TGF-β-induced nuclear
translocation of MRTF-A via activation of a Rho kinase-actin polymerization pathway which
is required for α-sm-actin induction in ASM cells.
Discussion
In the present study, we demonstrate a novel role for the noncanonical WNT ligands WNT-
5A and WNT-11 in the regulation of TGF-β-induced α-sm-actin expression in ASM cells. We
show that WNT-5A and WNT-11 induce Rho kinase-dependent actin remodeling in ASM
cells which is required for TGF-β induction of α-sm-actin. Furthermore, TGF-β induces an
increase in the abundance and nuclear translocation of MRTF-A which is regulated by
noncanonical WNTs and is required for α-sm-actin expression in ASM cells.
TGF-β is a potent inducer of contractile proteins such as α-sm-actin, sm-MHC, calponin and
SM22 in ASM cells [13]. Moreover, WNT/β-catenin signaling is involved in differentiation
and the expression of contractile proteins. For example, WNT-7B-activated β-catenin
signaling is required for proper development and differentiation of bronchial SMCs [21].
Similarly, TGF-β-activated β-catenin regulates pulmonary fibroblast differentiation and
expression of α-sm-actin [18] whereas it partners with cAMP response element-binding
protein (CREB)-binding protein (CREBBP or CBP) and regulates TGF-β-induced α-sm-actin
expression in pulmonary alveolar epithelial cells [22]. Interestingly, WNT-3A augments
TGF-β-SMAD2 signaling via β-catenin leading to the expression of α-sm-actin in mouse
fibroblasts [23] further suggesting a crosstalk between these two pathways in the expression
of contractile proteins. We found that knock-down of either WNT-5A or WNT-11 attenuates
TGF-β-induced α-sm-actin expression and polymerization in ASM cells whereas stimulation
with recombinant WNT-5A or WNT-11 is able to increase α-sm-actin expression
demonstrating that WNT-5A and WNT-11 mediate TGF-β-induced α-sm-actin expression in
ASM cells. Our data add to these previous observations as we demonstrate that noncanonical
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
129 | P a g e
Figure 4. Actin remodeling is required for TGF-β-induced α-sm-actin expression. (A) hTERT-ASM cells were stimulated with TGF-β (2 ng/ml) in the presence or absence of latrunculin A (0.1 µM) for 48 hours. F-actin, G-actin and nuclear stainings were done as described in materials and methods section. Green=F-actin, Red=G-actin and Blue=Nucleus. Magnification 20X. (B) hTERT-ASM cells were stimulated with TGF-β (2 ng/ml) in the presence or absence of latrunculin A (0.1 µM). WCE were analysed for α-sm-actin protein abundance. GAPDH expression was used to verify equal loading. (C) hTERT-ASM cells were stimulated as described above. α–sm-actin (red) and nuclear (blue) staining were done as described in the materials and methods section and analysed by immunofluorescence microscopy. Magnification 20X.
Chapter 4
130 | P a g e
Figure 5. WNT-5A and WNT-11 mediate TGF-β-induced actin remodeling. (A) hTERT-
ASM cells were stimulated with TGF-β (2 ng/ml) in the presence or absence of LL-Z1640-2 (0.5
µM) for 48 hours. F-actin, G-actin and nuclear staining were done as described in the materials
and methods section. Green=F-actin, Red=G-actin and Blue=Nucleus. Magnification 20X. (B)
hTERT-ASM cells were transfected with a negative control siRNA or WNT-5A-specific or WNT-11-
specific siRNA. Subsequently, cells were stimulated with TGF-β (2 ng/ml) for 48 hours and stained
for F-actin, G-actin and nucleus and analyzed by immunofluorescence microscopy. Green=F-actin,
Red=G-actin and Blue=Nucleus. Magnification 20X.
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
131 | P a g e
WNT signaling plays a key role in the regulation of TGF-β induced α-sm-actin expression in
smooth muscle cells.
Noncanonical WNT/Ca2+ and WNT/planar cell polarity signaling are involved in cytoskeletal
reorganization and cell movements along with the transcriptional regulation of various
genes. While there is no direct evidence published implicating noncanonical WNT signaling
in the regulation of contractile proteins; NFAT and JNK, two of the mediators of
noncanonical WNT signaling are known to regulate α-sm-actin expression. NFAT activation
induces α-sm-actin expression in SMCs and inhibition of the calcineurin-NFAT pathway
attenuates it [24]. Similarly, JNK induces expression of α-sm-actin in response to
mechanical strain [25] and arginine vasopressin [26] in vascular SMCs. Most importantly,
the small GTPase RhoA, which mediates noncanonical WNT signaling and is also activated
downstream of TGF-β signaling, is an integral part of SMC differentiation and expression of
α-sm-actin [20]. Here, we show that WNT-5A and WNT-11 activate Rho kinase-dependent
noncanonical WNT signaling in ASM cells. Recombinant WNT-5A and WNT-11 increased
the phosphorylation of MYPT1 (data not shown) confirming Rho kinase cascade activation
in ASM cells. Rho kinase signaling is known to regulate the expression of contractile proteins
including α-sm-actin in SMCs [27,28]. In line with that, pharmacological inhibition of Rho
kinase signaling attenuated TGF-β-induced α-sm-actin expression in ASM cells.
Chapter 4
132 | P a g e
Figure 6. Rho kinase regulates TGF-β and WNT-5A/WNT-11-induced actin remodeling.
(A-B) Rho kinase regulates actin cytoskeletal remodeling. (A) hTERT-ASM cells were stimulated
with TGF-β (2 ng/ml) in the presence or absence of Y27632 (1.0 µM) for 48 hours. F-actin, G-actin
and nucleus were stained and analyzed by immunofluorescence microscopy. Green=F-actin,
Red=G-actin and Blue=Nucleus. Magnification 20X. (B) hTERT-ASM cells were treated as
described in (A) and western analysis was performed to detect the abundance of α–sm-actin in
WCE. Equal loading was verified by analyzing GAPDH expression. (C) hTERT-ASM cells were
stimulated with recombinant WNT-5A (100 ng/ml) or WNT-11 (100 ng/ml) in the presence or
absence of Y27632 (1.0 µM) for 2 hours. F-actin, G-actin and nuclear staining were done and
analyzed by immunofluorescence microscopy. Green=F-actin, Red=G-actin and Blue=Nucleus.
Magnification 20X.
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
133 | P a g e
Figure 7. Role for MRTF-A in TGF-β and WNT-5A/WNT-11-induced α-sm-actin
expression. (A) hTERT-ASM cells were stimulated with TGF-β (2 ng/ml) for 24 hours and MRTF-
A mRNA expression was determined by qRT-PCR, corrected for 18S rRNA and expressed relative
to the basal. Data represent mean ± SEM of 4 independent experiments. **p<0.01 compared to
vehicle basal; 2-tailed Student’s t test for unpaired observations. (B) MRTF-A protein expression
was determined by western blotting. Equal loading was verified by GAPDH analysis. (C) Nuclear
translocation of MRTF-A. hTERT-ASM cells were stimulated with TGF-β (2 ng/ml) for 16 and 24
hours. Nuclear extracts were prepared and analyzed for the presence of MRTF-A by western
blotting. Lamin A/C abundance was analysed to determine equal loading. (D) hTERT-ASM cells
were transfected with MRTF-A-specific or negative control siRNA. Subsequently, cells were
stimulated with TGF-β (2 ng/ml) for 48 hours, WCEs were prepared and western analysis was
performed to determine the expression of MRTF-A and α–sm-actin. Equal loading was verified by
GAPDH expression. (E) Nuclear extracts, prepared from the hTERT-ASM cells stimulated with
TGF-β (2 ng/ml) in the presence or absence of Y27632 (1.0 µM) for 24 hours, were analysed for
MRTF-A abundance by western blotting. Equal loading was verified by Lamin A/C expression. (F)
hTERT-ASM cells were transfected with WNT-11-specific or negative control siRNA. Subsequently,
Chapter 4
134 | P a g e
Noncanonical WNT signaling via small GTPases and the Ca2+ pathway regulates cytoskeletal
remodeling and stress fiber formation to promote cell migration. Studies including those
from our group have showed that inhibition of actin remodeling by latrunculin A or B
inhibits contractile protein expression [27,29]. We demonstrate that WNT-5A and WNT-11
promote actin remodeling by augmenting polymerized filamentous actin (F-actin)
abundance with a concomitant decrease in monomeric globular actin (G-actin) in a Rho
kinase-dependent manner. Moreover, inhibition of TGF-β-induced actin stress fiber
formation by latrunculin A attenuates α-sm-actin expression suggesting that TGF-induced
and noncanonical WNT-mediated actin dynamics are linked to the transcriptional control of
α-sm-actin.
The SMC-specific genes essentially contain CArG box DNA elements [CC(A/T)6GG] in their
promoters which are regulated by serum response factor (SRF) in association with
proliferative ternary complex factors or with myocardin family of transcription factors
(myocardin and myocardin-related transcription factors) driving contractile gene expression
programs [30]. While myocardin is constitutively nuclear, myocardin-related transcription
factors (MRTFs) remain associated with G-actin and stay primarily cytosolic. Actin
remodeling depletes the G-actin pool leading to the release of MRTFs and their nuclear
translocation where they associate with SRF and other transcriptional co-regulators to
activate target gene transcription [31,32]. TGF-β has been shown to regulate the Rho-actin-
MRTF axis [31,33-35], however, a direct link between noncanonical WNTs and MRTF
signaling is undocumented. We show that TGF-β induces expression and nuclear
translocation of MRTF-A in ASM cells where it drives TGF-β-induced α-sm-actin expression.
Of note, inhibition of Rho kinase or knock-down of WNT-11 attenuates TGF-β-induced
nuclear localization of MRTF-A validating a Rho kinase-dependent and WNT ligand-
mediated axis in MRTF-A nuclear shuttling. We provide the first evidence for the regulation
of a Rho kinase-actin-MRTF axis by noncanonical WNT ligands.
The TGF-β-induced and noncanonical WNT-mediated regulation of a Rho kinase-actin-
MRTF-A axis may have important implications in various processes in airway remodeling.
Clearly, noncanonical WNT signaling could contribute to contractile protein expression by
ASM. Further, as EMT is considered a contributing factor to the increased mesenchymal cell
population in asthmatic airways, the TGF-β and WNT-5A or WNT-11 crosstalk might also
contribute to this process. Indeed, MRTF-A is a critical mediator of TGF-β-induced EMT
[34,36] and epithelial-to-myofibroblast transition (EMyoT) [35]. Myofibroblasts are a rich
source of ECM proteins and MRTF-A is a key mediator of myofibroblast activation and can
regulate ECM expression. As demonstrated, MRTF-A induces collagen expression in lung
fibroblasts [37]. Thus, the TGF-β-noncanonical WNTs axis could also regulate ECM
expression in the airways. In support, we have demonstrated earlier that WNT-5A mediates
cells were stimulated with TGF-β (2 ng/ml) for 24 hours and immunostained using MRTF-A-
specific antibody (green) and a nuclear stain (blue). Immunofluroscence was performed to analyze
the abundance of MRTF-A. Magnification 20X.
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
135 | P a g e
TGF-β-induced ECM expression via noncanonical Ca2+-NFAT and JNK signaling further
suggesting a role for noncanonical WNT signaling in airway remodeling.
In conclusion, we demonstrate that noncanonical WNT signaling via WNT-5A and WNT-11
plays an important role in contractile protein expression in smooth muscle. WNT-5A and
WNT-11 are preferentially expressed in contractile myocytes and regulate TGF-β induced
expression of sm-α-actin via Rho kinase mediated actin polymerization and MRTF-A nuclear
translocation. These findings further support a role for noncanonical WNT signaling in
airway smooth muscle remodeling, implying that targeting this pathway may be a
therapeutic strategy worth pursuing.
Acknowledgements
This work was supported by a Vidi grant (016.126.307) from the Dutch Organization for
Scientific Research (NWO).
Chapter 4
136 | P a g e
References
1. Bumbacea D, Campbell D, Nguyen L, Carr D, Barnes PJ, et al. (2004) Parameters associated
with persistent airflow obstruction in chronic severe asthma. Eur Respir J 24: 122-128.
2. Kariyawasam HH, Aizen M, Barkans J, Robinson DS, Kay AB. (2007) Remodeling and airway
hyperresponsiveness but not cellular inflammation persist after allergen challenge in
asthma. Am J Respir Crit Care Med 175: 896-904.
3. Lazaar AL, Panettieri RA,Jr. (2003) Is airway remodeling clinically relevant in asthma? Am J
Med 115: 652-659.
4. Homer RJ, Elias JA. (2005) Airway remodeling in asthma: Therapeutic implications of
mechanisms. Physiology (Bethesda) 20: 28-35.
5. James AL, Elliot JG, Jones RL, Carroll ML, Mauad T, et al. (2012) Airway smooth muscle
hypertrophy and hyperplasia in asthma. Am J Respir Crit Care Med 185: 1058-1064.
6. Woodruff PG, Dolganov GM, Ferrando RE, Donnelly S, Hays SR, et al. (2004) Hyperplasia of
smooth muscle in mild to moderate asthma without changes in cell size or gene expression.
Am J Respir Crit Care Med 169: 1001-1006.
7. Benayoun L, Druilhe A, Dombret MC, Aubier M, Pretolani M. (2003) Airway structural
alterations selectively associated with severe asthma. Am J Respir Crit Care Med 167: 1360-
1368.
8. Halayko AJ, Salari H, MA X, Stephens NL. (1996) Markers of airway smooth muscle cell
phenotype. Am J Physiol 270: L1040-51.
9. Wright DB, Trian T, Siddiqui S, Pascoe CD, Johnson JR, et al. (2013) Phenotype modulation of
airway smooth muscle in asthma. Pulm Pharmacol Ther 26: 42-49.
10. Wright DB, Trian T, Siddiqui S, Pascoe CD, Ojo OO, et al. (2013) Functional phenotype of
airway myocytes from asthmatic airways. Pulm Pharmacol Ther 26: 95-104.
11. Leguillette R, Laviolette M, Bergeron C, Zitouni N, Kogut P, et al. (2009) Myosin, transgelin,
and myosin light chain kinase: Expression and function in asthma. Am J Respir Crit Care
Med 179: 194-204.
12. Baarsma HA, Konigshoff M, Gosens R. (2013) The WNT signaling pathway from ligand
secretion to gene transcription: Molecular mechanisms and pharmacological targets.
Pharmacol Ther 138: 66-83.
13. Oenema TA, Smit M, Smedinga L, Racke K, Halayko AJ, et al. (2012) Muscarinic receptor
stimulation augments TGF-beta1-induced contractile protein expression by airway smooth
muscle cells. Am J Physiol Lung Cell Mol Physiol 303: L589-97.
14. Kikuchi A, Yamamoto H, Sato A, Matsumoto S. (2012) Wnt5a: Its signalling, functions and
implication in diseases. Acta Physiol (Oxf) 204: 17-33.
15. Angers S, Moon RT. (2009) Proximal events in wnt signal transduction. Nat Rev Mol Cell Biol
10: 468-477.
16. Zhang P, Cai Y, Soofi A, Dressler GR. (2012) Activation of Wnt11 by transforming growth
factor-beta drives mesenchymal gene expression through non-canonical wnt protein
signaling in renal epithelial cells. J Biol Chem 287: 21290-21302.
17. Gosens R, Stelmack GL, Dueck G, McNeill KD, Yamasaki A, et al. (2006) Role of caveolin-1 in
p42/p44 MAP kinase activation and proliferation of human airway smooth muscle. Am J
Physiol Lung Cell Mol Physiol 291: L523-34.
WNT-5A and WNT-11 drive α-sm-actin expression via Rho kinsae-actin-MRTF-A signaling
137 | P a g e
18. Baarsma HA, Spanjer AI, Haitsma G, Engelbertink LH, Meurs H, et al. (2011) Activation of
WNT/beta-catenin signaling in pulmonary fibroblasts by TGF-beta is increased in chronic
obstructive pulmonary disease. PLoS One 6: e25450.
19. Gosens R, Stelmack GL, Bos ST, Dueck G, Mutawe MM, et al. (2011) Caveolin-1 is required for
contractile phenotype expression by airway smooth muscle cells. J Cell Mol Med 15: 2430-
2442.
20. Mack CP. (2011) Signaling mechanisms that regulate smooth muscle cell differentiation.
Arterioscler Thromb Vasc Biol 31: 1495-1505.
21. Cohen ED, Ihida-Stansbury K, Lu MM, Panettieri RA, Jones PL, et al. (2009) Wnt signaling
regulates smooth muscle precursor development in the mouse lung via a tenascin C/PDGFR
pathway. J Clin Invest 119: 2538-2549.
22. Zhou B, Liu Y, Kahn M, Ann DK, Han A, et al. (2012) Interactions between beta-catenin and
transforming growth factor-beta signaling pathways mediate epithelial-mesenchymal
transition and are dependent on the transcriptional co-activator cAMP-response element-
binding protein (CREB)-binding protein (CBP). J Biol Chem 287: 7026-7038.
23. Carthy JM, Garmaroudi FS, Luo Z, McManus BM. (2011) Wnt3a induces myofibroblast
differentiation by upregulating TGF-beta signaling through SMAD2 in a beta-catenin-
dependent manner. PLoS One 6: e19809.
24. Gonzalez Bosc LV, Layne JJ, Nelson MT, Hill-Eubanks DC. (2005) Nuclear factor of activated
T cells and serum response factor cooperatively regulate the activity of an alpha-actin
intronic enhancer. J Biol Chem 280: 26113-26120.
25. Tock J, Van Putten V, Stenmark KR, Nemenoff RA. (2003) Induction of SM-alpha-actin
expression by mechanical strain in adult vascular smooth muscle cells is mediated through
activation of JNK and p38 MAP kinase. Biochem Biophys Res Commun 301: 1116-1121.
26. Garat C, Van Putten V, Refaat ZA, Dessev C, Han SY, et al. (2000) Induction of smooth muscle
alpha-actin in vascular smooth muscle cells by arginine vasopressin is mediated by c-jun
amino-terminal kinases and p38 mitogen-activated protein kinase. J Biol Chem 275: 22537-
22543.
27. Mack CP, Somlyo AV, Hautmann M, Somlyo AP, Owens GK. (2001) Smooth muscle
differentiation marker gene expression is regulated by RhoA-mediated actin
polymerization. J Biol Chem 276: 341-347.
28. Schaafsma D, McNeill KD, Stelmack GL, Gosens R, Baarsma HA, et al. (2007) Insulin
increases the expression of contractile phenotypic markers in airway smooth muscle. Am J
Physiol Cell Physiol 293: C429-39.
29. Oenema TA, Maarsingh H, Smit M, Groothuis GM, Meurs H, et al. (2013) Bronchoconstriction
induces TGF-beta release and airway remodelling in guinea pig lung slices. PLoS One 8:
e65580.
30. Miano JM. (2003) Serum response factor: Toggling between disparate programs of gene
expression. J Mol Cell Cardiol 35: 577-593.
31. Olson EN, Nordheim A. (2010) Linking actin dynamics and gene transcription to drive cellular
motile functions. Nat Rev Mol Cell Biol 11: 353-365.
32. Parmacek MS. (2007) Myocardin-related transcription factors: Critical coactivators
regulating cardiovascular development and adaptation. Circ Res 100: 633-644.
33. Small EM. (2012) The actin-MRTF-SRF gene regulatory axis and myofibroblast
differentiation. J Cardiovasc Transl Res 5: 794-804.
Chapter 4
138 | P a g e
34. Morita T, Mayanagi T, Sobue K. (2007) Dual roles of myocardin-related transcription factors
in epithelial mesenchymal transition via slug induction and actin remodeling. J Cell Biol
179: 1027-1042.
35. O'Connor JW, Gomez EW. (2013) Cell adhesion and shape regulate TGF-beta1-induced
epithelial-myofibroblast transition via MRTF-A signaling. PLoS One 8: e83188.
36. Mihira H, Suzuki HI, Akatsu Y, Yoshimatsu Y, Igarashi T, et al. (2012) TGF-beta-induced
mesenchymal transition of MS-1 endothelial cells requires smad-dependent cooperative
activation of rho signals and MRTF-A. J Biochem 151: 145-156.
37. Luchsinger LL, Patenaude CA, Smith BD, Layne MD. (2011) Myocardin-related transcription
factor-A complexes activate type I collagen expression in lung fibroblasts. J Biol Chem 286:
44116-44125.
139 | P a g e
140 | P a g e
Top Related