Download - University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

Transcript
Page 1: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

University of Groningen

Non-alcoholic fatty liver diseaseSheedfar, Fareeba

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2015

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Sheedfar, F. (2015). Non-alcoholic fatty liver disease: understanding the role of aging, fatty acid transportand epigenetics. [S.l.]: [S.n.].

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 04-07-2020

Page 2: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

          

Research Paper

  www.impactaging.com AGING, April 2014, Vol. 6, No 4

Increased hepatic CD36 expression with age is associated withenhanced susceptibility to nonalcoholic fatty liver disease  Fareeba Sheedfar1, Miranda MY Sung2, Marcela Aparicio‐Vergara1, Niels J Kloosterhuis1, Maria Eugenia Miquilena‐Colina3, Javier Vargas‐Castrillón3, Maria Febbraio4, René L Jacobs5, Alain de Bruin6, Manlio Vinciguerra7,8, Carmelo García‐Monzón3, Marten H Hofker1, Jason RB Dyck2, and Debby PY Koonen1     1University of Groningen, University Medical Center Groningen, Molecular Genetics, Groningen, The Netherlands; 2Cardiovascular Research Centre, Department of Pediatrics, University of Alberta, Edmonton, AB, Canada;  3Liver Research Unit, University Hospital Santa Cristina, Instituto de Investigación Sanitaria Princesa, CIBERehd, Madrid, Spain;   4Department of Dentistry, University of Alberta, Edmonton, AB, Canada; 5Agricultural, Department of Food and Nutritional Science, University of Alberta, Edmonton, AB, Canada;  6Dutch Molecular Pathology Center, Department of Pathobiology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands;  7IRCCS Casa Sollievo della Sofferenza Hospital, San Giovanni Rotondo, Italy;  8UCL – Institute of Liver and Digestive Health, Royal Free Hospital, UK  Key words: CD36, aging, liver, steatosis, inflammation, obesity, NAFLD, NASH Abbreviations: Nonalcoholic fatty liver disease (NAFLD); nonalcoholic steatosis (NAS); nonalcoholic steatohepatitis (NASH); high‐fat diet (HFD); low‐fat diet (LFD); Quantitative real‐time polymerase chain reaction (qRT‐PCR); triglycerides (TG); oxidative phosphorylation (OXPHOS); hepatitis C virus infected with genotype 1 (HCV G1) Received: 3/4/14; Accepted: 4/04/14; Published: 4/09/14 Correspondence to: Debby P. Y. Koonen, PhD;  E‐mail:   [email protected]   Copyright: © Sheedfar et al. This is an open‐access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited  Abstract: CD36  has  been  associated with  obesity  and  diabetes  in  human  liver  diseases,  however,  its  role  in  age‐associated nonalcoholic fatty liver disease (NAFLD) is unknown. Therefore, liver biopsies were collected from individualswith histologically normal  livers (n=30), and from patients diagnosed with simple steatosis (NAS; n=26). Patients weredivided  into two groups according to age and  liver biopsy samples were  immunostained for CD36. NAFLD parameterswere examined in young (12‐week) and middle‐aged (52‐week) C57BL/6J mice, some fed with chow‐diet and some fedwith  low‐fat  (LFD;  10%  kcal  fat)  or  high‐fat  diet  (HFD;  60%  kcal  fat)  for  12‐weeks.  CD36  expression was  positivelyassociated with  age  in  individuals with  normal  livers  but  not  in  NAS  patients.  However,  CD36 was  predominantlylocated at the plasma membrane of hepatocytes in aged NAS patients as compared to young. In chow‐fed mice, aging,despite an increase in hepatic CD36 expression, was not associated with the development of NAFLD. However, middle‐aged mice did exhibit  the development of HFD‐induced NAFLD, mediated by an  increase of CD36 on  the membrane.Enhanced  CD36‐mediated  hepatic  fat  uptake may  contribute  to  an  accelerated  progression  of  NAFLD  in mice  andhumans.  Therapies  to  prevent  the  increase  in  CD36  expression  and/or  CD36  from  anchoring  at  the membrane mayprevent the development of NAFLD.  

  www.impactaging.com                     281                                          AGING, April 2014, Vol. 6 No.4

Page 3: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

INTRODUCTION The world is experiencing a dramatic increase in numbers of elderly people, rising to an estimated 22% of the world population aged 60 years and older by 2050 [1]. Although population aging is an indicator of improving global health, it has also become one of the century's main health problems. Aging is the leading risk factor for all chronic diseases, accounting for 60% of all deaths worldwide [2]. Thus, to understand how aging increases susceptibility to disease is vital in order to sustain a healthy aging society. Nonalcoholic fatty liver disease (NAFLD) is, worldwide, the most common liver disease, affecting one-third of the overall population [3]. NAFLD includes a wide spectrum of liver pathologies progressing from benign hepatic steatosis, to nonalcoholic-steatohepatitis (NASH), severe cirrhosis and fibrosis [4]. Growing evidence points towards an increased prevalence of NAFLD in older humans [5]. Indeed, aging is associated with a physiological increase in lipid accumulation in non-adipose tissues, including the liver [6]. Moreover, aging is associated with increased mortality in elderly subjects with NAFLD by significantly enhancing the progression to NASH and fibrosis [7,8]. Although fat may accumulate in the liver as a result of multiple abnormalities of hepatic lipid accumulation [9], few studies have examined the effect of aging on hepatic lipid metabolism [10–14]. As not all study outcomes share a common view on the impact of aging on NAFLD development [14], the cellular mechanisms underlying this age-related fat overload in the liver remain ill-defined. CD36 facilitates the uptake of long-chain fatty acids (LCFA) across the cell membrane and high levels of expression can contribute to lipid accumulation in heart and skeletal muscle [15]. Enhanced efficiency of LCFA uptake is directly related to increased recruitment of CD36 from intracellular storage sites into the plasma membrane. Increased CD36 expression in human and rodent models is commonly related to insulin resistance and type 2 diabetes, including high-fat (HF) feeding and obesity [16–18] and is also observed in the physiological aging process [19–21]. In the liver, CD36 was long believed to play a very minor role in LCFA uptake [15]. Diets rich in fatty acids have, however, been shown to increase protein expression of CD36 in the liver [18]. Moreover, as we have previously observed, LCFA uptake and lipid deposition in the liver are directly related to CD36 expression, suggesting a causative role for increased CD36 expression in the pathogenesis of type 2 diabetes [18]. Similar findings were observed by

several other rodent studies [22,23] and have recently been confirmed in liver biopsies of patients with NAFLD, highlighting the clinical relevance of CD36 in human liver diseases associated with obesity and type 2 diabetes [24]. Its role in age-associated NAFLD is, however, not yet known. We have, therefore, sought to investigate whether increased CD36 expression underlies the increased susceptibility to the development of NAFLD with age. Our data show that aging is associated with a dramatic increase in CD36 expression in human NAFLD as well as in aged mice on a normal diet. Our data also show that aging, in combination with HF-feeding, triggers the presence of CD36 at the cell surface of hepatocytes, which may contribute to enhanced fat uptake in NAFLD and drive the progression of simple steatosis towards NASH. Therefore, our data suggest that therapies to prevent the increase in CD36 expression and CD36 from anchoring at the membrane may prevent the development of NAFLD. RESULTS Hepatic CD36 expression profile in humans To determine whether CD36 expression in the human liver is increased by the physiological process of aging, immunohistochemical staining for CD36 was performed in liver biopsy samples from young (20-38 years) and aged individuals (50-83 years) with histologically normal livers, and liver biopsy samples from young (20-42 years) and aged individuals (52-74 years) diagnosed with non-alcoholic steatosis (NAS) (Fig. 1A). We observed a significant increase in the percentage of liver tissue expressing CD36 in aged versus young normal liver sections, suggesting an association between aging and increased CD36 expression in the healthy human liver (Fig. 1B). Furthermore, this increase in CD36 expression in the healthy human liver was directly correlated with age, as shown by linear regression analysis of all normal human liver samples (Fig. 1C; r2=0.97). Aged subjects with normal livers had significant increases in glucose levels, waist perimeters, aspartate aminotransferase and alkaline phosphatase when compared to young subjects (Table 1, p<0.05). However, no differences were observed in body mass index, hip perimeter, plasma lipids, insulin, alanine aminotransferase and gamma-glutamyltransferase between young and aged subjects with normal livers (Table 1). When comparing subjects having normal livers with NAS patients, we also observed in the latter a significant increase in the hepatic CD36 expression index in both young and old (Fig. 1B). However, there was in NAS patients no age-based difference in the

  www.impactaging.com                    282                                          AGING,  April 2014, Vol. 6 No.4

Page 4: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

CD36 expression (Fig. 1B), suggesting that absolute CD36 protein expression levels in steatotic livers do not correlate with age. Indeed, linear regression analysis confirmed the absence of an age effect on CD36 expression in NAS livers (Fig. 1C; r2=0.12). Further-more, CD36 was largely confined to the cytoplasm of most hepatocytes in both young and aged healthy human liver biopsies (Fig. 1A, upper panels, inserts). Consistent with this, CD36 was also found mainly in the

cytoplasm of hepatocytes of young NAS patients (Fig. 1A, left lower panel, insert). This in contrast to aged steatotic livers, where CD36 was located predominantly at the plasma membrane of hepatocytes (Fig. 1A, right lower panel, insert), suggesting that aging may significantly enhance CD36 translocation in steatotic livers. From a clinical point of view, characteristics of young and aged NAS patients were not significantly different (Table 1).

Figure  1.  CD36  expression  is  positively  associated  with  age  in  liver  biopsies  frompatients with normal  livers, but not  in  liver biopsies  from patients with non‐alcoholicsteatosis (NAS). (A) CD36 immunostaining of liver biopsy tissue from: young normal liver, 29 yearsold  (Left  upper  panel),  old  normal  liver,  76  years  old  (Right  upper  panel),  young  non‐alcoholicsteatosis (NAS), 31 years old (Left  lower panel), old NAS, 75 years old (Right  lower panel). Originalmagnification for all microphotographs: 400x. Each microphotograph includes a 2x zoom detail. (B)Hepatic  CD36  expression  index  in  liver  biopsies  from  patients  with  normal  livers  and  NAS.  (C)Correlation between age and hepatic CD36 expression index in normal livers and NAS.  

  www.impactaging.com                    283                                          AGING,  April 2014, Vol. 6 No.4

Page 5: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

Table 1. Characteristics of patients with normal liver and non‐alcoholic steatosis (NAS)  

Normal liver NAS

Young (n=16) Aged (n=14) Young (n=11) Aged (n=15)

Age (years) 29 (20 – 38) 67 (50 – 83)* 33 (24 – 42) 63 (52 – 74)*

Female gender (%) 16 (100%) 8 (57%) 7 (64%) 7 (47%)

Body mass index (kg/m2) 25.1 ± 4.3 28.2 ± 5.1 28.3 ± 3.6 30.6 ± 4.1

Waist Perimeter (cm) 86.9 ± 8.3 98.2 ± 10.3* 99.0 ± 9.5** 105.3 ± 9.7

Hip Perimeter (cm) 102.3 ± 7.7 104.4 ± 12.1 106.4 ± 8.8 109.7 ± 9.2

Glucose (mg/dl) 85.8 ± 7.7 94.8 ± 10.4* 88.5 ± 7.2 94.1 ± 8.5

Insulin (mU/ml) 6.4 ± 4.1 7.1 ± 2.4 9.5 ± 4.7 9.2 ± 4.2

HOMA-IR 0.8 ± 0.5 0.9 ± 0.3 1.2 ± 0.6 1.2 ± 0.6

Triglycerides (mg/dl) 84.6 ± 32.8 109.6 ± 52.2 143.6 ± 80.9** 123.1 ± 48.0

Total Cholesterol (mg/dl) 180.9 ± 26.9 178.7 ± 41.3 207.3 ± 67 200.6 ± 21.4

HDL-cholesterol (mg/dl) 49.4 ± 8.5 48.5 ± 12.3 48.7 ± 12.3 47.0 ± 10.4

ALT (IU/L) 14.7± 5.5 19.9 ± 9.1 24.5 ± 11.3** 24.4 ± 10.4

AST (IU/L) 15.3 ± 3.4 18.8 ± 4.4* 19.7 ± 8.4 21.1 ± 4.3

-GT (IU/L) 22.7 ± 16.3 33.2 ± 24.7 61.5 ± 79.6 44.9 ± 56.9

ALP (IU/L) 59.8 ± 18.2 77.7 ± 23.9* 60.7 ± 21.8 79.7 ± 20.5*

Grade of steatosis

Grade 0 16 (100%) 14 (100%)

Grade 1 9 (82%) 10 (62%)

Grade 2 2 (18%) 5 (38%)

 

Data are shown as mean ± SD, median (range), or n (%). * p<0.05 aged vs young ** p<0.05 normal liver young vs NAS young NAS,  non‐alcoholic  steatosis;  HDL,  high‐density  lipoprotein;  HOMA‐IR,  homeostatic  model  assessment‐insulin resistance;  ALT,  alanine  aminotransferase;  AST,  aspartate  aminotransferase;  ‐GT,  gamma‐glutamyltransferase; ALP, alkaline phosphatase 

  www.impactaging.com                    284                                          AGING,  April 2014, Vol. 6 No.4

Page 6: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

Aging does not induce hepatic steatosis or inflammation in chow-fed mice To further investigate the correlation between aging and hepatic CD36 expression, we assessed CD36 expression in middle-aged mice fed a chow-diet for one year. Body

weight was significantly increased (Fig. 2A) in middle-aged mice and no difference was observed in the liver to body weight ratio (data not shown). Hepatic CD36 gene (Fig. 2B) and protein expression (Fig. 2C) were significantly increased with aging in mice similar to that found in normal liver biopsies of aging humans.

Figure 2. Aging does not trigger the development of hepatic steatosis and inflammation in mice fed a chow diet for oneyear. (A) Body weight of young and middle‐aged mice fed a chow diet. (B) qRT‐PCR measurement of CD36 transcript  levels  in  livers ofyoung and middle‐aged mice (versus young mice) fed a chow diet, expressed as fold induction. (C) Immunoblot analysis using anti‐CD36and anti‐actin (protein  loading control) antibodies was performed on  liver extracts from young and middle‐aged mice fed a chow‐diet.Immunoblots were quantified by densitometry and normalized against actin as a control for protein loading. (D) H&E staining of paraffinembedded  liver  sections obtained  from young and middle‐aged mice  fed a chow diet.  (E) Triglyceride  (TG)  levels were determined  inlivers  of  young  and middle‐aged  chow‐fed mice.  (F)  Hepatic  gene  expression  of  interleukin‐1  (Il1),  IkappaB  alpha  (Ikbα),  Cluster  ofDifferentiation 68 (Cd68), monocyte chemoattractant protein‐1 (Mcp‐1), tumor necrosis factors (Tnf) and Chemokine (C‐X‐C motif) ligand1 (Cxcl1) in livers from young and middle‐aged mice (versus livers of young chow‐fed mice) were determined by qRT‐PCR and expressedas fold induction. Values are expressed as mean ± SEM; n = 6–7 mice in each group. *p ≤ 0.05 (nonparametric Mann‐Whitney U test). 

  www.impactaging.com                     285                                          AGING, April 2014, Vol. 6 No.4

Page 7: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

Histological assessment of H&E stained liver sections of young and middle-aged mice showed a slight occurrence of macrovesicular steatosis in livers of middle-aged mice (Fig. 2D). However, hepatic triglycerides (TG) levels (Fig. 2E) between young and

middle-aged mice did not differ, confirming that lipid droplet formation in middle-aged mice was not quantitatively relevant. We observed no alterations in the expression of several pro-inflammatory cytokines and genes encoding for proteins involved in macrophage

Figure 3. Aging  increases hepatic steatosis and  inflammation  in mice  fed a HFD  for 12 weeks.  (A) Body weight ofyoung and middle‐aged mice fed a HFD. (B) H&E staining of paraffin embedded liver sections and (C) biochemically quantificationof    liver  triglycerides  (TG) of young and middle‐aged mice  fed a HFD.  (D) mRNA expression of cytokines and genes  involved  ininflammation  interleukin‐1  (Il1),  Cluster  of  Differentiation  68  (Cd68),  monocyte  chemoattractant  protein‐1  (Mcp‐1),  tumornecrosis factors (Tnf), interleukin‐10 (Il10), interleukin‐6 (Il6), Chemokine (C‐X‐C motif) ligand 1 (Cxcl1), IkappaB kinase 2 (Ikk2) inthe liver of young mice fed a HFD (versus LFD‐fed mice) for 12 weeks determined by qRT‐PCR and expressed as fold induction. (E)mRNA expression of cytokines and genes involved in inflammation Il1, Cd68, Mcp‐1, Tnf, Il10, Il6, Cxcl1, Ikk2 in the liver of middle‐aged mice fed a HFD. (F) Immunoblot analysis using anti‐Phospho‐Erk1/2 and anti‐Erk1/2 antibody was performed in liver extractsof middle‐aged mice fed a LFD or HFD for 12 weeks, tubulin antibody was performed as a control for protein loading (not shown).Values are expressed as mean±SEM; n = 6–8 mice in each group. *p ≤0.05 (nonparametric Mann‐Whitney U test). 

  www.impactaging.com                    286                                          AGING,  April 2014, Vol. 6 No.4

Page 8: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

infiltration (Il1β, Tnf, IkBα, Cd68, Mcp1, Cxcl1) in middle-aged mice as compared to young mice (Fig. 2F). In addition, no difference was observed in the inflammatory signaling often associated with NAFLD in livers of middle-aged mice, as the phosphorylation status of the extracellular signal-regulated kinase 1/2 (Erk 1/2) was not affected by aging in these mice (Sup. Fig. 1A). These data suggest that aging is not associated with overt hepatic steatosis and/or hepatic inflammation in chow-fed mice. Increased susceptibility to the development of HFD-induced NAFLD with age To investigate whether aging may increase susceptibility to the development of HFD-induced NAFLD, 3- and 8-month-old mice were fed a HFD for 12 weeks. While body weight was significantly increased in both young and middle-aged mice fed a HFD compared to mice fed a LFD (Fig. 3A), body weight was only marginally affected by aging in itself (Fig. 3A, HF young: 47.7 ± 0.7; HF aged: 54.4, p≤0.05). Moreover, liver to body weight ratio was significantly increased in middle-aged mice as compared to young mice fed a HFD (HF young: 2.1 ± 0.2; HF aged: 4.1 ± 0.2, p≤0.05). H&E staining of liver sections of mice fed a HFD showed the predominant presence of microvesicular steatosis in HF-fed young mice in contrast to both macro- and microvesicular steatosis in HF-fed middle-aged mice (Fig. 3B). Consistent with enhanced lipid droplet formation in middle-aged versus young mice fed a HFD, hepatic TG content was significantly affected by the superimposed effect of aging and HFD-feeding, as shown by a three-fold increase in hepatic TG levels in middle-aged compared to young mice fed a HFD (Fig. 3C). In addition, despite an increase in Mcp1 expression levels, HFD-feeding did not elevate inflammation in the livers of young mice (Fig. 3D and Sup. Fig.1B). However, HFD-feeding was associated with a significant increase in the mRNA expression levels of Tnf, Il10, Cxcl1 and Ikk2 (Fig. 3E) and in the phosphorylation status of Erk1/2 (Fig. 3F) in middle-aged mice. This pro-inflammatory phenotype was observed only in the livers of middle-aged mice. Aging alters the balance between lipid uptake and utilization in mice fed a HFD To identify mechanisms that may underlie this increased susceptibility to HFD-induced NAFLD, we first assessed CD36 expression levels in young and middle-aged mice fed a HFD for 12 weeks. CD36 expression was significantly increased in these mice as compared to their LFD-fed counterparts (Fig. 4A).

Moreover, CD36 gene- and protein expression levels were significantly increased by the combined effects of age and HFD feeding (Fig. 4A-C), suggesting enhanced CD36-mediated hepatic fat uptake in middle-aged mice fed a HFD. As aging has also been shown to affect mitochondrial β-oxidation through alterations in the mitochondrial electron transport chain [25–27], we next assessed the protein level of the OXPHOS complexes in

Figure 4. Increased CD36 expression in aged mice fed aHFD  for  12  weeks.  (A)  qRT‐PCR  measurement  of  Cd36transcript levels in livers of young and middle‐aged mice fed aHFD  (versus  young  mice  on  LFD)  and  expressed  as  foldinduction.  (B)  Immunoblot analysis using anti‐CD36 and anti‐tubulin antibodies was performed on liver extracts from youngand  middle‐aged  mice  fed  a  HFD.  (C)  Immunoblots  werequantified by densitometry and normalized against tubulin asa control for protein  loading. Values are expressed as mean ±SEM;  n  =  6–8 mice  in  each  group. *  p≤0.05.  (nonparametricMann‐Whitney U test) 

  www.impactaging.com                    287                                          AGING,  April 2014, Vol. 6 No.4

Page 9: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

both young- and middle-aged mice fed a HFD. Although feeding mice a HFD did not alter the expression of OXPHOS complexes in young and middle-aged mice, a reduction was observed in the complexes I-IV in middle-aged compared to young mice (Sup. Fig. 2A, B) suggesting an impaired β-oxi-

dation in these mice. This, in combination with enhanced CD36-mediated lipid uptake, is likely to cause a severe disruption in the balance between fatty acid uptake and utilization in the livers of middle-aged mice, which may contribute to increased hepatic TG deposition.

Figure 5.  Increased plasma membrane abundance of CD36  in aged mice  fed a HFD  is not  related  to Parkinexpression  levels.  (A) Representative blot and  (B)  Immunoblot analysis to  isolate plasma membrane  (M)  from cytoplasm(Cyt) using anti‐CD36 antibody was performed in liver lysates from young and middle‐aged mice fed a LFD and HFD. Anti‐pan‐Cadherin antibody was performed as a control for isolation purity and Actin antibody was performed as a control for proteinloading.  (C)  Representative  blot  and  immunoblot  analysis  using  anti‐Parkin  antibody was  performed  in  liver  lysates  frommiddle‐aged mice fed a LFD and HFD and (D) in young and middle‐aged mice fed a HFD. Tubulin antibody was performed as acontrol for protein loading. Values are expressed as mean ± SEM; * p≤0.05 (nonparametric Mann‐Whitney U test). 

  www.impactaging.com                    288                                         AGING,  April 2014, Vol. 6 No.4

Page 10: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

Aging increases CD36 translocation in livers from mice fed a HFD for 12 weeks Since enhanced efficiency of FA uptake is directly related to increased recruitment of CD36 from intracellular storage sites toward the plasma membrane [15], we next isolated membrane (M) and cytoplasmic (Cyt) fractions from livers of young- and middle-aged mice fed a LFD and HFD and measured the plasma membrane abundance of CD36 using immunoblot analysis. CD36 expression was dramatically increased in the plasma membranes of middle-aged mice fed a HFD (Fig. 5A, B) suggesting enhanced CD36 translocation in middle-aged mice on HFD. Since insulin has previously been demonstrated to induce CD36 translocation [28,29], we measured fasted insulin levels in young- and middle-aged mice fed a HFD. Plasma insulin levels were significantly increased in both young (LF: 0.077±0.19; HF: 0.66±0.09, P≤0.05) and middle-aged mice (LF: 0.18±0.02; HF: 1.34±0.15, P≤0.05) fed a HFD compared to mice fed a LFD. However, insulin levels were significantly increased in middle-aged mice compared to young mice fed a HFD. Parkin expression was assessed in both young and middle-aged mice fed a HFD as it has been reported to stabilize CD36 at the plasma membrane [30]. Parkin expression, however, was not altered in middle-aged mice fed a HFD compared to both groups: middle-aged mice fed a LFD (Fig. 5C) and young mice fed a HFD (Fig. 5D). DISCUSSION In this study, we explored the role of CD36 in the development of age-associated NAFLD. Consistent with pre-clinical data [18,20,21], we report for the first time that CD36 expression is positively associated with age in biopsies from patients with normal livers. In addition, CD36 expression was elevated in biopsies from patients with non-alcoholic steatosis (NAS). However, this increase in CD36 protein expression was not further elevated in aged NAS patients. Instead, aged NAS patients displayed enhanced plasma membrane expression of CD36 as compared to young NAS patients. This is suggesting that in elderly individuals with NAS, enhanced CD36 translocation may contribute to hepatic steatosis and NAFLD as opposed to absolute CD36 protein levels. In agreement with this, middle-aged mice exhibit an increased susceptibility to the development of HFD-induced NAFLD, which is mediated by an increased abundance of CD36 on the plasma membrane. Thus, our data indicate that enhanced CD36-mediated hepatic fat uptake may contribute to an accelerated progression of age-related NAFLD in both mice and humans.

Our data are in line with previous findings confirming a role for CD36 in hepatic fatty acid uptake and hepatic steatosis in both rodents [18,31,32] and NAFLD patients [24]. Our data also extend previous findings on the pathogenic role of CD36 in the metabolic syndrome and age-related cardiomyopathy and lipotoxicity in heart and skeletal muscle [19–21] and suggest that CD36 is also one of the key candidate proteins playing a role in the development of age-related NAFLD. However, the mechanism(s) behind increased expression of CD36 in human and rodent livers is not known. Aging is associated with an increase in body weight and a physiological increase in lipid accumulation in non-adipose tissues [6]. In addition, aging increases the circulating levels of insulin, glucose and fatty acids in the human population and in mice [33], factors previously reported to either increase cellular CD36 expression or induce CD36 translocation to the plasma membrane [34–36]. As the patients in each age subgroup were matched in terms of sex distribution, body mass index, insulin resistance score (HOMA) and histological grade of steatosis (in the case of the NAS group), these parameters do not explain the differences seen in CD36 expression in our human study. Furthermore, not one single factor is likely to explain the age-related increase in hepatic CD36 levels in the normal liver group as we observed a significant increase in waist perimeter, glucose, AST and ALP levels between young and aged normal liver individuals (Table 1). In addition, we did not observe an age-effect on the hepatic CD36 expression level in NAS liver biopsy samples (Fig. 1). This is most likely due to the fact that CD36 expression levels were already significantly increased in biopsies from young NAS livers as compared with those from young normal livers. However, in young NAS patients, CD36 immunoreactivity was restricted mainly to the cytoplasm of hepatocytes, whereas in aged NAS patients, CD36 staining was largely detected at the plasma membrane of liver cells (Fig. 1, lower panels, inserts). Nevertheless, we cannot exclude the possibility that this membraneous staining pattern of CD36 might be related to accumulation of fat in the cytoplasm that may have pushed CD36 to the side; the factors responsible for the increased membrane abundance of CD36 in aged NAS patients remain elusive and further studies are required. Of all parameters tested only ALP was significantly increased in aged versus young NAS livers, but its level was within the normal clinical range. Further studies are clearly needed to explain the increased translocation of CD36 in aged NAS patients. Increased hepatic CD36 membrane expression was predominantly observed in middle-aged mice fed a HFD. The mechanism by which CD36 is translocated to the plasma membrane has not yet been elucidated.

  www.impactaging.com                    289                                           AGING, April 2014, Vol. 6 No.4

Page 11: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

However, it has been demonstrated that CD36 can be translocated rapidly from intracellular sites to the plasma membrane in response to insulin and thereby enhance FA uptake [28]. Therefore, the enhanced CD36 membrane expression in HF-fed middle-aged mice may be related to significantly enhanced plasma insulin levels in middle-aged compared to young mice fed a HFD. Indeed, insulin levels were elevated 7.5-fold in middle-aged mice fed a HFD in comparison to a 1.5-fold increase in the young mice. This may have contributed to a strong lipogenic drive with age, explaining not only the increased membrane abundance of CD36 but also the increased hepatic steatosis following HF-feeding in middle-aged mice (Fig. 3B and C). In addition, increased plasma insulin levels have also been observed in senescence-prone (SAMP10) mice and reported to explain the increased lipid accumulation with age in these mice [11]. However, since cytokines have been demonstrated to regulate CD36 expression at the transcriptional level [37], the possibility also arises that increased cytokine levels during hepatic inflammation (Fig. 3F) are responsible for the enhanced CD36 membrane abundance observed in middle-aged mice fed a HFD (Fig. 5A, B). Consistent with this is the hepatic overexpression of CD36 in NASH patients and in those with chronic HCV G1 infection [24]. Nevertheless, we cannot exclude the role of other mechanisms such as reduced CD36 recycling resulting in a delay in the proteasomal degradation of CD36 [38]. Indeed, CD36 turnover has been shown to be abnormally slow in macrophages from insulin-resistant ob/ob mice, resulting in CD36 accumulation at the plasma membrane [39]. In line with this, insulin has been shown to reduce CD36 ubiquitination and enhance CD36 protein levels in CHO cells expressing both the insulin receptor and CD36 [38]. As this was associated with enhanced fatty acid uptake, it may provide an alternative mechanism for trapping CD36 at the membrane surface. Furthermore, Parkin is suggested to play a pivotal role in enhancing hepatic fat uptake by increasing the protein stability and half-life of CD36 through monoubiquitination of CD36 [30]. However, we did not observe an age- or HFD-associated increase in Parkin expression in middle-aged mice compared to young mice. Nevertheless, more recent work has shown that neddylation of Parkin increases E3 ligase activity without affecting expression [40]. This may be an alternative pathway leading to increased mono-ubiquitination of CD36 and stabilization at the plasma membrane and warrants further study. Altogether, the exact mechanism by which CD36 is translocated to the plasma membrane has not been fully elucidated and needs further investigation.

In addition to our data implicating CD36 in age-induced NAFLD, we also report that middle-aged mice show a decline in the protein expression levels of the mitochondrial electron transport chain protein expression (complex I-IV), suggesting that fat oxidation is impaired in middle-aged mice irrespective of HF-feeding. Although we did not perform direct measurements of fatty acid oxidation, this is in line with a previous study showing that mitochondria of middle-aged mice display many electron transport chain defects and decreased complex I and IV activities [41]. Our results may thus suggest that the CD36-mediated increase in hepatic fat uptake in HFD-fed middle-aged mice, coupled with a decrease in fat oxidation in the liver, will enhance triglyceride synthesis in the liver during aging and thus may be key to advancing NAFLD with aging. Furthermore, our results indicate that minor lipid droplet formation is indeed present in middle-aged mice fed a regular chow diet for one year (Fig. 2D). However, the livers of these mice did not accumulate more TG (Fig. 2E) and failed to show hepatic inflammation (Fig. 2F, Sup. Fig. 1A), indicating the absence of NAFLD. Moreover, NAFLD development (hepatic steatosis and inflammation) occurred only in middle-aged mice fed a HFD (Fig. 3). Our data thus suggest that the aging process in itself does not accelerate NAFLD development in the rodent liver; however, aging does greatly promote the development of hepatic steatosis and inflammation (NAFLD) when superimposed with a HFD. Since hyperinsulinemia, steatosis and inflammation are considered as systemic manifestations of cellular hyperfunction or overactivity [42,43], our findings are consistent with the hyperfunction theory of aging proposed by Blagosklonny, which postulates that processes contributing to growth and reproduction run on in later life, leading to pathology and eventually to death [42,43]. Although our findings seem to contradict the current understanding that aging is associated with hepatic steatosis in humans and rodents, they are in line with the recent study of Fontana [14], who showed that aged mice are more prone to develop diet-induced steato-hepatitis than young mice. Significantly, the authors did not find a difference in the development of hepatic steatosis between 6-, 12- and 22-month-old mice fed a HFD for 16 weeks [14]. Although the authors did not study the effect of aging on hepatic lipid accumulation in chow fed mice, this clearly contrasts with our observation that HF-feeding when super-imposed on middle-aged mice does significantly promote hepatic steatosis. The reason for this discrepancy is not clear; it

  www.impactaging.com                     290                                          AGING,  April 2014, Vol. 6 No.4

Page 12: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

may, however, be related to the extended length of the dietary period in the study of Fontana et al. [14]. This could explain the lower accumulation of hepatic lipid levels in the young mice fed a HFD in our study. In summary, we have shown that aging per se does not contribute to the development of NAFLD; however, it does increase susceptibility to the development of diet-induced NAFLD. Furthermore, we report for the first time that aging increases CD36 membrane expression in the livers of both mice and humans. Therefore we propose that increased CD36 localization/stabilization at the plasma membrane may be a key to enhanced hepatic fat uptake, and may play an important role in advancing NAFLD with age. Our results suggest that drugs that prevent the increase in CD36 expression and/or CD36 from anchoring at the plasma membrane may alleviate NAFLD and prevent the transition from benign steatosis toward more advanced NASH. EXPERIMENTAL PROCEDURES Patients. This study comprised 56 non-diabetic patients who underwent a needle liver biopsy during programmed laparoscopic cholecystectomy. Liver biopsy sections were collected as previously described [24] and histological diagnosis of NAFLD according to Brunt et al [44] was used to select patients with histologically normal livers (grade 0, < 5% of steatotic hepatocytes; n=30) or with simple steatosis (NAS, grades 1 and 2, 5 to 66% of steatotic hepatocytes; n=26). Each group was further classified according to distinct age categories, resulting in a young subgroup aged 20-42 years (normal liver: n=16, NAS: n=11) and an older subgroup aged 50-83 years (normal liver: n=14; NAS: n=15). Patients in each age subgroup were matched in terms of sex distribution, BMI, insulin resistance score (HOMA) and histological grade of steatosis (in the case of NAS group). Since hepatic inflammation is a confounding variable [24], NASH patients were excluded from the study. Additional standard exclusion criteria were: patients with an alcohol intake of more than 20 gram/day, those with chronic hepatitis B, C or HIV infections, and patients taking chronic medications. The study was performed in agreement with the Declaration of Helsinki and with local and national laws. The Human Ethics Committee of the University Hospital Santa Cristina (Madrid, Spain) approved the study procedures, and each patient provided written informed consent before inclusion in the study. Immunohistochemistry on human liver biopsy sections. Immunostaining and computational image analysis using analySIS® software (Soft Imaging System,

Gmbh, Münster, Germany) were performed on formalin-fixed paraffin-embedded liver biopsy sections (4 m thickness) from all patients of each group, as previously described [24]. All immunostained liver biopsy sections were first coded and then evaluated by an expert in liver immunohistochemistry (CG-M). By measuring the stained surface in 6 different lobular areas, an average score representing the percentage of liver tissue area occupied by CD36 staining was obtained. In order to more accurately evaluate the expression of CD36 restricted to hepatocytes, we measured CD36 staining by using a high magnification objective (40x) (Nikon, Tokyo, Japan) to focus on lobular areas where hepatocytes are the predominant cell type. For each liver biopsy, the average value was considered as the hepatic CD36 expression index and expressed as the percentage of lobular area occupied by CD36 staining. Clinical and laboratory assessment. After a 12 h overnight fast, clinical and anthropometric data as well as venous blood samples were obtained from each patient at the time of liver biopsy. All serum chemistry analyses were performed at the Central Laboratory Service of the University Hospital Santa Cristina (Madrid, Spain) as described [24]. Insulin resistance was calculated by the homeostasis model assessment (HOMA-IR) [45]. Antibodies against (hepatitis B, C and HIV) surface antigens were tested for by immunoenzymatic assays (Murex, Dartford, UK) and were used to exclude patients from the study. Mice. This study was performed with the approval of the University of Alberta Animal Policy and Welfare Committee and the University of Groningen Ethics Committee for Animal Experiments, which adheres to the principles and guidelines established by the European Convention for the Protection of Laboratory Animals. Experiments were carried out on young (12-14 week old) and middle-aged (52-58 week old) male C57BL6/J mice, maintained on a 12-hour light-dark cycle and given free access to water and chow diet unless otherwise stated. At 12-14 or 32-34 weeks of age, a subset of mice was randomly divided into a low-fat diet (LFD) group (D12450B, 10% kcal from fat, Research Diets) and a high-fat diet (HFD) group (D12492, 60% kcal from fat, Research Diets) for a period of 12 weeks. Insulin was measured in plasma from fasted mice as described [20]. Liver histology. Paraffin-embedded sections of the liver (4µm) were stained with hematoxylin-eosin (H&E). Microscopy was performed with a Leica DM 3000 microscope with a DFC420 camera (Leica Microsystems, Rijswijk, the Netherlands).

  www.impactaging.com                    291                                           AGING,  April 2014, Vol. 6 No.4

Page 13: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

Quantitative real-time(qRT) PCR— Hepatic gene expression analyses. Total RNA was isolated from the liver using QIAazol reagent (QIAGEN, Venlo, the Netherlands). First-strand cDNA synthesis was performed using the QuantiTect Reverse Transcription Kit (QIAGEN, Venlo, the Netherlands). qRT-PCR was performed using a 7900HT System (Applied Biosystems, Warrington, UK) and values were corrected using the housekeeping gene Cyclophillin A (Ppia). Primers are presented in Supplemental Table 1. Determination of liver triglycerides. Crushed liver tissues from fasted mice were homogenized, lipids extracted and the amount of triglyceride determined by gas-liquid chromatography as previously described [46]. Immunoblot analysis. Liver tissue was homogenized and equal amounts of protein were subjected to SDS-PAGE, transferred to nitrocellulose or PVDF membrane (Amersham, Buckinghamshire, UK) and immunoblotted with antibodies against, Erk1/2, p-Erk1/2, Actin, α-tubulin, Parkin (Cell Signaling Technology, Leiden, the Netherlands), Pan Cadherin (Abcam, Cambridge, UK), CD36 (Novus Biologicals, Littleton, USA) and Oxphos (Abcam, Cambridge, UK; a kind gift from Dr. Herman Sillje, UMCG, Groningen). Immuno-positive bands were visualized by chemiluminescence (GE Healthcare Life Sciences, Diegem, Belgium) and quantified using the Molecular Imager ChemiDoc xrs+system from Bio-Rad (Veenendaal, the Netherlands). Statistical analysis. Data are presented as mean ± SEM unless stated otherwise. The characteristics of the patients studied were compared by the Pearson 2 test or Fisher exact test for categorical variables and the unpaired t test or Mann-Whitney U test for continuous variables. Spearman’s rho test was used to evaluate correlations. Experimental data were compared using the unpaired t test or Mann–Whitney U test. The level of significance was set at P<0.05. All statistical analyses were performed in GraphPad Prism (v. 5.00 for Windows, San Diego, CA). ACKNOWLEDGEMENTS We thank Dr. Bart van de Sluis and Dr. Jan Albert Kuivenhoven for their helpful comments and discussions and Henk van der Molen, Cindy Kao, Mathilde Vermeer, Kelly Leonard and Dr. Azzura Greco for their technical assistance. Funding. FS and MA-V are supported by a PhD scholarship from the Graduate School for Drug Exploration (GUIDE), University of Groningen. MHH and DPYK are supported by the Center for Translational Molecular Medicine (CTMM) project PREDICCt (grant

01C-104) and Dutch Heart Foundation, Dutch Diabetes Research Foundation and Dutch Kidney Foundation (PREDICCt). Further support was obtained by grants from Instituto de Salud Carlos III (PI10/00067 and PI13/01299) to CG-M; the Canadian Institutes of Health Research (CIHR, MOP125973) and the Canadian Diabetes Association (CDA, OG-3-13-4155) to JRBD; a MFAG-AIRC grant of the Associazione Italiana per la Ricerca sul Cancro to MV; the Natural Sciences and Engineering Research Council of Canada (386652) and a New Investigator Award from the Canadian Institutes of Health Research (CIHR) to RLJ. Conflict of interest statement No conflict of interest could be disclosed for any author. REFERENCES 1.  WHO.  What  are  the  public  health  implications  of  global ageing? World Heal. Organ. 2011; 2. WHO. 2008–2013 Action Plan  for the Global Strategy  for the Prevention and Control of Noncommunicable Diseases. Geneva, Switzerland. World Heal. Organ. 2009; 3.  Erickson  SK.  Nonalcoholic  fatty  liver  disease.  J.  Lipid  Res. 2009;50 Suppl:S412–416.  4. Brunt EM. Pathology of nonalcoholic  fatty  liver disease. Nat. Rev. Gastroenterol. Hepatol. 2010;7:195–203.  5. Floreani A. Liver diseases  in  the elderly: an update. Dig. Dis. 2007;25:138–143.  6. Slawik M, Vidal‐Puig AJ. Lipotoxicity, overnutrition and energy metabolism in aging. Ageing Res. Rev. 2006;5:144–164.  7.  Frith  J,  Day  CP,  Henderson  E,  Burt  AD,  Newton  JL.  Non‐alcoholic  fatty  liver  disease  in  older  people.  Gerontology. 2009;55:607–613.  8. Regev A, Schiff ER. Liver disease in the elderly. Gastroenterol. Clin. North Am. 2001;30:547–63.  9. Sheedfar F, Di Biase S, Koonen D, Vinciguerra M. Liver diseases and aging: friends or foes? Aging Cell. 2013;12:950–954.  10. Ghosh PM, Shu Z‐J, Zhu B, Lu Z, Ikeno Y, Barnes JL, Yeh C‐K, Zhang B‐X, Katz MS, Kamat A. Role of β‐adrenergic receptors  in regulation  of  hepatic  fat  accumulation  during  aging.  J. Endocrinol. 2012;213:251–261.  11.  Honma  T,  Yanaka  M,  Tsuduki  T,  Ikeda  I.  Increased  lipid accumulation  in  liver  and white  adipose  tissue  in  aging  in  the SAMP10 mouse.  J. Nutr.  Sci.  Vitaminol.  (Tokyo).  2011;57:123–129.  12. Jin J, Iakova P, Breaux M, Sullivan E, Jawanmardi N, Chen D, Jiang  Y, Medrano  EM,  Timchenko NA.  Increased  expression  of enzymes  of  triglyceride  synthesis  is  essential  for  the development of hepatic steatosis. Cell Rep. 2013;3:831–843.  13. Bieghs V, Wouters K, van Gorp PJ, Gijbels MJJ, de Winther MPJ, Binder CJ, Lütjohann D, Febbraio M, Moore KJ, van Bilsen M, Hofker MH,  Shiri‐Sverdlov  R.  Role  of  scavenger  receptor  A and  CD36  in  diet‐induced  nonalcoholic  steatohepatitis  in hyperlipidemic  mice.  Gastroenterology.  2010;138:2477–86, 2486.e1–3.  14.  Fontana  L,  Zhao  E,  Amir M,  Dong  H,  Tanaka  K,  Czaja MJ. Aging  promotes  the  development  of  diet‐induced  murine 

  www.impactaging.com                    292                                           AGING,  April 2014, Vol. 6 No.4

Page 14: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

steatohepatitis  but  not  steatosis.  Hepatology.  2013;57:995–1004.  15.  Koonen  DPY,  Glatz  JFC,  Bonen  A,  Luiken  JJFP.  Long‐chain fatty  acid  uptake  and  FAT/CD36  translocation  in  heart  and skeletal muscle. Biochim. Biophys. Acta. 2005;1736:163–180.  16.  Bonen  A,  Parolin  ML,  Steinberg  GR,  Calles‐Escandon  J, Tandon NN, Glatz  JFC,  Luiken  JJFP, Heigenhauser GJF, Dyck DJ. Triacylglycerol  accumulation  in  human  obesity  and  type  2 diabetes  is  associated with  increased  rates  of  skeletal muscle fatty  acid  transport  and  increased  sarcolemmal  FAT/CD36. FASEB J. 2004;18:1144–1146.  17.  Luiken  JJ,  Arumugam  Y,  Dyck  DJ,  Bell  RC,  Pelsers  MM, Turcotte  LP,  Tandon NN, Glatz  JF, Bonen A.  Increased  rates of fatty  acid  uptake  and  plasmalemmal  fatty  acid  transporters  in obese Zucker rats. J. Biol. Chem. 2001;276:40567–40573.  18. Koonen DPY, Jacobs RL, Febbraio M, Young ME, Soltys C‐LM, Ong H, Vance DE, Dyck  JRB.  Increased hepatic CD36 expression contributes  to  dyslipidemia  associated  with  diet‐induced obesity. Diabetes. 2007;56:2863–2671.  19. Koonen DPY, Febbraio M, Bonnet S, Nagendran J, Young ME, Michelakis  ED,  Dyck  JRB.  CD36  expression  contributes  to  age‐induced  cardiomyopathy  in mice.  Circulation.  2007;116:2139–2147.  20. Koonen DPY, Sung MMY, Kao CKC, Dolinsky VW, Koves TR, Ilkayeva O,  Jacobs RL, Vance DE, Light PE, Muoio DM, Febbraio M, Dyck  JRB. Alterations  in  skeletal muscle  fatty  acid handling predisposes middle‐aged mice to diet‐induced insulin resistance. Diabetes. 2010;59:1366–1375.  21. Sung MMY, Koonen DPY, Soltys C‐LM, Jacobs RL, Febbraio M, Dyck  JRB.  Increased  CD36  expression  in  middle‐aged  mice contributes  to  obesity‐related  cardiac  hypertrophy  in  the absence  of  cardiac  dysfunction.  J.  Mol.  Med.  (Berl). 2011;89:459–469.  22. Nishikawa S, Sugimoto J, Okada M, Sakairi T, Takagi S. Gene expression  in  livers of BALB/C and C57BL/6J mice fed a high‐fat diet. Toxicol. Pathol. 2012;40:71–82.  23.  Yimin,  Furumaki  H, Matsuoka  S,  Sakurai  T,  Kohanawa M, Zhao  S, Kuge  Y,  Tamaki N, Chiba H. A novel murine model  for non‐alcoholic  steatohepatitis  developed  by  combination  of  a high‐fat  diet  and  oxidized  low‐density  lipoprotein.  Lab.  Invest. 2012;92:265–281.  24.  Miquilena‐Colina  ME,  Lima‐Cabello  E,  Sánchez‐Campos  S, García‐Mediavilla MV, Fernández‐Bermejo M, Lozano‐Rodríguez T, Vargas‐Castrillón J, Buqué X, Ochoa B, Aspichueta P, González‐Gallego J, García‐Monzón C. Hepatic fatty acid translocase CD36 upregulation  is  associated  with  insulin  resistance,  hyper‐insulinaemia  and  increased  steatosis  in  non‐alcoholic  steato‐hepatitis and chronic hepatitis C. Gut. 2011;60:1394–1402.  25. Petersen KF, Befroy D, Dufour S, Dziura J, Ariyan C, Rothman DL, DiPietro L, Cline GW, Shulman GI. Mitochondrial dysfunction in  the  elderly:  possible  role  in  insulin  resistance.  Science. 2003;300:1140–1142.  26. Gupte AA, Liu JZ, Ren Y, Minze LJ, Wiles JR, Collins AR, et al. Rosiglitazone  attenuates  age‐  and  diet‐associated  nonalcoholic steatohepatitis  in  male  low‐density  lipoprotein  receptor knockout mice. Hepatology. 2010;52:2001–2011.  27. Houtkooper RH, Argmann  C, Houten  SM,  Cantó  C,  Jeninga EH, Andreux PA, Thomas C, Doenlen R, Schoonjans K, Auwerx J. The metabolic footprint of aging in mice. Sci. Rep. 2011;1.  28.  Luiken  JJFP,  Koonen  DPY, Willems  J,  Zorzano  A,  Becker  C, Fischer  Y,  Tandon NN,  Van Der  Vusse GJ,  Bonen  A, Glatz  JFC. 

Insulin stimulates  long‐chain  fatty acid utilization by rat cardiac myocytes through cellular redistribution of FAT/CD36. Diabetes. 2002;51:3113–3119.  29.  Buqué  X,  Cano  A, Miquilena‐Colina ME, García‐Monzón  C, Ochoa  B,  Aspichueta  P.  High  insulin  levels  are  required  for FAT/CD36 plasma membrane  translocation and enhanced  fatty acid  uptake  in  obese  Zucker  rat  hepatocytes.  Am.  J.  Physiol. Endocrinol. Metab. 2012;303:E504–514.  30. Kim K‐Y, Stevens M V, Akter MH, Rusk SE, Huang RJ, Cohen A, et al. Parkin  is a  lipid‐responsive regulator of fat uptake  in mice and mutant human cells. J. Clin. Invest. 2011;121:3701–3712.  31. Ehehalt R, Füllekrug J, Pohl J, Ring A, Herrmann T, Stremmel W.  Translocation  of  long  chain  fatty  acids  across  the  plasma membrane‐‐lipid  rafts  and  fatty  acid  transport  proteins. Mol. Cell. Biochem. 2006;284:135–140.  32. Zhou J, Febbraio M, Wada T, Zhai Y, Kuruba R, He J, Lee JH, Khadem S, Ren S,  Li S, Silverstein RL, Xie W. Hepatic  fatty acid transporter  Cd36  is  a  common  target  of  LXR,  PXR,  and PPARgamma  in  promoting  steatosis.  Gastroenterology. 2008;134:556–567.  33.  Chang  AM,  Halter  JB.  Aging  and  insulin  secretion.  Am.  J. Physiol. Endocrinol. Metab. 2003;284:E7–12.  34. Bonen A, Benton CR, Campbell SE, Chabowski A, Clarke DC, Han  X‐X,  Glatz  JFC,  Luiken  JJFP.  Plasmalemmal  fatty  acid transport  is  regulated  in  heart  and  skeletal  muscle  by contraction, insulin and leptin, and in obesity and diabetes. Acta Physiol. Scand. 2003;178:347–356.  35.  Coort  SLM,  Hasselbaink  DM,  Koonen  DPY,  Willems  J, Coumans WA, Chabowski A,  van der Vusse GJ, Bonen A, Glatz JFC, Luiken  JJFP. Enhanced sarcolemmal FAT/CD36 content and triacylglycerol  storage  in  cardiac myocytes  from  obese  zucker rats. Diabetes. 2004;53:1655–1663.  36. Schwenk RW, Luiken JJFP, Bonen A, Glatz JFC. Regulation of sarcolemmal  glucose  and  fatty  acid  transporters  in  cardiac disease. Cardiovasc. Res. 2008;79:249–258.  37. Memon  RA,  Feingold  KR, Moser  AH,  Fuller  J,  Grunfeld  C. Regulation  of  fatty  acid  transport  protein  and  fatty  acid translocase  mRNA  levels  by  endotoxin  and  cytokines.  Am.  J. Physiol. 1998;274:E210–217.  38.  Smith  J,  Su  X,  El‐Maghrabi  R,  Stahl  PD,  Abumrad  NA. Opposite  regulation  of  CD36  ubiquitination  by  fatty  acids  and insulin:  effects  on  fatty  acid  uptake.  J.  Biol.  Chem. 2008;283:13578–13585.  39. Liang C‐P, Han S, Okamoto H, Carnemolla R, Tabas  I, Accili D, Tall AR. Increased CD36 protein as a response to defective insulin signaling in macrophages. J. Clin. Invest. 2004;113:764–773.  40.  Choo  YS,  Vogler G, Wang  D,  Kalvakuri  S,  Iliuk  A,  Tao WA, Bodmer  R,  Zhang  Z.  Regulation  of  parkin  and  PINK1  by neddylation. Hum. Mol. Genet. 2012;21:2514–2523.  41.  Chowdhry  S,  Nazmy MH, Meakin  PJ,  Dinkova‐Kostova  AT, Walsh  S V,  Tsujita  T, Dillon  JF, Ashford MLJ, Hayes  JD.  Loss of Nrf2  markedly  exacerbates  nonalcoholic  steatohepatitis.  Free Radic. Biol. Med. 2010;48:357–371.  42.  Gems  D,  Partridge  L.  Genetics  of  longevity  in  model organisms:  debates  and  paradigm  shifts.  Annu.  Rev.  Physiol. 2013;75:621–644.  43. Blagosklonny M V. Answering the ultimate question “what is the proximal cause of aging?”. Aging  (Albany. NY). 2012;4:861–877.  44. Brunt EM,  Janney CG, Di Bisceglie AM, Neuschwander‐Tetri BA,  Bacon  BR.  Nonalcoholic  steatohepatitis:  a  proposal  for 

  www.impactaging.com                    293                                          AGING,  April 2014, Vol. 6 No.4

Page 15: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

grading  and  staging  the  histological  lesions.  Am.  J. Gastroenterol. 1999;94:2467–2474.  45. Matthews DR, Hosker  JP, Rudenski AS, Naylor BA, Treacher DF,  Turner  RC.  Homeostasis  model  assessment:  insulin resistance  and  beta‐cell  function  from  fasting  plasma  glucose and  insulin  concentrations  in man. Diabetologia.  1985;28:412–419.  46. Jacobs RL, Devlin C, Tabas  I, Vance DE. Targeted deletion of hepatic  CTP:phosphocholine  cytidylyltransferase  alpha  in mice decreases plasma high density and very low density lipoproteins. J. Biol. Chem. 2004;279:47402–47410.        

SUPPLEMENTARY DATA                                 

                                                             

Supplementary Table 1. Primer sequences used for qRT‐PCR

Gene Forward primer 5’-3’ Reverse primer 5’-3’

Ikk2 GGAGTACTGCCAAGGAGGAGAT ACAGGCTGCCAGTTAGGGAGGAAG

IkBα TGGAAGTCATTGGTCAGGTGAA CAGAAGTGCCTCAGCAATTCCT

Cd68 TGACCTGCTCTCTCTAAGGCTACA TCACGGTTGCAAGAGAAACATG

CxcL1 CCAAACCGAAGTCATAGCCAC GTCTTCTTTCTCCGTTACTTGG

Il10 GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG

Il-1β TGCAGCTGGAGAGTGTGG TGCTTGTGAGGTGCTGATG

Il-6 GTTCTCTGGGAAATCGTGGA TTTCTGCAAGTGCATCATCG

Mcp1 GCTGGAGAGCTACAAGAGGATCA ACAGACCTCTCTCTTGAGCTTGGT

Cd36 GATCGGAACTGTGGGCTCAT GGTTCCTTCTTCAAGGACAACTTC

Tnf GTAGCCCACGTCGTAGCAAAC AGTTGGTTGTCTTTGAGATCCATG

Ppia TTCCTCCTTTCACAGAATTATTCCA CCGCCAGTGCCATTATGG

  www.impactaging.com                    294                                          AGING,  April 2014, Vol. 6 No.4

Page 16: University of Groningen Non-alcoholic fatty liver disease ... › research › portal › files › 15553219 › Chapter_4_p… · century's main health problems. Aging is the leading

                

 

  www.impactaging.com                    295                                           AGING,  April 2014, Vol. 6 No.4

Supplementary  Figure  1.  Hepatic  inflammation  did  notaltered in the aged mice fed a chow diet and young mice fedwith HFD for 12 weeks. (A) Phosphorylation status of Erk1/2 wasdetected  in  liver  extracts  from  young  and middle‐aged mice usingimmunoblot  analysis.  (B)  Immunoblot  analysis using  anti‐phospho‐Erk1/2  and  anti‐Erk1/2  antibody  was  performed  in  liver  extractsfrom young mice  fed a HFD  for 12 weeks. Values are expressed asmean ± SEM; n = 6–8 mice/group. *p ≤0.05  (Nonparametric Mann‐Whitney U test). 

Supplementary  Figure  2.  Reduced  expression  of  oxidative phosphorylation protein complexes (OXPHOS) in middle‐aged mice.(A) Representative immunoblots from liver extracts of young (Y) and middle‐aged (A) mice fed a LFD and a HFD using anti‐OXPHOS and actin antibody (B) Immunoblots were quantified by densitometry and normalized against actin as  a  control  for  loading.  Values  are  expressed  as  mean  ±  SEM;  n=  6‐7 mice/group. *p≤ 0.05. (Nonparametric Mann‐Whitney U test).