The Pennsylvania State University
The Graduate School
Department of Biochemistry and Molecular Biology
THE flexed-tail (f) MUTANT MOUSE: ADVANCING THE
UNDERSTANDING OF EXPANSIVE ERYTHROPOIESIS
A Thesis in
Biochemistry, Microbiology and Molecular Biology
by
L. E. Lenox
© 2005 L. E. Lenox
Submitted in Partial Fulfillment of the Requirements
for the Degree of
Doctor of Philosophy
August 2005
The thesis of L. E. Lenox was reviewed and approved* by the following:
Robert F. Paulson Associate Professor of Veterinary Science Thesis Advisor Chair of Committee Avery August Associate Professor of Immunology
Pamela H. Correll Associate Professor of Immunology
Ross C. Hardison Professor of Biochemistry and Molecular Biology
Andrew Henderson Associate Professor of Veterinary Science
Robert A. Schlegel Professor of Biochemistry and Molecular Biology Head of the Department of Biochemistry and Molecular Biology
*Signatures are on file in the Graduate School
iii
ABSTRACT
The autosomal, recessive flexed-tail mutant (f/f) mouse has defects at times of
expansive erythropoiesis. The phenotype is evident both during development and in the
adult. f/f show a transient fetal/neonatal anemia that remits shortly after birth when the
main site of hematopoiesis has shifted from the fetal liver to the bone marrow. Adult
mice appear normal, but show a delay in their recovery to acute anemia. Analysis of the
flexed-tail (f) mutant has shown that the contribution from stress erythroid progenitors
resident in the spleen responding to hypoxia-induced BMP4/Madh5 dependent signals is
required for the rapid recovery to an acute anemia. The f mutation is a neomorphic
mutation of Madh5, with aberrantly spliced transcripts disrupting the normal BMP4
signaling pathway in the spleen following an erythropoietic challenge. Although this
splenic contribution to an acute anemia is critical for the rapid return to homeostasis, it is
not essential since flexed-tail mice are viable and both humans and mice can survive
without a spleen. To further understand the mechanisms of expansive erythropoiesis, we
have extended our analysis to splenectomized mice. These mice show altered kinetics of
recovery to a phenylhydrazine induced acute anemia with expansive erythropoiesis now
seen in the liver. Further, BMP4 is expressed in the liver and liver erythroid progenitors
exhibit properties similar to stress BFU-E in the spleen. This work has shown the
important role of the BMP4 pathway for regulating expansive erythropoiesis in extra-
medullary organs. It has also broadened our appreciation for splicing mutations, the
regulations within signaling pathways, and the contribution these pathways make to
signaling networks.
iv
TABLE OF CONTENTS LIST OF FIGURES…......................................................................................................vi ACKNOWLEDGEMENTS..............................................................................................x Chapter 1. HEMATOPOIESIS, ERYTHROPOIESIS AND THE flexed-tail (f) MUTATION...............................................................................................1 Abstract……............................................................................................................1 Introduction to Hematopoiesis and the Development of the Hematopoietic System.................................................................................................................2 The development of the hematopoietic system……....................................3 Primitive and definitive hematopoiesis……................................................5 Changing sites of hematopoiesis throughout ontogeny…….......................6
The extra-embryonic location for the production/development of hematopoietic progenitor cells…............................................................7 The intra-embryonic location for the production of hematopoietic progenitor cells......................................................................................10 Migration of hematopoietic cells from microenvironments supporting their production to those specialized for their expansion.....................12
Introduction to Erythropoiesis...............................................................................15 Erythropoietin............................................................................................18 Regulation of erythropoietin......................................................................19 Erythropoietin signaling.............................................................................22 Hemoglobin................................................................................................24 Steady-state vs. Expansive Erythropoiesis.............................................................28 Microenvironments/Stroma Supporting Hematopoiesis........................................35 The flexed-tail (f) Mutant Mouse as a Means to Study Expansive Erythropoiesis...................................................................................................41 The embryonic defects of flexed-tail (f) mice…........................................41
The adult defects of flexed-tail (f) mice….................................................48 References..............................................................................................................55 Figures....................................................................................................................67 Chapter 2. MAPPING OF THE flexed-tail (f) LOCUS LEADS TO THE DISCOVERY THAT BMP4 AND Madh5 REGULATE THE ERYTHROID RESPONSE TO ACUTE ANEMIA.............................81 Forward..................................................................................................................81 Abstract..................................................................................................................83 Introduction............................................................................................................84 Methods..................................................................................................................87 Results....................................................................................................................89 Discussion..............................................................................................................99
v
References............................................................................................................103
Figures..................................................................................................................106 Chapter 3. STRESS ERYTHROPOIESIS IN SPLENECTOMIZED MICE.........113 Abstract................................................................................................................113 Introduction..........................................................................................................115 Methods................................................................................................................118 Results..................................................................................................................120 Discussion............................................................................................................129 References............................................................................................................135 Figures..................................................................................................................137 Chapter 4. THE IMPACT OF flexed-tail...................................................................145 Abstract................................................................................................................145 The Impact of Our Analysis of the flexed-tail Locus on Our Appreciation for Splicing Mutations and Their Physiological Consequences...........................146
The Impact of Our Analysis of the flexed-tail Locus as It Relates to the TGF-β Family Signaling Pathway..................................................................149
TGF-β-BMP signaling.............................................................................149 Negative regulators of TGF-β/BMP signaling…....................................153 Interaction of TGF-β/BMP signaling with other signaling pathway.......155 Neomorphic properties of the flexed-tail truncated transcripts...............156
The Impact of Our Analysis of the flexed-tail Locus: A Reminder of the Subtleties in Place Behind Beautifully Orchestrated Physiological Mechanisms….................................................................................................163
Concluding Remarks............................................................................................166 References............................................................................................................167 Figures..................................................................................................................173 Appendix A. CLONING AND CHARACTERIZATION OF THE flexed-tail (f) LOCUS....................................................................................................183 References............................................................................................................192
Figures…..............................................................................................................193 Appendix B. SUPPLEMENTARY INFORMATION: GENOTYPING OF THE Sideroflexin (Sfxn) LOCUS...................................................................205
vi
LIST OF FIGURES
Figure 1-1 The hematopoietic system 67
Figure 1-2 Dual stem cell model of hematopoietic stem cell ontogeny 68
Figure 1-3 Development and features of the ‘hemogenic’ regions during embryogenesis
69
Figure 1-4 Stages of erythroid development 70
Figure 1-5 Erythropoietin: regulation and signaling 71
Figure 1-6 Schematic of globin genes 72
Figure 1-7 CFU-E in the fetal liver of f/f and +/+ mice 73
Figure 1-8 Percentages of siderocytes in reticulocytes of f/f and f/+ control fetal and neonatal mice.
74
Figure 1-9 Diagram of hemoglobin biosynthesis 75
Figure 1-10 Chromatography of globin chains synthesized by day 18 +/+ (A) and f/f (B) fetal erythrocytes
76
Figure 1-11 Incorporation of 59Fe into heme from CFU-S of f/f and +/+ mice 77
Figure 1-12 Changes in spleen weight and reticulocyte count in flexed and wild-type recovering from phenylhydrazine induced acute anemia
78
Figure 1-13 Effects of phenylhydrazine treatment on enzymes of the hemoglobin biosynthetic pathway in spleen from flexed and wild-type mice
79
Figure 1-14 Transient endogenous spleen colonies (TE-CFU) in the spleens of wild-type and flexed-tail mice
80
Figure 2-1
Analysis of liver BFU-E expansion during the recovery from a PHZ induced hemolytic anemia
106
Figure 2-2 Genetic linkage map of the f locus and molecular analysis of Madh5 transcripts in f/f, f/+ and control mice
107
vii
Figure 2-3 Analysis of BMP4 expression during the recovery from acute anemia
108
Figure 2-4 Analysis of the ability of BMP4 to induce the formation of stress BFU-E in spleen cells from untreated mice
109
Figure 2-5 Analysis of the recovery from acute anemia in f/Madh5- and +/Madh5- mice
110
Figure 2-6 Analysis of the effect of over-expression of the f mis-spliced Madh5 mRNAs on BMP4 signaling in W-20-17 osteoblast cells
111
Figure 2-7 Identification of the sub-population of progenitor cells from untreated spleen that respond to BMP4
112
Figure 3-1 Hematocrit values during the recovery to a phenylhydrazine (PHZ) induced hemolytic anemia
137
Figure 3-2 Analysis of BFU-E expansion of bone marrow BFU-E during the recovery from PHZ induced acute hemolytic anemia
138
Figure 3-3 H&E stained liver sections during recovery from a PHZ induced acute anemia
139
Figure 3-4 Analysis of liver BFU-E expansion during the recovery from a PHZ induced hemolytic anemia
140
Figure 3-5 Analysis of BMP4 expression in the liver during recovery from a PHZ induced acute anemia
141
Figure 3-6 H&E stained liver sections from flexed-tail (f/f) mice 142
Figure 3-7 Immunohistochemistry for SDF-1 in liver of wild-type mice during the recovery from a PHZ induced acute anemia
143
Figure 3-8 Immunohistochemistry for SDF-1 in liver of splenectomized mice during the recovery from a PHZ induced acute anemia
144
Figure 4-1 Calculation of 5’ splice site consensus sequence 173
Figure 4-2 Cascade of BMP signaling and levels of modulation 174
Figure 4-3 Signaling specificity in the TGF-β superfamily 175
viii
Figure 4-4 Activation of the type I receptor kinase and recognition of R-Smads
176
Figure 4-5 Structure of the receptor activated R-Smads, common binding partner Smad4 and the inhibitory I-Smads
177
Figure 4-6 Map of full length Madh5 (Smad5) mRNA as well as the truncated transcripts found in f/f mice
178
Figure 4-7 RT-PCR from COS7 cells transfected with retroviral constructs containing full length and truncated Smad5 constructs
179
Figure 4-8 Transfected COS7 cells with constructs containing truncated transcripts
179
Figure 4-9 Predicted in-frame amino acid structure of truncated transcripts compared to wild-type Smad5
180
Figure 4-10 Gene expression of W-20-17 cells lines containing the f/f truncated transcripts
181
Figure 4-11 Current working model for the network regulating expansive erythropoiesis
182
Figure A-1 Physical map of Mus musculus Chr13 around region of Madh5 (Smad5)
193
Figure A-2 Strategy to find the flexed-tail (f) mutation 194
Figure A-3 Analysis for Madh5 (Smad5) on BAC clones 195
Figure A-4 H&E stained sections of the dorsal aorta from E10.5 f/f and f/+ littermates
196
Figure A-5 Northern blot for Madh5 (Smad5) mRNA levels in spleen of f/+ and f/f adult mice following an acute anemia
197
Figure A-6
Western blot for Madh5 (Smad5) protein levels in f/f, f/+ and +/+ mice
198
ix
Figure A-7 Short-term rescue of f/f mutant spleen cells through retroviral transduction of full length Madh5 (Smad5) cDNA
199
Figure A-8 Long-term rescue of flexed-tail mutants: Madh5 transgenic f/f mice 200
Figure A-9 Genome Walking results of Madh5 genomic region from f/f, +/+ and E10 BAC
201
Figure A-10 Map of Madh5 subdivided for direct amplification, cloning and sequencing
202
Figure A-11
Secondary structure comparison between the difficult to amplify region of “Alaska” and the easily amplified comparable sized fragment of “Bombay” of the Madh5 gene
202
Figure A-12 Number of Ts in PolyT region (in Greece fragment) from flexed-tail and wild-type mice
203
Figure A-13 In vitro splicing assays to determine the functional consequences of variations in the PolyT tract in flexed-tail and wild-type mice
204
Figure B-1 Genotyping for the Sideroflexin (Sfxn) mutation 206
Figure B-2 Direct sequencing of the Sfxn1 exon 2 in f/f mice 207
Figure B-3 Analysis of Sfxn mutations in f/f mice by oligonucleotide ligation assay
208
xACKNOWLEDGEMENTS
I would like to thank my family first and foremost for their love and support
throughout this process. I would not be where I am today without them. I would like to
thank my advisor, Dr. Robert Paulson, for giving me the opportunity to work in his lab.
He creates an environment conducive to scientific growth and development, built on
discussion, collaboration and curiosity. I am very thankful to the past and present
members of the Paulson lab, especially Anamaria Craici, Omid Harandi, Shailaja Hegde,
Andrew Lariviere, John Perry, Prashanth Porayette, Aparna Subramanian and Michele
Yon, who made it worth coming to work when the data didn’t. I appreciate the input
from and participation of my committee members which include Dr. Avery August, Dr.
Pamela Correll, Dr. Ross Hardison, and Dr. Andrew Henderson. Finally, I would like to
express my sincere gratitude to my friends and loved ones who have touched my life,
made things interesting, and kept me grounded on this journey. I look forward to using
what I have learned during this process to go on and make a difference in the world.
Chapter 1
HEMATOPOIESIS, ERYTHROPOIESIS AND THE flexed-tail (f) MUTATION
Abstract
Hematopoiesis is the process of blood cell development. Erythropoiesis is the
branch of hematopoiesis that leads to the development of an erythrocyte. There are
distinct mechanisms of erythropoiesis and specialized microenvironments that support
these processes. Steady-state erythropoiesis occurs at a constant rate in the bone marrow
and relies on local sources of erythropoietin (Epo). Expansive erythropoiesis is a distinct
mechanism which occurs in the fetal liver during embryogenesis or in the adult spleen
following an erythropoietic stress. Expansive erythropoiesis leads to the rapid
expansion of erythroid progenitors and requires high levels of erythropoietin regulated by
hypoxia in the tissues. The flexed-tail (f) mutant mouse is a means to study expansive
erythropoiesis. These mutants have an embryonic/fetal anemia that remits after birth as
the main site of hematopoiesis has shifted to the bone marrow. The f/f reticulocytes
contain non-heme iron granules known as siderocytes. Adult f/f mice exhibit normal
steady state blood values but have a delay in their recovery to an acute anemia. This
return of normal hematocrit levels and the up regulation of heme biosynthetic enzymes
are delayed; however no siderocytic granules are present in the adult reticulocytes during
recovery. This mutant provides an important model for understanding the progenitors,
signals and microenvironments that regulate expansive erythropoiesis.
2
Introduction to Hematopoiesis and the Development of the Hematopoietic
System
Hematopoiesis is the developmentally regulated and tissue specific process of
blood cell development. It is a highly conserved process in worms, fish, avian,
amphibian, and mammalian systems. Depicted as a hierarchal system cascading from a
pluripotent stem cell, this model has been firmly established through a series of
transplantation and cell fate experiments (Figure 1-1). Hematopoietic stem cells (HSC)
were first identified morphologically by a large nucleus with prominent nucleoli and a
deeply basophilic staining cytoplasms [1]. Currently the defining characteristics of the
hematopoietic stem cell are long-term, high level repopulation of all hematopoietic
lineages in the adult and the ability to self renew [2, 3]. In the murine system they can be
enriched for by their cell surface profile of kit hi, Sca-1 (Ly-6A/E)+ , with no lineage
specific surface expression, Lin- (Mac1-, B220-, CD3-, Gr1-) [3-5].
The HSC will commit to a particular lineage through multi-potent progenitors,
committed progenitors, and precursor cells ending with mature differentiated cells
specialized for a particular function [6]. There are erythrocytes for oxygen delivery,
myeloid cells (neutrophils and macrophages) to fight infection, mast and myeloid cells
which secrete histamines in an allergic response, megakaryocytes for blood clotting, and
B and T lymphocytes that are critical for adaptive immune function. The maturation
down a particular lineage involves the interaction with other cells, cytokines for
instructive or permissive signals, and cell intrinsic mechanisms [6]. Our understanding
of this developmental program has been complemented by work in embryonic stem (ES)
cells. ES cells are pluripotent cells from the inner cell mass of the mouse E3.5 blastocyst.
3
When cultured in media lacking leukemia inhibitory factor (LIF), they can give rise to
cell aggregates termed embryoid bodies (EB). The EBs can be manipulated to
differentiate into the various ranges of embryonic tissues including epidermis, neuronal
and glial cells, muscle, endothelial and hematopoietic cells using specific cytokine
cocktails [7]. This system has added to our understanding of the origins of hematopoietic
potential, the relationship between lineages, and the “molecular definitions” of
progenitors and their progeny. For the most part, progenitor cells are still defined using
in vivo or in vitro colony assays, although advances have been made in distinguishing
them based on cell surface markers or gene expression profiles. As progenitors commit
to a lineage, they progressively gain morphological distinguishable characteristics, but
lose self-renewal capabilities. Mature hematopoietic cells have finite life spans ranging
from 2 days for neutrophils, to 30 days for erythrocytes, while the life of lymphoid cells
varies [4]. To maintain steady-state levels, the system must produce 1010 cells per day
to keep pace with normal losses [6]. It must also be able to adjust for large perturbations
in homeostasis such as blood loss or infection by invoking developmental pathways of
certain lineages, while leaving others unaffected.
The development of the hematopoietic system. Hematopoietic tissue is derived from
ventral mesoderm through the instructive signals of fibroblast growth factor (FGF),
transforming growth factor-β (TGF-β), bone morphogenic protein (BMP) and other
factors [1, 8]. BMP4 is known to be induced by and mediate the signals of Indian hedge
hog (Ihh), which is sufficient to reprogram anterior ectoderm and induce primitive
erythropoiesis in murine embryonic explants [9]. BMPs have been shown to be necessary
4
following early specification of ventral mesoderm, by directly or indirectly targeting
critical hematopoietic transcription factors such as SCL, GATA-1, GATA-2, LMO-2, and
EKLF [10]. In fact, SCL is necessary and sufficient to specify hematopoietic mesoderm
[11]. SCL -/- mice are embryonic lethal at E9.5 due to a failure to develop embryonic
red cells [12, 13] and SCL -/- ES cells make no contributions to hematopoietic lineages in
chimeras [7]. Its been shown that the transcription factors SCL, LMO-2 and GATA-1
form a complex in vitro, specifying mesoderm to become blood, with over-expression of
the complex leading to embryos that are ventralized with blood throughout the dorsal
ventral axis [14].
A dual stem cell model has been proposed (Figure 1-2) whereby mesoderm
precursors migrate to both extra and intra-embryonic sites, with hematopoietic stem cell
activity arising independently at both locations [1]. It is clear from the anatomy of
hematopoietic development there is a close relationship between hematopoietic cells and
endothelial cells. In 1932, Murray et al. proposed the idea of a common ancestor to both
the hematopoietic and endothelial lineages termed the hemangioblast [15]. The initial
observation was made that both endothelial cells and hematopoietic cells emerge from a
cluster of identical cells from this mesodermal layer. The idea of this common ancestor
is supported by the close proximity of these cells as they develop, the similarity of their
cell surface markers [7], and gene expression profile with expression of CD34, Flk1,
TIE2, SCL, and GATA2 [3, 16]. Keller and colleagues have used the ES cell
differentiation system to identify a candidate for the hemangioblast. They found a
transient Flk1+ (VEGF receptor) population, termed the blast colony forming cell (Bl-
CFC) that in functional studies could give rise to both primitive and definitive
5
hematopoietic precursors, as well as adhesive cells expressing an endothelial marker
(PECAM) [17, 18]. The important role of Flk1 expression for an
endothelial/hematopoietic ancestor is verified by in vivo evidence that Flk1-/- mice die
between E8.5-9.5 with no yolk sac blood islands, no organized blood vessels in the
embryo or yolk sac, with severely reduced hematopoietic progeny [19, 20]. This system
has also emphasized the importance of SCL for hematopoietic development since SCL -/-
ES cells can differentiate into Flk1+ mesoderm and down the endothelial lineage, but are
blocked in hematopoiesis at the hemangioblast stage [7].
Primitive and definitive hematopoiesis. The hematopoietic system occurs in two waves
that are defined by the morphology of the progeny, potential of the progenitor cells, and
the type of globins produced. Primitive hematopoiesis is a transient wave during
ontogeny that is replaced permanently by definitive hematopoiesis which is maintained
throughout the life of the animal. Primitive hematopoiesis shares characteristics with
lower vertebrates and amphibians such as large nucleated red blood cells. These
primitive cells produce only embryonic globins. The progeny have limited potential,
primarily producing primitive erythrocytes and macrophages in vivo, although other
lineages can be obtained using in vitro colony assays [4]. The onset of definitive
hematopoiesis occurs later in ontogeny and is characterized by enucleated erythrocytes,
fetal (in humans) and adult globin production, and progenitors with full potential, giving
rise to all blood cell lineages [4, 6]. The mechanisms that drive primitive erythropoiesis
are clearly distinct from those of definitive erythropoiesis. Definitive erythropoiesis is
much more dependent on Erythropoietin (Epo) than primitive, even though Epo increased
6
the number of primitive erythroid cells and accumulation of globin transcripts in vitro [1].
Disruption of Epo, Epo receptor (EpoR) or Jak2, the downstream signaling kinases of the
receptor complex, almost completely abrogated definitive erythropoiesis in the fetal liver,
with only mild effects on primitive erythropoiesis [21-23]. Aside from the different
sensitivities to cytokines, there are distinct differences in transcriptional regulation of
primitive and definitive hematopoiesis. Although there are mutations shown to alter both
primitive and definitive hematopoiesis such as SCL/Tal1, LMO2 and Flk1, disruption of
the transcription factors Myb, AML-1 (Runx1), CBFβ, cause severe abnormalities in
definitive hematopoiesis, leaving yolk sac (primitive) hematopoiesis phenotypically
normal [4].
Changing sites of hematopoiesis throughout ontogeny. An interesting phenomenon of
the hematopoietic system is how hematopoietic locations change throughout ontogeny.
The properties of the system emphasize how microenvironments are specialized for
particular functions, establishing the role of a particular cell, the potential of that cell, and
whether that potential will be reached. In vivo, hematopoietic cells develop de novo in
both an extra-embryonic (yolk sac) [24] and intra-embryonic locations (P-Sp/AGM
region) (Figure 1-3) [25, 26]. These “hemogenic” areas share similar features since both
are composed of splanchnopleura (mesoderm against an endoderm layer), with no
hematopoietic potential found in somatopleura (mesoderm against ectoderm) [16, 27, 28].
The interactions of the mesodermal and endodermal layer as well as factors secreted by
these tissues are important for the development of both hematopoietic and endothelial
cells [29]. Although these hemogenic sites offer the microenvironment necessary for the
7
formation of hematopoietic progenitors, only the yolk sac provides conditions supportive
of their development. The AGM environment, which develops from the para-aortic
splanchnopleura (P-Sp), is not optimal for their differentiation or expansion [4]. Once
circulation has been established (28-32 somite stage) and hematopoietic locations are no
longer isolated, cells will migrate to and colonize microenvironments specialized for
hematopoietic cell differentiation and expansion [3, 28]. This observation has added an
extra level of complexity to the debate in the field over the origins of stem cells
contributing to the overall workings of the adult hematopoietic system.
The extra-embryonic location for the production/development of hematopoietic
progenitor cells. The earliest blood cells emerge in the extra-embryonic mesoderm of
the avian and murine yolk sac (YS), and at analogous sites within the ventral blood island
(VBI) of Xenopus, or the neutral intermediate cell mass (ICM) associated with the tail in
bony fish [10]. In mice these blood islands form at mid/late primitive streak stage
(embryonic day 7.0, [E7.0]) [30], within 12 hrs of the start of mesoderm formation [1].
The blood islands start as a compact group of identical cells. External cells begin to
develop an endothelial morphology, while internal cells begin to lose their connections
and differentiate into primitive erythrocytes [16, 31]. These large, nucleated primitive
erythroid cells sustain the embryo until E12.5 when definitive enucleated cells enter
circulation from the fetal liver [31]. While primitive erythropoiesis constitutes essentially
all hematopoiesis in the early yolk sac (YS), small numbers of macrophage and
megakaryocyte progenitors and bi-potential (Ery and Mac at E7.5) can be found using in
vitro assays [32]. Before the onset of circulation high proliferative potential colony
8
forming-cells (HPP-CFC), a quiescent multipotential cell of the adult bone marrow, are
found exclusively in the YS (E9.0) [31]. The HPP-CFC is the earliest multipotential
precursor that can be cultured in vitro without stromal support, capable of giving rise to
secondary HPP-CFC and other multipotential or unilineage progenitor cells in replating
assays. However, YS progenitors have limited potential as we see no lymphoid
progenitors present until after circulation has been established (E11-12) [25, 26, 33].
The YS does have definitive potential, which is consistent with what is seen in the
amphibian where the VBI does contribute to some extent to definitive hematopoiesis
[34]. At E8.25 definitive hematopoietic progenitors (large BFU-E producing adult
globins), and by E8.5 multipotential precursors (macrophages and granulocytes) are
detectible by in vitro colony assays, although at this time only embryonic red cells are
produced in vivo [30, 31]. Around the establishment of circulation (E8.5-9), myeloid
and B lymphoid progenitors arise with colonies composed of erythroid cells,
macrophages, granulocytes, mast cells, and megakaryocytes, identified by E9. Short term
repopulating cells, CFU-S can be detected in this region by E9.5 [35, 36]. Although
harboring progenitor cells with definitive multi-lineage potential, the YS
microenvironment does not appear sufficient to fully support the expansion and
differentiation of erythroid progenitors [37]. Further, precursors in the yolk sac do not
display extensive self-renewal since they are progressively replaced by a new population
of progenitors from an intra-embryonic location [16]. Using chick-chick and chick-quail
chimeric models, a number of investigators have failed to observe yolk sac contributions
to adult myelopoiesis or lymphopoiesis [28, 38, 39].
The YS does not contain a hematopoietic stem cell population capable of
9
repopulating an irradiated adult until E11 when HSCs are already present in the blood
stream, AGM region, vitelline and umbilical arteries [33, 40-42]. Some have suggested
that this is due to the inability of the YS hematopoietic cells to home and engraft to the
adult microenvironment [28]. While others speculate it is due to the low level of MHI
class I on its surface, making it a prime target for destruction by NK cells [4]. Even
though no adult HSC is present in the YS prior to E11 the idea has emerged that there is
an “embryonic” hematopoietic stem cell present prior to this time. The embryonic stem
cells can be distinguished from the adult HSC by a slightly different surface expression
profile of Sca1lo, MAC1+, Kit+ and AA4.1antigen+ [2, 43, 44]. This embryonic HSC
has the potential to repopulate an adult, but it does not reach this potential until it has
been primed by an adequate microenvironment. Both the AGM stroma and the fetal liver
have been shown to induce the development of HSCs capable of repopulating adults.
AGM-S3 is a clonal endothelial cell line originally isolated from murine E10.5 AGM
region that can support primitive murine and human hematopoiesis in vitro. This line
provides factors that promote the generation of CFU-S (short-term repopulating) and
HSC (long-term repopulating) cells, and their ability to correctly home in an adult
environment. Prior to an established circulatory system, cells from E8-8.5 YS (and the P-
Sp which will become the AGM region, but at this stage has not generated true HSCs)
co-cultured on the AGM-S3 stromal line acquire long-term repopulating ability for
lethally irradiated adults [45]. The importance of the fetal liver environment for the
specification of definitive characteristics to embryonic cells has been demonstrated both
in vitro and in vivo. YS explants from 20-25 somite pairs (sp) reveal a transient wave of
erythroid cells that express embryonic and adult globins. Coculture with liver
10
primordium led to a subsequent wave of YS erythroid cells that express adult globins
[37]. Yoder et al. demonstrated that the full potential of the embryonic HSC (YS HSC) is
dependent on the age of the recipient of the cells. They took advantage of the fact that
the fetal liver of newborn mice continues as a hematopoietic organ for several weeks after
birth. Pregnant dams (at E18 of gestation) were given a subcutaneous busulfan injection,
causing pups to be born in a sublethally myeoablated state. Injection of these conditioned
pups with E8-9 YS cells leads to the engraftment and contribution of these cells to adult
hematopoiesis. Transplanted cells gave rise to all blood cell lineages long term (>11
months). Bone marrow from these primary YS recipients reconstituted B and T
lymphocytes, granulocytes, and erythrocyte lineages in secondary lethally irradiated adult
mice. Thus embryonic HSCs when injected into a fetal/newborn environment are able to
acquire the necessary characteristics to repopulate the adult hematopoietic environment,
an attribute that is missed when directly injected into adults [46, 47].
The intra-embryonic location for the production of hematopoietic progenitor cells.
Although embryonic HSC can be “primed” for the adult environment, the chimeric
models have shown that it was an intra-embryonic location that contributes to adult
hematopoiesis [35, 38, 48]. In amphibians it is the dorsal lateral plate (DLP) that
contributes to adult definitive hematopoiesis [34], as is seen the corresponding region of
the murine system [49]. This intra-embryonic hemogenic tissue initiates as the visceral
para-aorta splanchnopleura (P-Sp) which will go on to form the dorsal aorta, gonads and
mesonephros (AGM region) following organogenesis [49]. Hematopoietic precursors are
found in the P-Sp/AGM region from E8.0-13, peaking about E10.5-11 [4]. At about the
11
time definitive hematopoietic cells are present in YS, they are independently formed in
the P-Sp [1]. In vitro studies have demonstrated the presence of multipotent progenitors
(lymphoid and myeloid) in the P-Sp/AGM E8-10 embryos, which is the first time we see
progenitors with lymphoid potential [16, 49]. Prior to the establishment of the
circulatory system (which begins at the 8-10 somite pair stage: E8.5-9), multipotent
lymphomyeloid progenitors can be found in this region, although they are incapable of
reconstituting adult recipients [25, 26]. The P-Sp at this stage does appear to have
embryonic hematopoietic stem cell potential. Yoder and colleagues looked at
CD34+ckit+ cells from E9 YS and P-SP and found equivalent multilineage repopulating
ability into conditioned newborn recipient. Once circulation has been established, colony
forming cells capable of producing progeny of the erythroid, macrophage, granulocyte,
mast and megakaryocyte lineages were observed in the P-Sp/AGM region, as was the
case in the YS [50].
In addition to early embryonic HSC potential, it is in this intra-embryonic location
that “true” HSCs emerge which can be directly injected into lethally irradiated adult
recipients and contribute fully to adult hematopoiesis by re-establishing all blood lineages
in the long term [16, 25, 33, 35]. The development coincides with organogenesis which
leads to the formation of the AGM region (aorta gonad mesonephros region) from the
once P-Sp. At 37 somite pairs (E10.5-11.5), along the ventral wall of the dorsal aorta
(and other major vessels such as the vitelline and umbilical arteries) the first definitive
adult HSCs emerge as budding clusters from the endothelial wall [16, 33, 35, 40, 51].
Budding hematopoietic clusters from the ventral wall of the dorsal aorta is a phenomenon
seen not only in mammals, but also birds, zebrafish, and amphibian embryos [4]. The
12
underlying mesenchyme secretes factors such as BMP4, which is critical for this process
[52, 53]. The transcription factor AML1/Cbfa2/Runx1 is expressed in the AGM (in
definitive hematopoietic progenitor cells and in endothelial cells from which these
hematopoietic cells are thought to emerge) [54] at the time the first HSC develop and
influences the temporal and spatial appearance of adult repopulating HSCs [55]. In fact,
Runx1 is required for the switch between primitive and definitive hematopoiesis. Runx1
-/- mice initiate yolk sac hematopoiesis, but die at E11-12.5 with only primitive nucleated
erythroblasts in the liver rudiment and a block in the establishment of definitive
hematopoietic progenitors with an absence of definitive erythroid, myeloid and
megakaryocytic cells [7]. de Bruijn et al. (2002) used GFP expressed from Sca-1 to
demonstrate that the first HSCs are localized within the endothelial cell layer lining the
wall of the dorsal aorta [2]. Around this time the fetal liver begins colonization (28-32
somite stage; E10-10.5) [1]. By E12, both the YS and FL now possess cells with HSC
activity, which have most likely traveled there from the AGM region through the
circulation [4].
Migration of hematopoietic cells from microenvironments supporting their
production to those specialized for their expansion. Once circulation has been
established, progenitors can migrate from environments designed for the production of
hematopoietic cells, to those specialized for their differentiation and expansion. By E12,
primitive hematopoiesis has sharply declined, and the fetal liver is the primary site of
definitive hematopoiesis of the developing embryo [28, 56]. The fetal liver does not
possess any de novo hematopoietic potential. When E9.5 fetal liver tissue was engrafted
13
under the kidney capsule of an adult recipient, no hematopoietic elements were present,
even though the tissue survived. The introduction of hematopoietic cells into the
circulation of the FL tissue recipient resulted in the multi-lineage engraftment in the
implanted fetal tissue [57, 58]. The timing and origin of cells seeding the fetal liver is
controversial. The exact contribution of extra-embryonic (yolk sac) and intra-embryonic
(AGM) progenitors is not clear. Both have been shown to possess cells with definitive
hematopoietic activity in in vitro culture systems, but since circulation has been
established, pinpointing a cell’s origin is difficult. It is highly likely that cells from both
locations contribute to the overall pool of progenitors that home here. β1 and α4
integrins have been shown to be important for the homing of HSCs to the fetal liver
environment, while the CXCR4-SDF1 complex is required for the retention of cells in the
hematopoietic organ once migration has occurred [4]. The fetal liver microenvironment
supports the maturation of all lineages such as myeloid, mast, megakaryocytic and
lymphoid. In fact, it is fine tuned to support expansive erythropoiesis, as this is the
main requirement at this stage of development [56, 59].
Previous studies in humans have shown the unique ability of fetal burst forming
units (BFU-E) to expand in response to Epo alone, not requiring cytokines with burst
promoting activity (BPA) such as GM-CSF or IL-3 [60]. Kit ligand strongly synergized
with Epo to stimulate the growth of these BFU-E [61], and has been shown by others to
be essential for the function of CFU-E progenitors [62] . The critical role of Kit ligand or
its receptor in fetal liver erythropoiesis is evident by severe anemia associated with
mutations of the ligand or its receptor, affecting proliferation but not differentiation of
progenitor cells [63-65]. GM-CSF or IL-3 did not increase the clonogenicity of
14
embryonic and fetal BFU-E unless Epo concentrations are suboptimal. This phenomenon
is distinct from BM progenitors, where only a small subset respond to Epo alone,
requiring other BPA to generate BFU-E [61]. It has also been shown that fetal
progenitors have a greater proliferative capacity in culture than their adult counterparts
[66, 67] and that fetal liver CFU-E were at least 5 times more sensitive to Epo than BM
CFU-E [67].
Although the fetal liver is the central point of hematopoiesis for the rapidly
growing embryo, by E18 the embryo is reaching full gestation (20 days) and achieving
steady state homeostatic conditions. From the fetal liver, cells will migrate to the adult
hematopoietic centers of the spleen (beginning E12) and bone marrow (by E15-16) [4].
In contrast to humans where the bone marrow provides sufficient expansive capabilities,
mice utilize both the spleen and bone marrow compartments for blood cell production for
the life of the adult [68].
15
Introduction to Erythropoiesis
Erythropoiesis is the process of red blood cell development. The mature
erythrocyte is a small (8 µm diameter; 2 µm thickness) biconcave disk with a volume of
90 fL. It lacks a nucleus and mitochondria, with no ability to synthesize new proteins.
The role of the erythrocyte is highly specialized for oxygen transport and delivery using
the iron-containing molecule, hemoglobin. The average erythrocyte has a finite lifespan
of 120+/-20 days, with many trips through the microvasculature possible by its highly
resilient, 2 molecule thick membrane, consisting of tightly packed phospholipids. The
proper function and longevity of the erythrocyte is determined not only by the integrity of
its cell membrane, but also by its metabolism. Without a nucleus and mitochondria, the
cell has little ability to metabolize fatty acids or amino acids, and relies almost
exclusively on the break down of glucose for its energy requirements [69].
Historically, the progenitors of the erythroid lineage are defined by in vivo or in
vitro colony assays. The erythroid lineage is a branch of the myeloid lineage with the
earliest myeloid progenitor CFU-GEMM (colony forming unit-granulocyte, erythroid,
macrophage, and megakaryocyte) defined by in vitro colony assays or by an in vivo
colony assay for CFU-S (colony forming unit spleen) (refer to Figure 1-1). Currently,
these multipotential myeloid progenitors and their more lineage restricted progeny can be
enriched using cell surface markers. From both fetal liver and adult bone marrow,
multipotential common myeloid progenitors (CMP) can be isolated [IL7Rα-Lin-c-
Kit+Sca1-FcγRloCD34+], which give rise to either bi-potential megakaryocyte/erythrocyte
progenitors (MEP) [IL7Rα-Lin-c-Kit+Sca1-FcγRloCD34-] or granulocyte/macrophage
progenitors (GMP) [IL7Rα-Lin-c-Kit+Sca1-FcγRhiCD34+] as verified through in vitro
16
colony assays [70, 71]. The earliest cell committed to the erythroid lineage is known as
the Burst Forming Unit Erythroid, or BFU-E (Figure 1-4). When plated in
methylcellulose media with a high concentration of erythropoietin (2 U/ml) and a factor
with burst promoting activity such as IL-3 [72], these cells produce a large macroscopic
cluster of 4 or more colonies, composed of primarily erythroid cells after 7-10 days in
culture. BFU-E are not actively proliferating (most are in the G0/G1 phase of cell cycle)
[73], but this depends on the strain of mice [74, 75]. In vivo, their proliferation appears
to be controlled by conditioning factors derived from lymphocytes and macrophages,
including stem cell factor (SCF), inerleukin-3 (IL-3) and granulocyte-macrophage
colony-stimulating factor (GM-CSF) [69]. Analysis of mice with null mutations in either
GM-CSF or IL-3 receptor indicates that these factors are not crucial for erythropoiesis.
However, mice deficient in SCF or its receptor (Kit) suffer from severe anemia,
suggesting a requirement of these signaling components for erythropoiesis [62]. The
early BFU-E have few erythropoietin receptors (EpoR), and thus respond minimally to
erythropoietin. As these cells mature, larger numbers of EpoR are expressed and late
BFU-E become more Epo responsive. The BFU-E will differentiate into a late stage
erythroid progenitor termed colony forming unit-erythroid, or CFU-E. These cells are
also defined by an in vitro colony assay, with a single progenitor generating single, small
colonies (8 or more erythroblasts) after 2 days in culture [76]. CFU-E are actively
proliferating, and respond strongly to Epo to stimulate growth and prevent apoptosis [77]
obtained with as little as 0.03 U/mL Epo in culture, which is 50-100 times less than that
to detect the more primitive BFU-E [78]. CFU-E will go through a series of programmed
maturation and differentiation steps leading to mature erythrocytes [69].
17
Unlike the earlier progenitors, progeny of the CFU-E can be identified by their
morphology under a light microscope. Nucleated red cell precursors, or normoblasts, are
distinguished by their dense nuclear chromatin, lack of cytoplasmic granules, and later by
hemoglobin within the cell cytoplasm. The maturation of the normoblasts is divided into
three phases, early, intermediate and late, based on morphology of cells stained with
Wright’s stain. Along the erythroid developmental progression, there is a reduction in
cell size and mitochondria/RNA content as hemoglobin content increases until
enucleation, when cells are released into circulation. Early stage maturation cells
(pronormoblasts and basophilic normoblasts) are large (300-800fL), with nucleoli
generally not seen until the pronormoblast level. By the intermediate, polychromatic
stage, the nucleus is more compact and hemoglobin is present in the cytoplasm. In the
late maturation stage, eosinophilic or orthochromatic normoblasts have a dense, even
opaque nucleus, and pink cytoplasm from high hemoglobin content. Late stage
erythroblasts cease dividing and accumulate in the G0 phase. The nucleus will be
extruded, along with a degradation of organelle, to give a marrow reticulocyte, which is
still larger than a circulating mature erythrocyte and containing about two-thirds of its
eventual hemoglobin content. This cell gets its name because of the presence of residual
strands of RNA (reticulin). Under normal conditions, the cell is held in the marrow as the
remainder of hemoglobin synthesized and the cell gradually decreases its cell size, RNA
and mitochondria content. Finally, as the cell volume reaches that of a mature cell, it is
released into circulation (blood reticulocyte), with residual RNA for another 24 hrs
before becoming the mature erythrocyte. The total time for the development from the
CFU-E to mature erythrocyte takes about 7 days, but under anemic or hypoxic
18
conditions, this can be shortened to as little as 5-6 days from the early release of marrow
reticulocytes into circulation, reducing the intermitotic interval or by skipping a mitotic
division [69, 77].
Erythropoietin. The key humoral regulator of erythropoiesis is the 34kDa glycoprotein
Erythropoietin (Epo) [79]. The primary role of this member of the cytokine superfamily
which includes thrombopoietin (Tpo), granulocyte-specific colony stimulating factor (G-
CSF) and IL-7 [80], is to promote the survival of sensitive progenitors by preventing
apoptosis [77, 81, 82], and to some extent to promote the proliferation and differentiation
of precursors [6, 83]. When added alone to cultures of purified erythroid progenitors,
Epo prevents apoptosis but does little to support cell proliferation (no great increase in
progenitor numbers), or induce differentiation (measured by globin synthesis or
enucleation). It works in concert with other factors such as SCF, required for optimal
progenitor cycling but itself is a poor mediator of cell survival, and insulin-like growth
factor (IGF-1), which is required for optimal erythroid differentiation (determined by
globin synthesis and enucleation) [84]. Epo and Epo receptor (EpoR) knock-out mice die
at E13-15, due to severe anemia from a lack of differentiation of their mature erythroid
progenitors (CFU-E) [21, 23, 85]. The similarity in the knock-out models gives strong
supporting evidence that there is a single receptor for Epo, and a single ligand for the
EpoR [86].
Although the lack of Epo or its receptor is embryonically lethal, they are not
essential for the development of erythroid progenitor cells. Erythroid colony forming
cells, early BFU-E and CFU-E progenitors, can be found in fetal liver cultures of Epo or
19
EpoR -/- mice by including SCF or Tpo in the culture conditions [21, 23, 85]. Epo/EpoR
is crucial for the proliferation and survival of CFU-E and their terminal differentiation
[81, 84]. The period of Epo dependence is from just before the CFU-E stage through the
basophilic erythroblast stage with the beginning of hemoglobin synthesis [82]. This
window of Epo dependence is mirrored by the EpoR expression on erythroid progenitors,
from a low of 300 receptors/cell on late BFU-E to a high of 1100 receptors on CFU-E
and erythroblasts (refer to Figure 1-4). There are no Epo receptors on reticulocytes or
erythrocytes. EpoR has been shown to be expressed on megakaryocytes, endothelial
cells, heart, ovaries, placenta and brain, with a possible physiological role in cell survival
in these tissues as it been shown to be required for the survival of neuronal cells [87].
Within a population of erythroid progenitors, there exists heterogeneity with respect to
Epo sensitivities [84]. Cell divisions accompanying terminal differentiation are finely
controlled by cell cycle regulators, so when these progenitors are deprived of Epo, they
undergo apoptosis [73].
Regulation of erythropoietin. Developmental, tissue specific and environmental signals
all contribute to the precise regulation of Epo. Epo is expressed primarily by peritubular
interstitial cells in the cortex or the outer medulla of the kidney in adult mice, and also to
a lesser extent in the liver, particularly during fetal and neonatal development. Other
quantitatively less significant sites of production include brain, testis, lung, spleen,
placenta, bone marrow and ovary [79]. There are low basal levels of Epo in the serum,
with production greatly enhanced in response to hypoxia when more cells are recruited to
produce Epo, rather than individual cells increasing the amount of Epo they produce [88].
20
The peritubular interstitial cells of the kidney detect a decrease in available oxygen
caused by decreased hemoglobin, decreased oxygen content or the higher oxygen
affinity of hemoglobin, all related to tissue oxygenation which is a function of the
number of circulating erythrocytes [69]. Epo production can be elicited in laboratory
animals by inducing hypoxemia, lowering the circulating blood mass by bleeding or PHZ
injection, or divalent metals like cobalt that mimic ferrous (Fe+2) oxide [89]. Regulation
of Epo by hypoxia and other stimuli occur at the transcriptional level [79, 90], and
requires protein synthesis since the translational inhibitor cyclohexamide can block the
hypoxic induction. There is a 50-100 fold increase in Epo mRNA in the human
hepatoma cells line Hep3B under hypoxic conditions [91]. The magnitude of Epo mRNA
induction is proportional to the degree of anemia, with maximum levels reached 4-8
hours after the hypoxic stimuli. There are three non-coding stretches of the Epo gene that
are highly conserved between humans and mouse: the promoter, the first intron and a
120 base pair (bp) region just 3’ to the polyadenylation site [79]. It is this 3’ enhancer
element that is critical for the regulation of Epo by hypoxia (Figure 1-5A) [92-94]. The
hypoxically inducible function of the Epo enhancer is dependent on three defined
regions. Located most 5’ in the enhancer is a response element for HIF-1 (CACGTGCT;
the consensus sequence being TACGTGCT ), which is the primary element that mediates
the transcriptional response to hypoxia [94]. 3’ to the HIF element is a CACA site. No
proteins are known to bind to this site, but mutations in this region abrogate hypoxia
inducible activity of the enhancer [79]. Unless the enhancer element is placed directly
upstream of the promoter, it requires a third site for hypoxically induced transcription
[93]. This is the DR-2 site, a direct repeat of two steroid hormone receptor half sites
21
separated by 2 bp [92, 95]. The orphan nuclear receptor, HNF-4α has been shown to bind
specifically to this site [95]. This may contribute to the specificity of Epo gene
expression since HNF-4α has an expression profile limited to the renal cortex and liver,
as well as the intestine [79].
Binding of HIF-1 is the critical mediator of the hypoxic induction of Epo [79].
HIF-1 is a heterodimer composed of two subunits, both of which are basic helix-loop-
helix (bHLH) proteins in the PAS (PerAHR-ARNT-SIM) family of transcription factors
[96]. HIF-1β is the previously cloned aryl hydrocarbon receptor nuclear translocator
(ARNT) involved in the transcriptional regulation of genes in response to xenobiotics and
oxidant stress. It is expressed constitutively with mRNA and protein levels not
significantly affected by oxygen tension [79]. It is the HIF-1α subunit that confers the
hypoxic control to the heterodimer. HIF-1α is also expressed constitutively, but the
protein is rapidly degraded (half-life less than 5 minutes) under normoxic conditions [77,
97]. This subunit is only detectable in cells treated with hypoxia or stimuli that mimic
hypoxia (cobalt or iron chelators) [79]. Oxygen is an essential co-substrate for the Fe2-
dependent prolylhydroxylase that tags HIF-1α through proline hydroxylation on its
oxygen dependent degradation domain (ODD) for degradation by the ubiquitin-
proteasome pathway. Deletion of this domain leads to the stabilization of HIF-1α which
has constitutive DNA binding activity independent of oxygen tension [98]. Under
hypoxia, HIF-1α degradation is prevented, leading to its accumulation and the formation
of active HIF-1α-ARNT heterodimers [99]. A second hypoxia sensitive site on HIF-1α is
in its carboxyl-terminal transactivation domain (CAD). Under hypoxia, there is an
absence of arginine hydroxylation, so the transcriptional coactivators CBP and p300 can
22
associate with HIF-1α, and enhance the binding of HIF-1α to hypoxia responsive
elements on target genes [77]. CBP/p300 has been shown to interact with HNF-4 [100].
Thus it appears the 3’ enhancer element of the Epo gene provides a scaffold for the
trimeric complex composed of the hypoxia regulated HIF-1α, the constitutively expressed
HNF-4, and the general transcriptional activator p300 to assemble and regulate Epo
transcription [79].
Erythropoietin signaling. Primarily through mechanisms of apoptotic suppression, Epo
acts to increase erythrocyte numbers and combat hypoxia by stimulating the early release
of maturing normoblasts from the marrow, increasing the amount of hemoglobin
synthesized per erythrocyte and stimulating the expansion of late BFU-E and all CFU-E
into mature red cells [84]. EpoR is a single chain receptor, with a highly related tertiary
structure to other family members including growth hormone receptor, prolactin and Tpo
(Figure 1-5B) [80]. It contains no kinase or other enzyme motif in its cytoplasmic
domain. Epo binding induces a conformational change in EpoR leading to
dimerization/oligomerisation of Epo receptors [101]. This allows the
transphosphorylation and activation of the two receptor associated JAK2 molecules
(Janus family receptor tyrosine kinases), which appears to be the initiator of EpoR signal
transduction [81]. JAK2 subsequently phosphorylates some or all of the eight tyrosine
residues in the intracellular domain of EpoR [101]. These phosphorylated tyrosines act
as docking sites and attract other intracellular proteins to bind the EpoR via their src
homology 2 (SH2) domains, leading to further phosphorylation of these proteins. The
signaling cascades propagated include the signal transducers and activator of
23
transcription STAT5, phospholipid modifying enzymes (PI-3-kinase, PLC-γ, and SHIP),
regulators of Ras and MAP kinase signaling, tyrosine phosphatases (SHIP1 and SHIP2),
suppressors of cytokine signaling (CIS and SOCS3) and the Src family kinases [81].
The earliest detectible cellular action is the release of intracellular calcium ions, followed
in 1-2 hours by transcription of mRNA for several erythroid proteins, including the
globin chains [69]. An increase in Ca2+ influx is an early and necessary step in the
commitment to differentiation of murine erythroleukemia cells. The Ca2+ chelator EGTA
can inhibit Epo-induced murine erythroid colony growth. The increase in intracellular
Ca2+ may stimulate the expression the expression of proto-oncogenes or transcription
factor phosphorylation [101].
Following binding of Epo, the receptor:hormone complex is endocytosed into the
cell and degraded by the lysosome [102]. The amplitude and duration of EpoR signaling
is modulated by negative regulators. CIS1 (a member of the family cytokine-receptor
inhibitors) binds the Epo receptor to interfere with STAT5 binding to the receptor, and
may also accelerate the ubiquitination and degradation of activated EpoR. SOCS3, a
member of the family of suppressor of cytokine signaling, binds the kinase domain of
JAK-2, inhibiting its tyrosine kinase activity in vitro. SHP1 (SH2-containing protein
tyrosine phosphatase 1), dephosphorylates and inactivates JAK2 [81].
Epo signal transduction pathways have been shown to induce increased
expression and or activation of the anti-apoptotic Bcl2 family member Bcl-XL, along
with other transcription factors including GATA-1, NF-E2, SCL, NF-κb, EKLF and
24
AP-1. Proto-oncogenes which are subsequently activated include c-myc, c-myb, c-fos and c-jun [101].
Hemoglobin. All of the cellular processes of the erythrocyte are finely tuned to create a
cell whose primary function is oxygen delivery. Hemoglobin is the molecule within an
erythrocyte that is directly responsible for oxygen transport and the main intracellular
protein constitutes about 33% of its contents. A reduction in hemoglobin synthesis,
which could result from deficiencies in iron supply or an impairment of prophyrin or
globin production, results in a microcytic, hypochromic anemia [69]. Each hemoglobin
molecule consists of two alpha-type globin chains and two beta-type globin chains, each
containing a heme molecule that can bind oxygen. Mice, along with humans, use
different hemoglobin species throughout ontogeny, a process referred to as hemoglobin
switching. The regulation of this process is primarily transcriptional [103]. In humans
there is an embryonic to fetal globin switch coinciding with the transition from yolk sac
to fetal liver hematopoiesis, and a switch from fetal to adult globins occurring near the
perinatal period when hematopoiesis shifts to the bone marrow. Mice, like most species
have a single switch from embryonic to adult globins once hematopoiesis has shifted
from primitive in the yolk sac to definitive in the fetal liver [104, 105]. The murine
alpha-globin gene on Chr 11, consists of three genes (ζ, α1 and α2) that are dependent on
the major regulatory element (αMRE) which appears as an erythroid specific DNaseI-
hypersensitive site 26 kb upstream of the ζ gene (Figure 1-6A) [105]. The ζ globin chain
is restricted to the embryonic or primitive erythroid lineage, with only transcripts from
the α1 or α2 expressed beyond E12.5 as determined by S1 nuclease protection analysis
25
[106].
Both human and mouse beta-globin genes are regulated by a variety of
mechanisms including chromatin structure, promoter elements, cis and trans-regulatory
elements including enhancers, silencers and insulator elements and through the
interactions of transcription factors with these elements [103, 104, 107-113]. The murine
beta globin locus (Hbb) on Chr7 consists of four functional genes: the embryonic Hbb-y
and Hbb-bh1 and the adult Hbb-b1, and Hbb-b2 organized with the embryonic genes near
the 5’end and adult genes near the 3’ end of the locus (Figure 1-6B). Though not
contributing to functional globin proteins, the Hbb-bh0 gene is 3’ to Hbb-y and produces
minor embryonic mRNA, while the pseudogenes Hbb-bh2 and Hbb-bh3 lie downstream
of Hbb-bh1[114]. Inbred mouse strains possess one of three haplotypes at the β-globin
locus: Hbbd (diffuse), Hbbs (single) and Hbbp [115]. In strains of the diffuse type (Hbbd/
Hbbd) such as BALB/c, the two adult β chains βmaj and βmin, coded by the Hbb-b1 and
Hbb-b2 genes respectively, are made in unequal amounts and can be distinguished from
one another based on variations in their amino acid sequence (9 substitutions between
βdmin and βdmaj) [114, 116, 117]. Strains of the single haplotype (Hbbs/ Hbbs) such as
C57BL, contain two adult βglobin genes but make only one type of beta chain protein,
which is very similar to the βdmaj chain differing at just 3 amino acid positions [116,
117]. The Hbbp haplotype, such as in the AU/SsJ strain of mice, resembles Hbbd but
makes a variant βmin chain [117, 118].
A key cis-acting regulatory element of the beta globin gene is the Locus Control
Region (LCR). In mice it is comprised of six DNaseI hypersensitive sites (HS) located
from 5 to 28 kilobases upstream of the embryonic Hbb-y globin gene. The LCR is
26
crucial for the high-level expression of the individual beta globin genes [107] with
distance from the LCR a contributing factor for controlling both the level and the timing
of expression [107, 119] . The LCR functions by establishing an open chromatin
structure of the beta globin genes, along with direct interactions between LCR elements
and the specific gene promoters through DNA looping [108], although knock-out studies
have shown the endogenous β-globin locus does not require the LCR to establish and
maintain an open chromatin conformation for developmental regulation of expression
[120]. Erythroid Kruppel-like factor (EKLF) is the key transcription factor required
specifically for the transcription of only the adult-type β-globin genes and binds to the
CCACCC element in the promoters of the mouse (and human) adult-type β-globin genes,
stabilizing the interaction between the LCR and the β-globin genes [121].
Although remarkably similar, there are slight variations between the human β-
globin genes and those of rodents. Without an embryonic-to-fetal switch as seen in the
human system, the mouse has no quantitative homologue to fetal hemoglobin (HbF)
[104]. Although no quantitatively homologous murine fetal hemoglobin exists, one of
the adult beta globins, βmin, qualitatively resembles that of the human HbF [122]. βmin
is developmentally controlled with an upregulation during gestation to roughly 45% of
total β-like globin gene expression [107] corresponding to the period in human gestation
when there is an upregulation of HbF [123]. Similarly, the amount of βmin drops
following birth to comprise only 20% the total amount of beta globin produced in the
adult. This percentage changes in adult mice under stimulation of erythropoiesis such as
phlebotomy, exposure to hydroxyurea, or injection of erythropoietin, with an increase in
βmin relative to βmaj [107]. There is interest in understanding how the HbF, and thus the
27
ßmin globin, is regulated for devising new treatments for diseases such as sickle cell
anemia and β-thalassemia. Patients with elevated levels of HbF show milder forms of
these diseases [104, 124]. The current methods to artificially raise HbF levels are toxic,
so further understanding of the system may lead to alternative therapeutic targets and
better treatment options for patients.
28
Steady State vs. Expansive Erythropoiesis
Steady-state erythropoiesis maintains circulating levels of erythrocytes that have
reached their finite life span. It relies on local sources of Epo and other factors to
replenish the pool of healthy erythrocytes. Steady state erythropoiesis occurs at a
constant rate, within the bone marrow microenvironment. Distinct from steady state is
stress or expansive erythropoiesis. Microenvironments supportive of expansive
erythropoiesis include the fetal liver and adult spleen, and to some extent the adult liver.
It relies on high levels of Epo and other factors, leading to the rapid production of
erythrocytes.
Hypoxia is the major stimulus to induce stress erythropoiesis and could be defined
in terms of hypoxemia, anemia, or increased hemoglobin-oxygen affinity at sea level
[89]. Erythropoietic expansion to extramedullary sites is noticed in response to
hypobaric hypoxia. In fact, the spleen appears to be the optimal microenvironment in
mice for erythroid production and maturation following hypoxia, whether from hypobaric
hypoxia, bleeding or hemolytic anemia [68, 125-128]. It is an accepted principle that
reduced oxygen supply or increased oxygen demand is accompanied by increased plasma
Epo (pEpo) titers. In the laboratory, Epo production can be induced by hypoxemia,
lowering circulating red cell mass by bleeding or phenylhydrazine injections, or cobalt
administration [89].
Once a hypoxic state is sensed in the body, expansive erythropoiesis is engaged,
yet the mechanisms of this process are only beginning to be understood. The erythroid
progenitors themselves are altered in response to hypoxia. Rich et al. (1982)
demonstrated that culturing bone marrow and fetal liver BFU-E or CFU-E in 5% oxygen
29
(5% oxygen, 5% carbon dioxide, 90% nitrogen) resulted in an increase in colony number
and an increase in Epo sensitivity compared to cells grown in air (air supplemented with
5% carbon dioxide) [129]. Following hypoxia, hematopoiesis shifts to secondary
hematopoietic organs. Work has shown that after severe phlebotomy, the contribution of
the spleen to erythropoiesis increased from 10% in normal mice to over 40% in
phlebotomized mice [130]. Early experiments by Hara and Ogawa attributed the increase
in splenic contribution to the migration of cells from the bone marrow. They followed
erythropoietic precursors in the bone marrow, blood and spleen in adult mice with
phenylhydrazine (PHZ) induced acute anemia following a 3 day injection regime (60
mg/Kg injected on Day 0, 1, and 3). They saw an increase of CFU-E in the bone marrow
until Day 4 with the number of BFU-E declining until Day 10. Both CFU-E and BFU-E
increased until Day 4 in the spleen, and then declined to pretreatment levels. Only BFU-
E were recognized in murine blood, with the maximal increase of blood BFU-E on Day
2, two days prior to the peak in the spleen. To determine whether erythropoietic
stimulation resulted in changes of the progenitor’s proliferation state, they looked at the
proportion of precursors in the DNA synthesis phase. Cells in DNA synthesis phase
incorporate 3HTdR while their proliferative potential is destroyed by it. Using
methylcellulose clonal cell culture technique they looked at erythropoietic precursors in
the femur, spleen and blood of mice made anemic by bleeding, stimulated with Epo
injections or erythropoietically suppressed by the hypertransfusion with packed red blood
cells (polycythemia). Neither anemia nor polycythemia caused changes in the
proliferative stage of the precursors. This suggested to them that the changes in the
number of BFU-E seen in the spleen represent the migration of these early erythroid
30
progenitors from their storage in the BM to the spleen for expansion and maturation,
rather than BFU-E proliferation [76]. However, work in our lab contradicts this model.
Our analysis shows that BMP4/Madh5 dependent signals, regulated by hypoxia, initiate
the differentiation and expansion of erythroid progenitors resident in the spleen. These
findings suggest a new model where stress erythroid progenitors, resident in the spleen
are poised to expand following an acute anemia [131].
Brandan et al. (1997) determined that the erythroid response to hypoxia was a
function of microenvironmental regulation rather than simple hormonal variance. Mice
were submitted to hypobaric hypoxia (HH) over an 18 day period. Plasma Epo titers rise
shortly after hypoxic exposure in both rodents and humans, but fall within 1-2 days
reaching normal yet above baseline levels after 3-4 days of sustained hypoxia. Cells
from bone marrow and spleen were evaluated over the time course for their proliferative
response to recombinant human erythropoietin (rHuEpo) analyzed by thymidine
incorporation assays as well as total nuclear cell counts and erythropoietic maturation
determined by 59Fe uptake. Bone marrow showed a very gradual yet sustained
proliferative response, with only a slight increase under stress which remained elevated
over the duration of the treatment. Spleen in contrast had a burst of maximal proliferative
response on day 6 of HH (26 fold increase), which returned to near control values after
day 10. Total nuclear cell counts increased in bone marrow and spleen, 1.5 and 5 times
respectively. While bone marrow total erythroid cell counts increased slightly and
remained elevated over the hypoxic period, splenic red cells rose abruptly to 30 times
over control on day 6 and fell sharply to near control levels by day 12. Splenic
contribution was approximately 60% of total production between days 6-8, with bone
31
marrow making the major contribution (90%) by the end of the assay. The adaptive
response to hypoxia of erythroid cells exposed to the bone marrow or spleen
microenvironments is clearly different even with identical endogenous serum Epo titers
[125].
Aside from Epo, other factors are important for proper stress erythropoiesis.
There is a requirement for glucocorticoids, stem cell factor (SCF) and its receptor Kit,
(and Epo) for the in vitro expansion of immature erythroblasts to induce long-term
proliferation accompanied by differentiation arrest, with demonstrated roles for these
factors in stress erythropoiesis [126, 132-136]. It is known that stem cell factor (SCF)
and its receptor ckit are required for normal hematopoiesis in adult mouse. Mice with
mutations at the Steel locus (Sl) or dominant-white spotting (W) locus, encoding SCF and
the Kit receptor respectively [137-140], have a phenotype consisting of a macrocytic
anemia, decreased numbers of tissue mast cells and abnormalities in spermatocytes and
melanocytes [141]. In addition to these characteristics, the functional interaction of SCF
with Kit is also required for acute erythroid expansion following a hemolytic anemia.
Genetically anemic W/Wv mice, have defects in their recovery to a phenylhydrazine
induced acute anemia, with a delay in their splenic contribution (from the normal day2
until day 7 to 9) [136]. Mice treated with the monoclonal antibody ACK2, which
specifically recognizes the Kit receptor and blocks the hematopoietic growth-promoting
effects of SCF, had reduced femoral CFU-E, BFU-E and CFU-GM following a PHZ-
induced acute anemia, in fact less than half that found in phenylhydrazine treated
controls. Splenic hematopoiesis following an acute anemia was totally ablated in ACK2
antibody treated mice, which is in sharp contrast to control mice which saw a 25-50 fold
32
increase in CFU-E and 6 to 10 fold increase in BFU-E or CFU-GM in the spleen.
Transplantation experiments using donor cells from phenylhydrazine injected mice
treated with ACK2 or untreated control showed a 75% decrease in the fraction of donor
derived BFU-E and CFU-GM in the bone marrow and spleen of recipient mice
transplanted with ACK2 exposed progenitors. This would suggest that a significant role
for the SCF/Kit interaction in stress erythropoiesis in the spleen is in the homing behavior
of hematopoietic progenitor cells mobilized following an acute anemia [126].
Glucocorticoids are released predominantly during stress to maintain homeostasis
[135, 142, 143]. In vitro, glucocorticoids have been shown to stimulate erythropoiesis
by enhancing the formation of murine erythroid colonies [144] and increasing the
proliferation of erythroid cells [145]. Bauer et al. (1999) has shown the requirement for
the glucocorticoid receptor (GR) for the expansion of immature erythroid cells during
stress erythropoiesis for the activation of erythroid progenitors. GRnull/null mice die at
birth, so they generated GRdim/dim mice which carry a targeted mutation in the
dimerization domain of the GR making it defective for cooperative DNA binding and
consequent transactivation of genes with glucocorticoid responsive elements (GREs), but
still able to transrepress. GRdim/dim mice have impaired regulation of GRE-dependent
genes but survive to adulthood. Erythroid cells from the fetal livers of GRnull/null and
GRdim/dim mice fail to undergo sustained proliferation in vitro like wild-type cells.
Furthermore, unlike wild-type mice which show nearly an eight-fold increase in the
numbers of CFU-E in their spleen following hemolytic anemia, GRdim/dim adult mice have
no increase in their number of CFU-E. Under the erythropoietic stress of sustained
hypoxia, GRdim/dim adult mice show a lack of rapid adaptation as determined by no
33
observed increase in red blood cell counts, hemoglobin production, percent hematocrit, or
number of CFU-E from the spleen after being subjected to hypoxia (11% O2) for 2 Days.
The erythroid compartment of spleen cells responsible for GR-expansion following an
erythropoietic stress was restricted to the population displaying the unique combination
of early hematopoietic (CD34+ckit+) and the late state erythroid marker Ter119+ surface
antigens [135].
The involvement of a Ter119+ positive cell population in the spleen of
phenylhydrazine treated mice has been explored by others. Vannucchi et al (2000)
describe a bipotent (erythroid and megakaryocytic) early precursor cell which expresses
the erythroid Ter119 and megakaryocyte 4A5 surface markers. The Ter119+/4A5
population increased in both the bone marrow (from 1.3 to 3.8-4.7%) and spleens (from
<0.001 to 1.3-8.3%) of mice during recovery from a PHZ-induced acute anemia. This
population did not contain progenitor cells (CFU-E) and consisted of cells with the
morphology of blasts. PHZ-treated spleens expressed high levels of both erythroid (β-
globin and EpoR) and megakaryocytic (GpIIb, AchE and Mpl) genes. Due to the fact
that almost all (approx. 90%) of the colonies deriving from BFU-E and CFU-Mk (but
none of the colonies from CFU-GM and CFU-E) contained cells expressing erythroid and
megakaryocytic genes, and at least single erythroid BFU-E colonies transferred to
secondary TPO containing cultures that gave rise to cells with megakaryocyte
morphology, they concluded that normal BFU-E and most likely CFU-Mk are bipotent
for Erythroid/Megakaryocytic differentiation. This would concur with other
investigations which [146] would suggest that the E/Mk precursor is downstream to the
BFU-E level [147]. It makes physiological sense to maintain a population of cells
34
capable of both erythroid and megakaryocytic differentiation to respond to erythropoietic
stress as it is often brought on by massive blood loss due to a ruptured vessel.
35
Microenvironments/Stroma Supporting Hematopoiesis
Hematopoietic stem cells and their progenitor cells can proliferate and
differentiate in the microenvironments of the fetal liver, adult bone marrow, spleen and to
a certain extent the adult liver [148]. Although dispensable in vitro, in vivo the
macrophage have been considered to be a critical element of erythroid differentiation,
seen in the center of erythroblastic islands in the bone marrow and spleen making cell-to-
cell contact with the erythroblasts via very late antigen (VLA-4/vascular cell adhesion
molecule VCAM-1 interactions [130].
In fact, by selectively abrogating stromal macrophages from the splenic red pulp
with dichloromethylene diphosphonate encapsulated in multilamellar liposomes
(CL2MDP-liposome) in erythropoietically challenged mice, erythropoiesis was
suppressed at the level of CFU-E until 5 days after treatment when macrophages began to
appear in the red pulp [130]. However, it has not been demonstrated that macrophages
or macrophage cell lines support erythropoiesis in vitro. There are other components of
the microenvironments essential for supporting hematopoiesis and directing
differentiation. Stromal regulation of hematopoiesis has been proposed to occur by cell-
cell contact, extracellular matrices or through the secretion of hematopoietic growth
factors [149]. There is variation among hematopoiesis supporting microenvironments in
the types of cells comprising their stroma and the types of factors secreted by resident
cells, leading to varied affects on intrinsically distinct embryonic vs. adult precursors
from stroma stimuli through ontogeny [150].
Due to differences in the cellular composition of the hematopoietic organs, there
are differences in the type of hematopoiesis they are most suited to support. In the adult
36
mouse, the bone marrow is the major hematopoietic organ where stem cells and their
progenitors develop and where myelopoiesis dominates [150]. In myeloid progenitor
CFU-S assay, granulocyte colonies predominate in the bone marrow, with other CFU-S
progeny preferentially expanded at other hematopoietic locations [59, 151].
Interestingly, when stem cells are injected into animals whose spleens contain plugs of
bone marrow, colonies in spleen were predominantly erythroid, while those forming in
the bone marrow plugs were predominantly granulocytic [151]. The heterogeneous
mixture of adherent cells making up the hematopoietic inductive environment (HIM) of
the bone marrow (supporting the self-renewal and commitment of hematopoietic stem
cells) contains a mixture of macrophages, fibroblast, endothelial cells, and preadipocytes
[150]. In fact, long-term maintenance of stem cell growth and differentiation in vitro is
dependent on these bone marrow derived adherent cells [152].
The spleen and fetal liver have been established as sites of hematopoiesis where
erythropoiesis prevails. In a CFU-S assay, erythroid colonies predominate in the spleen,
with erythroid spleen colonies found throughout the red pulp and granulocyte colonies
distributed in the white pulp [150]. The fetal liver is the main site of hematopoiesis of the
developing embryo, with a phase of rapid expansion of erythropoietic cell population
during 12 to 16 days of gestation. Stromal cell lines from both spleen and fetal liver have
been established demonstrating the erythropoietic inductive environment (EIM) created
in these organs. The MSS31 cell line from mouse newborn spleens selectively supports
the expansion, proliferation and differentiation of erythropoietic progenitor cells from
mouse fetal liver in a semisolid medium with the addition of Epo. After the addition of
fetal liver cells, erythroid progenitors adhered to the MSS31 cells, eventually maturing to
37
hemoglobin producing cells that would detach and enucleate. This cell line exhibited
properties of endothelial cells having the ability to take up acetylated low-density
lipoprotein (Ac-LD) and form a capillary like structure in collagen matrices [151]. A
total of 5 lines were established from newborn spleens, which could support the
formation of large erythroid colonies from either mouse fetal liver cells or adult bone
marrow cells in the presence of Epo. They detected a new type of large colony composed
of up to 1000 benzidine-positive cells supported specifically on these spleen stromal
lines. This type of colony developing 4 to 6 days in culture was larger than a typical
CFU-E. It was also distinct from a typical BFU-E in its lower Epo dependency,
benzidine-staining, colony size, and timing of appearance [149]. Other cells lines known
to support hematopoietic stem cells such as the bone marrow derived preadipocyte-like
line PA6 and the mouse fibroblast cell line BALB3T3, do not posses the ability to
support the unique large erythroid colonies seen on the MSS cell lines [151]. Cell-to-cell
contact allowing short-range communication between the erythroid progenitor cells and
the MSS cells was required in that conditioned medium of MSS31 cells did not show any
effects on colony formation [149].
Mouse stromal lines established from E13 fetal livers have been established and
also shown to support the proliferation and differentiation of erythroid progenitors in a
semisolid medium in the presence of Epo [59]. Similar to that seen on the spleen stromal
lines, erythroid progenitors from mouse bone marrow of fetal liver were supported on
fetal liver stromal lines (FLS) in a semisolid medium in the presence of Epo after 4 days
in culture. The large colony forming cells from the adult bone marrow and fetal liver
require the same optimum Epo concentration (as low as 0.05 U/mL) enough for CFU-E,
38
but not for BFU-E. These cells could not be separated from CFU-E in a density gradient,
which can fractionate BFU-E from CFU-E. Thus, the progenitors forming these large
colonies may be at a stage closer to CFU-E than BFU-E, with unique properties that
distinguish them even from the CFU-E. When in close contact with the FLS, erythroid
progenitors can divide rapidly (average generation time of 9.6 hours) with erythroid cells
producing hemoglobins capable of dividing more than 10 times on the FLS layer, which
can help explain the expansive erythropoiesis seen in the fetal liver during development
[59, 150].
Unlike the MSS cell lines with endothelial biology and morphology [151], the
FLS lines were reported to appear more epithelial-like [59]. Chargraoui et al. (2003) has
shown that the fetal liver contains a unique population of cells with endodermal and
mesodermal features and it is this cell population that comprises the hematopoietic
supportive environment. These cells in epithelial-to-mesenchymal transition (EMT) lines
express both mesenchymal and epithelial markers, with EMT cells seen transiently in the
fetal liver during its hematopoietic phase in gestation. As hepatocytes matured and the
hematopoietic capacity of the fetal liver gradually lost, EMTs began to decline, being
absent at the end of gestation and in the adult. By late gestation (E18) two populations
are apparent: epithelial cells which resemble mature hepatocytes and express CK-8, and a
smaller contribution of ASMA-positive mesenchymal cells similar to hepatic Ito
cells/microfibroblasts. The down-regulation of EMT and up-regulation of hepatocyte
differentiation in the fetal liver stromal cell line AFT024 is the direct affect of oncostatin
M (OSM). OSM-induced modifications in the fetal liver stromal cell phenotype are
associated with a decrease in hematopoietic supportive ability, with no effect of OSM on
39
the bone marrow stromal line MS-5. OSM is expressed by CD45+ hematopoietic cells in
the fetal liver. During ontogeny, the CD45+ hematopoietic cells from the YS and AGM
migrate to the liver rudiment, finding a suitable environment of EMT cells. These cells
expand and differentiate leading to an increase in the amount of OSM, reaching levels
that would induce hepatocyte maturation of EMT cells. As hepatocyte maturation
proceeds and the EMT population decreasing, the liver eventually loses its ability to
support hematopoiesis [153].
In both cases, the EIM created by the MSS or FLS required cell-cell contact
and/or short-range communication between the erythroid progenitor cells and the stromal
layer for large erythroid colonies to form. These large colonies did not form when
progenitors were separated from the stromal layer by a diffusion chamber or a nucleopore
filter [59, 149]. Adhesion molecules and/or cell surface markers are a likely component
essential to the EIM environment. Development of erythroid cells on FLS is inhibited by
antibodies to very late activation antigen 4 (VLA-4 integrin) which is expressed on
erythroid cells [150]. All hematopoietic cells in the fetal liver express VLA-4, yet in
utero treatment of mice with an anti-VLA-4 monoclonal antibody specifically induced
anemia [154]. The stromal membrane associated protein-1 (SMAP-1) localizes to the red
pulp of the spleen where erythropoiesis dominates and expression during development
correlates with erythropoietic activity in the fetal liver. Antisense cDNA transfected into
MSS62 reduced expression of SMAP-1 and suppressed the large erythroid colony
formation, indicating the requirement of SMAP-1 in the EIM [150]. Mutations of the
receptor tyrosine kinase Kit coded by the murine dominant-white spotting locus (W) or
its ligand stem cell factor (SCF) [137, 138, 140] lead to deficiencies of germ cells,
40
melanocytes, and hematopoiesis, including the erythroid lineage [141]. Not only is the
functional interaction between the EpoR and Kit for erythroid colony formation,
antibodies against Kit in the fetal liver stromal inhibited the proliferation of progenitor
cells [155].
Optimal erythropoietic expansion is not solely based on the EIM
microenvironment. Cell intrinsic qualities exist that prepare a progenitor to take full
advantage of an inductive environment. Such is the case with the unique partnership
created by the fetal liver progenitor cells and the microenvironment of the fetal liver
leading to the expansive erythropoiesis seen at this time. While both bone marrow and
fetal liver stromas effectively maintain CFU-GM, the stimulatory effect of the fetal liver
microenvironment in the long term maintenance of erythroid progenitors in culture is
specific for fetal BFU-E. Fetal liver stroma efficiently supports fetal BFU-E for 6-7
weeks in vitro, whereas bone marrow stroma was not able to maintain fetal BFU-E
beyond 4 weeks. When bone marrow cells were cultured on a fetal liver stromal layer,
the number of adult BFU-E declined precipitously [156]. The fact that there are
differences in the responsiveness of bone marrow or fetal erythroid precursors to the
same stromal cells suggests cell intrinsic differences between progenitors to a particular
environment.
41
The flexed-tail (f) Mouse Mutant as a Means to Study Expansive Erythropoiesis
flexed-tail (f) is an autosomal recessive mouse mutation that arose spontaneously
and was initially identified in 1928 [157]. The hallmark features of this mutation are
defects in expansive erythropoiesis, a kinked tail which is caused by vertebral fusion, and
ventral white spotting caused by failure of melanoblasts to migrate from the neural crest
[158]. The latter two characteristics are not penetrant on all backgrounds. The primary
characteristics of this phenotype are apparent both during embryogenesis and in the adult
during the recovery from an acute anemia. In both cases the tissues of the animal are
under hypoxic stress.
The embryonic defects of flexed-tail (f/f) mice. The embryos show a transient yet
severe microcytic, hypochromic anemia that remits by two weeks after birth, with the
majority of fetal reticulocytes containing non-heme iron granules, which are referred to
as siderocytes [159, 160]. The number of red cells/mL in the blood of flexed-tail
embryos is approximately 80% that of normal mice, with these cells containing roughly
60-70% of the normal amount of hemoglobin, thus newborn mice contain about half the
normal amount of hemoglobin[161]. The characteristic siderocytes in f/f reticulocytes are
localized in the mitochondria which is similar to that seen in human sideroblastic anemia
[162].
Prior to E12 in the developing mouse, primitive erythroid cells are found in
circulation which originate from the blood islands of the yolk sac and are characterized
by large, nucleated cells, containing embryonic hemoglobins. Primitive erythropoiesis
42
has not been fully characterized in the f/f mutants. Although their anemia is apparent by
E12 (lower red cell count, smaller body weight), this distinction breaks down at earlier
embryonic stages, with primitive erythrocytes being fully hemoglobinized [160]. The
severe f embryonic anemia is manifested at the shift between primitive and definitive
hematopoiesis. The locus affects not only the proliferation/differentiation of definitive
erythroid progenitors limiting the production and release of erythrocytes, but also the
maturation of the terminally differentiated cells leading to defective hemoglobin
synthesis and siderocytes in fetal reticulocytes [160, 161, 163]. Previous analysis had
focused on the affect of f/f on fetal liver erythropoiesis; however we have seen
differences between f/f and control littermates as early as the emergence of definitive
hematopoietic progenitors in the aorta-gonad-mesonephros (AGM) region (E10.5). f/+
control littermates have hematopoietic clusters budding from the ventral wall of the
dorsal aorta at E10.5, which are thought to be driven by signals from the surrounding
mesenchymal tissue [4]. This situation is similar to that seen in human embryos at a
corresponding stage of development [52]. These clusters are missing from the wall of the
f/f dorsal aorta at E10.5 and are not seen until E11.5. In addition, f/f embryos exhibit a
less dense mesenchymal layer which may affect the development of hematopoietic
clusters (see Appendix A; Figure A-4). Primitive erythropoiesis is completely replaced
by E12 as definitive hematopoietic progenitor cells from this intra-embryonic source
along with cells from extra-embryonic sources, such as the yolk sac, migrate to and
establish the fetal liver as the primary hematopoietic organ of the embryo. The primitive
to definitive progression is delayed in f/f mutants, in that fully hemoglobinized primitive
cells (nucleated erythroblasts) persist into E16, possibly to compensate for the deficiency
43
of fully hemoglobinized definitive erythroblasts in circulation [160].
The anemia of the f/f mutant is especially pronounced between E13-16 [158],
which coincides with when the fetal liver is the primary hematopoietic organ of the
embryo. The f/f fetal liver is smaller in size and contains decreased numbers of erythroid
progenitors and identifiable erythroblasts [163-165]. Although the rate of increase in the
number of erythrocytes is as great in the f/f anemic fetuses compared to +/+, the defect
present in the fetal liver as early as E12 is retained with the same relative deficiency
through E16, suggesting the defect is in an erythroid progenitor migrating to or
proliferating in the fetal liver [158]. An early multi-potential myeloid progenitor capable
of committing to the erythroid lineage is the spleen colony forming unit or CFU-S. These
cells when injected into heavily irradiated recipients form macroscopic spleen colonies 9-
12 days after injection. There is no significant reduction in the ratio of CFU-S in the f/f
fetal livers, however the absolute number per liver is reduced (E12-15) [163, 164].
CFU-S consist primarily of erythroid cells. The CFU-S from f/f fetal livers produce
smaller colonies that are deficient in the erythroid cells as determined through
histological examination and the incorporation of 59Fe [163]. These results suggest that
erythroid differentiation in CFU-S is severely compromised.
Bateman et al. (1972) looked at the differentiation capacity of the colony forming
units (cfu) by measuring incorporation of 59Fe into the peripheral blood of recipients
transplanted with f/f fetal liver cells. He suggested the reduced number of recognizable
erythroblasts of f/f embryos is due to the low rate of proliferation of cfu and not a
reduction in the number of erythroblasts produced per cfu. More mature erythroid
committed progenitors are also affected by the f locus [163]. Both the absolute numbers
44
and proportions of CFU-E in f/f fetal livers rise more slowly, with peak values reaching
only 50% that of normal CFU-E while also persisting longer in the fetal liver (Figure 1-7)
[164]. The number of CFU-E present in vivo has been shown to be regulated by
erythropoietin (Epo) [76, 166]. Control and f/f CFU-E have equivalent sensitivities to
Epo in in vitro colony assays [164]. Near the end of gestation (E18), reticulocytes which
still make up the majority of red blood cells of control animals (70%), are elevated in f/f
mutants (98%), as the hematopoietic system is still trying to control the fetal anemia
[162].
The effects of the f locus on fetal hemoglobin synthesis are just as severe as the
defects seen in the proliferation and differentiation of erythroid progenitors. As Cole et
al. suggests, the hemoglobin deficiencies may arise from the complex interaction between
disturbed proliferation of precursor cells and disturbed hemoglobin synthesis in
terminally differentiated cells [161]. Although comparable numbers of hemoglobin
deficient and siderocyte containing cells can be found between normal and flexed
littermates at the transition between primitive and definitive erythropoiesis at E12,
normal mice rapidly proceed by E14 to the production of fully hemoglobinized cells with
little or no siderocytic material (Figure 1-8). In sharp contrast, the hemoglobin
deficiency and persistence of siderocytes are prominent features of f/f mutant during
development [159, 160, 162]. Throughout gestation, the majority of fetal reticulocytes,
upwards of 90%, contain siderocytes. Ultra structure studies reveal they are localized
within the mitochondria which is similar to human sideroblastic anemia [162]. This
elevated percentage of cells containing siderocytes does not drop appreciably until birth,
with levels finally stabilized at roughly 3% within three weeks [167]. During
45
development, the cells without siderocytes are just as hemoglobin deficient as those with
siderocytes [160]. This suggests the hemoglobin deficiency of flexed-tail mutants is not
completely tied to inefficiently utilizing iron, in that cells capable of maintaining
appropriate intracellular iron pools are still unable to synthesize enough hemoglobin.
Hemoglobin synthesis is a highly regulated process where the production of heme
is coordinated with the synthesis of α and β globin chains. f/f fetal reticulocytes have a
50% deficiency in beta globin chain synthesis which leads to an imbalance in α:β chain
ratio [162]. The deficiency in beta chain synthesis could be rescued by the addition of
heme, but not its precursor protoporphyrin (refer to Figure 1-9). This observation
suggests that there might be a defect in the conversion of protoporphyrin IX to the iron
containing molecule, heme, by heme synthetase. Iron uptake into f/f fetal reticulocytes is
normal while the utilization of absorbed iron for heme synthesis is reduced to less than
half the normal levels, with a similar reduction in the pool of iron available for heme
synthesis. The activity of heme synthetase in f/f reticulocyte homogenates (E17-18) was
similar to controls in vitro, when provided the precursor protoporphyrin, which had little
effect on the activity of normal reticulocyte homogenate. The activity of this enzyme
was actually elevated on a per liver and wet-weight basis when they compared fetal liver
homogenates between wild type and f/f mice at times the livers are composed of
comparable proportions of erythroid and non-erythroid cells and similar distributions of
erythroid types (f/+ E15; f/f E16) [161]. More importantly, addition of protoporphyrin
caused only a slight reduction in iron incorporation into heme from both genotypes,
indicating that it is unlikely heme synthetase activity in f/f fetal livers is restricted by
shortage of the precursor [168].
46
Heme is part of an end product inhibition loop that can inhibit or repress
upstream heme biosynthetic enzymes such as ALA synthetase, so that heme and globin
synthesis remain coordinated [161]. The inhibition would be propagated through the
pathway, with decreased activity of one enzyme leading to decreased activity of
subsequent downstream enzymes. Coleman et al. (1969) looked at the activity of delta-
aminolevulinate dehydratase (ALD) which follows ALA synthetase in the heme
biosynthetic pathway. ALD converts delta-aminolevulinic acid to the heme precursor
porphobilinogen. Peak activity of ALD in fetal livers from control animals expressed as
activity/g of liver occurred on E14-15, and coincided with the probable period of
maximum heme biosynthesis. Mutation of the f gene had no effect on this profile. There
was concern that since ALD is expressed in the adult liver, which is not normally an
erythropoietic organ, non-hematopoietic levels of this enzymes could be obscuring any
possible changes in the activity seen in +/+ and f/f fetal livers. Therefore they evaluated
the activity of uroporphyrinogen synthetase, an enzyme more specific to hematopoietic
tissue and not found in appreciable quantities in the adult liver. No deficiency of
uroporphyrinogen synthetase was detectible in f/f fetal livers at E14-15, with only
moderate deficiency on E13. It should be noted that liver weight of flexed fetuses is only
50-60% that of normal fetuses, so the actual enzyme activity per liver is decreased in
flexed mice even through the amount per gram is normal [165].
While certain enzyme components of the heme biosynthetic pathway show
normal activity in f/f embryos, questions remain as to the cause of the hemoglobin
deficiencies and widespread siderocytes. While other groups concluded the major cause
of the anemia of f/f neonates to be decreased heme synthesis resulting from reduced
47
formation of protoporphyrin or its precursors and aberrant regulation of globin chain
synthesis at the level of translation [161], Chui et al.(1977) suggest another possibility.
They attribute the excessive intracellular iron pools, and thus the siderocytes, to a defect
in the coordination regulation of hemoglobin components and a decreased utilization of
heme, rather than a problem in the heme biosynthetic pathway. Key to his argument is
the decreased production of globin chains with equivalent levels of free erythrocyte
protoporphyrin between control and f/f mice at E18 (Figure 1-10). By radiolabeling
newly synthesized globin chains and separating products by column chromatography,
they showed that f/f mutant reticulocytes exhibit a decrease in β-globin chain synthesis.
Fluorescence measurements from E18 +/+ or f/f fetal erythrocytes showed similar levels
of free protoporphyrin. Iron uptake into neonatal reticulocytes is normal; in fact one
would expect free erythrocyte levels to be markedly elevated if the mutant cells were iron
deficient. Not only is there equivalent levels of this precursor of heme, they go on to
report that there is an excess of free heme in mutant reticulocytes, evidenced by the fact
protein synthesis in f/f reticulocytes is more resistant than normal reticulocytes to the
inhibitory effects of three heme synthesis inhibitors (isoniazid [INH which acts at the step
involving pyridoxal phosphate], the iron chelator 2,2’-bipyridine and ethanol). One of
these inhibitors, INH, normally results in the inhibition of globin synthesis, with alpha
chain more susceptible than beta to the inhibitory effects due to the lack of intracellular
free heme. However, total globin synthesis in f/f cells was less vulnerable to the
inhibitory effects of INH than the control cells (106% vs. 26% of control). Further
evidence the defect of f is not a decrease in heme synthesis is that, hemin, the Fe+3
oxidation product of heme, which has been shown to be capable of stimulating globin
48
synthesis in heme deficient reticulocytes by as much as 270% above control values, has
identical stimulatory effects on f/f globin synthesis (just 25% above basal values) as that
seen in normal fetal red cells. In fact, hemin preferentially stimulates alpha chain over
beta chain synthesis, but it fails to significantly alter alpha/beta ratios in f/f mutant cells
where alpha synthesis is already elevated compared to beta chain [162]. Many have
suggested the deficiency in hemoglobin synthesis is a consequence of disturbed
proliferation [161, 164] or the inability of the heme biosynthetic pathway to keep pace
with the rapid proliferation during fetal development [158]. Regardless of the root
cause, it is clear the reduced hemoglobin and siderocytic granules seen in f/f neonates are
stemming from an overall disruption in the coordinate regulation of hemoglobin
components. Arguably, the effect of the f mutation during embryonic development on
the proliferation/differentiation of hemoglobin producing cells and the production of
hemoglobin by those cells is complex. There is an overall disruption of the coordinate
regulation of hemoglobin components. The consequence of this disruption manifests as
the hemoglobin deficiencies and siderocytes seen in f/f mutant reticulocytes.
The adult defects of flexed-tail (f) mice. Thompson et al. (1966) determined that the f
locus was involved in the
“control of hematopoietic function that is manifested only under conditions of rapid growth, rather than simply a step specific to
fetal life.” [167]
This observation connects the two processes, the expansive erythropoiesis seen in the
developing embryo, and erythropoiesis following an acute anemia in adult. The severe
49
anemia seen in the f neonate resolves within 2 weeks after birth. Adult mice appear
normal based on basic blood parameters. Their blood contains normal numbers of
erythrocytes and siderocytes are essentially absent [159, 160]. There are normal numbers
of erythroid progenitors such as BFU-E and CFU-E in f/f bone marrow and spleen [166].
The sensitivities of progenitors such as CFU-E to Epo and IL3 are similar to controls
[164, 166].
Differences between constituents of the hematopoietic system of the wild-type
and f/f adult mice begin to emerge as the mutant is dissected more closely. As was seen
from CFU-S from the f/f fetal liver, there are similar numbers of this multipotential
myeloid progenitor from f/f adult bone marrow, but they produce smaller spleen colonies
devoid of erythroid cells. There is a disturbance in the proliferation or differentiation of
these progenitors towards the erythroid lineage evidenced by the decreased ability of f/f
CFU-S to incorporate 59Fe into heme from the 6th to 10th day after transplantation (Figure
1-11). The defect manifests only under conditions of rapid proliferation, as there are
normal levels of iron incorporation by 30 days post transplantation once homeostasis has
been re-established. This is not the consequence of host cells replacing engrafted mutant
cells. Secondary CFU-S assays were performed by taking spleens engrafted with f/f or wt
bone marrow 20 or 30 days after initial transplantation, and reinjected into hosts to obtain
spleen colonies. f/f donor cells do persist and retain the characteristic iron incorporation
defect when subsequently transplanted into new hosts. The defective incorporation of
iron into heme is not a consequence of the f/f spleen microenvironment, but rather a cell
intrinsic deficiency since wild type donor cells into flexed recipients behave as if injected
into the wild type recipients [167].
50
One may question whether this CFU-S defect is a delay in the appearance of cells
of the erythroid lineage from these progenitors, or a delay in the rate of hemoglobin
synthesis by individual erythroid progeny. Fowler et al. (1967) addressed this question
using radioautography to measure the uptake of 59Fe by individual cells versus overall
incorporation into heme. There were similar numbers of radioiron granules in nucleated
and non-nucleated cells from +/+ and f/f origins. However, overall there were fewer
59Fe-labeled cells per 100 nucleated cells in the f/f radioautographs compared to +/+
controls. The fact that the deficiency is in the number of cells with radioiron granules,
and not the amount of radioiron per cell demonstrates the f locus specifically affects the
proliferation of erythroid cells, leading to a delay in the production of hemoglobin-
synthesizing cells, rather than a decrease in the rate of hemoglobin synthesis by these
cells. The proliferation/differentiation defects in erythroid progeny from CFU-S do not
alter other hematopoietic lineages. Granulopoiesis from f/f CFU-S was unaffected, with
only a slightly longer lag period in the colony-forming cell growth curve, and no
significant differences in doubling times [169].
Adult f/f mutants do have defects in hematopoietic progenitors that can be
detected by specialized in vivo and in vitro colony assay. The consequences of these
differences are phenotypically apparent in the animal only during periods of
erythropoietic stress such as massive blood loss, irradiation, or phenylhydrazine (PHZ)
induced acute anemia. The hypoxic state caused by the destruction of cells capable of
transporting oxygen invokes expansive erythropoiesis to return blood levels back to
normal. f/f have a delay in this recovery to an acute anemia affecting kinetics rather than
magnitude of parameters ranging from reticulocyte counts in the blood to the up
51
regulation of heme biosynthetic enzymes [165]. Following administration of a single
dose of PHZ (100mg/kg body weight), hematocrit, or packed red blood cell volumes,
drop from 50% to below 30% as a large portion of red blood cells are lysed by the
chemical. Wild-type and f/+ can return hematocrit values to the normal range (~50%),
within 7 days, while it takes f/f mutants 10-12 days to reach a normal blood profile [170].
For this recovery to occur, the hematopoietic system must shift from steady state
maintenance to stress mechanisms to rapidly return homeostasis. The bone marrow may
be a storage site for hematopoietic cells, but the core of the response to re-establish the
erythropoietic system occurs in the spleen [76, 165]. It is not surprising then that there is
no striking difference seen in the bone marrow of f/f and wild-type mice recovering an
acute anemia. Both show a rise in erythropoietic cells from 12%, to 20% in normal mice
by the fourth day after treatment, and 29% in f/f by the fifth day after treatment [165] (It
should be noted that in these experiments, a different PHZ regimen was used that
required 3 injections, dropping hematocrit to 25% 2 days post treatment). The delay in
the return of normal hematocrit levels of f/f mice can be attributed to the delay in the
expansion and maturation of erythroid progenitors in the spleen. An increase in spleen
weight closely parallels the rise in reticulocyte counts following PHZ treatment in both
flexed and normal genotypes. Maximum spleen weight is delayed in f/f compared to
controls, like the percentage of reticulocytes in the blood (Figure 1-12). These
reticulocytes do not contain siderocytes as seen in the embryo. These parameters, as well
as percentages of erythropoietic cells in the spleen determined morphologically by spleen
smears for nucleated hemoglobinized cells, rose more slowly and remained higher longer
in f/f mutants [165].
52
The delay in erythropoietic cells in the spleen of f/f mice leads to the overall delay
in establishing normal blood parameters following an erythropoietic challenge. This
delay also extends to the enzymatic changes in the spleen which normally occur during
recovery period. Spleen cells actively producing hemoglobin increase from 2 to 60% of
the total number of cells following PHZ treatment in wild type mice, with an increase in
δ-aminolevulinate dehydratase (ALD) activity 24hrs post PHZ treatment. Similar
increases are seen in uroporphyrinogen synthetase, another enzyme in the heme
biosynthetic pathway. The increase in enzyme activity is not simply due to increase in the
size of the spleen, since activity levels are expressed in units per grams of tissue. The lag
seen in the proliferation of heme-synthesizing cells in f/f spleens leads to the lag in this
compensatory increase of both ALD and uroporphyrinogen synthetase by 2-3 days
(Figure 1-13). Although the activity of critical enzymes in the heme biosynthetic
pathway has been disturbed, there is no increase in siderocytes found in f/f adults
recovering from an acute anemia. These results demonstrate that the direct effect of f is
in the control of the differentiation or proliferation of the hematopoietic cells which
contain these enzymes [165].
Although f/f adult mice have normal numbers of BFU-E and CFU-E, they do
exhibit a defect in transient endogenous colony forming cells (TE-CFU). Unlike the in
vitro colony assays used for BFU-E and CFU-E, TE-CFU are defined in an in vivo assay,
requiring an erythropoietic stressor to engage them. Mice are given a sub lethal dose of
radiation (800 rads) that destroys many actively cycling cells and stimulated with 10 units
of Erythropoietin. These progenitors form macroscopic colonies on the spleen composed
primarily of maturing erythroblasts 4-6 days after stimulation. TE-CFU are more
53
severely affected by the f locus than a mere change in the kinetics of their appearance or
functioning following an acute anemia. The nature of the TE-CFU makes it a likely
candidate for a progenitor whose role is highly specialized for rapid erythropoietic
repopulation which is required only at times of great erythropoietic need. These cells
have the ability to produce an excess of 105 progeny in approximately 5 days dependent
on the continual exposure to Epo [166]. Such an extreme condition parallels the hypoxic
state following a PHZ induced acute anemia, so it is not surprising a progenitor poised to
respond to acute erythroid stress is defective in f/f mutant mice.
In terms of development of an erythrocyte, TE-CFU are postulated to lie between
the multipotential myeloid progenitor (CFU-S) and the late stage erythroid committed
CFU-E based on the timing of their appearance, growth requirements and colony size.
The extent that these cells may overlap with the more immature erythroid progenitor, the
BFU-E has not been determined. Defining the exact relationship between the TE-CFU
and the other erythroid committed progenitors is complicated by the different types of
assays used to detect them. TE-CFU are virtually undetectable in f/f mutants along the
course of the experiment, while +/+ show upwards of 100 colonies per spleen at the peak
of their expression (Figure 1-14). Equivalent numbers of TE-CFU are reported between
f/f and +/+ at later times (9-12 days), but these seem inconsequential when compared to
the numbers seen in the initial wave of +/+ mice. TE-CFU are unable to be transplanted
when injected into irradiated hosts. To circumvent this attribute, chimeras were
established from +/+ or f/f bone marrow and used to test whether the lack of TE-CFU in
f/f mutants is a cell intrinsic defect or a microenvironmental consideration. f/f chimeras
lack the transient wave of colonies seen in the +/+ control chimeras demonstrating the
54
cell intrinsic defect of the mutant progenitor cells. Clearly the f locus is having a
profound effect on the generation and/or maturation of this specific erythroid progenitor
[166].
55
References
1. Yoder, M.C.a.P., J., Ventral (Yolk sac) Hematopoiesis in the Mouse, in
Hematopoiesis. A developmental approach, L.I. Zon, Editor. 2001, Oxford University Press, Inc.: New York. p. 180-191.
2. de Bruijn, M.F., X. Ma, C. Robin, K. Ottersbach, M.J. Sanchez, and E. Dzierzak, Hematopoietic stem cells localize to the endothelial cell layer in the midgestation mouse aorta. Immunity, 2002. 16(5): p. 673-83.
3. Orkin, S.H., Diversification of haematopoietic stem cells to specific lineages. Nat Rev Genet, 2000. 1(1): p. 57-64.
4. Godin, I. and A. Cumano, The hare and the tortoise: an embryonic haematopoietic race. Nat Rev Immunol, 2002. 2(8): p. 593-604.
5. Spangrude, G.J., S. Heimfeld, and I.L. Weissman, Purification and characterization of mouse hematopoietic stem cells. Science, 1988. 241(4861): p. 58-62.
6. Bagby Jr., G.C., Hematopoiesis, in The Molecular Basis of Blood Diseases, 2nd edition, G. Stamatoyannopoulos, et al., Editors. 1993, WB Saunders: Phialdelphia. p. 71-103.
7. Mikkola, H.K. and S.H. Orkin, The search for the hemangioblast. J Hematother Stem Cell Res, 2002. 11(1): p. 9-17.
8. Kessler, D.S. and D.A. Melton, Vertebrate embryonic induction: mesodermal and neural patterning. Science, 1994. 266(5185): p. 596-604.
9. Dyer, M., S. Farrington, D. Mohn, J. Munday, and M. Baron, Indian Hedgehog activates hematopoiesis and vasculogenesis and can respecify prospective neurectodermal cell fate in the mouse embryo. Development, 2001. 128: p. 1717-1730.
10. Schmerer, M. and T. Evans, Primitive erythropoiesis is regulated by Smad-dependent signaling in postgastrulation mesoderm. Blood, 2003. 102(9): p. 3196-205.
11. Mead, P.E., C.M. Kelley, P.S. Hahn, O. Piedad, and L.I. Zon, SCL specifies hematopoietic mesoderm in Xenopus embryos. Development, 1998. 125(14): p. 2611-20.
12. Robb, L., I. Lyons, R. Li, L. Hartley, F. Kontgen, R.P. Harvey, D. Metcalf, and C.G. Begley, Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene. Proc Natl Acad Sci U S A, 1995. 92(15): p. 7075-9.
13. Shivdasani, R.A., E.L. Mayer, and S.H. Orkin, Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL. Nature, 1995. 373(6513): p. 432-4.
14. Mead, P.E., A.E. Deconinck, T.L. Huber, S.H. Orkin, and L.I. Zon, Primitive erythropoiesis in the Xenopus embryo: the synergistic role of LMO-2, SCL and GATA-binding proteins. Development, 2001. 128(12): p. 2301-8.
15. Murray, P.S.F., The development in vitro of the blood of the early chick embryo. Proc. Roy. Soc. London, 1932(111): p. 497-521.
56
16. Garcia-Porrero, J.A., A. Manaia, J. Jimeno, L.L. Lasky, F. Dieterlen-Lievre, and I.E. Godin, Antigenic profiles of endothelial and hemopoietic lineages in murine intraembryonic hemogenic sites. Dev Comp Immunol, 1998. 22(3): p. 303-19.
17. Choi, K., M. Kennedy, A. Kazarov, J.C. Papadimitriou, and G. Keller, A common precursor for hematopoietic and endothelial cells. Development, 1998. 125(4): p. 725-32.
18. Kennedy, M., M. Firpo, K. Choi, C. Wall, S. Robertson, N. Kabrun, and G. Keller, A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature, 1997. 386(6624): p. 488-93.
19. Shalaby, F., J. Ho, W.L. Stanford, K.D. Fischer, A.C. Schuh, L. Schwartz, A. Bernstein, and J. Rossant, A requirement for Flk1 in primitive and definitive hematopoiesis and vasculogenesis. Cell, 1997. 89(6): p. 981-90.
20. Shalaby, F., J. Rossant, T.P. Yamaguchi, M. Gertsenstein, X.F. Wu, M.L. Breitman, and A.C. Schuh, Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature, 1995. 376(6535): p. 62-6.
21. Lin, C.S., S.K. Lim, V. D'Agati, and F. Costantini, Differential effects of an erythropoietin receptor gene disruption on primitive and definitive erythropoiesis. Genes Dev, 1996. 10(2): p. 154-64.
22. Neubauer, H., A. Cumano, M. Muller, H. Wu, U. Huffstadt, and K. Pfeffer, Jak2 deficiency defines an essential developmental checkpoint in definitive hematopoiesis. Cell, 1998. 93(3): p. 397-409.
23. Wu, H., X. Liu, R. Jaenisch, and H.F. Lodish, Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor. Cell, 1995. 83(1): p. 59-67.
24. Silver, L. and J. Palis, Initiation of murine embryonic erythropoiesis: a spatial analysis. Blood, 1997. 89(4): p. 1154-64.
25. Cumano, A., F. Dieterlen-Lievre, and I. Godin, Lymphoid potential, probed before circulation in mouse, is restricted to caudal intraembryonic splanchnopleura. Cell, 1996. 86(6): p. 907-16.
26. Cumano, A., J.C. Ferraz, M. Klaine, J.P. Di Santo, and I. Godin, Intraembryonic, but not yolk sac hematopoietic precursors, isolated before circulation, provide long-term multilineage reconstitution. Immunity, 2001. 15(3): p. 477-85.
27. Pardanaud, L., D. Luton, M. Prigent, L.M. Bourcheix, M. Catala, and F. Dieterlen-Lievre, Two distinct endothelial lineages in ontogeny, one of them related to hemopoiesis. Development, 1996. 122(5): p. 1363-71.
28. Yoder, M.C., Introduction: spatial origin of murine hematopoietic stem cells. Blood, 2001. 98(1): p. 3-5.
29. Palis, J. and M.C. Yoder, Yolk-sac hematopoiesis: the first blood cells of mouse and man. Exp Hematol, 2001. 29(8): p. 927-36.
30. Palis, J., S. Robertson, M. Kennedy, C. Wall, and G. Keller, Development of erythroid and myeloid progenitors in the yolk sac and embryo proper of the mouse. Development, 1999. 126(22): p. 5073-84.
31. Palis, J., R.J. Chan, A. Koniski, R. Patel, M. Starr, and M.C. Yoder, Spatial and temporal emergence of high proliferative potential hematopoietic precursors
57
during murine embryogenesis. Proc Natl Acad Sci U S A, 2001. 98(8): p. 4528-33.
32. Rich, I.N., The developmental biology of hemopoiesis: effect of growth factors on the colony formation by embryonic cells. Exp Hematol, 1992. 20(3): p. 368-70.
33. Muller, A.M., A. Medvinsky, J. Strouboulis, F. Grosveld, and E. Dzierzak, Development of hematopoietic stem cell activity in the mouse embryo. Immunity, 1994. 1(4): p. 291-301.
34. Chen, X.D. and J.B. Turpen, Intraembryonic origin of hepatic hematopoiesis in Xenopus laevis. J Immunol, 1995. 154(6): p. 2557-67.
35. Medvinsky, A. and E. Dzierzak, Definitive hematopoiesis is autonomously initiated by the AGM region. Cell, 1996. 86: p. 897-906.
36. Medvinsky, A.L., N.L. Samoylina, A.M. Muller, and E.A. Dzierzak, An early pre-liver intraembryonic source of CFU-S in the developing mouse. Nature, 1993. 364(6432): p. 64-7.
37. Cudennec, C.A., J.P. Thiery, and N.M. Le Douarin, In vitro induction of adult erythropoiesis in early mouse yolk sac. Proc Natl Acad Sci U S A, 1981. 78(4): p. 2412-6.
38. Dieterlen-Lievre, F., On the origin of haemopoietic stem cells in the avian embryo: an experimental approach. J Embryol Exp Morphol, 1975. 33(3): p. 607-19.
39. Martin, C., O. Lassila, T. Nurmi, J. Eskola, F. Dieterlen-Lievre, and P. Toivanen, Intraembryonic origin of lymphoid stem cells in the chicken: studies with sex chromosome and IgG allotype markers in histocompatible yolk sac-embryo chimaeras. Scand J Immunol, 1979. 10(4): p. 333-8.
40. de Bruijn, M.F., N.A. Speck, M.C. Peeters, and E. Dzierzak, Definitive hematopoietic stem cells first develop within the major arterial regions of the mouse embryo. Embo J, 2000. 19(11): p. 2465-74.
41. Huang, H. and R. Auerbach, Identification and characterization of hematopoietic stem cells from the yolk sac of the early mouse embryo. Proc Natl Acad Sci U S A, 1993. 90(21): p. 10110-4.
42. Lu, L.S., S.J. Wang, and R. Auerbach, In vitro and in vivo differentiation into B cells, T cells, and myeloid cells of primitive yolk sac hematopoietic precursor cells expanded > 100-fold by coculture with a clonal yolk sac endothelial cell line. Proc Natl Acad Sci U S A, 1996. 93(25): p. 14782-7.
43. Jordan, C.T., C.M. Astle, J. Zawadzki, K. Mackarehtschian, I.R. Lemischka, and D.E. Harrison, Long-term repopulating abilities of enriched fetal liver stem cells measured by competitive repopulation. Exp Hematol, 1995. 23(9): p. 1011-5.
44. Sanchez, M.J., A. Holmes, C. Miles, and E. Dzierzak, Characterization of the first definitive hematopoietic stem cells in the AGM and liver of the mouse embryo. Immunity, 1996. 5(6): p. 513-25.
45. Matsuoka, S., K. Tsuji, H. Hisakawa, M. Xu, Y. Ebihara, T. Ishii, D. Sugiyama, A. Manabe, R. Tanaka, Y. Ikeda, S. Asano, and T. Nakahata, Generation of definitive hematopoietic stem cells from murine early yolk sac and paraaortic splanchnopleures by aorta-gonad-mesonephros region-derived stromal cells. Blood, 2001. 98(1): p. 6-12.
58
46. Yoder, M.C., J.G. Cumming, K. Hiatt, P. Mukherjee, and D.A. Williams, A novel method of myeloablation to enhance engraftment of adult bone marrow cells in newborn mice. Biol Blood Marrow Transplant, 1996. 2(2): p. 59-67.
47. Yoder, M.C., K. Hiatt, and P. Mukherjee, In vivo repopulating hematopoietic stem cells are present in the murine yolk sac at day 9.0 postcoitus. Proc Natl Acad Sci U S A, 1997. 94(13): p. 6776-80.
48. Lassila, O., J. Eskola, P. Toivanen, C. Martin, and F. Dieterlen-Lievre, The origin of lymphoid stem cells studied in chick yold sac-embryo chimaeras. Nature, 1978. 272(5651): p. 353-4.
49. Kumaravelu, P., L. Hook, A.M. Morrison, J. Ure, S. Zhao, S. Zuyev, J. Ansell, and A. Medvinsky, Quantitative developmental anatomy of definitive haematopoietic stem cells/long-term repopulating units (HSC/RUs): role of the aorta-gonad-mesonephros (AGM) region and the yolk sac in colonisation of the mouse embryonic liver. Development, 2002. 129(21): p. 4891-9.
50. Yoder, M.C., K. Hiatt, P. Dutt, P. Mukherjee, D.M. Bodine, and D. Orlic, Characterization of definitive lymphohematopoietic stem cells in the day 9 murine yolk sac. Immunity, 1997. 7(3): p. 335-44.
51. Wood, H.B., G. May, L. Healy, T. Enver, and G.M. Morriss-Kay, CD34 expression patterns during early mouse development are related to modes of blood vessel formation and reveal additional sites of hematopoiesis. Blood, 1997. 90(6): p. 2300-11.
52. Marshall, C., C. Kinnon, and A. Thrasher, Polarized expression of bone morphogenetic protein-4 in the human aorta-gonad-mesonephros region. Blood, 2000. 96: p. 1591-1593.
53. Marshall, C.J. and A.J. Thrasher, The embryonic origins of human haematopoiesis. Br J Haematol, 2001. 112(4): p. 838-50.
54. North, T., T. Gu, T. Stacy, Q. Wang, L. Howard, M. Binder, M. Marin-Padilla, and N. Speck, Cbfa2 is required for the formation of intra-aortic hematopoietic clusters. Development, 1999. 126: p. 2563-2575.
55. Cai, Z., M. de Bruijn, X. Ma, B. Dortland, T. Luteijn, R.J. Downing, and E. Dzierzak, Haploinsufficiency of AML1 affects the temporal and spatial generation of hematopoietic stem cells in the mouse embryo. Immunity, 2000. 13(4): p. 423-31.
56. Zon, L.I., Developmental biology of hematopoiesis. Blood, 1995. 86(8): p. 2876-91.
57. Houssaint, E., Differentiation of the mouse hepatic primordium. II. Extrinsic origin of the haemopoietic cell line. Cell Differ, 1981. 10(5): p. 243-52.
58. Johnson, G.R. and M.A. Moore, Role of stem cell migration in initiation of mouse foetal liver haemopoiesis. Nature, 1975. 258(5537): p. 726-8.
59. Ohneda, O., N. Yanai, and M. Obinata, Microenvironment created by stromal cells is essential for a rapid expansion of erythroid cells in mouse fetal liver. Development, 1990. 110(2): p. 379-84.
60. Peschle, C., A. Migliaccio, G. Migliaccio, R. Ciccariello, F. Letteri, G. Quattrini, G. Russo, and G. Mastroberardino, Identification and characterization of three classes of erythroid progenitors in human fetal liver. Blood, 1981. 58: p. 565-574.
59
61. Muench, M. and R. Namikawa, Disparate regulation of human fetal erythropoiesis by the microenvironments of the liver and bone marrow. Blood Cells, Molecules and Diseases, 2001. 27: p. 377-390.
62. Wu, H., U. Klingmuller, A. Acurio, J.G. Hsiao, and H.F. Lodish, Functional interaction of erythropoietin and stem cell factor receptors is essential for erythroid colony formation. Proc Natl Acad Sci U S A, 1997. 94(5): p. 1806-10.
63. Bernex, F., P. De Sepulveda, C. Kress, C. Elbaz, C. Delouis, and J.J. Panthier, Spatial and temporal patterns of c-kit-expressing cells in WlacZ/+ and WlacZ/WlacZ mouse embryos. Development, 1996. 122(10): p. 3023-33.
64. Bernstein, A., L. Forrester, A.D. Reith, P. Dubreuil, and R. Rottapel, The murine W/c-kit and Steel loci and the control of hematopoiesis. Semin Hematol, 1991. 28(2): p. 138-42.
65. Ogawa, M., S. Nishikawa, K. Yoshinaga, S. Hayashi, T. Kunisada, J. Nakao, T. Kina, T. Sudo, H. Kodama, and S. Nishikawa, Expression and function of c-Kit in fetal hemopoietic progenitor cells: transition from the early c-Kit-independent to the late c-Kit-dependent wave of hemopoiesis in the murine embryo. Development, 1993. 117(3): p. 1089-98.
66. Lansdorp, P.M., W. Dragowska, and H. Mayani, Ontogeny-related changes in proliferative potential of human hematopoietic cells. J Exp Med, 1993. 178(3): p. 787-91.
67. Rich, I.N. and B. Kubanek, The ontogeny of erythropoiesis in the mouse detected by the erythroid colony-forming technique. II. Transition in erythropoietin sensitivity during development. J Embryol Exp Morphol, 1980. 58: p. 143-55.
68. Bozzini, C.E., M.E. Barrio Rendo, F.C. Devoto, and C.E. Epper, Studies on medullary and extramedullary erythropoiesis in the adult mouse. Am J Physiol, 1970. 219(3): p. 724-8.
69. Hillman, R.S.a.C.A.F., Red Cell Manual. 7 ed. 1996, Philadelphia: F.A. Davis Company.
70. Akashi, K., D. Traver, T. Miyamoto, and I.L. Weissman, A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature, 2000. 404(6774): p. 193-7.
71. Traver, D., T. Miyamoto, J. Christensen, J. Iwasaki-Arai, K. Akashi, and I.L. Weissman, Fetal liver myelopoiesis occurs through distinct, prospectively isolatable progenitor subsets. Blood, 2001. 98(3): p. 627-35.
72. Paulson, R.F., Personal communication, L.E. Lenox, Editor. 2005: State College, PA.
73. Koury, M.J., S.T. Sawyer, and S.J. Brandt, New insights into erythropoiesis. Curr Opin Hematol, 2002. 9(2): p. 93-100.
74. Melkun, E., M. Pilione, and R.F. Paulson, A naturally occurring point substitution in Cdc25A, and not Fv2/Stk, is associated with altered cell-cycle status of early erythroid progenitor cells. Blood, 2002. 100(10): p. 3804-11.
75. Suzuki, S. and A.A. Axelrad, Fv-2 locus controls the proportion of erythropoietic progenitor cells (BFU-E) synthesizing DNA in normal mice. Cell, 1980. 19(1): p. 225-36.
60
76. Hara, H. and M. Ogawa, Erythropoietic precursors in mice under erythropoietic stimulation and suppression. Exp Hematol, 1977. 5(2): p. 141-8.
77. Israels, L.G., and E.D. Israels, Erythropoieisis: an overview, in Erythropoietins and erythropoiesis: molecular, cellular, preclinical, and clinical biology, G. Molineux, M. Foote, and S.G. Elliott, Editors. 2003, Birkhèauser Verlag: Basel; New York. p. 3-14.
78. Gregory, C.J. and A.C. Eaves, Three stages of erythropoietic progenitor cell differentiation distinguished by a number of physical and biologic properties. Blood, 1978. 51(3): p. 527-37.
79. Ebert, B.L. and H.F. Bunn, Regulation of the erythropoietin gene. Blood, 1999. 94(6): p. 1864-77.
80. Ihle, J.N., Signal Transduction in the Regulation of Hematopoeisis, in The Molecular Basis of Blood Disease, G. Stamatoyannopoulos, et al., Editors. 2001, WB Saunders, Co.: Philadelphia. p. 103-134.
81. Ghaffari, S., Jun-shen Huang, L., Zhang, J., and Lodish, H.F., Erythropoietin receptor signaling processes, in Erythropoietins and erythropoiesis: molecular, cellular, preclinical, and clinical biology, G. Molineux, M. Foote, and S.G. Elliott, Editors. 2003, Birkhèauser Verlag: Basel; New York. p. 65-85.
82. Koury, M., Kelley, L., and Bondurant, M., The Fate of Erythroid Progenitor Cells. Annals of the New York Academy of Sciences: Molecular, Cellular, and Developmental Biology of Erythropoietin and Erythropoiesis, 1994. 718: p. 259-267.
83. DeMartino, J., Martin, C., Mathey-Prevot, B., and D'Andrea, A., Erythropoietin Receptor Contains both Growth-promoting Activity and Differentaition-promoting Activity. Annals of the New York Academy of Sciences: Molecular, Cellular, and Developmental Biology of Erythropoietin and Erythropoiesis, 1994. 718: p. 213-221.
84. Kaushansky, K., Hematopoietic Growth Factors and Receptors, in The Molecular Basis of Blood Disease, G. Stamatoyannopoulos, et al., Editors. 2001, WB Saunders, Co.: Philadelphia. p. 25-79.
85. Kieran, M.W., A.C. Perkins, S.H. Orkin, and L.I. Zon, Thrombopoietin rescues in vitro erythroid colony formation from mouse embryos lacking the erythropoietin receptor. Proc Natl Acad Sci U S A, 1996. 93(17): p. 9126-31.
86. Molineux, G., Biology of erythropoietin, in Erythropoietins and erythropoiesis: molecular, cellular, preclinical, and clinical biology, G. Molineux, M. Foote, and S.G. Elliott, Editors. 2003, Birkhèauser Verlag: Basel; New York. p. 113-132.
87. Dame, C., Molecular biology of the erythropoietin receptor in hematopoietic and non-hematopoietic tissues, in Erythropoietins and erythropoiesis: molecular, cellular, preclinical, and clinical biology, G. Molineux, M. Foote, and S.G. Elliott, Editors. 2003, Birkhèauser Verlag: Basel; New York. p. 35-64.
88. Koury, S.T., M.J. Koury, M.C. Bondurant, J. Caro, and S.E. Graber, Quantitation of erythropoietin-producing cells in kidneys of mice by in situ hybridization: correlation with hematocrit, renal erythropoietin mRNA, and serum erythropoietin concentration. Blood, 1989. 74(2): p. 645-51.
61
89. Bozzini, C.E., Alippi, R. M., Barcelo, A. C., Conti, M. I., Bozzini, C., Lezon, C. E., Olivera, M. I., The Biology of Stress Erythropoiesis and Erythropoietin Production. Annals of the New York Academy of Sciences: Molecular, Cellular, and Developmental Biology of Erythropoietin and Erythropoiesis, 1994. 718: p. 83-92.
90. Guillemin, K. and M. Krasnow, The hypoxic response: Huffing and HIFing. Cell, 1997. 89: p. 9-12.
91. Galson, D., Blanchard, K., Fandrey, J., Goldberg, M. and Bunn, H.F., Cis Elements That Regulate the Erythropoietin Gene. Annals of the New York Academy of Sciences: Molecular, Cellular, and Developmental Biology of Erythropoietin and Erythropoiesis, 1994. 718: p. 21-30.
92. Blanchard, K.L., A.M. Acquaviva, D.L. Galson, and H.F. Bunn, Hypoxic induction of the human erythropoietin gene: cooperation between the promoter and enhancer, each of which contains steroid receptor response elements. Mol Cell Biol, 1992. 12(12): p. 5373-85.
93. Pugh, C.W., B.L. Ebert, O. Ebrahim, and P.J. Ratcliffe, Characterisation of functional domains within the mouse erythropoietin 3' enhancer conveying oxygen-regulated responses in different cell lines. Biochim Biophys Acta, 1994. 1217(3): p. 297-306.
94. Semenza, G.L. and G.L. Wang, A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol Cell Biol, 1992. 12(12): p. 5447-54.
95. Galson, D.L., T. Tsuchiya, D.S. Tendler, L.E. Huang, Y. Ren, T. Ogura, and H.F. Bunn, The orphan receptor hepatic nuclear factor 4 functions as a transcriptional activator for tissue-specific and hypoxia-specific erythropoietin gene expression and is antagonized by EAR3/COUP-TF1. Mol Cell Biol, 1995. 15(4): p. 2135-44.
96. Wang, G.L., B.H. Jiang, E.A. Rue, and G.L. Semenza, Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci U S A, 1995. 92(12): p. 5510-4.
97. Semenza, G.L., HIF-1 and mechanisms of hypoxia sensing. Curr Opin Cell Biol, 2001. 13(2): p. 167-71.
98. Huang, L.E., J. Gu, M. Schau, and H.F. Bunn, Regulation of hypoxia-inducible factor 1alpha is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci U S A, 1998. 95(14): p. 7987-92.
99. Semenza, G., HIF - 1 and human disease: one highly involved factor. Genes & Dev, 2000. 14: p. 1983-1991.
100. Yoshida, E., S. Aratani, H. Itou, M. Miyagishi, M. Takiguchi, T. Osumu, K. Murakami, and A. Fukamizu, Functional association between CBP and HNF4 in trans-activation. Biochem Biophys Res Commun, 1997. 241(3): p. 664-9.
101. Cheung, J.Y. and B.A. Miller, Molecular mechanisms of erythropoietin signaling. Nephron, 2001. 87(3): p. 215-22.
102. Sawyer, S., Introduction: The Erythropoietin Receptor and Signal Transduction. Annals of the New York Academy of Sciences: Molecular, Cellular, and
62
Developmental Biology of Erythropoietin and Erythropoiesis, 1994. 718: p. 185-190.
103. Whitelaw, E., S.F. Tsai, P. Hogben, and S.H. Orkin, Regulated expression of globin chains and the erythroid transcription factor GATA-1 during erythropoiesis in the developing mouse. Mol Cell Biol, 1990. 10(12): p. 6596-606.
104. Stamatoyannopoulos, G., and Grosveld, F., Hemoglobin Switching, in The Molecular Basis of Blood Disease, G. Stamatoyannopoulos, et al., Editors. 2001, WB Saunders, Co.: Philadelphia. p. 135-182.
105. Gourdon, G., J.A. Sharpe, D.R. Higgs, and W.G. Wood, The mouse alpha-globin locus regulatory element. Blood, 1995. 86(2): p. 766-75.
106. Trimborn, T., J. Gribnau, F. Grosveld, and P. Fraser, Mechanisms of developmental control of transcription in the murine alpha- and beta-globin loci. Genes Dev, 1999. 13(1): p. 112-24.
107. Alami, R., M. Bender, Y. Feng, S. Fiering, B. Hug, T. Ley, M. Groudine, and E. Bouhassira, Deletions within the mouse beta-globin locus control region preferentially reduce beta(min) globin gene expression. Genomics, 2000. 63: p. 417-424.
108. Bulger, M. and M. Groudine, Looping versus linking: toward a model for long-distance gene activation. Genes Dev, 1999. 13(19): p. 2465-77.
109. Higgs, D.R., Do LCRs open chromatin domains? Cell, 1998. 95(3): p. 299-302. 110. Hug, B.A., R.L. Wesselschmidt, S. Fiering, M.A. Bender, E. Epner, M. Groudine,
and T.J. Ley, Analysis of mice containing a targeted deletion of beta-globin locus control region 5' hypersensitive site 3. Mol Cell Biol, 1996. 16(6): p. 2906-12.
111. Kioussis, D. and R. Festenstein, Locus control regions: overcoming heterochromatin-induced gene inactivation in mammals. Curr Opin Genet Dev, 1997. 7(5): p. 614-9.
112. Miller, J.L., Hemoglobin switching and modulation: genes, cells, and signals. Curr Opin Hematol, 2002. 9(2): p. 87-92.
113. Navas, P.A., K.R. Peterson, Q. Li, M. McArthur, and G. Stamatoyannopoulos, The 5'HS4 core element of the human beta-globin locus control region is required for high-level globin gene expression in definitive but not in primitive erythropoiesis. J Mol Biol, 2001. 312(1): p. 17-26.
114. Lyon, M.F., J.E. Barker, and R.A. Popp, Mouse globin gene nomenclature. J Hered, 1988. 79(2): p. 93-5.
115. Russell, E.S., and McFarland, E. C., Genetics of mouse hemoglobins. Annals of the New York Academy of Sciences, 1974. 241: p. 25-38.
116. Erhart, M.A., K.S. Simons, and S. Weaver, Evolution of the mouse beta-globin genes: a recent gene conversion in the Hbbs haplotype. Mol Biol Evol, 1985. 2(4): p. 304-20.
117. Weaver, S., M.B. Comer, C.L. Jahn, C.A. Hutchison, 3rd, and M.H. Edgell, The adult beta-globin genes of the "single" type mouse C57BL. Cell, 1981. 24(2): p. 403-11.
118. Jahn, C.L., C.A. Hutchison, 3rd, S.J. Phillips, S. Weaver, N.L. Haigwood, C.F. Voliva, and M.H. Edgell, DNA sequence organization of the beta-globin complex in the BALB/c mouse. Cell, 1980. 21(1): p. 159-68.
63
119. Trimborn, T., J. Gribnau, F. Grosveld, and P. Fraser, Mechanisms of developmental control of transcription in the murine alpha and beta-globin loci. Genes and Development, 1999. 13: p. 112-124.
120. Bender, M.A., M. Bulger, J. Close, and M. Groudine, Beta-globin gene switching and DNase I sensitivity of the endogenous beta-globin locus in mice do not require the locus control region. Mol Cell, 2000. 5(2): p. 387-93.
121. Gillemans, N., R. Tewari, F. Lindeboom, R. Rottier, T. de Wit, M. Wijgerde, F. Grosveld, and S. Philipsen, Altered DNA-binding specificity mutants of EKLF and Sp1 show that EKLF is an activator of the beta-globin locus control region in vivo. Genes Dev, 1998. 12(18): p. 2863-73.
122. Whitney, J.B., 3rd, Differential control of the synthesis of two hemoglobin beta chains in normal mice. Cell, 1977. 12(4): p. 863-71.
123. Wawrzyniak, C. and R. Popp, Expression of the two adult β-globin genes in mouse yolk sac and fetal liver. Developmental Biology, 1987. 119: p. 299-301.
124. Oliveri, N. and D. Weatherall, The therapeutic reactivation of fetal hemoglobin. Human Molecular Genetics, 1998. 7: p. 1655-1658.
125. Brandan, N., M. Aguirre, R. Carmuega, M. Alvarez, and J. Juaristi, Proliferative and maturative behaviour patterns on murine bone marrow and spleen erythropoiesis along hypoxia. Acta Physiol Pharmacol Ther Latinoam, 1997. 47(2): p. 125-35.
126. Broudy, V., N. Lin, G. Priestley, K. Nocka, and N. Wolf, Interaction of stem cell factor and its receptor c-kit mediates lodgement and acute expansion of hematopoietic cells in the murine spleen. Blood, 1996. 88: p. 75-81.
127. Hara, H. and M. Ogawa, Erythropoietic precursors in mice with phenylhydrazine-induced anemia. American Journal of Hematology, 1976. 1: p. 453-458.
128. Ploemacher, R.E. and P.L. van Soest, Morphological investigation on phenylhydrazine-induced erythropoiesis in the adult mouse liver. Cell Tissue Res, 1977. 178(4): p. 435-61.
129. Rich, I. and B. Kubanek, The effect of reduced oxygen tension on colony formation of erythropoietic cells in vitro. British Journal of Haematology, 1982. 52: p. 579-588.
130. Sadahira, Y., T. Yasuda, T. Yoshino, T. Manabe, T. Takeishi, Y. Kobayashi, Y. Ebe, and M. Naito, Impaired splenic erythropoiesis in phlebotomized mice injected with CL2MDP-liposome: an experimental model for studying the role of stromal macrophages in erythropoiesis. J Leukoc Biol, 2000. 68(4): p. 464-70.
131. Lenox, L.E., J.M. Perry, and R.F. Paulson, BMP4 and Madh5 regulate the erythroid response to acute anemia. Blood, 2005. 105(7): p. 2741-8.
132. von Lindern, M., W. Zauner, G. Mellitzer, P. Steinlein, G. Fritsch, K. Huber, B. Lowenberg, and H. Beug, The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro. Blood, 1999. 94(2): p. 550-9.
133. Wessely, O., A. Bauer, C.T. Quang, E.M. Deiner, M. von Lindern, G. Mellitzer, P. Steinlein, J. Ghysdael, and H. Beug, A novel way to induce erythroid progenitor self renewal: cooperation of c-Kit with the erythropoietin receptor. Biol Chem, 1999. 380(2): p. 187-202.
64
134. Wessely, O., E.M. Deiner, H. Beug, and M. von Lindern, The glucocorticoid receptor is a key regulator of the decision between self-renewal and differentiation in erythroid progenitors. Embo J, 1997. 16(2): p. 267-80.
135. Bauer, A., F. Tronche, O. Wessely, C. Kellendonk, H. Reichardt, P. Steinlein, G. Schutz, and H. Beug, The glucocorticoid receptor is required for stress erythropoiesis. Genes Dev, 1999. 13: p. 2996-3002.
136. Harrison, D. and E. Russell, The response of W/Wv and Sl/Sld amaemic mice to hematopoietic stimuli. Br. J. Haematol, 1972. 22: p. 155-167.
137. Geissler, E.N., M.A. Ryan, and D.E. Housman, The dominant-white spotting (W) locus of the mouse encodes the c-kit proto-oncogene. Cell, 1988. 55(1): p. 185-92.
138. Huang, E., K. Nocka, D.R. Beier, T.Y. Chu, J. Buck, H.W. Lahm, D. Wellner, P. Leder, and P. Besmer, The hematopoietic growth factor KL is encoded by the Sl locus and is the ligand of the c-kit receptor, the gene product of the W locus. Cell, 1990. 63(1): p. 225-33.
139. Zhu, H. and H. Bunn, Oxygen sensing and signaling: impact on the regulation of physiologically important genes. Respiration Physiology, 1999. 115: p. 239-247.
140. Zsebo, K.M., D.A. Williams, E.N. Geissler, V.C. Broudy, F.H. Martin, H.L. Atkins, R.Y. Hsu, N.C. Birkett, K.H. Okino, D.C. Murdock, and et al., Stem cell factor is encoded at the Sl locus of the mouse and is the ligand for the c-kit tyrosine kinase receptor. Cell, 1990. 63(1): p. 213-24.
141. Russell, E., Hereditary Anemias of the Mouse: A review for Geneticists. Advances in Genetics, 1979. 20: p. 357-459.
142. Axelrod, J. and T.D. Reisine, Stress hormones: their interaction and regulation. Science, 1984. 224(4648): p. 452-9.
143. Tronche, F., C. Kellendonk, H.M. Reichardt, and G. Schutz, Genetic dissection of glucocorticoid receptor function in mice. Curr Opin Genet Dev, 1998. 8(5): p. 532-8.
144. Golde, D.W., N. Bersch, and M.J. Cline, Potentiation of erythropoiesis in vitro by dexamethasone. J Clin Invest, 1976. 57(1): p. 57-62.
145. Udupa, K.B., H.M. Crabtree, and D.A. Lipschitz, In vitro culture of proerythroblasts: characterization of proliferative response to erythropoietin and steroids. Br J Haematol, 1986. 62(4): p. 705-14.
146. McLeod, D.L., M.M. Shreeve, and A.A. Axelrad, Chromosome marker evidence for the bipotentiality of BFU-E. Blood, 1980. 56(2): p. 318-22.
147. Vannucchi, A.M., F. Paoletti, S. Linari, C. Cellai, R. Caporale, P.R. Ferrini, M. Sanchez, G. Migliaccio, and A.R. Migliaccio, Identification and characterization of a bipotent (erythroid and megakaryocytic) cell precursor from the spleen of phenylhydrazine-treated mice. Blood, 2000. 95(8): p. 2559-68.
148. Ploemacher, R.E., P.L. van Soest, and O. Vos, Kinetics of erythropoiesis in the liver induced in adult mice by phenylhydrazine. Scand J Haematol, 1977. 19(5): p. 424-34.
149. Yanai, N., Y. Matsuya, and M. Obinata, Spleen stromal cell lines selectively support erythroid colony formation. Blood, 1989. 74(7): p. 2391-7.
65
150. Obinata, M. and N. Yania, Cellular and molecular regulation of erythropoietic inductive microenvironment (EIM). Cell Structure and Function, 1999. 24: p. 171-179.
151. Yanai, N., T. Satoh, and M. Obinata, Endothelial cells create a hematopietic inductive microenvironment preferential to eythropoiesis in the mouse spleen. Cell Structure and Function, 1991. 16: p. 87-93.
152. Dexter, T.M., E. Spooncer, R. Schofield, B.I. Lord, and P. Simmons, Haemopoietic stem cells and the problem of self-renewal. Blood Cells, 1984. 10(2-3): p. 315-39.
153. Chagraoui, J., A. Lepage-Noll, A. Anjo, G. Uzan, and P. Charbord, Fetal liver stroma consists of cells in epithelial-to-mesenchymal transition. Blood, 2003. 101(8): p. 2973-82.
154. Hamamura, K., H. Matsuda, Y. Takeuchi, S. Habu, H. Yagita, and K. Okumura, A critical role of VLA-4 in erythropoiesis in vivo. Blood, 1996. 87(6): p. 2513-7.
155. Ohneda, O., N. Yanai, and M. Obinata, Combined action of c-kit and erythropoietin on erythroid progenitor cells. Development, 1992. 114(1): p. 245-52.
156. Slaper-Cortenbach, I., R. Ploemacher, and B. Lowenberg, Different stimulative effects of human bone marrow and fetal liver stromal cells on erythropoiesis in long-term culture. Blood, 1987. 69(1): p. 135-9.
157. Hunt, H. and D. Premar, Flexed-tail a mutation in the house mouse. Anat. Rec., 1928. 41: p. 117.
158. Russell, E.S., Margaret W. Thompson, and Eleanor C. McFarland, Analysis of effects of W and f genic substitutions on fetal mouse hematology. Genetics, 1968. 58: p. 259-270.
159. Gruneberg, H., The anaemia of the flexed-tail mouse (Mus musculus L.) I. Static and dynamic haematology. Journal of Genetics, 1942. 43: p. 45-68.
160. Gruneberg, H., The anaemia of the flexed-tail mice (Mus musculus L.) II. Siderocytes. Journal of Genetics, 1942. 44: p. 246-271.
161. Cole, R., J. Garlick, and R. Tarbutt, Disturbed haem and globin synthesis in reticulocytes of prenatal flexed-tail (f/f) anaemic mice. Genet. Res., Camb., 1974. 23: p. 125-135.
162. Chui, D., G. Sweeney, M. Patterson, and E. Russell, Hemoglobin synthesis in siderocytes of flexed-tail mutant (f/f) fetal mice. Blood, 1977. 50: p. 165-177.
163. Bateman, A. and R. Cole, Colony forming cells in the livers of prenatal flexed (f/f) anaemic mice. Cell Tissue Kinet., 1972. 5: p. 165-173.
164. Cole, R. and T. Regan, Haematopoietic Progenitor cells in the prenatal conegenitally anaemic "Flexed-tail" (f/f) mice. British Journal of Haematology, 1976. 33: p. 387-394.
165. Coleman, D., E. Russell, and E. Levin, Enzymatic studies of the hemopoietic defect in flexed mice. Genetics, 1969. 61: p. 631-642.
166. Gregory, C., E. McCulloch, and J. Till, The Cellular Basis for the defect in haematopoiesis in flexed-tail mice. III Restriction of the defect to erythropoietic progenitors capable of transient colony formation in vivo. British Journal of Haematology, 1975. 30: p. 401-410.
66
167. Thompson, M., E. McCulloch, L. Siminovitch, and J. Till, The cellular basis for the defect in haematopoiesis in flexed-tail mice. I. the nature and persistence of the defect. Br J Haematol, 1966. 12: p. 152-160.
168. Cole, R., T. Regan, and R. Tarbutt, Haemoglobin synthesis in reticulocytes of prenatal f/f anaemic mice. B J Haematol, 1972. 23: p. 443-452.
169. Fowler, J., J. Till, E. McCulloch, and L. Siminovitch, The cellular basis for the defect in haematopoiesis in flexed-tail mice. II. The specificity of the defect for erythropoiesis. Br. J Haematol, 1967. 13: p. 256-264.
170. Lenox, L.E., hematocrit values during the recovery from a PHZ induced acute anemia in +/+, f/+ and f/f mice, Penn State University.
67
Figu
re 1
-1.
The
hem
atop
oiet
ic sy
stem
.(Fr
om th
e Lu
nd S
tem
Cel
lCen
ter:
http
://w
ww
.mol
med
.lu.se
/hem
atop
oies
is_p
00.h
tm)
68
Figure 1-2. Dual stem cell model of hematopoietic stem cell ontogeny.(From Palis and Yoder, 2001 [1]; hypothesis proposed by Godin et al. 1995. Proc. Natl. Acad. Sci. USA 92: 773-777). Mesoderm (M) cells spread laterally from the primitive streak to contribute to the formation of extra-embryonic and intra-embryonic tissue. Extra-embryonic yolk sac HSCs and intra-embryonic HSCs arise from mesoderm (M) during gastrulation. The aorta-gonad-mesonephros region (AGM) differentiates from paraaortic splanchnopleura(P-SP). Hematopoietic cells will seed the fetal liver once circulation has been established. Finally, cells will migrate to the bone marrow which remains the main site of hematopoiesis in the adult.
69
Figu
re 1
-3.
Dev
elop
men
t and
feat
ures
of t
he ‘h
emog
enic
’ reg
ions
dur
ing
embr
yoge
nesi
s. (F
rom
Gar
cia-
Porr
ero
et a
l. 19
98 [1
6]).
Hem
ogen
icre
gion
s giv
e ris
e to
hem
atop
oiet
ic c
ells
from
the
extra
-em
bryo
nic
yolk
sac
(YS)
at e
mbr
yoni
c da
y 7.
5 (E
7.5)
and
intra
-em
bryo
nic
regi
on sp
lanc
hnop
leur
a (S
p) a
t the
pre
som
itic
stag
e (E
7.5)
. A
fter t
he 1
0-12
som
ite st
age,
in
tra-e
mbr
yoni
c he
mat
opoi
etic
pot
entia
l is r
estri
cted
to th
e pa
raao
rtic
spla
nchn
ople
ura
(P-S
p), w
hich
will
giv
e ris
e to
the
aorta
, gon
ads a
nd m
eson
ephr
os (A
GM
regi
on) f
ollo
win
g or
gano
gene
sis.
Dep
icte
d ar
e th
e po
tent
ials
of t
he h
emat
opoi
etic
ce
lls a
t the
var
ious
loca
tions
.
(SCL/Tal1)(LMO2)
(GATA2)
(EKLF)(GATA1)
(KIT)
70
(SCL/Tal1)(LMO2)(GATA2)
(EKLF)(GATA1)
Figure 1-4. Stages of erythroid development. (From Koury, MJ et al. 2002 [73 ] and Israels, LG and Israels, ED 2003 [75 ]). Erythropoiesis from CFU-GEMM to erythrocyte; developmental stages, regulatory cytokines, cell-surface receptors, erythroid transcription factors and hemoglobin synthesis. Basic helix-loop-helix factor (SCL/TAL1); LIM-domain partner of TAL1 (LMO2); zinc finger factors that bind GATA sequences (GATA-1, GATA-2); erythroid Krüppel-like factor; stem cell factor receptor (KIT).
71A)
B)
Figure 1-5. Erythropoietin: regulation and signaling. The 3’ enhancer element of the Epo gene is highly conserved between the murine and human systems. Shown in (A) is an expanded view of this enhancer in the human gene. Sites that are functionally critical for hypoxic induction are underscored in red. Binding of HIF-1, HNF-4, and p300 is illustrated (From Ebert, BL and Bunn, F 1999 [77]). (B) Model of the Epo receptor. Important residues or motifs are marked on the left side of the figure (cysteine: C; tyrosine: Y; arginine: R; serine: S; tryptophan: W), including their position. Important signaling pathways and negative regulatory loop are indicated on the right side of the model. P indicates the phosphorylation necessary for the activation of the pathway (From Dame, C 2003 [85]).
72A)
bh2 bh3(chr7)
(βmaj) (βmin)
B)
Figure 1-6. Schematic of globin genes. (A) Murine α-globin loci. Genes are represented by solid boxes and vertical arrows represent DNase I hypersensitive sites (From Trimborn, T. et al. 1999 [104]) (B) Comparison of the human and mouse β-Globin clusters. The LCR is shown as a yellow box; numbers 1-6 represent the upstream hypersensitive sites. The horizontal green (embryos), blue (fetus) and red (adult) lines represent the developmental stages at which the various genes are expressed; the pseudogenes bh2 and bh3 are shown as gray lines; (βmaj and βmin) are the gene products from the b1 and b2 genes respectively in Hbbd (diffuse) mice (From Higgs, D. R. 1998 [107]).
73
A B
Figure 1-7. CFU-E in the fetal liver of f/f and +/+ mice. (A) Numbers of CFU-E (able to form colonies of 16 or more cells) in livers of prenatal f/f ( ) and +/+ ( ) mice and numbers of colonies formed from +/+ ( ) and f/f ( ) livers without additional erythropoietin. (B) Proportions of CFU-E in livers of prenatal f/f and normal mice. (Cole and Regan 1976 [161]).
74
Figure 1-8. Percentage of siderocytes in reticulocytes of f/f and f/+ control fetal and neonatal mice. The solid lines refers to anemics (f/f), the broken line to their normal siblings (f/+) (Gruneberg; II Siderocytes, 1942 [157]).
75
Figure 1-9. Diagram of hemoglobin biosynthesis. (Taken from http://cls.umc.edu/COURSES/CLS312/hgbsynth.doc).
Coproporphyrinogen Oxidase(in mitochondria)
(in cytoplasm)
(in mitochondria)
76
Figure 1-10. Chromatography of globin chains synthesized by day 18 +/+ (A) and f/f (B) fetal erythrocytes. Cells were labeled with 3H-leucine for 90 min. Non-isotopic adult hemolysate was added before globin chains were prepared and isolated. There were more +/+ than f/f fetal erythrocytes collected for this set of experiments, which accounted for the higher incorporation of 3H-leucine into globin chains in +/+ cells (Chui, et al. 1977 [159]).
77
Figure 1-11. Incorporation of 59Fe into heme from CFU-S of f/f and +/+ mice.Incorporation of 59Fe into heme by cells derived from the spleens of irradiated (C3HXC57BL)F1 hosts which received transplants of 2X106 marrow cells (containing appox. 300 CFU), obtained from f/f ( ) or +/+ ( ) donors. 59 Fe incorporation is expressed as that percentage of the activity added to the incubation tube which was incorporated by 1.2X107 spleen cells in 45 minutes. The combined results of five experiments are given and the limits indicated are standard errors of the means (Thompson, M., et al. 1966. [164]).
78
Figure 1-12. Changes in spleen weight and reticulocyte counts in flexed and wild-type mice recovering from phenylhydrazine induced acute anemia. Each point represents the average value obtained from at least 10 mice (Coleman, D.L. et al. 1969 [162]).
A)+/+f/f
79
AL
D A
ctiv
ity (U
nits
/ g
Sple
en)
B)
Figure 1-13. Effects of phenylhydrazine treatment on enzymes of the hemoglobin biosynthetic pathway in spleen from flexed and wild-type mice. A) δ-aminolevulinate dehydratase (ALD) activity. Units of activity are µmoles of porphobilinogen produced per hour per g of spleen. Each point represents the average value obtained from 4 to 8 separate assays performed on individual spleens. B) Uroporphyrinogen synthetase activity. Each point represents the average value obtained from 4 to 6 separate assays. Each assay was run on the combined homogenates of spleen from 2 to 3 treated mice (Coleman, D.L. et al. 1969 [162]).
80A)
B)
Figure 1-14. Transient endogenous spleen colonies (TE-CFU) in the spleens of wild-type and flexed-tail mice. A) +/+ or f/f mice (seven per group) were exposed to 800 rads of radiation followed by 10 units of Epo; spleens were examined 5 days later for TE-CFU. To test whether the marked differences seen between f/f and +/+ mice were cell autonomous, the experiments were repeated using chimeras prepared by repopulating B6C3F1 mice with bone marrow derived from either genotype. B) To examine the kinetics of endogenous colony formation in more detail, time course experiments were performed. Shown are the colony formation in the spleens of +/+ ( ) or f/f ( ) chimeras given 800 rads and 10 Units of Epo at time zero. Values graphed are the means ±SE for groups of four mice per point except on day 11 and 12 where only two or three mice remained (Gregory, C.J. et al.1975 [163]).
81
Chapter 2
MAPPING OF THE flexed-tail (f) LOCUS LEADS TO THE DISCOVERY THAT BMP4 AND Madh5 REGULATE THE ERYTHROID RESPONSE TO ACUTE
ANEMIA
Forward
To clone the gene responsible for a mutation, first the locus must be
mapped to a precise interval on a particular chromosome. Candidate genes are selected,
and any mutations found within the candidate gene must be shown to co-segregate with
the mutant phenotype. It follows that biochemical evidence should be presented to verify
that the mutated gene is causing the phenotype. This could include variations of
transcripts or protein levels between wild-type and mutant animals or even recapitulating
the defective function and/or rescue of the defect in vitro. More conclusive than
biochemical evidence is functional evidence where a critical mechanism is shown to be
disrupted by a mutation in the candidate gene, which can be rescued by the wild-type
gene in vivo. Showing allelism with other known mutations is also a way to functionally
support the fact your candidate gene is the cause of the mutant phenotype.
Madh5 (Smad5) has been shown through in vivo and in vitro functional data to be
the flexed-tail locus. The complexity of the mutation and the genomic structure of
Smad5, as well as the nuances of the Smad5/BMP4 signaling pathway have surfaced
through various strategies used to prove f=Smad5. Appendix A contains information on
some of the experiments performed throughout the course of the flexed-tail project.
82
Although not exhaustive, it describes the most relevant experiments devised to either
locate the mutation or provide evidence for Smad5 being the f locus. Due to the lack of
positive results, inconsistencies or ambiguities obtained, they were not contained in the
published Blood manuscript.
John Perry and I were co-first authors on the above mentioned Blood manuscript
(Lenox, L.E., J.M. Perry and R.F. Paulson, BMP4 and Madh5 regulate the erythroid response to acute
anemia. Blood, 2005. 105(7): p. 2741-8.) The following sections are directly from this
manuscript. The colony assays, including those from sorted cells, and the BMP4
expression data were the work of John M. Perry.
83
Abstract
Acute anemia initiates a systemic response that results in the rapid mobilization
and differentiation of erythroid progenitors in the adult spleen. flexed-tail (f) mutant mice
exhibit normal steady state erythropoiesis, but are unable to rapidly respond to acute
erythropoietic stress. Here we show that f/f mutant mice have a mutation in Madh5. Our
analysis shows that BMP4/Madh5 dependent signaling, regulated by hypoxia, initiates
the differentiation and expansion of erythroid progenitors in the spleen. These findings
suggest a new model where stress erythroid progenitors, resident in the spleen are poised
to respond to changes in the microenvironment induced by acute anemia.
84
Introduction
Erythropoiesis in the bone marrow is primarily homeostatic; however, the
situation is dramatically different in the adult spleen in response to acute erythropoietic
stress, where rapid, expansive erythropoiesis occurs. Previous work suggested a model
where acute anemia leads to tissue hypoxia, which induces erythropoietin (Epo)
expression in the kidney. Increased levels of serum Epo mobilize cells from the bone
marrow, which migrate to the spleen where they expand and differentiate [1, 2]. The
spleen contains a unique microenvironment that can support expansive erythropoiesis [3].
However the signals that regulate the increase in splenic erythropoiesis in response to
acute anemia are not clear. The expansive erythropoiesis observed in the adult spleen is
similar to fetal liver erythropoiesis during development [4]. In both cases rapid erythroid
development occurs.
Similar to the spleen, fetal liver stromal cells are capable of supporting the
expansion of erythroid progenitors [5]. Because of these common features it has been
suggested that splenic and fetal liver erythropoiesis may be mechanistically similar. This
link between the fetal liver and spleen is apparent in mice with a mutation at the flexed-
tail (f) locus. During fetal development, f/f mutant embryos exhibit a severe microcytic,
hypochromic anemia [6-8]. f/f fetal livers contain about 50% the normal number of
erythroid progenitors [9,10] and have a maturation defect, which results in the production
of large numbers of siderocytes or erythrocytes that contain non-heme iron granules
[8,11]. Despite these defects, the anemia of f/f mice resolves about two weeks after birth.
Adult f/f mice exhibit normal numbers of steady state erythroid progenitors [12].
However, they are unable to respond rapidly to acute erythropoietic stress. This defect is
85
manifested by a delay in the expansion of erythroid progenitors in the spleen and a delay
in the appearance of reticulocytes following Phenylhydrazine (PHZ) induced acute
anemia [13]. Despite the delayed response, adult f/f mice do not exhibit the maturation
defect present during fetal liver erythropoiesis because no siderocytes are observed
during the recovery from acute anemia [14]. These observations demonstrate that the f
gene product plays a key role in regulating the expansion and maturation of erythroid
progenitors at times of great erythropoietic need.
Previous work has suggested that f/f mice have a mutation in sideroflexin 1
(sfxn1), a putative mitochondrial transporter, which is proposed to play a role in the
transport of molecules required for heme biosynthesis [15]. In this report, however, we
show that f/f mice have a mutation in the Madh5 gene, which directly affects the ability
of f/f mice to respond to acute anemia. Madh5 functions as a receptor activated Smad
downstream of the BMP2, 4 and 7 receptors [16,17]. Previous work has implicated
BMP’s and in particular BMP4 in the development of mesodermal cells that will give rise
to hematopoietic cells early in development [18]. Our work shows that in response to
acute anemia, BMP4 is rapidly induced in the spleen. BMP4 acts on an immature
progenitor cell causing it to differentiate into an Epo responsive stress erythroid
progenitor. Cell sorting experiments showed that BMP4 responsive cells exhibit the same
cell surface phenotype as the bone marrow derived Megakaryocyte-Erythroid progenitors
(MEPs) [19], however, only spleen MEPs respond to BMP4. These results demonstrate
that these spleen progenitors exhibit properties that are distinct from bone marrow
erythroid progenitors suggesting that they represent a population of “stress erythroid
86
progenitors” resident in the spleen whose function is to rapidly generate erythrocytes at
times of great erythropoietic need.
87
Methods
Mice. C57BL/6 and C57BL/6-f mice were obtained from Jackson Laboratory.
Madh5+/- mice were obtained from Dr. C. Deng [20]. All mice were approximately 6-8
weeks old, controls were age matched. Acute anemia was induced by injection of
Phenylhydrazine (Sigma, St. Louis, MO) at a concentration of 100 mg/Kg mouse in PBS.
Colony Assays for BFU-E. Splenocytes, bone marrow, and peripheral blood
cells were isolated from C57BL/6 control f/+ and f/f mice. 1x105/ml nucleated bone
marrow and peripheral blood cells and 2x106/ml nucleated splenocytes were plated in
methylcellulose media (StemCell Technologies, Vancouver, BC) containing 3U/ml Epo +
either 10 ng/ml IL3 (Sigma, St. Louis, MO) or 0.15-15 ng/ml BMP4 (R&D Systems,
Minneapolis, MN) where indicated. BFU-E were scored as described [21]. For the BMP4
pre-incubation experiment, splenocytes and bone marrow cells from C57BL/6 and f/f
mice were incubated for 24 hours in IMDM + 5% FCS + 15 ng/ml BMP4. Colony assays
were then performed as indicated above + 15 ng/ml BMP4 for each.
Characterization of the Epo sensitivity of the stress BFU-E. Colony assays
were performed as above on bone marrow and spleen cells in the presence of 0.1, 0.3, 1,
3, and 10 U/ml Epo as indicated. Additionally, bone marrow cells were supplemented
with 50 ng/ml SCF while splenocytes were supplemented with 15 ng/ml BMP4. Colonies
were scored as above.
Cloning of Madh5 mRNAs from f/f, f/+ and control mice. Total RNA was
isolated from single cell suspensions of spleen cells using the TRIzol reagent (Invitrogen,
Carlsbad, CA) according to manufacturer’s instructions. cDNA was generated and
88
Madh5 cDNA was amplified using 5’-GGGGCCGAGCTGCTAAT-3’ and 5’-
CTATGAAACAGAAGAAATGGGG-3’ primers.
Analysis of BMP4 expression. Total RNA isolated from bone marrow or spleen
cells homogenized in TRIzol (Invitrogen, Carlsbad, CA) was reverse transcribed into
cDNA. PCR was performed using primers 5’-TGTGAGGAGTTTCCATCACG-3’ and
5’- TTATTCTTCTTCCTGGACCG-3’.
Staining of Spleen sections with anti-BMP4 antibodies. Spleens were harvested
on the indicated days post PHZ induced anemia, fixed in Zinc fixative and paraffin
embedded tissues sections were cut. The expression of BMP4 was analyzed as described
[22] using anti-BMP4 antibody (Novocastra Laboratories/Vector Laboratories,
Burlingame, CA). Slides were analyzed by confocal microscopy.
Cell staining and sorting. Bone marrow and spleen MEPs were sorted as
previously described [19] with the exception that FITC-conjugated anti-c-kit was used
(and APC-conjugated anti-c-kit and FITC-conjugated anti-CD34 eliminated) for spleen
sorts after determining that FITC conjugated anti-CD34 did not stain spleen cells. Cells
were washed twice and sorted using a Coulter Elite ESP flow cytometer. Cells were
plated in methylcellulose and scored as described in colony assays for BFU-E above.
Analysis of BMP4 signaling in W-20-17 osteoblast cells. The cDNAs coding
the f/f truncated transcripts, as well as full length Madh5 were cloned into the MSCVneo
retroviral construct. Recombinant virus was generated as previously described [23] and
used to infect W-20-17 cells (ATCC, Manassas, VA). Pools of neoR colonies were plated
and induction of alkaline phosphatase by BMP4 was measured as described [33].
89
Results
flexed-tail mutant mice exhibit a delayed expansion of erythroid progenitors in the
spleen in response to acute anemia. In order to identify the origin of the defect, we
characterized the response of f/f, f/+ and control mice to acute anemia using a modified
PHZ induced hemolytic anemia protocol that rapidly induced severe anemia (hematocrit
30% treated v. 50% untreated) in 12 hours. Similar to previous findings, we observed that
early erythroid progenitors (BFU-E) in the bone marrow were not elevated in response to
anemia and in fact gradually declined over time (Figure 2-1A). The greatest difference
was observed in the spleen and peripheral blood. In the spleen, control mice exhibited an
expansion of BFU-E that peaked at 36 hours post anemia induction. Similarly, f/+ mice
showed the greatest expansion at 36 hours but unlike control mice we also observed a
significant expansion later at 4 and 6 days post anemia. In contrast, the expansion was
significantly delayed in the f/f mice where it peaked at 4 days post anemia induction
(Figure 2-1B). These results correlate with previous data showing that the f/f mice were
delayed in the expansion of erythroblasts in the spleen following anemia induction [13].
In the peripheral blood, however, we did not identify any BFU-E potentially migrating
from the bone marrow to the spleen at any of the time points in the f/f, f/+ or control mice
(data not shown). These results suggest a new model where progenitor cells resident in
the spleen mediate the response to acute anemia.
Splenic erythroid progenitors that expand in response to acute anemia exhibit
distinct properties. Bone marrow BFU-E colonies have a distinct morphology, develop
in 7 days in culture and require two signals to develop. The first signal is Epo and the
90
second is a Burst-Promoting Activity (BPA), which in vivo is SCF, but in vitro IL-3 or
GM-CSF can substitute. We observed that the BFU-E colonies from spleen 36 hours post
anemia induction exhibited altered morphology. The colonies were larger, had more
small satellite colonies associated with the BFU-E. They also grew faster such that spleen
colonies grown for 5 days resembled bone marrow colonies that had grown for 7 days
and spleen BFU-E were routinely grown for 5 days out of convenience. In many ways
these erythroid progenitors resembled fetal liver erythroid progenitors, which are known
to exhibit a faster cell cycle than bone marrow BFU-E. Fetal liver BFU-E can also
develop in media containing only Epo, without an added BPA [24]. Given that f/f mice
also have a defect in fetal liver, we repeated the analysis of bone marrow, peripheral
blood and spleen BFU-E following induction of acute hemolytic anemia, however this
time cells were cultured in media containing only Epo. The bone marrow contained very
few cells that could form BFU-E colonies in Epo only media (Figure 2-1C). In the control
and f/+ spleens however, the expansion of BFU-E at 36 hours was completely
recapitulated when the cells were plated in Epo only media (Figure 2-1D). In fact more
splenic BFU-E colonies developed in this media. Similar to the initial observations, the f/f
mice exhibited a delay in the expansion of BFU-E with the maximum number of colonies
observed at 4 days post anemia induction. The number of spleen BFU-E observed under
the Epo only culture conditions responded in a linear manner when increasing numbers of
cells were plated, which suggests that the spleen cells are not producing a BPA (data not
shown). Once again we did not identify any BFU-E in the peripheral blood at any of the
time points in the f/f, f/+ or control mice indicating that these BFU-E are resident in the
spleen.
91
In addition to shorter cell cycling times, fetal liver erythroid progenitors also
exhibit an increased sensitivity to Epo [24]. We tested the Epo-sensitivity of splenic
erythroid progenitors. We observed that these progenitor cells were actually less sensitive
to Epo than bone marrow cells (Figure 2-1E). Decreased Epo sensitivity is an ideal
property of a stress progenitor, because differentiation of these progenitors would be
dependent on the high serum Epo concentrations only present during the response to
acute anemia. Taken together, these results suggest that the spleen contains a distinct
population of erythroid progenitors that are poised to respond to acute erythroid stress.
These progenitors, which we will refer to as “stress BFU-E”, form large burst colonies in
5 days, require only Epo at relatively high levels to develop and are resident in the spleen.
f/f mice have mutation in the Madh5 gene. The flexed-tail locus is located on mouse
chromosome 13 [25]. We generated a panel of 408 F2 progeny using a F1(C57BL/6-f/f X
BALB/c) intercross. F2 progeny were scored at birth for anemia by hematocrit and for
the presence of siderocytes by staining blood smears for iron deposits. We constructed a
high resolution genetic linkage map of the f locus and initially localized the gene 0.6 cM
distal to the microsatellite marker D13MIT13. Further analysis of markers showed that
the f locus co-segregated with the marker D13Mit208 (Figure 2-2A). Our linkage
mapping results differ from the recent work from Fleming et al. [15]. They mapped the f
locus to a more proximal position on chromosome 13 and identified a mutation in the
sideroflexin 1 (sfxn1) gene, which they proposed caused the f/f mutant phenotype. Since
there is only a single allele of the f mutation, all f/f must carry the same mutation [26].
Like Fleming et al., our colony of C57BL/6J-f mice was derived from C57BL/6J-f mice
92
obtained from the Jackson Laboratory. However, when we scored our f/f progeny for the
presence of the mutation in exon 2 of Sfxn1, we identified f/f progeny that exhibited
severe anemia and siderocytes at birth, but were heterozygous for the insertion mutation
(Appendix B). These results suggest that in our colony, the f mutation has been separated
from the mutation in Sfxn1 by recombination and thus, mutation of Sfxn1 cannot be the
cause of the f/f mutant phenotype.
In order to identify candidate genes for the f locus, we initially took advantage of
the fact that one of our flanking markers, D13Mit13, is located in the IL-9 gene [27]. This
region of mouse chromosome 13 is homologous to human chromosome 5q31.
Comparison of the human and mouse gene maps in region immediately surrounding IL-9
revealed MADH5 was located in this region. The possibility that Madh5 was encoded by
the f locus was supported by the recent mouse genome sequence release that showed that
D13MIT208 is located in the Madh5 gene. Previous work in Xenopus and mice has
demonstrated that BMP4/Madh5 dependent signals play a key role in the development of
erythroid cells [18,28]. Madh5 is highly expressed in the fetal liver during development
[29] and we have observed Madh5 expression in the spleen of mice recovering from PHZ
induced acute anemia (Data not shown).
To determine whether Madh5 is mutated in f/f mice, we cloned the entire coding
region of Madh5 by RT-PCR from spleen RNA isolated from C57BL/6J-+/+, C57BL/6J-
f/+ and C57BL/6J-f/f mice. Only the expected product was observed in wildtype mice,
however in both f/+ and f/f mice an additional band was observed (Figure 2-2B). The
majority of the mRNA in f/+ mice is the wildtype fragment, while in f/f mice the majority
of the mRNA is a truncated mRNA. The level of wildtype message in f/f mutant mice
93
varies, but most express <30% wildtype mRNA. Analysis of the sequence of the
truncated mRNA showed that it is a mixture of two mis-spliced mRNAs. The consistent
feature of these mutant mRNAs was the deletion of exon 2, which contains the AUG
initiator codon. In one of the mis-spliced mRNAs we also observed deletion of exon 4
and insertion of a 15 nucleotide sequence at the splice junction between exons 6 and 7. In
the other mis-spliced mRNA, we observed an aberrant splice into the middle of exon 3
(Figure 2-2). There were no other alterations in the coding sequence of Madh5 observed
in f/f mice. Southern blot analysis of the Madh5 genomic region did not identify any
deletions or rearrangements in the Madh5 locus suggesting that the alterations in the
Madh5 mRNA in f/f mice are due to defects in mRNA splicing (data not shown). We
have sequenced the entire Madh5 transcription unit from f/f and control mice and have
not identified a consistent mutation, which suggests that the defect may lie in the
promoter or 3’ to the Madh5 gene. We are currently investigating this possibility.
BMP4 expression is induced in the spleen just prior to the expansion of “stress BFU-
E”. The identification of aberrantly spliced Madh5 mRNA in f/f mice suggests a role for
the BMP2, 4 and 7 signaling pathways in the response to acute anemia [16, 30]. We
investigated the expression of BMP2, 4 and 7 in the spleen during the response to acute
anemia by RT-PCR. BMP2 is not expressed in the spleen at any time point during the
recovery from acute anemia, while BMP7 is expressed at low levels at all times tested
(data not shown). BMP4 is not expressed in the spleen of untreated mice, however
expression is initiated at 12 hours, peaks at 24 hours with lower levels at 36 and 48 hours
post anemia induction. We also observe low levels at 6 and 8 days post anemia induction.
94
The highest expression observed at 24 hours post anemia induction is just prior to the
expansion of “Stress BFU-E” in the spleen (Figure 2-3A). Staining of spleen sections
with anti-BMP4 antibodies showed that BMP4 protein was not present in untreated mice,
however high-levels of BMP4 was observed throughout the red pulp of the spleen at 24
and 36 hours post anemia induction, but expression is severely decreased by 48 hours and
essentially off by 96 hours post anemia induction (Figure 2-3B). BMP4 was excluded
from the white pulp.
The expression of BMP4 is tightly regulated during the response to acute anemia.
During the analysis of the BMP4 expression by RT-PCR, we also tested the expression in
f/f mice. Surprisingly, BMP4 expression is expanded in the mutant mice and untreated
mice at all the time points during the response to acute anemia exhibit BMP4 expression
(Figure 2-3A). The expression of BMP4 in untreated f/f correlates with the observation of
stress BFU-E in these mice (See Figure 2-1D). Despite the constitutive mRNA
expression, BMP4 protein expression was not observed at all time points suggesting that
BMP4 expression is regulated post-transcriptionally. These observed differences in
BMP4 expression in f/f mice suggest that the regulation of BMP4 may require a Madh5-
dependent signal to inhibit the expression of BMP4 in the spleens of untreated mice.
The increase in serum Epo concentration that occurs during the response to acute
anemia is regulated at the transcriptional level by the hypoxia inducible transcription
factor complex, HIF-1 [31]. Given that Epo expression is regulated by hypoxia we tested
whether BMP4 expression is also hypoxia inducible. MSS31 spleen stromal cells [32],
which support erythroid progenitor cell expansion in vitro, were grown in normoxic (20%
O2) and hypoxic (6% O2) conditions. At low oxygen concentration, the expression of
95
BMP4 was significantly increased (Figure 2-3C). Analysis of the BMP4 gene revealed the
presence of a putative HIF element in the 3’UTR, which is conserved in the human, rat
and mouse BMP4 genes.
BMP4 causes the differentiation of an immature progenitor cell into an Epo
responsive stress BFU-E. Given that BMP4 was induced in the spleen just prior to the
expansion of stress BFU-E, we next tested whether culturing spleen cells from untreated
mice in Epo and BMP4 could induce the expansion of stress BFU-E. Spleen cells from
untreated f/f and control mice were plated in methylcellulose media containing 3U/ml
Epo and various concentrations of BMP4. Control spleen cells responded in a dose
dependent manner to BMP4 with a 6.1 fold increase in the number of stress BFU-E seen
at a 15 ng/ml BMP4 dose (Figure 2-4A). f/f spleen cells failed to respond to BMP4 except
at the highest concentration, which is consistent with their defect in Madh5. BMP4 had
very little effect on the number of BFU-E in the bone marrow suggesting that there are
very few BMP4 responsive erythroid progenitor cells in the bone marrow (Figure 2-4A).
We did not detect any BMP4 responsive cells in the peripheral blood in untreated or in
mice treated with PHZ to induce anemia (data not shown).
BMP4 can induce the expansion of stress BFU-E, but the mechanism by which
BMP4 affects these cells is not clear. One might imagine two possible roles for BMP4.
First BMP4 could synergize with Epo to promote the differentiation of stress BFU-E,
much like SCF synergizes with Epo to increase the number and size of bone marrow
BFU-E [33]. Alternatively, BMP4 may act on an earlier cell inducing it to differentiate
into an Epo responsive stress BFU-E. This possibility is similar to the situation in
96
Xenopus embryos where BMP4 can induce mesodermal cells to become erythroid
progenitors [18]. To test these possibilities, we pre-incubated spleen cells from untreated
mice with and without BMP4 for 24 hours, washed the cells and then plated them in
methylcellulose media containing either Epo alone or Epo and BMP4. The cells pre-
incubated with BMP4 and plated in Epo alone gave rise to as many stress BFU-E
colonies as the cells plated in Epo and BMP4 (Figure 2-4B). These results suggest that a
short exposure to BMP4 promotes the differentiation of an immature BMP4 responsive
(BMP4R) cell into an Epo responsive stress BFU-E.
f is a gain of function allele of Madh5. Our analysis shows that the f mutation maps to
the Madh5 locus, f/f mice express misspliced mRNAs, and spleen cells from f/f fail to
respond to BMP4. Although all of these data are consistent with f being a mutation in
Madh5, we crossed f mice with Madh5+/- mice [20] to generate f/Madh5- mice to test
whether f was allelic to Madh5. Figure 2-5A shows the expansion of Stress BFU-E in
f/Madh5- and +/Madh5- during the recovery from acute anemia. Both genotypes exhibit
an altered recovery when compared to control (compare Figure 2-5A with Figure 2-1D).
The peak expansion of stress BFU-E in f/Madh5- is delayed until 48 hours, while
+/Madh5- exhibit an increase in Stress BFU-Es at 36 hours, they continue to expand at 48
hours. Analysis of BMP4 mRNA expression in these mice showed that both f/Madh5-
and +/Madh5- expressed BMP4 at all time points during the recovery (Figure 2-5B).
These data are similar to what is observed in f/f and f/+ mice suggesting that a Madh5
dependent signal is required for the regulation of BMP4 in the spleen. These results show
that the phenotype of f/Madh5- is more severe than f/+ and +/Madh5-, which
97
demonstrates that f is allelic to a targeted mutation in Madh5. Classical genetic analysis,
however, would predict that if f was a hypomorphic or loss of function mutation in
Madh5 then f/Madh5- should have a more severe phenotype than f/f. We observed the
opposite in that the f/f phenotype was the most severe. These data suggest that the f
mutation in Madh5 is a neomorphic or gain of function mutation in Madh5. To test this
possibility, we expressed each of the two mis-spliced Madh5 mRNAs identified in f/f
mice in a cell line that responds to BMP4 and analyzed whether these mRNAs could
affect BMP4 dependent responses. W-20-17 is a mouse osteoblast cell line that
differentiates in response to BMP4 [34]. The mutant transcripts as well as controls were
cloned in to the MSCV-neo retroviral vector and W-20-17 cells were infected with
recombinant retroviruses. Although the mis-spliced messages lack the initiator ATG of
wildtype Madh5, both messages contain in-frame ATGs that could be used to initiate the
translation of truncated forms of the Madh5 protein (Figure 2-6A). Treatment of W-20-17
cells with BMP4 induces the osteoblast differentiation program as measured by an
increase in Alkaline Phosphatase (AP) activity. W-20-17 cells that express either f mutant
message have a profound defect in BMP4 dependent induction of AP activity with
mutant message #1 exhibiting the most severe defect (Figure 2-6B). These results show
that the mis-spliced Madh5 mRNAs present in f/f mice dominantly suppress BMP4
dependent signals. Furthermore, W-20-17 cells do not express endogenous Madh5 (Data
not shown), but rather rely on Madh1 and Madh8 to transmit BMP4 signals, which
suggests that the mis-spliced mRNAs also inhibit signaling through Madh1 and Madh8.
These results explain why f/Madh5- mice have a less severe phenotype than f/f because
the f/Madh5- mice express lower levels of the mis-spliced mRNAs.
98
Spleen Megakaryocyte-Erythroid progenitors (MEPs) are the BMP4 responsive
cells. In order to further characterize the BMP4R cell, we fractionated spleen cells and
assayed for response to BMP4. Initially we sorted cells based on their expression of
lineage restricted markers. BMP4R cells were observed in the Lin- population (Figure 2-
7A). Previous work had demonstrated that mice with a mutation in the Kit receptor,
Dominant white spotting (W) mice, failed to respond rapidly to acute anemia, which
suggested that the BMP4R cell may also be Kit+ [35]. Analysis of Lin- Kit+ spleen cells
confirmed this hypothesis as BMP4R cells were not detected in Lin-Kit- spleen cells
(Figure 2-7B). In the bone marrow, erythroid progenitors are derived from the Common
Myeloid Progenitor (CMP) and the Megakaryocyte-Erythroid Progenitor (MEP) [19].
CMPs and MEPs are Kit+, but differ in their expression of CD34. We analyzed the
expression of CD34 in Lin- Kit+ spleen cells and observed that they were CD34-,
suggesting that the spleen does not contain CMPs (data not shown). Isolation of MEPs
from spleen showed that they responded to BMP4 (Figure 2-7C). Interestingly, MEPs
from isolated from bone marrow failed to respond to BMP4. These results suggest that
the unique microenvironment of the spleen alters the properties of MEPs rendering them
responsive to BMP4 and further underscores our assertion that distinct erythroid
progenitors are present in the spleen poised to respond to acute erythroid stress.
99
Discussion
Acute anemia induces a robust erythroid response that occurs in the spleen. Our
data demonstrate that in response to PHZ induced anemia, dedicated stress progenitors
resident in the spleen respond to a BMP4 dependent signal, which leads to the rapid
expansion of erythroid progenitors. These data differ from the previous model which
suggested that high serum Epo levels induced by tissue hypoxia mobilized erythroid
progenitors from the bone marrow to spleen where they expanded and differentiated [1,2].
This early model was based on the observation that BFU-E were present in the peripheral
blood during the recovery from acute anemia [1]. However, we did not observe migration
of erythroid progenitors in our studies and all of our data suggests that stress BFU-E are
resident in the spleen. One reason for the differences in our data could be that earlier
experiments cultured BFU-E for 10 days rather than the 5-7 days used in our studies. The
longer culture conditions may have allowed more immature cells to develop. In addition,
we used a modified protocol to induce anemia, which utilized a single injection of a high
dose of PHZ. This protocol results in a synchronous and reproducible expansion of
erythroid progenitors. The earlier experiments used multiple injections of a low dose of
PHZ. We have found that multiple low doses of PHZ did not allow us to look at early
events during the recovery and did not produce reliable results (L. Lenox and RF Paulson
unpublished observations 1999).
The earlier model suggested that bone marrow progenitors develop in the spleen
during the recovery. Our data however demonstrates that specialized BMP4R cells are
resident in the spleen. BMP4 induces these cells to differentiate leading to the expansion
of stress BFU-E in the spleen but not in the bone marrow. Stress BFU-E exhibit
100
properties that are distinct from bone marrow BFU-E in that they form large burst
colonies in 5 days rather than 7 days and they require only Epo without any added BPA
for BFU-E formation. Fractionation of spleen cells revealed that BMP4R cells are
contained within the MEP population. However, only spleen MEPs are able to respond to
BMP4. This observation suggests that the spleen microenvironment may provide a
specialized signal that enables spleen MEPs to respond to BMP4 [3]. This situation would
be similar to chondrogenesis, where pre-somitic mesoderm cells require BMP signals to
differentiate into chondrocytes, but are unable to respond to BMP unless they first
encounter a Sonic hedgehog signal [36].
The notion that f/f mice have defect in a spleen progenitor was first suggested
almost 30 years ago. Gregory et al. showed that f/f mice had normal numbers of BFU-E
and CFU-E, but were defective in transient endogenous colony forming units (TE-CFU)
[12]. This population of cells was defined by an in vivo assay that identifies progenitor
cells that form endogenous spleen colonies following sublethal irradiation and
stimulation of erythropoiesis by Epo injection or bleeding [37]. BMP4R cells exhibit many
of the properties expected in a putative TE-CFU. They are resident in the spleen, rapidly
expand at times of great erythropoietic need and require high levels of Epo for
differentiation. In addition to TE-CFU, previous work has identified other stress erythroid
progenitors in the spleen. Mice with mutations in the glucocorticoid receptor are slow to
respond to acute anemia and it has been suggested that a CD34+ Kit+ TER119+
population of cells fails to expand in these mutant mice [38]. Another group identified a
4A5+ TER119+ bipotential megakaryocyte-erythroid progenitor that expands in the
spleen following PHZ induced anemia [39]. However, both of these progenitors express
101
the lineage-restricted marker, TER119, which is not present on BMP4R cells or BFU-E in
general [40]. The relationship between these progenitors and the BMP4R cells and the
stress BFU-E is not understood, but the most likely possibility is that they are derived
from BMP4R cells.
Our analysis of f/f mice has identified a mutation in Madh5, which causes aberrant
splicing. The mis-spliced Madh5 mRNAs exert a dominant negative effect on BMP4
signaling which suggests that f represents a gain of function allele of Madh5. These mis-
spliced mRNAs inhibit BMP4 dependent signals in W-20-17 osteoblast cells, which do
not express endogenous Madh5, suggesting that the f mutant mRNAs inhibit BMP4
signaling mediated by Madh1 and/or Madh8. This possibility is consistent with our
observation that f/f exhibits a more severe phenotype than f/Madh5- mice. In this case, f/f
mice express higher levels of mis-spliced mRNAs and thus would have a more
significant impairment of BMP4 dependent signaling than f/Madh5- mice.
Previous work from Fleming et al. suggested that f was a mutation in the putative
mitochondrial transporter Sfxn1 [15]. We show that the mutation in Sfxn1has been
separated from the f locus by recombination in f/f mice in our colony. All of our
observations characterizing the BMP4 dependent expansion of stress BFU-E in the spleen
during the recovery from acute anemia and the defective response in f/f mice support the
idea that the f locus encodes Madh5. In addition, other phenotypes associated with f/f
mice, tail flexures and white belly spots, can easily be explained by defects in the BMP4
signaling pathway. The tail flexures are caused by defects in chondrogenesis that result in
vertebrae fusion [41]. BMP4 plays a key role in regulating chondrocyte development [36].
Furthermore, white belly spots are caused by defects in the migration of neural crest
102
derived melanocytes [42]. Inhibition of BMP4 signaling in chick embryos impairs the
ability of neural crest cells to migrate [43]. Thus the combination of the observed defects
in BMP4 dependent signals in f/f mice with the genetic interactions of f and Madh5-
alleles demonstrates that the f locus encodes Madh5.
103
References
1. Hara H, Ogawa M. Erythropoietic precursors in mice with phenylhydrazine induced anemia. Am J Hematol. 1976; 1:453-458.
2. Broudy V, Lin N, Priestley G, Nocka K, Wolf N. Interaction of stem cell factor and its receptor c-kit mediates lodgement and acute expansion of hematopoietic cells in the murine spleen. Blood. 1996; 88:75-81.
3. Obinata M, Yania N. Cellular and molecular regulation of erythropoietic inductive microenvironment (EIM). Cell Struct Funct. 1999; 24:171-179.
4. Palis J, Segel G. Developmental biology of erythropoiesis. Blood Rev.1998; 12:106-114.
5. Ohneda O, Yanai N, Obinata M. Microenvironment created by stromal cells is essential for a rapid expansion of erythroid cells in the mouse fetal liver. Development. 1990; 110:379-384.
6. Mixter R, Hunt H. Anemia in the flexed tailed mouse, Mus musculus. Genetics. 1933; 18:367-387.
7. Gruneberg H. The anaemia of the flexed-tail mouse (Mus musculus L.) I. Static and dynamic haematology. J Genetics. 1942; 43:45-68.
8. Gruneberg H. The anaemia of the flexed-tail mice (Mus musculus L.) II. Siderocytes. J Genetics. 1942; 44:246-271.
9. Bateman A, Cole R. Colony forming cells in the livers of prenatal flexed (f/f) anaemic mice. Cell Tissue Kinet. 1972; 5:165-173.
10. Cole R, Regan T. Haematopoietic Progenitor cells in the prenatal congenitally anaemic "Flexed-tail" (f/f) mice. Br J Haematol. 1976; 33:387-394.
11. Chui D, Sweeney G, Patterson M, Russell E. Hemoglobin synthesis in siderocytes of flexed-tail mutant (f/f) fetal mice. Blood. 1977; 50:165-177.
12. Gregory C, McCulloch E, Till J. The Cellular Basis for the defect in haematopoiesis in flexed-tail mice. III Restriction of the defect to erythropoietic progenitors capable of transient colony formation in vivo. Br J Haematol. 1975; 30:401-410.
13. Coleman D, Russell E, Levin E. Enzymatic studies of the hemopoietic defect in flexed mice. Genetics. 1969; 61:631-642.
14. Cole R, Regan T, Tarbutt R. Haemoglobin synthesis in reticulocytes of prenatal f/f anaemic mice. B J Haematol. 1972; 23:443-452.
15. Fleming M, Campagna D, Haslett J, Trenor C, Andrews N. A mutation in a mitochondrial transmembrane protein is responsible for the pleiotropic hematological and skeletal phenotype of flexed-tail (f/f) mice. Genes Dev. 2001; 15:652-657.
16. Massague J. How cells read TGF-β signals. Nat Rev Mol Cell Biol. 2000; 1:169-178.
17. Massague J, Chen YG. Controlling TGF-β signaling. Genes Dev. 2000; 14:505-520.
18. Huber T, Zhou Y, Mead P, Zon L. Cooperative effects of growth factors involved in the induction of hematopoietic mesoderm. Blood. 1998; 92:4128-4137.
104
19. Akashi K, Traver D, Miyamoto T, Weissman I. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature. 2000; 404:193-197.
20. Yang X, Castilla L, Xu X, et al.. Angiogenesis defects and mesenchymal apoptosis in mice lacking SMAD5. Development. 1999; 126:1571-1580.
21. Finkelstein L, Ney P, Liu Q, Paulson R, Correll P. Sf-Stk kinase activity and the Grb2 binding site are required for Epo-independent growth of primary erythroblasts infected with Friend virus. Oncogene. 2002; 21:3562-3570.
22. Marshall C, Kinnon C, Thrasher A. Polarized expression of bone morphogenetic protein-4 in the human aorta-gonad-mesonephros region. Blood. 2000; 96:1591-1593.
23. Melkun E, Pilione M, Paulson R. A naturally occurring point substitution in Cdc25A, and not Fv2/Stk, is associated with altered cell cycle status of early erythroid progenitor cells. Blood. 2002; 100:3804-3811.
24. Peschle C, Migliaccio A, Migliaccio G, et al.. Identification and characterization of three classes of erythroid progenitors in human fetal liver. Blood. 1981; 58:565-574.
25. Lyon M, Rastan S, Brown S. Genetic Variants and Strains of the Laboratory Mouse (ed 3rd). Oxford: Oxford University Press; 1996.
26. Hunt H, Premar D. Flexed-tail a mutation in the house mouse. Anat. Rec. 1928; 41:117. 27. Bult CJ, Blake JA, Richardson JE, et al.. The Mouse Genome Database (MGD): integrating biology with the genome. Nucleic Acids Res. 2004; 32 Database issue:D476-481.
28. Nakayama N, Lee J, Chiu L. Vascular endothelial growth factor synergistically enhances bone morphogenetic protein-4 dependent lymphohematopoietic cell generation from embryonic stem cells in vitro. Blood. 2000; 95:2275-2284.
29. Flanders K, Kim E, Roberts A. Immunohistochemical expression of Smads 1-6 in the 15-day gestation mouse embryo: signaling by BMPs and TGF-betas. Dev Dyn. 2001; 220:141-154.
30. Hogan B. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 1996; 10:1580-1594.
31. Ebert B, Bunn H. Regulation of the Erythropoietin Gene. Blood. 1999; 94:1864-1877.
32. Yanai N, Satoh T, Obinata M. Endothelial cells create a hematopoietic inductive microenvironment preferential to eythropoiesis in the mouse spleen. Cell Struct Funct. 1991; 16:87-93.
33. McNiece I, Langley K, Zsebo K. Recombinant human stem cell factor synergises with GM-CSF, G-CSF, IL-3 and Epo to stimulate human progenitor cells of the myeloid and erythroid lineages. Exp. Hematol. 1991; 19:226-231.
34. Binnerts ME, Wen X, Cante-Barrett K, et al.. Human Crossveinless-2 is a novel inhibitor of bone morphogenetic proteins. Biochem Biophys Res Commun. 2004; 315:272-280.
35. Harrison D, Russell E. The response of W/Wv and Sl/Sld amaemic mice to hematopoietic stimuli. Br. J. Haematol. 1972; 22:155-167.
105
36. Murtaugh L, Chyung J, Lassar A. Sonic Hedgehog promotes somatic chondrogenesis by altering the cellular response to BMP signaling. Genes Dev. 1999; 13:225-237.
37. Gregory C, McCulloch E, Till J. Transient erythropoietic spleen colonies: effects of erythropoietin in normal and genetically anemic W/Wv mice. J Cell Physiol. 1975; 86:1-8.
38. Bauer A, Tronche F, Wessely O, et al.. The glucocorticoid receptor is required for stress erythropoiesis. Genes Dev. 1999; 13:2996-3002.
39. Vannucchi A, Paoletti F, Linari S, et al.. Identification and characterization of a bipotent (erythroid and megakaryocytic) cell precursor from the spleen of phenylhydrazine-treated mice. Blood. 2000; 95:2559-2568.
40. Kina T, Ikuta K, Takayama E, et al.. The monoclonal antibody TER-119 recognizes a molecule associated with glycophorin A and specifically marks the late stages of murine erythroid lineage. Br J Haematol. 2000; 109:280-288.
41. Kamenoff R. Effects of the flexed-tail gene on the development of the house mouse. J Morphol. 1935; 58:117-155.
42. Christiansen J, Coles E, Wilkinson D. Molecular control of neural crest formation, migration and differentiation. Curr Opin Cell Biol. 2000; 12:719-724.
43. Sela-Donenfeld D, Kalcheim C. Regulation of the onset of neural crest migration by coordinated activity of BMP4 and Noggin in the dorsal tube. Development. 1999; 126:4749-4762.
0
50
100
150
0 12 24 36 48 4 6 8
BFU
-E
DControl
f/ff/+
Hours DaysPost PHZ Injection
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
A
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
C
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
B
Bone marrow Epo+IL-3
Bone marrow Epo
SpleenEpo+IL-3
SpleenEpo
0
25
50
75
100
0.1 0.3 1 3 10
Epo concentration U/ml
BFU
-E (%
Max
imal
) Bone MarrowSpleen
E.
0
50
100
150
0 12 24 36 48 4 6 8
BFU
-E
DControl
f/ff/+
Hours DaysPost PHZ Injection
0
50
100
150
0 12 24 36 48 4 6 8
BFU
-E
DControl
f/ff/+Control
f/ff/ff/+
Hours DaysPost PHZ Injection
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+Control
f/ff/ff/+
Hours DaysPost PHZ Injection
BFU
-E
A
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+Control
f/ff/ff/+
Hours DaysPost PHZ Injection
BFU
-E
C
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
C
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
BFU
-E
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+
Hours DaysPost PHZ Injection
0
50
100
150
0 12 24 36 48 4 6 8
Control
f/ff/+Control
f/ff/ff/+
Hours DaysPost PHZ Injection
BFU
-E
B
Bone marrow Epo+IL-3
Bone marrow Epo
SpleenEpo+IL-3
SpleenEpo
0
25
50
75
100
0.1 0.3 1 3 10
Epo concentration U/ml
BFU
-E (%
Max
imal
) Bone MarrowSpleen
E.
0
25
50
75
100
0.1 0.3 1 3 10
Epo concentration U/ml
BFU
-E (%
Max
imal
) Bone MarrowSpleen
0
25
50
75
100
0.1 0.3 1 3 10
Epo concentration U/ml
BFU
-E (%
Max
imal
) Bone MarrowSpleen
E.
106
Figure 2-1. Analysis of BFU-E expansion during the recovery from PHZ induced acute hemolytic anemia. (A) Bone marrow and (B) spleen BFU-E from C57BL/6-f/f, C57BL/6-f/+ and C57BL/6-+/+ control mice during the recovery from PHZ induced acute anemia. Cells were plated in methylcellulose media containing Epo (3 U/ml) and IL-3 (10 ng/ml). (C) Bone marrow and (D) spleen BFU-E from C57BL/6-f/f, C57BL/6-f/+ and C57BL/6-+/+ control mice during the recovery from PHZ induced acute anemia. Cells were plated in methylcellulose media containing only Epo (3 U/ml). (E) Sensitivity of bone marrow and spleen BFU-E to Epo. A total of 5x105 bone marrow or spleen cells were plated in methylcellulose media containing the indicated concentrations of Epo plus 50 ng/ml SCF (bone marrow, ) or 15 ng/ml BMP4 (spleen, ). The asterisk indicates P= 0.02. Error bars represent standard deviation.
D13Mit248
D13Mit65
flexed -tail
D13Mit279
D13Mit208
D13Mit21
D13Mit41
D13Mit186
Sfxn1
D13Mit250D13Mit13
D13Mit122
C57
BL/
6-+/
+
C57
BL/
6-f/
+
C57
BL/
6-f/
f
*
Wildtype
flexed-tail
1 ∆3 5 6 74
StopATG
1 2 4 5 6 73
cctgttcatttccag
1 3 5 6 7
**
A.
B.
D13Mit248
D13Mit65
flexed -tail
D13Mit279
D13Mit208
D13Mit21
D13Mit41
D13Mit186
Sfxn1
D13Mit250D13Mit13
D13Mit122
C57
BL/
6-+/
+
C57
BL/
6-f/
+
C57
BL/
6-f/
f
*
Wildtype
flexed-tail
1 ∆3 5 6 741 ∆3 5 6 74
StopATG
1 2 4 5 6 731 2 4 5 6 73
cctgttcatttc
1 3 5 6 7
cctgttcattt
1 3 5 6 71 3 5 6 7
**
A.
B.
107
Figure 2-2. Genetic linkage map of the f locus and molecular analysis of Madh5transcripts in f/f, f/+ and control mice. (A) Linkage map of the f locus on mouse chromosome 13. The position of the markers on chromosome 13 according to NCBIm33 mouse genome assembly is indicated. The position of Madh5 and Sfxn1 are shown. (B) The coding region of the Madh5 was cloned by RT-PCR of spleen RNA from the indicated mice. The arrowheads indicate the position of the wildtype and mutant mRNAs. The * indicates a non-specific background band. The exon structure of the wildtype and f/f mRNAs is indicated at the right. The f/f mouseshown here is an example of a mutant mouse that expresses very little wildtypeMadh5 mRNA.
+/+
Number of Cycles
20
25
30
Post-PHZ Injection
f/f
BMP4HPRT
Hours Days0 12 24 36 48 4 6 8
Hours Days0 12 24 36 48 4 6 8
20
25
30
Number of Cycles
BMP4HPRT
+/+
Number of Cycles
20
25
30
Post-PHZ Injection
f/f
BMP4HPRTBMP4HPRT
Hours Days0 12 24 36 48 4 6 8
Hours Days0 12 24 36 48 4 6 8
Hours Days0 12 24 36 48 4 6 8
Hours Days0 12 24 36 48 4 6 8
20
25
30
Number of Cycles
BMP4HPRTBMP4HPRT
+/+
f/f
0 Hour 24 Hour 36 Hour 48 Hour 96 Hour
+/+
f/f
0 Hour 24 Hour 36 Hour 48 Hour 96 Hour
20% 6%[O2]BMP4
HPRT
CTTGACCTTATTTATGACTTTACGTGCAAA
CTTGACCTTATTTATGACTTTACGTGCAAA||||||||||||||||||||||||||||||CTTGACCTTATTTATGACTTTACGTGCAAA
TGAATG
||||||||||||||||||||||||||||||Mouse
Human
HNF4 site HIF SiteRat
20% 6%[O2]BMP4
HPRT
CTTGACCTTATTTATGACTTTACGTGCAAA
CTTGACCTTATTTATGACTTTACGTGCAAA||||||||||||||||||||||||||||||CTTGACCTTATTTATGACTTTACGTGCAAA
TGAATG
||||||||||||||||||||||||||||||Mouse
Human
HNF4 site HIF SiteRat
CTTGACCTTATTTATGACTTTACGTGCAAA
CTTGACCTTATTTATGACTTTACGTGCAAA||||||||||||||||||||||||||||||CTTGACCTTATTTATGACTTTACGTGCAAA
TGAATG
||||||||||||||||||||||||||||||Mouse
Human
HNF4 site HIF SiteRat
B)
C)
A)108
Figure 2-3. Analysis of BMP4 expression during the recovery from acute anemia. (A)RT-PCR analysis of BMP4 expression in C57BL/6-+/+ control (Top) and C57BL/6-f/f (bottom) mice. Arrows indicate the positions of the BMP4 specific band and the HPRT control band and the number of PCR cycles is indicated at the right. (B) Spleen sections from C57BL/6-+/+ (Top) and C57BL/6-f/f (bottom) mice stained with anti-BMP4 antibodies at the indicated times following PHZ induced acute anemia. (C) RT-PCR analysis of BMP4 expression in MSS31 spleen stromal cells grown at normoxic (20%) and hypoxic (6%) conditions (Top). The position of the putative hypoxia inducible element in the BMP4 gene is indicated and an alignment of this sequence from mouse, human and rat is presented (Bottom).
109
Spleen
Bone Marrow
0
50
Epo Epo+BMP4
Stre
ss B
FU-E
+ BMP4- BMP4
Pre-incubation
Fold
incr
ease
0
2
4
6
1
0
2
4
6
0 0.15 1.5 15BMP4 (ng/m
Fold
Incr
ease
1
Controlf/f
A.
B.
Spleen
Bone Marrow
0
50
Epo Epo+BMP4
Stre
ss B
FU-E
+ BMP4- BMP4
Pre-incubation
Fold
incr
ease
0
2
4
6
1
0
2
4
6
0 0.15 1.5 15BMP4 (ng/ml)
Fold
Incr
ease
1
Controlf/f
Controlf/f
A.
B.
Figure 2-4. Analysis of the ability of BMP4 to induce the formation of stress BFU-E in spleen cells from untreated mice. (A) Bone marrow (Top) and spleen (Bottom) cells from untreated f/f and control mice were plated in methylcellulose media containing Epo (3 U/ml) and the indicated concentration of BMP4. (B) Spleen cells from C57BL/6-+/+ mice were pre-incubated with BMP4 (15 ng/ml) for 24 hours, washed and then plated in the methylcellulose media containing either Epo (3 U/ml) alone or Epo + BMP4 (15 ng/ml).
110
0
100
200
300
400
0 12 24 36 48 4 6 8
Post-PHZ Injection
BFU
-E
f/Madh5-+/Madh5-
Hours Days
f/Madh5-
+/Madh5-BMP4
HPRT
0 12 24 36 48 4 6 8
Hours DaysPost PHZ treatment
B.
A.
0
100
200
300
400
0 12 24 36 48 4 6 8
Post-PHZ Injection
BFU
-E
f/Madh5-+/Madh5-
Hours Days
f/ -
+/ -BMP4
HPRT f/ -
+/ -BMP4
HPRT
+/ -BMP4
HPRT
0 12 24 36 48 4 6 8
Hours DaysPost PHZ treatment
B.
A.
Figure 2-5. Analysis of the recovery from acute anemia in f/Madh5- and +/Madh5-mice. (A) Analysis of the expansion of stress BFU-E in the spleen of C57BL/6-f/Madh5- and C57BL/6-+/Madh5- mice. Spleen cells were plated in methylcellulose media containing 3 U/ml Epo. (B) Expression of BMP4 in the spleen of C57BL/6-f/Madh5- and C57BL/6-+/Madh5- mice. The BMP4 and HPRT control bands are indicated by the arrows. These results are from 25 cycles of PCR.
111
-BMP4+BMP4
0123456789
Control Wildtype Mutant #1 Mutant #2
Alk
alin
e Ph
osph
atas
eA
ctiv
ity
Wildtype
Mutant #1
Mutant #2
ATG
*
[*****]
B.
A.
-BMP4+BMP4
0123456789
Control Wildtype Mutant #1 Mutant #2
Alk
alin
e Ph
osph
atas
eA
ctiv
ity
-BMP4+BMP4
0123456789
Control Wildtype Mutant #1 Mutant #2
Alk
alin
e Ph
osph
atas
eA
ctiv
ity
Wildtype
Mutant #1
Mutant #2
ATG
*
[*****]
Wildtype
Mutant #1
Mutant #2
ATG
*
[*****]
B.
A.
Figure 2-6. Analysis of the effect of over-expression of the f mis-spliced Madh5 mRNAs on BMP4 signaling in W-20-17 osteoblast cells. (A) Schematic representation of the f mis-spliced Madh5 mRNAs and control Madh5 mRNA. The position of the endogenous ATG is indicated in the wildtype mRNA. * indicate the positions of putative in-frame ATGs in the mis-spliced mRNAs. (B) Induction of alkaline phosphatase activity by BMP4 in control W-20-17 cells and W-20-17 cells expressing wildtype or mis-splice Madh5 mRNAs. Alkaline phosphatase activity was normalized to protein concentration and expressed in relative units.
112
0
1
2
3
4
5
6
Unfractionated Lin+ Lin-
BFU
-E p
er 1
05ce
llsN.D.
EpoEpo + BMP4
020406080
100120140160
BFU
-E p
er 1
05ce
lls
N.D.N.D.
Lin- Kit+ Lin- Kit-
EpoEpo + BMP4
0
10
20
Bone Marrow Spleen
BFU
-E p
er 3
x104
cells Epo
Epo + BMP4
A.
B.
C.
0
1
2
3
4
5
6
Unfractionated Lin+ Lin-
BFU
-E p
er 1
05ce
llsN.D.
EpoEpo + BMP4
0
1
2
3
4
5
6
Unfractionated Lin+ Lin-
BFU
-E p
er 1
05ce
llsN.D.
EpoEpo + BMP4EpoEpo + BMP4
020406080
100120140160
BFU
-E p
er 1
05ce
lls
N.D.N.D.
Lin- Kit+ Lin- Kit-
EpoEpo + BMP4
020406080
100120140160
BFU
-E p
er 1
05ce
lls
N.D.N.D.
Lin- Kit+ Lin- Kit-
EpoEpo + BMP4EpoEpo + BMP4
0
10
20
Bone Marrow Spleen
BFU
-E p
er 3
x104
cells Epo
Epo + BMP4
0
10
20
Bone Marrow Spleen
BFU
-E p
er 3
x104
cells Epo
Epo + BMP4EpoEpo + BMP4
A.
B.
C.
Figure 2-7. Identification of the sub-population of progenitor cells from untreated spleen that responds to BMP4. (A) Unfractionated, Lin+ and Lin –cells from untreated wildtype spleen were plated in 3 U/ml Epo + 15 ng/ml BMP4 and the induction of stress BFU-E was analyzed. (B) Kit+ Lin- and Kit- Lin- cells from untreated wildtype spleen were plated in 3 U/ml Epo + 15ng/ml BMP4 and the induction of stress BFU-E was analyzed. (C) MEPs (Lin- Sca1- IL-7Rα- Kit+ CD34- FcγRlow) isolated from bone marrow and spleen of wildtype mice were plated in 3 U/ml Epo + 15 ng/ml BMP4 and the induction of stress BFU-E was analyzed. N.D.None Detected.
113
Chapter 3
STRESS ERYTHROPOIESIS IN SPLENECTOMIZED MICE
Abstract
The spleen has been shown to be the main site for reestablishing homeostasis
following an erythropoietic stress. This is due to the fact it contains highly specialized
erythroid progenitors which respond to BMP4 [1], as well as the erythropoietic inductive
environment created (EIM) created by the stroma of this organ [2]. Mice defective in this
expansion of erythroid progenitors, such as the flexed-tail (f/f) mutants, which exhibit a
disruption of BMP4/Madh5 signaling due to a splicing defect in Madh5, show a delay in
the recovery to an acute anemia. Considering the critical role of the spleen and its
progenitors in response to an erythropoietic stress, we wanted to characterize the stress
erythroid response in splenectomized mice and determine if their defect was even more
severe than the delay seen in flexed-tail mice. Splenectomized mice show different
kinetics in their recovery to a phenylhydrazine induced acute anemia. Although there is
no increase in the bone marrow contribution to erythropoiesis over that seen in wild-type
controls, the liver of splenectomized mice shows evidence of erythropoietic activity.
BMP4 is expressed in the liver and confers properties to erythroid progenitors in the liver
of splenectomized mice similar to those seen in progenitors expanding in the spleen of
wild-type mice. Since there are no erythroid progenitors in the liver prior to an acute
anemia, we wanted to determine what signals may be important for progenitor cells to
114
traffic here from other locations. A potential candidate is the chemokine stromal cell-
derived factor-1 (SDF-1 or CXCL12). SDF-1 is a factor whose expression has been
shown to increase in ischemic tissue and is involved in the mobilization of progenitor
cells. SDF-1 is expressed in the liver of wild-type and splenectomized mice and could be
playing a role in the recruitment of erythroid progenitor cells to the liver following a
phenylhydrazine induced acute anemia. The differences between splenectomized and
control mice were not significant, so the role of SDF-1 in homing of progenitor cells to
the liver will require functional analysis of SDF-1/CXCR4 signaling. Interestingly, even
though f/f mice are defective in the stress erythroid response in the spleen, they show no
morphological evidence for erythropoietic activity in the liver when it is observed in the
liver of splenectomized mice. Considering that BMP4 is expressed at sites participating
in stress erythropoiesis (be it the spleen or the liver) and it has a role in the expansion of
stress erythroid progenitors at these locations, this might suggest that splenectomized f/f
mice would have a further delay in erythropoiesis in the liver following an erythropoietic
challenge.
115
Introduction
The spleen is the primary organ for re-establishing homeostasis following an
erythropoietic challenge such as irradiation, hypoxia or an acute anemia [3-6]. Work in
our lab has characterized the role of the spleen in stress erythropoiesis and has shown the
spleen contains an endogenous erythroid progenitor which differentiates under the control
of BMP4. BMP4 expression, regulated by hypoxia, increases in the spleen at 24 hours
post PHZ induced acute anemia. This BMP4 signal drives the expansion and
differentiation of erythroid progenitors resident in the spleen [7]. BMP4 induces the
differentiation of a highly specialized “stress” BFU-E. These “stress” BFU-E exhibit
properties distinct from steady state bone marrow progenitors. They grow faster in
culture, forming a BFU-E colony in 5 days rather than 7 and develop in the absence of a
burst promoting factor, requiring only Epo to form BFU-E. This process of expansive
erythropoiesis is supported by the unique erythropoietic inductive microenvironment
(EIM) established in the spleen. The ability of the spleen EIM to induce the expansion of
erythroid progenitors has been demonstrated using MSS31 cell line from mouse newborn
spleens [2]. After the addition of fetal liver cells and erythropoietin, erythroid
progenitors adhered to the MSS31 cells, eventually maturing to hemoglobin producing
cells that would detach and enucleate. Cell-to-cell contact allowing short-range
communication between the erythroid progenitor cells and the MSS cells is required in
that conditioned medium of MSS31 cells did not show any effects on colony formation.
Although the EIM of the spleen is known to be a composite of secreted factors,
progenitor cells, stromal cells, and adhesion molecules, the properties that distinguishes
this EIM from other microenvironments has not been fully characterized.
116
The expansive erythropoiesis in the spleen is altered in mice with a mutation at
the flexed-tail locus (f) [8, 9]. f/f are defective in the BMP4/Smad5 signaling pathway,
which disrupts the expansion of splenic erythroid progenitors and leads to a delay in the
recovery to acute anemia [7, 10]. Since a defect in the BMP signaling pathway in the
spleen manifests as a delay in re-establishing homeostasis, we wanted to characterize the
response in the complete absence of a spleen. Both flexed-tail and splenectomized mice
are viable, but it is reasonable to hypothesize that the lack of the specialized splenic
microenvironment by splenectomy would impart an even more severe phenotype during
the immediate recovery to an acute stress than that seen in the flexed-tail mutant.
. In this report we show that splenectomy does affect the ability of mice to
respond to an erythropoietic stress. Splenectomized mice show delayed kinetics of
hematocrit recovery following a PHZ induced acute anemia. Although the bone marrow
does not greatly increase its contribution to the recovery, the delay in recovery is not
severe since erythropoiesis is initiated in the liver. Unlike the spleen, the liver does not
harbor any erythroid specific progenitors. However, the liver expresses BMP4 and the
progenitor cells participating in the liver resemble splenic stress BFU-E which proliferate
with Epo alone. Even though f/f mice are defective in their splenic response, they do not
have a response in their liver. Since erythroid progenitors are not present in the liver
prior to the anemia, progenitors must migrate to the liver for their expansion. The signal
directing the homing of progenitors to the liver may be the chemokine stromal-derived
factor-1 (SDF-1 or CXCL12). SDF-1 has been shown to be a key regulator of stem cell
migration and is involved in the recruitment of CXCR4+ progenitor cells to ischemic
tissue for tissue regeneration. SDF-1 is expressed in the liver during the recovery from
117
acute anemia and may be involved in the recruitment of erythroid progenitor cells to the
liver in splenectomized mice. The similarities that have emerged between expansive
erythropoiesis in the spleen and that seen in the liver of splenectomized mice helps define
the signals that are important for initiating expansive erythropoiesis in extra-medullary
organs in general, the nature of the progenitors participating and how progenitors may
locate environments which will provide the most productive site for their expansion.
.
118
Methods
Mice. C57BL/6 and C57BL/6 splenectomized mice were obtained from Jackson
Laboratory. Spleens were removed at weaning. All mice were 6-8 weeks old and
controls were age matched. Splenectomized mice were not used until at least 3 weeks
after splenectomy. Acute anemia was induced by a single injection of Phenylhydrazine
(Sigma, St. Louis , MO) at a concentration of 100 mg/Kg mouse in PBS.
Hematocrit Analysis. Percent hematocrit was determined by the packed red
blood cell volume over total volume of blood obtained using a capillary tube ocular
bleed.
Colony Assays for BFU-E. Single cell suspensions from bone marrow or liver
were obtained at indicated points post PHZ induced acute anemia in IMDM + 5% heat
inactivated FCS. For liver suspensions, 22 mg/50 mL collagenase Type I (Worthington,
Lakewood, NJ) was included in the media. Erythrocytes were lysed with cold 0.16M
ammonium chloride (Sigma, St. Louis, MO). In addition, liver suspensions were passed
through a 70 µM nylon cell strainer (BD Falcon, Bedford, MA) along with separation of
debris and hepatocytes from mononuclear cells using a Nycoprep 1.077 gradient (AXIS-
SHIELD PoC AS, Oslo, Norway). 1x105 /mL bone marrow or 1.4x105/mL liver cells
were plated in methylcellulose media (StemCell Technologies, Vancouver, BC)
containing 3U/mL Epo ± either 10ng/mL IL3 (Sigma, St. Louis, MO) or 15ng/mL BMP4
(R&D Systems, Minneapolis, MN) where indicated. BFU-E were scored as described
[11].
H&E staining of liver sections. Livers were harvested at the indicated times post
PHZ induced anemia, fixed in 4% paraformaldehyde, and paraffin embedded tissue
119
sections cut and stained using standard hematoxylin and eosin staining procedures
(Electron Microscope Facility, Penn State University, University Park, PA).
Staining of liver sections with BMP4 and SDF-1 antibodies. Livers were
harvested at the indicated times post PHZ induced anemia, fixed in 4% paraformaldehyde
and paraffin embedded tissue sections cut. Sections were de-paraffinized using
Histoclear (National Diagnostics, Atlanta, GA) and rehydrated through ethanol gradients
before blocking endogenous peroxidase activity for 15 minutes in 3% H2O2 in PBS.
After 3x 2 min washes in PBS, slides were blocked with Protein Blocking Agent
(Immunotech, Marseille, France) in a humid chamber for 40-60 min. Expression of
BMP4 was analyzed using anti-BMP4 (Novocastra Laboratories/Vector Laboratories,
Burlingame, CA) (1:20) in PBS + 1% BSA (Fisher Scientific, Hampton, NJ) and
expression of SDF-1 using anti-mouse CXCR12 β subunit (eBiosciences, San Diego,
CA) (1:200) in PBS + 1% BSA. After 3x 5min washes with PBS, HRP-conjugated
secondary antibodies were diluted in PBS +1 % BSA (1:50) for goat anti-mouse, or
(1:100) for goat anti-rabbit, and incubated for 40 min. After washing in PBS, HRP
activity was detected using HRP detection kit (Pharmingen, San Diego, CA) according to
manufacturer’s instructions. Cells were counterstained with hematoxylin where
indicated.
120
Results
The kinetics of recovery from acute anemia is delayed in splenectomized mice.
Analysis of the flexed-tail (f) mutant mice has shown that the contribution from stress
erythroid progenitors resident in the spleen, which respond to hypoxia-induced
BMP4/Madh5 dependent signals, is critical for quickly re-establishing homeostatic
hematocrit levels following an erythropoietic challenge [7]. Although this mechanism is
required for the rapid recovery from an acute anemia, it is clearly dispensable for bone
marrow steady state erythropoiesis since flexed-tail mice are viable. This point is further
demonstrated by the observation that both mice and humans can survive without a spleen.
To determine if splenectomized mice have a defect in their recovery to an acute anemia,
we followed the hematocrit of splenectomized mice after a single dose injection of PHZ,
dropping hematocrit from 50% to below 40% within 12 hrs. This allows us to evaluate
the severity of splenectomy during the initial phase of expansive erythropoiesis and
characterize the compensatory mechanism of stress erythropoiesis during the critical
window of splenic participation. Surprisingly, splenectomized mice show no delay in
their recovery of normal hematocrit values following an acute anemia (Figure3-1). Both
splenectomized and control mice re-establish 50% hematocrit values by eight days post-
treatment. Although splenectomized mice recover in the same time as control mice, they
show different kinetics of recovery. Control mice stabilize and show a rise in hematocrit
by three days after treatment, which correlates with the maturing stress BFU-E in the
spleen which peaks at 36 post treatment [1]. Splenectomized mice, lacking a source of
121
the stress BFU-E from the spleen, show a longer lag period with their hematocrit not
stabilized or increasing until six days post treatment.
Bone marrow erythropoiesis does not increase in splenectomized mice during the
recovery from acute anemia. Since the defect in the recovery to an acute anemia is not
that drastic in splenectomized mice, we wanted to determine how splenectomized mice
compensate for the loss of the erythropoietic inductive environment (EIM) of the spleen.
An obvious location for compensation would be the bone marrow. The bone marrow is
the location of homeostatic erythropoiesis and bone marrow BFU-E require two signals
to differentiate, Epo plus a burst promoting factor, such as IL3. The absence of a spleen
may augment the production of erythroid progenitors in the bone marrow. To test this
possibility we used in vitro colony assay to evaluate the number of early erythroid
progenitors (BFU-E) over the recovery period. We saw only a small elevation in the
number of BFU-E in the bone marrow of splenectomized mice both at 12 hours and 48
hours (less than two fold) (Figure 3-2). It seems that these slight differences in steady
state BM BFU-E, although contributing to the recovery, did not appear great enough to
explain the near normal recovery time of the splenectomized mice. This is consistent
with that reported by Bozzini et al. [3] where splenectomized mice with extended
exposure (9 day; 23,000ft, 19hr/day) to hypoxia or injected with erythropoietin showed
no increase in the rate of erythropoiesis in their bone marrow, though they were capable
of increasing their total circulating red cell volume.
Perhaps the differences seen in the bone marrow were not detected under the
conditions used for classical BFU-E. It is known that the spleen harbors erythroid
122
progenitors poised for expansive erythropoiesis with unique properties that distinguish
them from classical bone marrow BFU-Es. Endogenous splenic erythroid progenitors
proliferate more quickly than classical BM BFU-E (5 days vs. 7-10 days in culture
respectively), to produce mature erythrocytes more rapidly. Unlike progenitor cells from
the BM which show little response to BMP4, endogenous splenic erythroid progenitors
differentiate following exposure to BMP4, to a “stress BFU-E.” These stress BFU-E
expand in the presence of high levels of Epo, independent of a factor with burst-
promoting activity [1]. To determine if the bone marrow of splenectomized mice harbor
progenitors with properties more like the splenic stress BFU-E poised for expansive
erythropoiesis, we did in vitro colony assay for cells that respond to BMP4 + Epo, or Epo
alone. There were no statistical differences seen in the number of BMP4 responsive
erythroid progenitors or in erythroid progenitor that responded to Epo alone from the
bone marrow of control and splenectomized mice (data not shown). These data
demonstrate that the bulk of the compensation for the lack of the EIM of the spleen or its
endogenous progenitors is not seen from the bone marrow. Even under this extreme
condition, the bone marrow does not alter its microenvironment or spectrum of
progenitor cells to support expansive erythropoiesis.
The liver becomes the site of extramedullary erythropoiesis in splenectomized mice.
Since the bone marrow is not making any dramatic contribution to the timely recovery of
splenectomized mice, another hematopoietic organ must be involved. Erythropoiesis is
known to be supported in non-splenic extra-medullary sites including the liver, axillary
lymph nodes and thymus following erythropoietic stimulation. It is known that the liver
123
and lymph nodes in splenectomized mice show a considerable increase in red cell
production through morphological evidence and the incorporation of 59Fe by these tissues
following extended exposure to a hypoxic atmosphere (20-25 days) or injected with
9units Epo daily for 14 days [3]. We looked at H&E stained liver sections from control
and splenectomized mice over the recovery period to the acute anemia for evidence of
hematopoietic activity (Figure 3-3). A few, tiny hematopoietic clusters (staining dark
purple against the pink hepatocytes) can be seen in control mice by day 4 post treatment,
but these clusters are small and sparse, with no great increase in their numbers over the
recovery period. In sharp contrast to the control mice, the liver of splenectomized mice
show the emergence of these clusters at day 4, with prominent, wide spread, large-sized
clusters by day 6, continuing at least through day 8 post treatment. Closer inspection of
these clusters (Figure 3-3B) reveals the presence of red staining mature erythrocytes at
the center, surrounded by more immature erythropoietic progenitors. The data
demonstrate that without a spleen present, robust expansive erythropoiesis occurs in the
liver.
BFU-E expand in the liver during the recovery from an acute anemia but are not
resident in the liver. Before treatment, no appreciable numbers of erythroid progenitors
are present in the livers of control or splenectomized mice as determined by in vitro
colony assays (Figure 3-4). This is consistent with what others have reported in both the
murine [6] and human systems [12]). However, from the H&E stained sections it is clear
that the liver becomes a critical contributing microenvironment for erythroid progenitors
following the acute anemia in splenectomized mice. We analyzed BFU-E in the liver by
124
in vitro colony assays. During recovery from PHZ induced anemia, BFU-E expanded in
both splenectomized and control mice, however the increase was much greater in
splenectomized mice. Between untreated and 3 days post PHZ treatment, livers of
splenectomized mice exhibited a 65-fold expansion of BFU-E compared, which is more
than 3 times greater than the 20-fold increase seen in wild-type livers (Figure 3-4). The
fact that no erythroid specific progenitors are found in untreated mice suggests that the
microenvironment of the liver is not fully suited to replace that of the spleen, in that it
does not harbor erythroid progenitors poised to respond to an erythropoietic stress.
Liver expresses BMP4 and liver erythroid progenitors exhibit properties similar to
spleen stress BFU-E. BMP4 is the key signal that initiates stress erythropoiesis in the
spleen. It is known that BMP4 is induced in the spleen 24 hours following induction of
an acute anemia. The spleen stromal line MSS31 grown under hypoxic conditions also
upregulates the expression of BMP4 [7]. In order to test whether the liver also
upregulates BMP4, we stained liver sections from splenectomized and control mice for
BMP4. This analysis showed that BMP4 is constitutively expressed in the liver in both
control and splenectomized mice over the recovery period (Figure 3-5). Not all cells in
the cross section stain positively for BMP4 expression with staining often concentrated
around the bile ducts. However, there appears to be no correlation between the
hematopoietic clusters, and localization of BMP4 expression.
Although BMP4 expression does not appear to be regulated by hypoxia in the
liver as it is in the spleen, the fact that it is expressed in the liver during the recovery to
acute anemia reveals a potential role of BMP4 signaling for the expansion of progenitors
125
in the liver following erythropoietic challenge. These observations suggest that the liver
progenitors may respond in a similar manner to that seen with endogenous progenitors in
the spleen. In the spleen there are two types of progenitors. An immature progenitor,
the BMP4 responsive cell (BMP4R), which responds to the upregulation of BMP4 in the
spleen following an acute anemia and differentiates into an Epo responsive stress
erythroid progenitor (stress BFU-E). Splenic erythroid progenitors only need transient
exposure to BMP4 to render them Epo responsive. If BMP4R cells similar to those
observed in the spleen migrate to the liver in splenectomized mice, they would be
converted to stress BFU-E, which form BFU-E colonies in the presence of Epo alone. To
determine if this was true of erythroid progenitors in the liver, in vitro colony assays were
repeated under the condition of Epo + BMP4 or Epo alone. The majority of BFU-E
colonies seen at day 3 post anemia in splenectomized mice are actually BFU-E that are
responding to Epo alone (Figure 3-4B). Including BMP4 in the media did not increase
the number of BFU-E, which is consistent with the idea that the endogenous BMP4
expression in the liver is sufficient to drive the differentiation of any potential BMP4R
cells (data not shown). These progenitors forming colonies in the liver, encountering a
BMP4 signal already present, are now capable of rapid proliferation independent of a
burst promoting factor, which is a characteristic more similar to splenic stress BFU-E
than steady-state BM erythroid progenitors.
No evidence of erythropoietic activity in the liver of flexed-tail mice during the
period it is observed in splenectomized mice. When the spleen is absent, there is
morphological evidence for erythropoiesis in the liver starting at day 4 post PHZ-induced
126
acute anemia, with prominent clusters observed at day 6. Although the spleen is present
in flexed-tail mice, the mechanisms of expansive erythropoiesis in the spleen are
defective. We looked at H&E liver from flexed-tail mice at day 4 and 6 post PHZ-
induced acute anemia to determine if flexed-tail mice increase erythropoiesis in the liver
to compensate for their defective splenic mechanisms. We saw no prominent
hematopoietic clusters in the liver of flexed-tail mice as we had seen at day 4 and 6 in
splenectomized mice (Figure 3-6). The liver expresses BMP4 during the recovery and
confers properties to erythroid progenitors in the liver of splenectomized mice similar to
those seen in progenitors expanding in the spleen of wild-type mice. flexed-tail mice
show a delay in the expansion of the stress erythroid progenitors in their spleen, due to
the inability to respond to BMP4 signals regulating their expansion. It is unclear if the
lack of erythropoiesis in the liver of flexed-tail mice at these time points is due to the
preference for spleen microenvironment for expansive erythropoiesis, even if it is
defective, or if the mechanism in the liver would also be delayed considering the role
BMP4 has in the expansion of stress erythroid progenitors in the liver.
SDF-1 is expressed in the livers of wild-type and splenectomized mice. Despite the
fact that the liver is capable of supporting expansive erythropoiesis, it is clearly a second
choice to the spleen. Although the liver is expressing BMP4 at the same time with the
spleen following an acute anemia, no significant erythropoiesis is occurring in the liver
when a spleen is present. This suggests that there must be a signal for cells to specifically
home to the liver and initiate erythroid differentiation once it is determined there is no
splenic contribution to the recovery. One possible candidate for this homing signal is the
127
chemokine stromal cell-derived factor-1 (SDF-1 or CXCL12). SDF-1 through interaction
with its receptor CXCR4, has been established as a key regulator of murine stem cell
migration, homing, and anchorage of repopulating cells to the bone marrow, as well as
release of maturing cells into the blood stream [13]. SDF-1 has been shown to be
expressed by liver bile duct epithelium with expression increased in the liver by stressors
such as irradiation or inflammation. This upregulation leads to the SDF1 dependent
recruitment of CD34+/CXCR4+ hematopoietic progenitors to the liver for repair [14].
Ceradini et al. has shown SDF-1 expression can be regulated by other physiological
stressors such as ischemia. The hypoxia inducible factor HIF-1 is up-regulated in
endothelial cells in ischemic tissue in direct proportion to reduced oxygen tension. HIF-1
levels mediated by the hypoxic gradient induced SDF-1 expression which increased the
adhesion, migration and homing of circulating CXCR4+ progenitors cells to the
ischemic tissue for tissue regeneration [15]. An acute anemia creates hypoxic conditions
in the tissues, which could lead to increased expression of SDF-1 in the liver of
splenectomized mice, and the homing of progenitor cells to this organ for expansion. To
address this possible mechanism of progenitor cell recruitment, immunohistochemical
analysis of liver sections for SDF-1 expression from control and splenectomized mice
was performed over the recovery period (Figure 3-7 and Figure 3-8). In both
splenectomized and wild-type mice, SDF-1 can be seen in hepatocytes just below the
endothelial layer of hepatic vessels, as well as the bile duct epithelia. In untreated mice,
there is much more overall staining in splenectomized mice compared to wild-type,
especially in hepatocytes surrounding vessels. By 12 hrs post PHZ, both splenectomized
and wild-type mice show SDF-1 expression throughout the liver, with more over-all
128
staining apparent in the splenectomized mice. The most dramatic increase in SDF-1 is
seen at 48 hours, as SDF-1 expression in both is more punctuated as individual
hepatocytes show high level expression compared to more moderate amounts in
neighboring cells. At 4 and 6 days post anemia, SDF-1 expression evens out throughout
the liver, although individual high-expressing cells can still be seen below the endothelial
lining of the vessel walls. In splenectomized mice at day 8 there is a slight elevation in
over-all SDF-1 staining compared to wild-type controls, but levels have decreased in both
and almost returned to that seen prior to the anemia. Because SDF-1 is expressed in the
liver during the recovery from an acute anemia, it may have a role in the recruitment of
erythroid progenitors, but the results are not conclusive at this time.
129
Discussion
The splenic mechanisms of expansive erythropoiesis during the immediate
response to an acute anemia are critical for the rapid return to steady state blood
parameters, but are not essential for survival as splenectomized mice are viable. Our
results have shown splenectomized mice display different kinetics of recovery to an acute
anemia. Consistent with previous reports, erythropoiesis does not increase substantially
in the bone marrow during the immediate response to acute anemia of splenectomized
mice, but the liver now becomes an important organ for re-establishing homeostasis. The
liver [6], lymph nodes [3], thymus [16] have all been shown to participate in
erythropoietic activity under various conditions including bone marrow suppression from
radiation exposure [12, 17], malaria infection [18], phenylhydrazine induced hemolytic
anemia [19] and splenectomy [3]. The liver is of particular interest since it was the
primary site of hematopoiesis during development supporting the expansion of erythroid
progenitors. Although once supportive of expansive erythropoiesis, the liver
microenvironment loses this ability as cells differentiate from stroma of epithelial-to-
mesenchymal transition (EMT) to mature hepatocytes, directed by the increase in
oncostatin M (OSM) from the influx of hematopoietic progenitors from the yolk sac and
AGM [20]. Though no longer specialized for erythropoietic activity, the hematopoietic
potential in the liver is re-established under stress conditions sharing similarities with the
erythropoietic supportive environment of the spleen.
Evidence of the erythropoietic capacity of the adult liver has been determined
morphologically by the existence of erythroblastic islands forming in the liver following
130
an acute anemia using an extended phenylhydrazine regimen (over a 4 day period) [6].
Bozzini et al. took splenectomized mice exposed to hypoxia or injected with
erythropoietin, and observed the inability of the splenectomized mice to fully respond to
these erythropoietic stimuli, although noted an increase in red cell production in the liver
(and lymph nodes) [3]. These data verifies the ability of the adult liver to support
erythropoiesis, but does not define the parameters necessary for establishing the suitable
erythropoietic microenvironment, the nature of the participating progenitors, or its role in
the immediate recovery to an acute anemia in the absence of a spleen. We have shown
that parallels can be drawn between expansive erythropoiesis seen in the spleen and
erythropoiesis initiated in the liver. BMP4 is expressed in both the spleen and the liver
following an acute anemia. In the spleen BMP4 is tightly regulated and its up-regulation
is coordinated with the onset of the acute anemia. In the liver there is no great fluctuation
in BMP4 levels but rather it is ubiquitously expressed. Regardless, a large proportion of
progenitors that migrate to this BMP4 rich environment, experience a BMP4 signal and
are now capable of responding to Epo alone, independent of a factor with burst
promoting activity. We have not observed the migration of BFU-E that can expand in the
presence of Epo alone in the blood. The characteristic of stress BFU-E to respond to Epo
alone sets expansive erythroid progenitors, whether endogenous to the spleen or those
seen in the liver, apart from their steady-state bone marrow counterparts. Although the
majority of the progenitors participating in the liver exhibit stress BFU-E properties,
some steady state BFU-E are present because inclusion of IL-3 increases the number of
BFU-E in the liver.
One difference between progenitors participating in the spleen, and those in the
131
liver of splenectomized mice is their origin. BMP4 responsive cells reside in the spleen
of mice under homeostatic conditions. We know that the population of BMP4-responsive
cells in the spleen participating in expansive erythropoiesis show limited ability to self-
renew and must be replenished following an erythropoietic challenge. A full response of
this population can not be re-detected after the initial 36 hr burst until 21 days after the
onset of the anemia (Perry JP, unpublished results). Through transplantation experiments
it appears that the source of replenishing the splenic BMP4 responsive progenitors is the
bone marrow. Signals within the splenic microenvironment render the transplanted bone
marrow cells capable of responding to BMP4, since the un-transplanted bone marrow
progenitors show no appreciable response to BMP4 signaling before homing to the spleen
microenvironment (JP Perry in preparation). Considering that this population of
progenitors with BMP4 responsive potential originates in the bone marrow, the extreme
conditions of lacking the spleen may alter conditions enough to allow those normally sent
to the spleen, to be retained in the bone marrow or sent to the liver. Neither of these
situations is consistent with what we have seen in our colony assays from the bone
marrow or liver. There are no great increases in BMP4 responsive cells, progenitors that
can respond to Epo alone, or steady-state BFU-E (requiring a burst promoting factor) in
the bone marrow or liver prior to the onset of the anemia. Although capable of
supporting erythropoiesis, the liver microenvironment is not sufficient to replace the
splenic microenvironment to maintain an expansive erythroid progenitor population.
Although the liver lacks erythroid progenitors it does contain both CFU-S and
hematopoietic stem cells, both capable of differentiating down the erythroid pathway [17,
21]. The fact that no BFU-E are present within the liver prior to the onset of the anemia
132
would suggest a migration from the bone marrow, or a differentiation of these multi-
potential progenitors. Most likely it is a combination of both sources. The single dose of
PHZ we use to induce a synchronous response to the acute anemia, rather than multiple
doses initiating multiple waves, is important for characterizing the immediate response to
acute anemia. However, it makes establishing a connection between what others have
reported for the migration of progenitors following an erythropoietic challenge [19, 22]
and the origins and timing of BFU-E we see in the liver, ambiguous.
Whether endogenous multipotential cells are differentiating or progenitors are
migrating from the bone marrow, we know that no appreciable amount of erythropoiesis
occurs in the liver if a spleen is present, even if the splenic mechanisms are defective.
H&E stained liver sections from flexed-tail mice at Day 4 and Day 6 of recovery from
PHZ acute anemia are comparable to wild-type. We have seen that exposure to BMP4
alters the growth factors requirements of erythroid progenitors under erythropoietic
stress, but how do progenitor cells migrate to the appropriate microenvironment that can
support their expansion? The observation that CXCR4-positive endothelial progenitor
cells are specifically recruited to sites of injury by hypoxic gradients via HIF-1-induced
expression of SDF-1 and the observation that SDF-1 is important for the mobilization of
hematopoietic progenitor cells, made SDF-1 up-regulation in the liver of splenectomized
mice an attractive model for the recruitment of erythroid progenitors during the recovery
from an acute anemia. SDF-1 is expressed in the liver following an acute anemia in both
wild-type and splenectomized mice. Though overall expression appears slightly higher in
splenectomized mice throughout the recovery from acute anemia, there are no dramatic
differences seen between mice with or without a spleen. So although SDF-1 may be a
133
factor important for the recruitment of progenitor cells to the liver, there may be other
mechanisms at work to either help establish erythropoiesis in the liver of splenectomized
mice, or extinguish the response when a spleen is present. The intrinsic properties of the
progenitors themselves may be important for the regulation of their own trafficking and
will need to be addressed in future work.
However, the mechanisms affecting differences in erythropoietic activity in the
liver following an acute anemia may be less a function of microenvironmental factors or
characteristics intrinsic to the progenitors themselves and more a function of the
physiology of the organism. The liver is unique among organs in that it receives the
majority of its blood supply (approx. 75%) from the hepatic portal vein which carries
venous blood that is largely depleted of oxygen. The blood entering the liver by the
hepatic portal vein comes from the digestive tract and the major abdominal organs such
as the spleen and pancreas [23]. The majority of progenitors mobilized from the bone
marrow would reach the spleen first. Finding a suitable environment for their expansion,
most cells could lodge in the spleen, with few progenitors continuing on through
circulation to eventually reach the liver. When the spleen is absent, progenitors do not
find a suitable environment until they reach the liver and thus the large numbers of
erythroid progenitors seen in the liver of splenectomized mice following an acute anemia.
SDF-1, known to be regulated in a HIF-1 dependent manner may show expression in the
liver of both wild-type and splenectomized mice due to the decreased oxygenation of the
blood of this organ. In fact, the level of ischemia in the tissue, or the duration of the
hypoxia may be an important component to this whole process. The wild-type mice with
a burst in BFU-E in the spleen at 36 hrs were able to stabilize their hematocrits between
134
2-3 days post anemia before the liver is showing any morphological evidence of
erythropoietic activity [1]. This might suggest that a mechanism which is shutting down
the response in the spleen, is also important for shutting down any response that might
have initiated in the liver. Even if the mobilization of progenitors from the bone marrow
is a process set into motion at the point the anemic/hypoxic threshold is crossed, the early
contribution from the spleen alleviates the hypoxia to a point where the environment in
the liver no longer contains all the necessary signals to support expansion of these
progenitors.
135
References
1. Lenox, L.E., J.M. Perry, and R.F. Paulson, BMP4 and Madh5 regulate the erythroid response to acute anemia. Blood, 2005. 105(7): p. 2741-8.
2. Obinata, M. and N. Yania, Cellular and molecular regulation of erythropoietic inductive microenvironment (EIM). Cell Structure and Function, 1999. 24: p. 171-179.
3. Bozzini, C.E., M.E. Barrio Rendo, F.C. Devoto, and C.E. Epper, Studies on medullary and extramedullary erythropoiesis in the adult mouse. Am J Physiol, 1970. 219(3): p. 724-8.
4. Hara, H. and M. Ogawa, Erthropoietic precursors in mice with phenylhydrazine-induced anemia. Am J Hematol, 1976. 1(4): p. 453-8.
5. Broudy, V.C., N.L. Lin, G.V. Priestley, K. Nocka, and N.S. Wolf, Interaction of stem cell factor and its receptor c-kit mediates lodgment and acute expansion of hematopoietic cells in the murine spleen. Blood, 1996. 88(1): p. 75-81.
6. Ploemacher, R.E. and P.L. van Soest, Morphological investigation on phenylhydrazine-induced erythropoiesis in the adult mouse liver. Cell Tissue Res, 1977. 178(4): p. 435-61.
7. Lenox, L.E., J.M. Perry, and R.F. Paulson, BMP4 and Madh5 regulate the erythroid response to acute anemia. Blood, 2004.
8. Hunt, H. and D. Premar, Flexed-tail a mutation in the house mouse. Anat. Rec., 1928. 41: p. 117.
9. Mixter, R. and H. Hunt, Anemia in the flexed tailed mouse, Mus musculus. Genetics, 1933. 18: p. 367-387.
10. Coleman, D., E. Russell, and E. Levin, Enzymatic studies of the hemopoietic defect in flexed mice. Genetics, 1969. 61: p. 631-642.
11. Finkelstein, L.D., P.A. Ney, Q.P. Liu, R.F. Paulson, and P.H. Correll, Sf-Stk kinase activity and the Grb2 binding site are required for Epo-independent growth of primary erythroblasts infected with Friend virus. Oncogene, 2002. 21(22): p. 3562-70.
12. Golden-Mason, L. and C. O'Farrelly, Having it all? Stem cells, haematopoiesis and lymphopoiesis in adult human liver. Immunol Cell Biol, 2002. 80(1): p. 45-51.
13. Lapidot, T. and I. Petit, Current understanding of stem cell mobilization: the roles of chemokines, proteolytic enzymes, adhesion molecules, cytokines, and stromal cells. Exp Hematol, 2002. 30(9): p. 973-81.
14. Kollet, O., S. Shivtiel, Y.Q. Chen, J. Suriawinata, S.N. Thung, M.D. Dabeva, J. Kahn, A. Spiegel, A. Dar, S. Samira, P. Goichberg, A. Kalinkovich, F. Arenzana-Seisdedos, A. Nagler, I. Hardan, M. Revel, D.A. Shafritz, and T. Lapidot, HGF, SDF-1, and MMP-9 are involved in stress-induced human CD34+ stem cell recruitment to the liver. J Clin Invest, 2003. 112(2): p. 160-9.
15. Ceradini, D.J., A.R. Kulkarni, M.J. Callaghan, O.M. Tepper, N. Bastidas, M.E. Kleinman, J.M. Capla, R.D. Galiano, J.P. Levine, and G.C. Gurtner, Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1. Nat Med, 2004. 10(8): p. 858-64.
136
16. Albert, S., P. Wolf, and I. Pryjma, Evidence of Erytheropoiesis in the Thymus of Mice. J Reticuloendothel Soc, 1965. 85: p. 30-9.
17. Taniguchi, H., T. Toyoshima, K. Fukao, and H. Nakauchi, Presence of hematopoietic stem cells in the adult liver. Nat Med, 1996. 2(2): p. 198-203.
18. Halder, R.C., T. Abe, M.K. Mannoor, S.R. Morshed, A. Ariyasinghe, H. Watanabe, H. Kawamura, H. Sekikawa, H. Hamada, Y. Nishiyama, H. Ishikawa, K. Toba, and T. Abo, Onset of hepatic erythropoiesis after malarial infection in mice. Parasitol Int, 2003. 52(4): p. 259-68.
19. Ploemacher, R.E., P.L. van Soest, and O. Vos, Kinetics of erythropoiesis in the liver induced in adult mice by phenylhydrazine. Scand J Haematol, 1977. 19(5): p. 424-34.
20. Chagraoui, J., A. Lepage-Noll, A. Anjo, G. Uzan, and P. Charbord, Fetal liver stroma consists of cells in epithelial-to-mesenchymal transition. Blood, 2003. 101(8): p. 2973-82.
21. Taniguchi, H., T. Toyoshima, K. Fukao, and H. Nakauchi, Evidence for the presence of hematopoietic stem cells in the adult liver. Transplant Proc, 1995. 27(1): p. 196-9.
22. Hara, H. and M. Ogawa, Erythropoietic precursors in mice with phenylhydrazine-induced anemia. American Journal of Hematology, 1976. 1: p. 453-458.
23. Ross, M.H., Kaye, G. I. and Pawlina, W., Histology. 4th ed. 2003, Baltimore: Lippincott Williams and Wilkins. 875.
137
0.0%
10.0%
20.0%
30.0%
40.0%
50.0%
60.0%
70.0%
0 12 24 36 48 3 4 5 6 8
Time post PHZ treatment
(%) H
emat
ocrit
c57 averagesplenectomized average
****
*
Hours Days
0.0%
10.0%
20.0%
30.0%
40.0%
50.0%
60.0%
70.0%
0 12 24 36 48 3 4 5 6 8
Time post PHZ treatment
(%) H
emat
ocrit
c57 averagesplenectomized average
****
*
Hours Days
Figure 3-1. Hematocrit values during the recovery to a phenylhydrzaine(PHZ) induced hemolytic anemia. Percent hematocrit (packed red blood cell volume) were plotted for C57BL/6-+/+ ( ) or C57BL/6-splenectomized ( ) mice. * indicated p<0.05, ** indicates p<0.01.
ss
138
BFU
-E p
er 1
X10^
5 B
M c
ells *
***
**
Time post PHZ treatment
05
101520253035404550
0 12 24 36 48 4 6 8
C57 control
C57 splenectomized
Hours Days
BFU
-E p
er 1
X10^
5 B
M c
ells *
***
**
Time post PHZ treatment
05
101520253035404550
0 12 24 36 48 4 6 8
C57 control
C57 splenectomized
Hours Days
Figure 3-2. Analysis of BFU-E expansion of bone marrow BFU-E during the recovery from PHZ induced acute hemolytic anemia. Bone marrow BFU-E from C57BL/6-+/+ (black bar) and C57BL/6-splenectomized (white bar). 1X105 bone marrow cells were plated in methylcellulose media containing Epo (3 U/mL) and IL-3 (10 ng/mL). *indicates p<0.05, **indicates p<0.01.
139
Figu
re 3
-3.
H&
E st
aine
d liv
er se
ctio
ns d
urin
g re
cove
ry fr
om a
PH
Z in
duce
d ac
ute
anem
ia.
(A) 4
00X
mag
nific
atio
n of
H&
E st
aine
d liv
er se
ctio
ns fr
om C
57B
L/6-
+/+
cont
rol a
nd sp
lene
ctom
ized
mic
e. (
B) 1
0X fu
rther
mag
nific
atio
nof
the
hem
atop
oiet
ic c
lust
ers i
n th
e re
gion
of t
he y
ello
w b
ox sh
own
in p
art (
A) [
tota
l of 4
000X
mag
nific
atio
n].
Con
trol
2 D
ays
4 D
ays
6 D
ays
8 D
ays
Sple
nect
omiz
ed
Unt
reat
ed
Con
trol
2 D
ays
4 D
ays
6 D
ays
8 D
ays
Sple
nect
omiz
ed
Unt
reat
ed
Con
trol
2 D
ays
4 D
ays
6 D
ays
8 D
ays
Sple
nect
omiz
ed
Unt
reat
edA
)
B)
140
B) Epo only
A) Epo + IL3
0
20
40
60
80
100
120
140
160
Live
r BFU
-E:
1.4X
10^5
cel
ls/w
ell
O 2 3 4 5
Days post PHZ treatment
Live
r BFU
-E:
1.4X
10^5
cel
ls/w
ell
0
20
40
60
80
100
120
140
160
O 2 3 4 5
Days post PHZ treatment
control splenectomized
control splenectomized
B) Epo only
A) Epo + IL3
0
20
40
60
80
100
120
140
160
Live
r BFU
-E:
1.4X
10^5
cel
ls/w
ell
O 2 3 4 5
Days post PHZ treatment
Live
r BFU
-E:
1.4X
10^5
cel
ls/w
ell
0
20
40
60
80
100
120
140
160
O 2 3 4 5
Days post PHZ treatment
0
20
40
60
80
100
120
140
160
O 2 3 4 5
Days post PHZ treatment
control splenectomized
control splenectomized
Figure 3-4. Analysis of liver BFU-E expansion during the recovery from a PHZ induced hemolytic anemia. 1.4X105 liver cells from C57BL/6-+/+ control (black bar) or C57BL/6-splenectomized mice (white bar) were harvested at various points during the recovery to a PHZ induced acute anemia and plated in methylcellulose media containing (A) Epo (3 U/mL) + IL-3 (10 ng/mL) or (B) Epo (3 U/mL) alone. * indicates p<0.05, **indicates p<0.01.
141
Figu
re 3
-5.
Ana
lysi
s of B
MP4
exp
ress
ion
in th
e liv
er d
urin
g re
cove
ry fr
om a
PH
Z in
duce
d ac
ute
anem
ia.
(A) 4
00X
m
agni
ficat
ion
of li
ver s
ectio
ns fr
om C
57B
L/6-
+/+
cont
rol a
nd C
57B
L/6-
sple
nect
omiz
ed m
ice
stai
ned
with
ant
i-BM
P4
antib
odie
s at t
he in
dica
ted
times
follo
win
g a
PHZ
indu
ced
acut
e an
emia
and
cou
nter
-sta
ined
with
hem
atox
ylin
. (B
) Liv
er
sect
ions
show
n in
par
t (A
) sta
ined
with
out t
he B
MP4
ant
ibod
y bu
tonl
y w
ith th
e se
cond
ary-
HR
P co
njug
ated
ant
ibod
y an
d co
unte
rsta
ined
as a
con
trol.
*in
dica
tes n
o co
unte
r-st
ain.
Con
trol
Sple
nect
omiz
ed
B)
Con
trol
Sple
nect
omiz
ed
B)
*
2 D
ays
4 D
ays
6 D
ays
8 D
ays
Unt
reat
ed
Con
trol
Sple
nect
omiz
ed
A)
2 D
ays
4 D
ays
6 D
ays
8 D
ays
Unt
reat
ed
Con
trol
Sple
nect
omiz
ed
A)
*
142
Day 6 Day 4
f/f mouse #1
100 µ m 100 µ m
f/f mouse #2
Figure 3-6. H&E stained liver sections from flexed-tail (f/f) mice. Liver sections from two different f/f mice recovering from a PHZ induced acute anemia. At these time points (Day 4 and Day 6 post PHZ) splenectomized mice have numerous, large hematopoietic clusters present in their livers (seeFigure 3-3), which are not present in the f/f livers.
143
0hr 12hr 24hr 36hr
200µm200µm
SDF-1
Control
48hr 4Day 6Day 8Day
200µm200µm
SDF-1
Control
Figure 3-7. Immunohistochemistry for SDF-1 in the liver of wild-type mice during the recovery from a PHZ induced acute anemia. Liver sections taken at various time points from wild-type mice recovering from a PHZ induced acute anemia. These sections were stained using an SDF-1 (CXCL12 β subunit) antibody, or HRP-conjugated secondary only (Control). No counter-stain was used.
144
0hr 12hr 24hr 36hr
200µm200µm
SDF-1
Control
y y y
200µm200µm
48hr 4Day 6Day 8Day
SDF-1
Control
Iso Cont
Figure 3-8. Immunohistochemistry for SDF-1 in the liver of splenectomized mice during the recovery from a PHZ induced acute anemia. Liver sections taken at various time points from splenectomized mice recovering from a PHZinduced acute anemia. These sections were stained using an SDF-1 (CXCL12 βsubunit) antibody, or HRP-conjugated secondary only (Control). No counter-stain was used. Also shown is rabbit IgG serum isotype control (Iso Cont).
145
Chapter 4
THE IMPACT OF flexed-tail
Abstract
The analysis of the flexed-tail locus broadens our appreciation for splicing
mutations and their physiological consequences, as well as the complexities and controls
in place within signaling networks. The flexed-tail mutation in Madh5 may be added to
the growing list of splicing-affecting genomic variants (SpaGV), which are often over-
looked as “silent” genomic variants. There is evidence that the truncated transcripts
from flexed-tail mice are producing truncated proteins. Analysis of the composition of
these truncated proteins begins to address the neomorphic properties observed as they
disrupt the TGF-β/BMP signaling pathways. We are reminded of the subtleties in place
behind precisely orchestrated signaling networks as these aberrant molecules are
controlled from propagating widespread detrimental effects.
146
The Impact of Our Analysis of the flexed-tail Locus on Our Appreciation for
Splicing Mutations and Their Physiological Consequences
We have shown through allelism and functional assays that the cause of the
flexed-tail phenotype is a splicing mutation in Madh5 (Smad5). Although disappointing,
the lack of the actual mutation causing the splicing abnormalities may not be as
surprising as originally perceived. Considering splicing as straight-forward as two
consecutive transesterification reactions joining exons while removing introns
distinguished by minimal motifs (GU and AG dinucleotides at exon-intron and intron-
exon junctions, a polypyrimidine tract and a branch point A) is simplistic at best. Recent
work has demonstrated the relevance of splicing enhancers and silencers regulating
splicing. These elements can appear as nonsense mutations contained within exons,
portions of introns, or sequences completely outside the gene, located from tens to
thousands of base pairs from the splice sites they affect. A recent review by Pagani and
Baralle (2004), emphasizes the need for diligence beyond sequence comparison when
evaluating for the molecular basis of disease, for far too often over-looked “silent”
genomic variants (GV) appear harmless because they do not affect amino acid coding
sequence or splice junction nucleotides. The effect of these single nucleotide
substitutions or small insertions and deletions, often in SNPs and simple sequence
repeats, must in their opinion be evaluated in splicing functional assays to determine
which are deleterious and which are really benign. These splicing-affecting genomic
variants (SpaGV) lead to splicing abnormalities which include inducing exon skipping,
activation of cryptic splice sites or alterations in the balance of alternatively spliced
147
isoforms, all could potentially lead to disease states [1]. Considering the daunting task
for the splicing machinery to correctly identify exons, only 145 nucleotides [2] on
average, separated by sometimes kilobases of sequence contaminated with pseudogenes
and cryptic splice sites, it is not surprising that weakly defined splice junctions whose
surrounding nucleotides fall outside the most highly conserved consensus [3] [as is the
case of the 5’splice junction of intron 1 of Madh5: score of 66.5 out of 100; see Figure 4-
1 for description of calculation], would be highly susceptible to perturbations caused by
seemingly benign genetic variations.
Aside from exon splicing enhancers (ESE), which are often bound by the splicing
activating serine arginine (SR) protein, or the exon splicing silencers (ESS), which bind
heterogeneous nuclear ribonucleoproteins particles (hnRNP), Pagani and Baralle shed
light onto more “hidden pathways to disease.” Their analysis examines splicing-affecting
genomic variants (SpaGV) that stem from variants affecting RNA secondary structure,
modifiers of SpaGVs, and the transcription-splicing connection. Variants in promoter or
transcriptional enhancer elements often affect the splicing process due to the coordinate
regulation of transcription and splicing in vivo. Our sequence analysis of Madh5 did not
include the promoter, or the entire 3’ UTR (our reference cDNA sequence GI# 6678773
has been replaced by GI#42734445, which has roughly 2000 more base pairs at the 3’
end of the final exon) which could contain sequences important for transcription
regulation. Mindful of the potential for subtle variations leading to splicing anomalies,
we had been focused on the analysis of a potentially variant polyT tract in intron 4 of the
flexed-tail mutant (see Appendix A). Whether the flexed-tail mutation in Madh5 can be
added to the growing list of SpaGV in genes that contribute to pathologies including
148
ataxia telangiectasia [4], nerofibromin 1 [5], and cystic fibrosis transmembrane regulator,
[6-8] will be a matter of time and diligence.
As genomes are more thoroughly analyzed beyond the mere content of genes,
more will be learned about mutations that can affect splicing. Those genome variations
which lie outside the coding region of the gene contribute to the complexity of the
molecular mechanism of splicing and their analysis will augment our limited knowledge
of the splicing process. From this it may become more evident if and how a mutation that
may exist in a locus such as sideroflexin could be modifying the flexed-tail splicing
defect in Smad5 and contributing to the variations seen among mice. Questions such as
these will be less complex when we are able to analyze the progeny from our current
breeding of f/+; sideroflexin +/+ crosses that will separate the loci.
149
The Impact of Our Analysis of the flexed-tail Locus as It Relates to the TGF-β
Family Signaling Pathway
We have shown that the flexed-tail Madh5 splicing mutation leads to mice having
defective BMP4 signaling. The defect not only disrupts the balance of correctly spliced
transcripts, but also creates aberrantly spliced truncated transcripts that possess
neomorphic properties. A general understanding of the intricacies of the TGF-β
signaling pathway suggests that these mutant forms could overcome the built-in
safeguards of this signaling system.
TGF-β/BMP signaling. The TGF-β superfamily of secreted signaling molecules is
comprised of 35 structurally related pleiotropic cytokines in vertebrates including the
transforming growth factors (TGF-βs), bone morphogenic proteins (BMPs), activins,
nodals and related proteins [9]. They are important molecules initiating a diverse range
of cellular processes from differentiation, proliferation, migration and apoptosis with key
roles in development and carcinogenesis. TGF-β responses can be cell type specific and
are dependent on both the concentration of TGF-β signaling components and the activity
of other signaling pathways which can synergize or antagonize the TGF-β pathway.
Although this pathway appears simple, combinatorial interactions in the heteromeric
receptor and Smad complexes, receptor-interacting and Smad-interacting proteins, and
cooperation with sequence-specific transcription factors allow substantial versatility and
diversification of TGF-β family responses [10].
150
The extra-cellular TGF-β family members signal by stimulating the formation of
specific heteromeric complexes of type I and type II serine/threonine kinases membrane
receptors which exist in homodimers at the cell surface in the absence of ligand (Figure
4-2) [10]. There are five known mammalian type II receptors which bind the TGF-β
ligands and phosphorylate and activate the type I receptors, of which there are seven
mammalian members. The combination of type II and type I receptors in this tetrameric
complex allows differential ligand binding or differential signaling in response to the
same ligand [11, 12]. For example the type II receptor Act RII can combine with the type
I receptor ActRIB (ALK4) and mediate activin signaling, but its interaction with the
BMP-RIA (ALK3) allows BMP binding and signaling (Figure 4-3). Thus, a ligand can
induce different signaling pathways depending on the composition of the receptor
complex. TβRII interacts not only with the type I receptor TβRI (ALK5) which activates
Smad2 and Smad3, but also with ALK1 to activate Smad1 and Smad5 [10].
The activated type I receptors, which are responsible for downstream signaling
specificity [12], phosphorylate and thus stimulate intracellular signaling molecules
known as Smads. Smads are highly conserved molecules first identified as the products
of the Drosophila Mad and C. elegans Sma genes, which lie downstream of the BMP-
analogous ligand-receptor systems in these organisms [12-14]. Functionally, Smads fall
into three subfamilies: Receptor regulated Smads (R-Smads: Smad1, Smad2, Smad3,
Smad5, Smad8,), the common mediator (Co-Smads: Smad4), and the inhibitory Smads
(I-Smads: Smad6 and Smad7). R-Smads are further subdivided into two classes: Smad2
and -3 which transduce activin/TGF-β signals, and Smad1, -5, and -8 which preferentially
transduce BMP signals. Access of the R-Smads to the type I receptor is facilitated by
151
auxiliary proteins such as Smad anchor for receptor activation (SARA) [9], however such
an accessory protein has not been conclusively identified in the BMP pathway [12]. R-
Smads and Smad4 are expressed in most if not all cell types [10], while the induction of
Smad6 and Smad7 is highly regulated by extracellular signals [12, 15-17].
Certain structural elements in the receptor, such as the 9 amino acid L45 loop [18]
and within the MH2 domain of Smad molecule itself such as the L3 loop [19] along with
alpha helix 1 [20], are important for dictating the specificity of recognition of the type I
receptor and the Smad protein (Figure 4-4). It is noted that these regions provide
minimal components for specificity in vitro and larger regions may be important for the
correct assembly of receptor complexes, accessory adaptor molecules and Smad protein
complexes in vivo [20].
The R-Smads and Co-Smads share two conserved domains: N-term Mad
homology-1 domain (MHI) and the C-term Mad-homology -2 domain (MH2), separated
by the more variable linker region (Figure 4-5). I-Smads show only weak homology with
the N-term MHI domain, although their MH2 domain shows high homology to the MH2
domains of R-Smads and Co-Smad. The MHI domain is important for DNA binding and
interaction with transcription factors. It contains a lysine-rich nuclear localization
sequence that is conserved in all R-Smads and been shown in Smad1 and Smad3 to
confer nuclear import [21]. Although Smad2 also has this lysine-rich sequence in its
MHI domain, upon phosphorylation by a type I receptor it is released from the anchoring
SARA and translocates to the nucleus by a cytosolic-factor-independent import activity
that requires a region in the MH2 domain [22]. While Smads alone can bind to specific
DNA sequences, their binding affinity is considered to be too weak to serve as effective
152
and highly specific DNA binding proteins in vivo [23, 24]. The linker region of Smad1/5
contains MAPK phosphorylation sites, PSXP motifs, and their phosphorylation has been
shown to inhibit activated Smads from nuclear accumulation. This ERK-mediated
inhibition of nuclear accumulation occurs without interfering with the formation of
Smad1-Smad4 complex [25]. The MH2 domain is the motif which interacts with the
receptor (R-Smads, Smad6/7), mediates protein-protein interactions with Smads,
transcriptional coactivators and corepressors. The MH2 domain of both R-Smads and Co-
Smad activate transcription primarily through the ability of this domain to recruit the
general transcriptional coactivators p300 and CBP [10, 15, 24, 26].
Both the MHI and MH2 have been shown to be involved in protein-protein
interactions with a continually growing list of transcription factors. These transcription
factors can act as specificity determinants because they can be cell-type specific and be
regulated by other signaling pathways [9]. The plethora of interacting proteins provides a
mechanistic explanation for the documented crosstalk between the Smad pathway and
many other signaling networks, which range from the Ras/MAPK pathway to the Wnt/β-
catenin and nuclear hormone signaling cascades [15, 16].
Inactive cytoplasmic Smads are intrinsically auto-inhibited through an
intramolecular interaction between the MH1 and MH2 domains [12, 27]. In vitro, N-
terminal deletion mutants of Smad1 have been used to mimic activated Smad1 [28].
Upon ligand binding, the type II receptor phosphorylates the type I receptor, which in
turn propagates the signal by phosphorylating R-Smads at the SSXS motif at the C-term
end of their MH2 domain. Once activated, Smad molecules go through a conformational
change which relieves the inhibitory folding of the MHI domain on the MH2 domain.
153
This open conformation allows the R-Smad to form heteromeric complexes with the Co-
Smad, Smad4, with oligomerisation achieved by the interaction of the phosphorylated C-
term tail of R-Smads with the L3 loop of another Smad [12, 29]. This R-Smad/Co-Smad
complex accumulates in the nucleus, and controls gene expression in a cell-type specific
and ligand dose-dependent manner through interactions with transcription factors,
coactivators and corepressors [12, 30].
Negative regulators of TGF-β/ BMP signaling. Regulation of the TGF-β family
pathway is achieved at various levels, including extra-cellularly, at the membrane site and
intra-cellularly (refer to Figure 4-2). Many of these factors are TGF-β/BMP-inducible
and inhibit the BMP pathway, thus establishing negative feedback loops. The active
local concentrations of TGF-β ligands have been shown to be important for rendering a
particular biological effect, especially during development. The active local
concentration and consequently the extent of action of these morphogens are controlled in
part by the influence of extracellular modulators. In vertebrates, these extracellular
modulators include noggin, chordin, chordin–like, follistatin, FSRP, the DAN/Cerberus
protein family and sclerostin [31]. Noggin for example has been shown to bind to and
antagonize BMP-2, -4, and -7 signals by interfering with the ability of the BMP to bind
cognate cell-surface receptors [32].
At the membrane, BMP and activin membrane bound inhibitor (BAMBI) is a
molecule which shows sequences similarity to TGF-β receptors but lacks the intracellular
kinase domain. As a naturally occurring dominant-negative pseudoreceptor whose
expression appears to be induced by BMPs, BAMBI blocks TGF-β, activin, and BMP
154
signaling by interacting with receptors of the TGF-β family and preventing the formation
of functional receptor complexes [24, 31, 33, 34].
Within the cytoplasm I-Smads and Smad ubiquitination regulatory factor (Smurf)
are some of the more well characterized modulators. Induction of Smad6 and Smad7 is
highly regulated by extracellular signals including epidermal growth factor (EGF), TGF-
β1, Activin and BMP-7, suggesting the existence of auto-inhibitory feedback
mechanisms [12, 15-17]. In fact, the promoter region of the mouse Smad6 contains a
BMP responsive element, which directly binds a Smad4/5 complex [35]. Inhibitory
Smads, through their MH2 domains [10], can bind stably to the intracellular domain of
activated BMP type I rectors and prevent activation of the R-Smads by the receptor [36-
38]. They have been shown to recruit a complex of GADD34 and the catalytic subunit of
protein phosphatase 1 to the TGF-β type I receptor to de-phosphorylate and inactivate the
receptor. In addition Smad6 has been shown to compete with Smad4 for binding to
receptor-activated Smad-1 yielding apparently inactive Smad1-Smad6 complexes [24,
39].
In addition to competing for receptors and/or Smad4 binding, or by recruiting
phosphatase complexes to the activated receptors to attenuate signaling, I-Smads recruit
Smad ubiquitination regulatory factors (Smurf1 and Smurf2) to components of the
pathway. Smurf1 and Smurf2 are members of the HECT (homologous to E6-associated
protein C terminus) class of E3 ubiquitin ligases. Smurf1 interacts with Smad1 and -5
through the PPXY motif (PY motif) located in the linker region of Smad1 and targets
these molecules for ubiquitination, leading to proteasomal degradation [24, 40, 41].
155
Smurf1 also binds to BMP type I receptors via I-Smads and induces ubiquitination and
degradation of these receptors [28, 31].
Within the nucleus multiple factors have been shown to act as transcriptional
corepressors of BMP-Smad signaling. As an example, the cellular counterpart of the
retroviral oncogene (v-ski) known as c-ski and the related SnoN protein physically
interact with the MH2 domain of Smad2, -3, and -4 to directly repress their ability to
activate TGF-β target genes [24]. Recently, Ski was also shown to interact with the MH2
domain of Smad1 and Smad5 in a BMP signaling-dependent manner [42].
Interaction of TGF-β/BMP signaling pathway with other signaling pathways. Cross-
talk between the TGF-β/BMP pathway and other signaling pathways is an area field that
has been recently emerging. These mechanisms include the Wnt/β-Catenin,
Ca2+/Calmodulin signaling, Wnt/Ca2+ signaling, Erk-MAPK pathway, and the JAK-
STAT pathway [24]. Both the Erk-MAPK and the JAK-STAT pathway have roles in
Erythropoietin signaling and erythroid development and may prove important for our
discussion, although the analysis of their role in TGFβ signaling has been mainly in vitro.
Activation of receptor tyrosine kinases (RTKs) by ligands such as epidermal growth
factor (EGF) or hepatocyte growth factor (HGF) subsequently activates the Erk
(extracellular signal regulated kinases) subfamily of mitogen-activated protein kinases
(MAPK), which in turn phosphorylate serine residues in consensus PXSP motifs located
in the linker region of Smad1. As a consequence, Smad1 is inhibited from accumulating
in the nucleus. This balance between phosphorylation and activation by BMPs and the
opposing regulation by the RTKs phosphorylation, determines the levels of Smad1
156
activity in the nucleus, and so the role of Smad1 in the control of cell fate [25].
Leukemia inhibitory factor (LIF), which acts through the gp130 receptor and STAT3, can
act synergistically with BMP2 in inducing astrocyte differentiation in culture. This is
shown to be due to the formation of Smad1 and STAT3 complex bridged by the general
transcriptional coactivator p300 [43]. Furthermore, BMP signals may be transduced by
MAP kinases in addition to Smads [24]. Considering the diverse role of the TGF-β family
members and the limited number of signaling components, the complexity and interaction
among various signaling pathways is not surprising, but much remains to be learned
about the intricacies of these events.
Neomorphic properties of the flexed-tail truncated transcripts. By stably transducing
the two truncated transcripts of Smad5 from flexed-tail into a BMP responsive bone
marrow stromal cell line (W-20-17) [44, 45], it has been established that it is not so much
the reduced levels of the full length transcript that is leading to the flexed-tail phenotype,
but more so the presence of the truncated versions (refer to Chapter 2 and Figure 2-6, pg.
110) [46]. The presence of the truncated transcripts consistently affected the basal level
of alkaline phosphatase activity in these cells, as well as rendering the lines containing
them unable to respond to BMP4 signals. BMP normally causes the cells to differentiate
with an increase seen in alkaline phosphatase activity. If the line showed any response
to BMP4, it was never to the level reached by the W-20-17 line control (empty MSCV
vector), suggesting that any response they may show may never reach physiologically
significant thresholds. Transcript #1 appeared to be the more detrimental transcript as
157
this line grew more slowly than the lines containing the other constructs and consistently
showed the least response to BMP4.
So why would an osteoblast cell line which normally differentiates in response to
BMP signals be unresponsive with the presence of the flexed-tail truncated versions of
Smad5 transcript? This is consistent with the behavior of the BMP4 responsive erythroid
cells contained in the spleen and we have evidence suggesting that these transcripts
produce truncated proteins. Analysis of the transcripts using NetStart1.0 [47, 48]
predicted downstream, high potential translational start sites in-frame with the legitimate
translational start site missing from the deletion of exon 2 in the truncated transcripts
(Figure 4-6). If translation is initiated at these downstream ATGs (at 1190bp in #1; at
1370, 1388, 1412 or 1445 in #2; reference sequence is GI #6678773) , the truncated
transcripts would produce truncated Smad5 proteins of 33.05kDa and 26.8kDa from
transcript #1 and #2 respectively. To determine if this was the case, COS7 cells were
transiently transfected with the MSCV constructs containing full length Smad5 (Neo22),
truncated transcript #1 (lel-139) and transcript #2 (lel-118). Figure 4-7 verifies the
presence of the mRNA from these constructs. Lysates from these COS7 cells were
immunoprecipitated using a column bound (Seize column, Pierce) C-term Smad5 specific
anti-body (D-20, Santa Cruz). Figure 4-8 shows a band at the predicted size for a protein
made from transcript #1.
How could such truncated proteins interrupt the response to BMP signals and
disrupt the auto-regulatory loop of the signaling pathway? Closer inspection of the
composition of the protein may provide some insights. Figure 4-9 shows the comparison
158
of the truncated Smad5 proteins compared to full length versions. The most notable
difference is the absence of the MH1 domain. Without an MHI domain, there is no
portion of the molecule to collapse upon and control the MH2 or active portion of the
molecule. The C-term domain has an effector function that becomes apparent when the
isolated domain is tested in transcriptional assays [49] and mesoderm induction assays
[50] [25]. In fact, groups use deletion mutant of the closely related Smad1 which lacks
the N-term Mad-homology domain to mimic activated Smad1 [28]. The fact that the
MHI domain which normally binds to the MH2 in the inactive state to prevent aberrant
activation is absent suggests that these truncated proteins may be functioning by
misregulated, overactive signaling.
Possibly more detrimental than the loss of a regulatory motif in the molecule, is
the features the truncated protein would still contain. Through the presence of the MH2
domain, the proteins would possess the necessary elements of the Smad molecule to bind
the receptor, associate with Smad4 and transactivate transcription. Alpha helix 1 and the
L3 loop of the MH2 domain are present in both truncated proteins. The critically
residues of the L3 loop (amino acids [AAs] 425 and 428 have not been disrupted by the
inserted 5 amino acids of transcript #1 (see Figure 4-9). Both transcripts contain the C-
terminal phosphorylation sites required to activate the molecule by the type I receptors.
Considering the composition of these molecules, and the mechanisms by which other
inhibitors such as BAMBI and the inhibitory Smads function, one way these proteins
could be interfering in correct Smad pathway signaling is by competing with full length
Smad5 for necessary components. The unregulated MH2 domain could bind to type I
159
receptors, preventing full length Smad5 access. These truncated proteins, activated by
the receptor can interact with the Co-Smad, again causing competitive inhibition of full
length Smad5. Whether these aberrant complexes could be shuttled to the nucleus is
unclear since the N-term NLS is not present. However, if they did make it to the nucleus,
they are likely to be able to activate/repress transcription through functional
transcriptional complexes and the active MH2 domain. We’ve seen evidence for a
disruption of the negative feedback loop in flexed-tail mice by the constitutive
transcription of BMP4 in the spleens of these animals. Although both BAMBI and
Smad6 have been shown by RT-PCR to be affected during recovery in wild-type mice
(increase in BAMBI; decrease in Smad6), again, these aberrant transcripts may
themselves be competing with full length Smad5 and preventing correct regulation of the
pathway.
As signaling pathways must be tightly controlled, safeguards are in place to
prevent a single disruption from causing catastrophic consequences. The BMP signaling
pathway has established safeguards to even these aberrant active proteins through over-
lapping functions of other Smad members, tight regulation of the duration and intensity
of the signaling and the requirement for the combinatory network of other signaling
pathways. In the case of the predicted truncated proteins, evidence for their regulation is
revealed by their structure. The portion of the linker region from transcript #1 does
contain the Erk-MAPK phosphorylation sites (AAs 188, 196, 205 and 213) shown to
regulate nuclear accumulation of activated Smad1 (comparison of GI#6678773 amino
acid sequence with [25]). It is possibly, and even likely these truncated proteins would be
160
highly unstable due to the action of Smurf1. The inhibitory activity of Smurf1 is not
necessarily correlated with its ability to bind to Smad1/5 directly. Smurf1 associated
with Smad1/5 indirectly through I-Smads (Smad6) can induce their ubiquitination and
degradation. Although Smurf1 did not ubiquitinate a Smad1 mutant with a deletion of it
PY motif (∆PY), it could do so in the presence of Smad6. Smurf1 induced ubiquitination
of Smad1(∆PY) more strongly than it did that of full length Smad1, suggesting that the
Smurf1-Smad6 complex targets activated R-Smads more efficiently than non-activated
R-Smads [28].
Interestingly, the paper describing the W-20-17 features [45] noted that lower
basal levels of alkaline phosphatase activity, as we had seen with the presence of the
truncated transcripts, was observed when they included TGF-β in the culture media. The
original W-20 lines, although starting at statistically lower basal levels, were still able to
differentiate and increase levels of alkaline phosphatase activity following exposure to
BMPs. Others have used C2C12 mesenchymal cells to identify genes differentially
regulated by BMP2 and TGF-β [51]. The following genes were included in a list shown
in C2C12 cells to have varied expression in the presence of BMP2 (B), BMP2/TGF-β
(BT), or TGF-β (T) in the culture conditions, with their relative expression levels denoted
in brackets: Hey1 (Hairy/enhancer-of-split related with YRPW motif 1) [B>BT>T] ,
Hes1 [down-regulated by BMP2 and up-regulated by TGF-β; TGF-β inhibited BMP2
down-regulation], (hairy/enhancer of split1), Car3 (carbonic anhydrase 3) [B>BT>T],
Tnc (Tenascin C) [B<BT<T]. Using RT-PCR from BMP4 stimulated W-20-17 cell lines
containing the stably transduced transcripts, we evaluated the levels of these genes. The
most drastic difference between control and transcript containing lines was seen in the
161
Car3 gene (Figure 4-10). There was almost no Car3 expression from the line containing
transcript#1, compared to MSCV vector control which showed equivalent amounts of
Car3 and the housekeeping gene HPRT. This decrease in the amount of Car3 expression
in the presence of truncated transcript #1 suggests that these cells may be altering their
gene expression profile as if there is TGF-β present. This would be an interesting
situation since Smad5 can act downstream of both BMPs and potentially TGFβs [12, 52,
53]. These results are preliminary and more stringent evaluation would be necessary to
draw such conclusions, but the study of the truncated versions may provide insights into
how Smad5 is specified to propagate a TGF-β vs. BMP signal.
A location for this distinction between TGF-β vs. BMP signal could be occurring
at the level of the receptor complex. A point of convergence of the pathways occurs at
the type I receptor, ALK1 (refer to Figure 4-3). The maintenance and specificity of the
system requires that each member of the type I receptor family be able to discriminate
among different groups of Smad proteins [20]. It is repeatedly stated that the type I
receptors Activin receptor like kinase (ALK) 1, 2, 3 (BMPR-IA) and 6 (BMPR-IB)
phosphorylate Smad1, -5, and -8, whereas ALK 4, 5, and 7 phosphorylate 2 and 3.
However, recent studies in endothelial cells have shown that TGF-β can bind to and
transducer signals through ALK1 and ALK5 [54, 55]. ALK5 is widely expressed, but
ALK1 is predominantly expressed in endothelial cells at specific sites of interactions
between epithelial and mesenchymal cells [56]. The TGFβ-ALK5 signaling has an
opposite effects from the TGFβ-ALK1 pathways on endothelial cell behavior. ALK5
inhibits endothelial cell migration and proliferation, whereas ALK1 stimulates both
162
processes [9, 57, 58]. The possibility that receptor combinations acting as a branch point
of TGF-β family signal modulation could be occurring in other cell types and involve
other type I receptors such as the closely related ALK2 is an area for future research [9].
The type of receptors expressed by a particular cell may help dictate how the cell
interprets signals from multiple TGF-β family members, and through the use of one
Smad molecule over another, how those interpretations are relayed to the nucleus to
regulate gene expression.
163
The Impact of Our Analysis of the flexed-tail Locus: A Reminder of the Subtleties in
Place Behind Beautifully Orchestrated Physiological Mechanisms
Apart from regulations in place within a signaling pathway, the requirement for the
composite of signals from other pathways adds another dimension to the functions of cell
systems. The converging pathways often affect feedback loops to help fine tune the
cell’s instructions. As much as negative feedbacks may be important to quench
responses, so too are positive feedback loops to achieve threshold levels to propagate
cellular responses. In flexed-tail mice, BMP4 expression and signaling is disrupted,
along with the apparent disruption of a negative feedback loop regulating BMP4
expression, as BMP4 mRNA is always present. When we compare the signals
converging to drive stress erythropoiesis, such as hypoxia and BMP4, we can see
parallels to networks of signaling in other related systems. There is evidence for TGF-β2
signaling combining with hypoxic signals causing autocrine regulation of the upstream
TGF-β2 molecule in endothelial cells. Exposure of human umbilical vein endothelia
cells (HUVECs) to hypoxia (1% O2) increases gene expression and bioactivation of TGF-
β2 and induces the phosphorylation and nuclear transport of Smad2 and Smad3 and their
association with DNA [59]. Furthermore, hypoxia and TGF-β cooperate in the induction
of the promoter activity of vascular endothelial growth factor (VEGF), which is a major
stimulus in the promotion of angiogenesis. Optimal HIF-1α dependent induction of
VEGF promoter was obtained in the presence of Smad3 and co-immunoprecipitation
experiments revealed that HIF-1α physically associates with Smad3, through the MH1
and MH2 domains [60]. Long term hypoxic conditions result in the late up-regulation of
164
TGF-β1, again suggesting the induction of an autocrine loop by hypoxia [60, 61]. The
cross-talk between Smad3 and HIF-1α signaling pathways appears to be an important
mechanism by which endothelial cells, relatives of hematopoietic cells from the
hemangioblast, respond to hypoxic stress [59]. The working model that is currently
under investigation in our lab for the network created by the BMP, hypoxia and the stem
cell factor (SCF) pathways to regulate erythroid development and stress erythropoiesis is
shown in Figure 4-11. How the cell integrates the directions from the various molecular
players will broaden our understanding of erythropoiesis and other cellular processes.
Stepping back from the molecular dissection of signaling molecules in BMP
signaling, and the signaling networks created within a cell from instructions from its
microenvironment, the next level of complexity involves the interaction of cells with new
microenvironments. This is a regular occurrence for hematopoietic progenitor cells that
must traffic to specialized microenvironments, especially when stress conditions arise. In
the case of stress erythropoiesis in splenectomized mice, we have seen that there are
signals common to different microenvironments, such as BMP4 expression in both the
spleen and liver. The conservation of important signaling pathways across different
microenvironments allows for the flexibility of progenitors to function even in
suboptimal locations. For this reason, we could postulate that splenectomized flexed-tail
mutants might show an even greater delay in their recovery kinetics than that seen in
splenectomized wild-type mice. How the parts of cell intrinsic mechanisms and
environmental cues combine to establish the whole process of proper cell trafficking for
165
expansion or differentiation will be important not only for understanding stress
erythropoiesis but also for other branches of hematopoiesis and development.
166
Concluding Remarks
The molecular mechanisms that regulate physiological responses within an organism are
orchestrated with such complexity that viewing them from afar would appear
undiscernibly chaotic. Through closer inspection of the parts, be it the organ, progenitor
cell, signaling molecule or transcription factor, understanding where they fit into the
whole life process becomes more obtainable. The functional parts begin to coalesce, to
provide durability, flexibility and adaptability for the organism against the stresses of its
environment. To realize that a spontaneous mutation, manifesting as the slightly kinked
tail on a mouse in a barn of an observant farmer, could years later not only introduce us
to new signals in the regulation of erythropoiesis, but also lead us to the intricacies of
gene regulation and signaling networks, is nothing less than inspiring. Its lesson
emphasizes the need to be mindful of the subtleties in the life processes, as they may be
having a bigger impact on the system as a whole than initially appreciated.
167
References
1. Pagani, F. and F.E. Baralle, Genomic variants in exons and introns: identifying the splicing spoilers. Nat Rev Genet, 2004. 5(5): p. 389-96.
2. Lander, E.S., L.M. Linton, B. Birren, C. Nusbaum, M.C. Zody, J. Baldwin, K. Devon, K. Dewar, M. Doyle, W. FitzHugh, R. Funke, D. Gage, K. Harris, A. Heaford, J. Howland, L. Kann, J. Lehoczky, R. LeVine, P. McEwan, K. McKernan, J. Meldrim, J.P. Mesirov, C. Miranda, W. Morris, J. Naylor, C. Raymond, M. Rosetti, R. Santos, A. Sheridan, C. Sougnez, N. Stange-Thomann, N. Stojanovic, A. Subramanian, D. Wyman, J. Rogers, J. Sulston, R. Ainscough, S. Beck, D. Bentley, J. Burton, C. Clee, N. Carter, A. Coulson, R. Deadman, P. Deloukas, A. Dunham, I. Dunham, R. Durbin, L. French, D. Grafham, S. Gregory, T. Hubbard, S. Humphray, A. Hunt, M. Jones, C. Lloyd, A. McMurray, L. Matthews, S. Mercer, S. Milne, J.C. Mullikin, A. Mungall, R. Plumb, M. Ross, R. Shownkeen, S. Sims, R.H. Waterston, R.K. Wilson, L.W. Hillier, J.D. McPherson, M.A. Marra, E.R. Mardis, L.A. Fulton, A.T. Chinwalla, K.H. Pepin, W.R. Gish, S.L. Chissoe, M.C. Wendl, K.D. Delehaunty, T.L. Miner, A. Delehaunty, J.B. Kramer, L.L. Cook, R.S. Fulton, D.L. Johnson, P.J. Minx, S.W. Clifton, T. Hawkins, E. Branscomb, P. Predki, P. Richardson, S. Wenning, T. Slezak, N. Doggett, J.F. Cheng, A. Olsen, S. Lucas, C. Elkin, E. Uberbacher, M. Frazier, R.A. Gibbs, D.M. Muzny, S.E. Scherer, J.B. Bouck, E.J. Sodergren, K.C. Worley, C.M. Rives, J.H. Gorrell, M.L. Metzker, S.L. Naylor, R.S. Kucherlapati, D.L. Nelson, G.M. Weinstock, Y. Sakaki, A. Fujiyama, M. Hattori, T. Yada, A. Toyoda, T. Itoh, C. Kawagoe, H. Watanabe, Y. Totoki, T. Taylor, J. Weissenbach, R. Heilig, W. Saurin, F. Artiguenave, P. Brottier, T. Bruls, E. Pelletier, C. Robert, P. Wincker, D.R. Smith, L. Doucette-Stamm, M. Rubenfield, K. Weinstock, H.M. Lee, J. Dubois, A. Rosenthal, M. Platzer, G. Nyakatura, S. Taudien, A. Rump, H. Yang, J. Yu, J. Wang, G. Huang, J. Gu, L. Hood, L. Rowen, A. Madan, S. Qin, R.W. Davis, N.A. Federspiel, A.P. Abola, M.J. Proctor, R.M. Myers, J. Schmutz, M. Dickson, J. Grimwood, D.R. Cox, M.V. Olson, R. Kaul, C. Raymond, N. Shimizu, K. Kawasaki, S. Minoshima, G.A. Evans, M. Athanasiou, R. Schultz, B.A. Roe, F. Chen, H. Pan, J. Ramser, H. Lehrach, R. Reinhardt, W.R. McCombie, M. de la Bastide, N. Dedhia, H. Blocker, K. Hornischer, G. Nordsiek, R. Agarwala, L. Aravind, J.A. Bailey, A. Bateman, S. Batzoglou, E. Birney, P. Bork, D.G. Brown, C.B. Burge, L. Cerutti, H.C. Chen, D. Church, M. Clamp, R.R. Copley, T. Doerks, S.R. Eddy, E.E. Eichler, T.S. Furey, J. Galagan, J.G. Gilbert, C. Harmon, Y. Hayashizaki, D. Haussler, H. Hermjakob, K. Hokamp, W. Jang, L.S. Johnson, T.A. Jones, S. Kasif, A. Kaspryzk, S. Kennedy, W.J. Kent, P. Kitts, E.V. Koonin, I. Korf, D. Kulp, D. Lancet, T.M. Lowe, A. McLysaght, T. Mikkelsen, J.V. Moran, N. Mulder, V.J. Pollara, C.P. Ponting, G. Schuler, J. Schultz, G. Slater, A.F. Smit, E. Stupka, J. Szustakowski, D. Thierry-Mieg, J. Thierry-Mieg, L. Wagner, J. Wallis, R. Wheeler, A. Williams, Y.I. Wolf, K.H. Wolfe, S.P. Yang, R.F. Yeh, F. Collins, M.S. Guyer, J. Peterson, A. Felsenfeld, K.A. Wetterstrand, A. Patrinos, M.J.
168
Morgan, P. de Jong, J.J. Catanese, K. Osoegawa, H. Shizuya, S. Choi and Y.J. Chen, Initial sequencing and analysis of the human genome. Nature, 2001. 409(6822): p. 860-921.
3. Shapiro, M.B. and P. Senapathy, RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res, 1987. 15(17): p. 7155-74.
4. Teraoka, S.N., M. Telatar, S. Becker-Catania, T. Liang, S. Onengut, A. Tolun, L. Chessa, O. Sanal, E. Bernatowska, R.A. Gatti, and P. Concannon, Splicing defects in the ataxia-telangiectasia gene, ATM: underlying mutations and consequences. Am J Hum Genet, 1999. 64(6): p. 1617-31.
5. Ars, E., E. Serra, J. Garcia, H. Kruyer, A. Gaona, C. Lazaro, and X. Estivill, Mutations affecting mRNA splicing are the most common molecular defects in patients with neurofibromatosis type 1. Hum Mol Genet, 2000. 9(2): p. 237-47.
6. Cartegni, L., S.L. Chew, and A.R. Krainer, Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet, 2002. 3(4): p. 285-98.
7. Chu, C.S., B.C. Trapnell, S. Curristin, G.R. Cutting, and R.G. Crystal, Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nat Genet, 1993. 3(2): p. 151-6.
8. Pagani, F., C. Stuani, M. Tzetis, E. Kanavakis, A. Efthymiadou, S. Doudounakis, T. Casals, and F.E. Baralle, New type of disease causing mutations: the example of the composite exonic regulatory elements of splicing in CFTR exon 12. Hum Mol Genet, 2003. 12(10): p. 1111-20.
9. ten Dijke, P. and C.S. Hill, New insights into TGF-beta-Smad signalling. Trends Biochem Sci, 2004. 29(5): p. 265-73.
10. Derynck, R. and Y.E. Zhang, Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature, 2003. 425(6958): p. 577-84.
11. Derynck, R. and X.H. Feng, TGF-beta receptor signaling. Biochim Biophys Acta, 1997. 1333(2): p. F105-50.
12. Moustakas, A., S. Souchelnytskyi, and C.H. Heldin, Smad regulation in TGF-beta signal transduction. J Cell Sci, 2001. 114(Pt 24): p. 4359-69.
13. Patterson, G.I. and R.W. Padgett, TGF beta-related pathways. Roles in Caenorhabditis elegans development. Trends Genet, 2000. 16(1): p. 27-33.
14. Whitman, M., Smads and early developmental signaling by the TGFbeta superfamily. Genes Dev, 1998. 12(16): p. 2445-62.
15. Itoh, S., F. Itoh, M.J. Goumans, and P. Ten Dijke, Signaling of transforming growth factor-beta family members through Smad proteins. Eur J Biochem, 2000. 267(24): p. 6954-67.
16. Massague, J., How cells read TGF-β signals. Nature Reviews Molecular Cell Biology, 2000. 1: p. 169-178.
17. Nakao, A., M. Afrakhte, A. Moren, T. Nakayama, J.L. Christian, R. Heuchel, S. Itoh, M. Kawabata, N.E. Heldin, C.H. Heldin, and P. ten Dijke, Identification of Smad7, a TGFbeta-inducible antagonist of TGF-beta signalling. Nature, 1997. 389(6651): p. 631-5.
169
18. Persson, U., H. Izumi, S. Souchelnytskyi, S. Itoh, S. Grimsby, U. Engstrom, C.H. Heldin, K. Funa, and P. ten Dijke, The L45 loop in type I receptors for TGF-beta family members is a critical determinant in specifying Smad isoform activation. FEBS Lett, 1998. 434(1-2): p. 83-7.
19. Lo, R.S., Y.G. Chen, Y. Shi, N.P. Pavletich, and J. Massague, The L3 loop: a structural motif determining specific interactions between SMAD proteins and TGF-beta receptors. Embo J, 1998. 17(4): p. 996-1005.
20. Chen, Y.G. and J. Massague, Smad1 recognition and activation by the ALK1 group of transforming growth factor-beta family receptors. J Biol Chem, 1999. 274(6): p. 3672-7.
21. Xiao, Z., N. Watson, C. Rodriguez, and H.F. Lodish, Nucleocytoplasmic shuttling of Smad1 conferred by its nuclear localization and nuclear export signals. J Biol Chem, 2001. 276(42): p. 39404-10.
22. Xu, L., Y.G. Chen, and J. Massague, The nuclear import function of Smad2 is masked by SARA and unmasked by TGFbeta-dependent phosphorylation. Nat Cell Biol, 2000. 2(8): p. 559-62.
23. Shi, Y., Y.F. Wang, L. Jayaraman, H. Yang, J. Massague, and N.P. Pavletich, Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA binding in TGF-beta signaling. Cell, 1998. 94(5): p. 585-94.
24. von Bubnoff, A. and K.W. Cho, Intracellular BMP signaling regulation in vertebrates: pathway or network? Dev Biol, 2001. 239(1): p. 1-14.
25. Kretzschmar, M., J. Doody, and J. Massague, Opposing BMP and EGF signalling pathways converge on the TGF-beta family mediator Smad1. Nature, 1997. 389(6651): p. 618-22.
26. Itoh, S., J. Ericsson, J. Nishikawa, C.H. Heldin, and P. ten Dijke, The transcriptional co-activator P/CAF potentiates TGF-beta/Smad signaling. Nucleic Acids Res, 2000. 28(21): p. 4291-8.
27. Hata, A., R.S. Lo, D. Wotton, G. Lagna, and J. Massague, Mutations increasing autoinhibition inactivate tumour suppressors Smad2 and Smad4. Nature, 1997. 388(6637): p. 82-7.
28. Murakami, G., T. Watabe, K. Takaoka, K. Miyazono, and T. Imamura, Cooperative inhibition of bone morphogenetic protein signaling by Smurf1 and inhibitory Smads. Mol Biol Cell, 2003. 14(7): p. 2809-17.
29. Correia, J.J., B.M. Chacko, S.S. Lam, and K. Lin, Sedimentation studies reveal a direct role of phosphorylation in Smad3:Smad4 homo- and hetero-trimerization. Biochemistry, 2001. 40(5): p. 1473-82.
30. Shi, Y. and J. Massague, Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell, 2003. 113(6): p. 685-700.
31. Balemans, W. and W. Van Hul, Extracellular regulation of BMP signaling in vertebrates: a cocktail of modulators. Dev Biol, 2002. 250(2): p. 231-50.
32. Zimmerman, L.B., J.M. De Jesus-Escobar, and R.M. Harland, The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell, 1996. 86(4): p. 599-606.
170
33. Grotewold, L., M. Plum, R. Dildrop, T. Peters, and U. Ruther, Bambi is coexpressed with Bmp-4 during mouse embryogenesis. Mech Dev, 2001. 100(2): p. 327-30.
34. Onichtchouk, D., Y.G. Chen, R. Dosch, V. Gawantka, H. Delius, J. Massague, and C. Niehrs, Silencing of TGF-beta signalling by the pseudoreceptor BAMBI. Nature, 1999. 401(6752): p. 480-5.
35. Ishida, W., T. Hamamoto, K. Kusanagi, K. Yagi, M. Kawabata, K. Takehara, T.K. Sampath, M. Kato, and K. Miyazono, Smad6 is a Smad1/5-induced smad inhibitor. Characterization of bone morphogenetic protein-responsive element in the mouse Smad6 promoter. J Biol Chem, 2000. 275(9): p. 6075-9.
36. Imamura, T., M. Takase, A. Nishihara, E. Oeda, J. Hanai, M. Kawabata, and K. Miyazono, Smad6 inhibits signalling by the TGF-beta superfamily. Nature, 1997. 389(6651): p. 622-6.
37. Inoue, H., T. Imamura, Y. Ishidou, M. Takase, Y. Udagawa, Y. Oka, K. Tsuneizumi, T. Tabata, K. Miyazono, and M. Kawabata, Interplay of signal mediators of decapentaplegic (Dpp): molecular characterization of mothers against dpp, Medea, and daughters against dpp. Mol Biol Cell, 1998. 9(8): p. 2145-56.
38. Souchelnytskyi, S., T. Nakayama, A. Nakao, A. Moren, C.H. Heldin, J.L. Christian, and P. ten Dijke, Physical and functional interaction of murine and Xenopus Smad7 with bone morphogenetic protein receptors and transforming growth factor-beta receptors. J Biol Chem, 1998. 273(39): p. 25364-70.
39. Hata, A., G. Lagna, J. Massague, and A. Hemmati-Brivanlou, Smad6 inhibits BMP/Smad1 signaling by specifically competing with the Smad4 tumor suppressor. Genes Dev, 1998. 12(2): p. 186-97.
40. Zhu, H., P. Kavsak, S. Abdollah, J.L. Wrana, and G.H. Thomsen, A SMAD ubiquitin ligase targets the BMP pathway and affects embryonic pattern formation. Nature, 1999. 400(6745): p. 687-93.
41. Rotin, D., WW (WWP) domains: from structure to function. Curr Top Microbiol Immunol, 1998. 228: p. 115-33.
42. Wang, W., F.V. Mariani, R.M. Harland, and K. Luo, Ski represses bone morphogenic protein signaling in Xenopus and mammalian cells. Proc Natl Acad Sci U S A, 2000. 97(26): p. 14394-9.
43. Nakashima, K., M. Yanagisawa, H. Arakawa, N. Kimura, T. Hisatsune, M. Kawabata, K. Miyazono, and T. Taga, Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science, 1999. 284(5413): p. 479-82.
44. Binnerts, M.E., X. Wen, K. Cante-Barrett, J. Bright, H.T. Chen, V. Asundi, P. Sattari, T. Tang, B. Boyle, W. Funk, and F. Rupp, Human Crossveinless-2 is a novel inhibitor of bone morphogenetic proteins. Biochem Biophys Res Commun, 2004. 315(2): p. 272-80.
45. Thies, R.S., M. Bauduy, B.A. Ashton, L. Kurtzberg, J.M. Wozney, and V. Rosen, Recombinant human bone morphogenetic protein-2 induces osteoblastic differentiation in W-20-17 stromal cells. Endocrinology, 1992. 130(3): p. 1318-24.
171
46. Lenox, L.E., J.M. Perry, and R.F. Paulson, BMP4 and Madh5 regulate the erythroid response to acute anemia. Blood, 2005. 105(7): p. 2741-8.
47. Pedersen, A.G. and H. Nielsen, Neural network prediction of translation initiation sites in eukaryotes: perspectives for EST and genome analysis. Proc Int Conf Intell Syst Mol Biol, 1997. 5: p. 226-33.
48. Pedersen, A.G.a.H.N. NetStart 1.0 Prediction Server. [cited; Available from: http://www.cbs.dtu.dk/services/NetStart/.
49. Liu, F., A. Hata, J.C. Baker, J. Doody, J. Carcamo, R.M. Harland, and J. Massague, A human Mad protein acting as a BMP-regulated transcriptional activator. Nature, 1996. 381(6583): p. 620-3.
50. Baker, J.C. and R.M. Harland, A novel mesoderm inducer, Madr2, functions in the activin signal transduction pathway. Genes Dev, 1996. 10(15): p. 1880-9.
51. de Jong, D.S., W.T. Steegenga, J.M. Hendriks, E.J. van Zoelen, W. Olijve, and K.J. Dechering, Regulation of Notch signaling genes during BMP2-induced differentiation of osteoblast precursor cells. Biochem Biophys Res Commun, 2004. 320(1): p. 100-7.
52. Fuchs, O., O. Simakova, P. Klener, J. Cmejlova, J. Zivny, J. Zavadil, and T. Stopka, Inhibition of Smad5 in human hematopoietic progenitors blocks erythroid differentiation induced by BMP4. Blood Cells Mol Dis, 2002. 28(2): p. 221-33.
53. Bruno, E., S.K. Horrigan, D. Van Den Berg, E. Rozler, P.R. Fitting, S.T. Moss, C. Westbrook, and R. Hoffman, The Smad5 gene is involved in the intracellular signaling pathways that mediate the inhibitory effects of transforming growth factor-beta on human hematopoiesis. Blood, 1998. 91(6): p. 1917-23.
54. Goumans, M.J., G. Valdimarsdottir, S. Itoh, F. Lebrin, J. Larsson, C. Mummery, S. Karlsson, and P. ten Dijke, Activin receptor-like kinase (ALK)1 is an antagonistic mediator of lateral TGFbeta/ALK5 signaling. Mol Cell, 2003. 12(4): p. 817-28.
55. Oh, S.P., T. Seki, K.A. Goss, T. Imamura, Y. Yi, P.K. Donahoe, L. Li, K. Miyazono, P. ten Dijke, S. Kim, and E. Li, Activin receptor-like kinase 1 modulates transforming growth factor-beta 1 signaling in the regulation of angiogenesis. Proc Natl Acad Sci U S A, 2000. 97(6): p. 2626-31.
56. Roelen, B.A., M.A. van Rooijen, and C.L. Mummery, Expression of ALK-1, a type 1 serine/threonine kinase receptor, coincides with sites of vasculogenesis and angiogenesis in early mouse development. Dev Dyn, 1997. 209(4): p. 418-30.
57. Matsuyama, S., M. Iwadate, M. Kondo, M. Saitoh, A. Hanyu, K. Shimizu, H. Aburatani, H.K. Mishima, T. Imamura, K. Miyazono, and K. Miyazawa, SB-431542 and Gleevec inhibit transforming growth factor-beta-induced proliferation of human osteosarcoma cells. Cancer Res, 2003. 63(22): p. 7791-8.
58. Ward, S.M., J.S. Desgrosellier, X. Zhuang, J.V. Barnett, and J.B. Galper, Transforming growth factor beta (TGFbeta) signaling via differential activation of activin receptor-like kinases 2 and 5 during cardiac development. Role in regulating parasympathetic responsiveness. J Biol Chem, 2002. 277(51): p. 50183-9.
172
59. Zhang, H., H.O. Akman, E.L. Smith, J. Zhao, J.E. Murphy-Ullrich, and O.A. Batuman, Cellular response to hypoxia involves signaling via Smad proteins. Blood, 2003. 101(6): p. 2253-60.
60. Sanchez-Elsner, T., L.M. Botella, B. Velasco, A. Corbi, L. Attisano, and C. Bernabeu, Synergistic cooperation between hypoxia and transforming growth factor-beta pathways on human vascular endothelial growth factor gene expression. J Biol Chem, 2001. 276(42): p. 38527-35.
61. Falanga, V., S.W. Qian, D. Danielpour, M.H. Katz, A.B. Roberts, and M.B. Sporn, Hypoxia upregulates the synthesis of TGF-beta 1 by human dermal fibroblasts. J Invest Dermatol, 1991. 97(4): p. 634-7.
A) 173
Score = 100 (t-mint)/(maxt-mint) (Pos)
-3-2-1+1+2+3+4+5+6
•t is the total of percentages for the 8 nucleotides occurring in the subsequence being scored
•mint and maxt are the minimum and maximum possible totals (the sum of the lowest and highest percentages in each of the eight positions)
B)
Figure 4-1. Calculation of 5’ splice site consensus sequence. (A) Table of the tabulated nucleotide frequencies (percent at which a nucleotide exists at a location within the splice region when compared to the total number of sequences evaluated: compiled from a total of 393 rodent sequences from GeneBank) for the 5’ splice site locations for rodents (Shapiro, M.B. and P. Senapathy, 1987 [3]). Consensus nucleotides are shown in the right-hand column in the green box; nucleotide position labeled in blue under position (Pos) column; orange boxes denote percents used for calculation in example shown in (B). (B) Example for the 5’ splice site calculation for the first exon-intron junction of murine Madh5. Capital letters denote the end of exon 1, while the lower case letters denote the first nucleotides of intron 1. (C) Map of the calculated 5’ splice site scores for murine Madh5.
1680 bps1680 bps1680 bps1680 bps
IAPIAPIAPIAP
= exon unaltered in f/f truncated transcript
= exon altered in f/f truncated transcript = intron
= site of 14bp insertion= exon unaltered in f/f truncated transcript
= exon altered in f/f truncated transcript = intron
= site of 14bp insertion
EXAMPLE: For the murine Madh5 sequence TGT_gtgagg
t = 11+14+7+100+100+37+73+82+19 = 443mint = 58maxt = 637Score = 100(443-58)/(637-58) = 66.5
C)66.5 99.5
92.686.2 80.7
96.9
insertion
174
Figure 4-2. Cascade of BMP signaling and levels of modulation. (From Balemans, W and Van Hul, W. 2002 [31]). BMP dimers bind to serine/threonine kinase receptors type I and II. Upon ligand binding, type II receptorstransphosphorylate type I receptors. The latter phosphorylate members of the Smad family of transcription factors. These Smads are subsequently translocated to the nucleus, where they activate transcription of target genes. (1) I-Smads and Smurfs regulate intracellular signaling by preventing further Smad signaling and consequent activation of gene transcription, (2) Pseudoreceptor BAMBI modulates BMP signaling at the membrane site by binding to BMP type II receptors, and (3) Extracellular antagonists modulate binding of BMP dimersto the BMP type I and type II receptors.
175
Ligands Activins TGF-βs BMPsGDFsMIS
Type II ActRII/IIB TβRII BMPRIIReceptors ActRII/IIB
MISRII
Type I ALK4 ALK5 ALK1 ALK3 Receptors ALK6
ALK2
Activin/TGF-βSmad pathway
BMPSmad pathway
*
Figure 4-3. Signaling specificity in the TGF-β superfamily. (From Moustakas et al., 2001[12]) Classification of mammalian Smad signaling cascade into activin-TGF-β (red) and BMP (blue) pathway. Representative examples of mammalian ligands, type II receptors, type I receptors, R-Smads, Co-Smads, and I-Smads are depicted in pathways linked by arrows or signs of inhibition. Bifurcation of the TGF- β pathway at the level of type I receptors towards both TGF- and BMP Smads is marked by an asterisk (*). Nomenclature of proteins: growth and differentiation factors (GDFs), Mullerian inhibiting substances (MIS), activin type II and type IIB receptor (ActRII/IIB), TGF-β type II receptor (TβRII), BMP type II receptor (BMPRII), MIS type II receptor (MISRII), activin receptor-like kinases 1-6 (ALK1-ALK6).
R-Smads Smad2 Smad1Smad3 Smad5
Smad8
Co-Smads Smad4
I-Smads Smad7 Smad6
176A)
L3 loop
pS-X-pS
SXS
GS domainL45 loop
B)
Figure 4-4. Activation of the type I receptor kinase and recognition of R-Smad. (From Shi, Y. and J. Massague, 2003 [30] and Chen, Y.G. and J. Massague, 1999 [20]) (A) In the basal state, type I receptor (TβRI) remains unphosphorylated. This conformation can be recognized by the type II receptor (TβRII) for phosphorylation in the GS domain. After phosphorylation, the TβRI uses its GS domain and the L45 loop to interact with the basic pocket and L3 loop of an R-Smad, resulting in its phosphorylation in the C-terminal SXS motif. The pThr/pSer-X-pSer motif on the R-Smad and the type I receptor is shown as green spheres [30]. (B) α-helix 1 and L3 sequences of R-Smads. Structural elements (arrows, β-strands; round boxes, α-helices) correspond to the Smad4 MH2 domain. Subtype-specific residues are boxed. Numbering of the last residue in each sequence corresponds to the Smad species not in parentheses. Not shown in (A) is α-helix 1. This structure has also been shown to be important for R-Smad recognition and activation by the type I receptors ALK1/2. Through comparison to the crystal structure of Smad4, the subtype specific residues of α-helix 1 are exposed to solvent in the vicinity of the L3 loop [20].
177
Generic Smad Structure
I-Smad
Smad4
R-Smad(Smad2)
Figure 4-5. Structure of the receptor activated R-Smads, common binding partner Smad4 and the inhibitory I-Smads. (From ten Dijke, P. and C.S. Hill, 2004 [9]) The MH1 (red) and MH2 (blue) domains are conserved among Smads. Two regions that are conserved among R-Smads but not other Smads are indicated by pale pink boxes. Non-conserved regions (including the linker) are shown in yellow. Smad2 contains two inserts in its MH1 domain (L1 and exon3) that are not found in other R-Smads. Motifs shown include: phosphorylated C-terminal SxS motif (pSXpS); (NES) nuclear export signal; (NLS) nuclear localization signal; (PY), the PPxYmotif that mediates binding to Smurf1 and Smurf2.
178
ATG
mutant transcript#1
mutant transcript#2
*[ ]*****
wild type
ATGATG
mutant transcript#1
mutant transcript#2
**[ ]*****[ ]*****
wild type
ATG
mutant transcript#1
mutant transcript#2
*[ ]*****
wild type
ATGATG
mutant transcript#1
mutant transcript#2
**[ ]*****[ ]*****
wild type
Figure 4-6. Map of full length Madh5 (Smad5) as well as the truncated transcripts found in f/f mice. Colored boxes represent exons. Dotted line denotes skipped exon(s). * indicates location of in-frame ATGs with (translation initiation sites predicted by NetStart with scores > 0.5; http://www.cbs.dtu.dk/services/NetStart/) [47] downstream of the known Madh5 translational start site (ATG). Actual start codon located in exon 2 has a score of 0.691; in frame ATG of mutant transcript #1 score of 0.585; in frame ATGs of mutant transcript #2 are 0.563, 0.588, 0.524, 0.588 and 0.608 respectively.
Figure 4-8. Transfected COS7 cells with constructs containing truncated transcripts. 48 hr transfection of COS7 cells with truncated transcripts, the empty MSCV-neo vector, and full length Smad5 transcript. Lysates were first immunoprecipitated with Seize-columns (Peirce) binding the N-term Smad1/5/8 antibody N-18 (Santa Cruz), which helped to eliminate non-specific binding and which would explain why no appreciable amounts of full length Smad5 are seen in the control lanes. Subsequently, the lysates were immunoprecipitated with Seize column (Peirce) bound C-term Smad5 antibody (D-20 from Santa Cruz), which would bind the predicted truncated proteins from the f/f truncated transcripts. The lysates were run on a 4-20% gradient gel, transferred, and the blot was probed with D-20 Smad5 (1:1000) and an anti-goat secondary (Santa Cruz) (1:8000). The predicted sizes for the transcripts are: lel-118 (transcript #2-F) 26.8 kDa; lel-139 (transcript #1-F) 33.1 kDa. (MSCV) is the empty MSCV-neo construct lysates; (1a-1c) elutants from the immunoprecipitation column binding protein from lysates of the truncated transcript #1 in MSCV-neo in Forward orientation; (2a-2c) elutants from the immunoprecipitation column binding protein from lysates of the truncated transcript #2 in MSCV-neo in the Forward orientation; (FL) is the full-length Smad5 in MSCV-neo (clone Neo22) lysates; (*) denotes a protein running at the predicted size for transcript #1.
83.6
39.631.4
17.4
kDa1a 1b 1c 2a 2b 2cMSCV FL
Figure 4-7. RT-PCR from COS7 cells transfected with retroviral constructs containing full length and truncated Smad5 constructs. 5µg total RNA from transfected COS7 cells (48 hr) was reverse transcribed according to SuperScriptII(Invitrogen) protocol using 250 ng random hexamers. cDNA was amplified using Smad5-A-5F and Smad5-A-3R primers. (FL) Full length Smad5 (Neo22 construct); (2) truncated transcript #2 in forward orientation (lel-118); (1) truncated transcript #1 in forward orientation (lel-139).
1000bp
1500bp
FL 2 1
2000bp
179
*
180
Receptor interaction and phosphorylationHomo- and hetero-oligomerization
Nuclear import/exportBinding to DNA cofactors
Binding to co-activators and co-repressors
DNA-bindingNuclear localization
Binding to DNA cofactors
1 133
PPXY (PY) motif recognized by WW domains of Smurf1 [41, 40]
Corresponding Smad5 Erk Kinase phosphorylation sites located at amino acids 188, 196, 205, 213 [25]
Figure 4-9. Predicted in-frame amino acid structure of truncated transcripts compared to wild-type Smad5. Reference for domains Entrez Gene ID #17129. (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=gene). Full length Smad5 codes for a 465 amino acid (aa) protein of 52 kDa. Truncated transcript #1 codes for a predicted 33.3 kDa protein combining aa’s 167-217 to 265-465, with 5 aa’s inserted between 418-419 according to those constructs used in the transduced W-20-17 cell assays. Truncated transcript #2’s longest open reading frame is predicted to be 26.8 kDa and consists of aa’s 227-465.
SXS motif of R-Smads which is phosphorylated by type I receptors to activate the molecule [30]
Alpha helix-1: conserved structure shown in Smad1 to be important in addition to L3 loop for the recognition of type I receptors [20]
MH2
265
MH1 MH2
223 465320-328 416-434
WT
MH2
PVHFQ167 217 265
227
Transcript #1
Transcript #2
L3 loop: structural motif determining specific interactions between Smad proteins an type I receptors, as well as for homo-trimerization and hetero-oligomerization (aa’s425,428) [19,30]
181
HPRT (338bps)
Car3 (291bps)
200bps
400bps
MSCV Smd5 #1R #1F#2R#2F
Figure 4-10. Gene expression of W-20-17 cell lines containing the f/f truncated transcripts. RT-PCR for HPRT and Car3 from W-20-17 cells lines stimulated with BMP4 (15 ng/mL) for 24 hrs. Lanes labeled as follows: empty MSCV-neo (MSCV); full length Smad5 clone Neo22 (Smd5); transcript #1-reverse orientation (#1R); transcript #2-forward orientation (#2F); transcript #2-reverse orientation (#2F); transcript #1-forward orientation (#1F).
182
BMP4 Hypoxia SCF
BMPR1α
Smad5 PERK
Kit receptor
MAPK
Rsk
ATF4
•SCL•Lmo2
•GATA1•Other factors
HIF1
eIF2α
ER stress
?
?
?
BMP4 Hypoxia SCF
BMPR1α
Smad5 PERK
Kit receptor
MAPK
Rsk
ATF4
•SCL•Lmo2
•GATA1•Other factors
HIF1
eIF2α
ER stress
?
?
?
Figure 4-11. Current working model for the network regulating expansive erythropoiesis (R.F. Paulson lab). The model diagrams the possible connection of the BMP, hypoxia and stem cell factor (SCF) signaling pathways converging to regulate erythroid development and stress erythropoiesis, specifically in regulating the expansion and differentiation of stress erythroid progenitors in the spleen. (Slide provided by Omid F. Harandi).
183
Appendix A
CLONING AND CHARACTERIZATION of the flexed-tail (f) LOCUS
The pursuit of a candidate gene for flexed-tail. The flexed-tail locus was located on
mouse chromosome 13 [1]. A panel of 408 F2 progeny from a F1(C57BL/6-f/f X
BALB/c) intercross were scored at birth for anemia by hematocrit and for the presence of
siderocytes by staining blood smears for iron deposits. A high resolution genetic linkage
map of the f locus was generated and initially localized the gene 0.6 cM distal to the
microsatellite marker D13MIT13. Further analysis by positional cloning of markers using
a TI31 Radiation Hybrid panel showed that the f locus co-segregated with the marker
D13Mit208. From here YAC and BAC libraries were screened for clones that contained
the flanking markers of flexed-tail (D13Mit13 and D13/Mit250) determined from the
genetic linkage map. Three YAC clones E10 (sized at approx. 110 Kb), E14 (sized at
115 Kb) and B24 (sized at 125 Kb) were initially determined by a PCR screen to contain
the flanking markers. At the time, no extensive data base existed that contained ordered
sequence of the mouse genome. With the development of the murine genomic resources,
it has become clear that the initial PCR screens were flawed. Although correct sized
bands were generated by the screens, sequence comparison from the ends of the BACs as
well as the generation of a comprehensive map of the mouse genome confirms that they
could not in fact contain both flanking markers. These markers lie too far apart to be
contained on the BACs of the determined sizes (Figure A-1).
184
Proceeding with the information available at the time, the strategy to clone the
flexed-tail locus consisted of using the BAC clones and various methods to generate
sequence information between the flanking markers, or to identify transcriptional units
contained within this region (Figure A-2). The GPS-1 Genome Priming System
(Clonetech) is a Tn7 transposon insertion system which will randomly insert a primer
binding site throughout the BAC clone. Using a library of these insertions, the sequence
of the BAC can be compiled and candidate genes revealed. An alternative system was
the Exon Trapping System (Invitrogen). This technique utilized a specialized splicing
vector which contained cloned genomic segments (from the BAC clones). When this
vector is transfected into COS7 cells, splicing will occur and exons isolated, cloned and
sequenced.
Exon information generated from both methods was further utilized to try and
generate candidate genes for flexed-tail. Exons were used as probes to screen a cDNA
library generated from E16 fetal liver to try and determine the full length transcript which
had contained the particular exon. 5’ and 3’ RACE (Rapid Amplification of cDNA ends)
helped generate larger transcripts containing a particular fragment, again to try and
isolate a candidate gene for flexed-tail. No solid candidate genes were obtained by these
methods.
The Human and Mouse Genome Projects, as well as the data bases set up to
support these endeavors proved to be most useful recourse for finding candidate genes for
the flexed-tail locus. The comparison of the Human and Mouse Genomes on the NCBI
website (http://www.ncbi.nlm.nih.gov/Homology/) showed that the D13Mit13, which
contained in the IL-9 gene, was in close proximity to Madh5 (Smad5) in both the human
185
and mouse genomes. Smad5 was determined by both PCR and Southern blot to be
contained on our BACs (E10 and E14), as well as being expressed in the adult spleen
following a phenylhydrazine induced acute anemia (D3 post PHZ using a 2-injection
regimen) (Figure A-3). Smad5 is a downstream signaling molecule for the TGFβ
superfamily of morphogens, acting primarily down stream of BMPs. BMP4 is
specifically expressed along the ventral wall of the dorsal aorta (part of the AGM region),
at the onset of definitive hematopoietic cells in this region [2]. Early H&E sections of f/f
and f/+ littermates suggest defects in this region at this time (Figure A-4). The embryonic
defects of the flexed-tail mutants including a more detailed analysis of the fetal liver and
AGM are the pursuit of Prashanth Porayette, a fellow graduate student in the Paulson lab.
Smad5 is localized to a region in the human genome with known homology to the
region of mouse Chr 13 where flexed-tail has been isolated, and has been shown through
PCR and Southern analysis to be contained on our BAC clones. The BMP signaling
pathway is important for erythroid development, and Smad5 has been shown to be
expressed in the adult spleen following an acute anemia. For these reasons, Smad5 was
more extensively pursued as the candidate for the flexed-tail locus. A summary of the
results is contained in our paper published in Blood (2005) [3].
Northern blot analysis. It was discovered that flexed-tail mutants were preferentially
producing a truncated Madh5 (Smad5) mRNA with significantly less full length
transcript detected in PCR. To get a more quantitative analysis of these differences
Northern blots from D=4 PHZ treated adult spleens were performed. Although initially
186
showing a roughly 2-fold decrease in the amount of full length Smad5 in f/f compared to
f/+ controls, these results could not be consistently repeated (Figure A-5). RNase
Protection assays fared no better at showing a definitive comparison of the amount of full
length Smad5 transcript in flexed-tail mice.
Western blot analysis. With the indication that there were differences in the amount of
correctly spliced transcripts from f/f mice as compared to +/+ or f/+, it follows that there
may be altered Smad5 protein levels in the mutants. Western blotting was attempted
using various protein sources (whole cell lysates: spleen; nuclear extracts; PHZ treated
spleen; retrovirally transduced spleen COS7, 293T, W-20-17 cells), using antibodies
against Smad5 (N-term (1/5/8); C-term (5); (phospho)-1/5/8; (phospho)-Smad5), and
using various procedures (whole cell lysates or immunoprecipitation: anti- Smad5;
Smad4; Smad1/5/8; Pierce Column to eliminate heavy chain using (1/5/8 or 5)). The
most promising results were generated using 24 hr post PHZ adult spleen lysates
immunoprecipitated with (anti-Smad1/5/8) and probed with anti-Smad5 (D20) (Figure A-
6). This result was not consistently seen. Difficulty in duplicating the results could be
attributed to the inherent variation in Smad5 amongst f/f mice, low levels of Smad5
protein in primary cells, stability of the protein, or specificity of the antibodies.
Short-term rescue of flexed-tail—retroviral transduction of f/f spleen cells. Spleen
erythroid progenitors from f/f mutants do not respond to BMP4 in erythroid colony
assays. To rescue these progenitors, f/f progenitors were retrovirally transduced with full
length Smad5 cDNA. At the time it was hypothesized that providing a wild-type copy
187
would produce enough full length transcript to render them capable of a BMP4 response.
Retroviral rescues were attempted using various conditions for the transduction (varied
time of transduction, combination of various factors including SCF, IL3, Epo, BMP4) as
well as various conditions in the plating media (no SCF, no IL3, but +/- Epo, +/- BMP4),
and even sorted Lin- vs. whole spleen cell suspensions. The conditions that showed the
best “rescue” of f/f as determined by the number of hemoglobinized colonies used Epo,
IL3, SCF in the transduction, and incubation with virus for 5 hours (Figure A-7A). The
morphology of the colonies was not consistent with pure BFU-E and showed a large
proportion of mixed morphology colonies. There was also no response to BMP4. The
condition that led to the expected number and morphology of colonies (BMP4, SCF and
IL3 in the transduction, incubated for 5 hours), showed little difference between any of
phenotypes with none showing a response to BMP4 (Figure A-7B). We know now that
the mere exposure of the spleen cells to BMP4 is enough to drive their differentiation to
an Epo responsive cell, which no longer retains BMP4 its responsiveness. Including
BMP4 during the transduction probably just differentiated the cells beyond what would
respond in the in vitro culture assays. Altering the cytokine cocktails during the
transduction was having unanticipated effects on our spleen progenitor cells, and thus no
conclusive results could be obtained using these methods.
Long-term rescue--Smad5 transgenic f/f mice. Before the observation of the
neomorphic properties of the flexed-tail truncated transcripts, it was hypothesized that a
wild-type copy of the Madh5 gene would rescue the recessive mutation. Using our E10
BAC we generated transgenic mice containing what we thought to be the full length
188
Smad5. Only 2 founders (out of 9 litters) were generated, with only #1439 a productive
breeder. These were crossed to our f/f mutants. F1s that were BAC+ were crossed again
to f/f. f/f BAC+ and f/f BAC- were compared for their hematocrit recovery following a
PHZ induced acute anemia. Initial results were promising, but by increasing the number
of mice for more statistically relevant results, we found no statistical difference in the
hematocrit values between f/f BAC+ and f/f BAC- over the recovery period (Figure A-8).
This suggests the flexed-tail phenotype was not rescued with our BAC. This could be
due to the founder not expressing the BAC, or to the fact the entire Smad5 was not
contained on E10 (3’-most end not on BAC: see 10/29/01), and thus Smad5 from the
BAC was not correctly regulated. Even if given a wild-type version of Smad5, the
flexed-tail mice are still producing the aberrant versions which have been shown to
disrupt BMP signaling.
Cloning of the flexed-tail mutation. The splicing defect in f/f mutants was not due to
any mutations in the coding region. For this reason, we tried alternative methods to
sequence the genomic sequence of Smad5 between flexed-tail and wild-type mice. One
technique, genome walking, enabled me to compile roughly 10 Kb of genomic sequence
from f/f (not including that compiled from our C57 controls, or off the BAC clones). A
map of this data is included in (Figure A-9). The biggest problem with this technique
was specificity. Artifacts and repeat regions, including a defective retroviral element
(intercisternal A particle, (IAP)) between exon 1 and exon 2, made analyzing the
sequence messy and complex at best. Since the sequence generated is genome wide,
pseudogenes also complicate the analysis.
189
To circumvent these problems, the entire Smad5 gene (from exon 1 to 7), or
roughly 39 Kb was directly amplified in shorter fragments (3-6 kb stretches), cloned and
sequenced (Laurie Lenox, John Perry, Prashanth Porayette and Michelle Yon). The
shorter fragments with their respective names are shown in (Figure A-10). The biggest
difficulties with direct sequencing of the Smad5 gene was getting fragments amplified for
cloning. A particularly difficult stretch was the 5’ most end of the gene containing exon
1. This region is highly GC rich (approx. 70%), with tight secondary structure, even at
the temperatures optimal for polymerase extension (72 degrees). A comparison of the
secondary structure using mFold (http://mfold.burnet.edu.au) between equal sized
fragments from the easily amplified Bombay fragment (43% GC rich), and the nearly
impossible 5’ end of Alaska is shown in (Figure A-11). The 5’ end of Alaska was
eventually sequence by adjusting PCR conditions, primer design (short 200-500bp
stretches), and through the use of EpiCenter Fail Safe polymerase, allowing efficient
extension at 88 degrees, rather than the standard 72 degrees. Sequences were compared
between flexed-tail and C57 wild-type clones, as well as comparisons to the Ensembl
genome database (Ensembl Genome Browser: http://www.ensembl.org/). Verification
was established between at least two clones, from two independent mice. The only
potential mutation that held up to this scrutiny was a variation in a poly T stretch located
in the Greece fragment (intron 4). Sequences originally cloned from flexed-tail showed
14Ts whereas the stretch from the C57 (as well as the database) contained 16Ts.
Mutations in poly-pyrimidine stretches have been shown to aberrantly effect splicing [4,
5]. The most notable is in the cystic fibrosis transmembrane conductance regulator
(CFTR) gene. In the CFTR gene there are variants in poly-T tract in intron 8 (5T, 7T,
190
9T), with each allele leading to the generation of correctly and aberrantly spliced CFTR
transcripts lacking exon 9. There is an inverse correlation between the level of aberrantly
spliced transcript and the length of the poly(T) tract. The more correctly spliced
transcript, the less severe the disease [6, 7]. The PolyT stretch of Smad5 was much
longer than that seen in CFTR. A number of techniques were used to verify the number
of T’s from f/f and C57 mice.
Determining the number of T’s in the Greece fragment polyT stretch. Due to the
length of the polyT stretch in question (14 vs. 16 Ts), all techniques requiring an
amplification step have proven problematic mostly likely due to polymerase slipping.
Directly cloning and sequencing the PolyT stretch using high fidelity polymerases would
suggest a distribution of Ts between flexed-tail and wild-type mice, centering around 15-
16Ts (Figure A-12). Alternative techniques have been attempted including radioactive
PCR (to decrease the number of cycles required and thus decreasing artifacts), primer
extension, Oligo-nucleotide ligation assays (3 different primer sets), screening of a
genomic library, as well as the Transgenomic Mutation Detection Kit. In all cases, it was
a balancing act between signal strength and specificity. Since none of these techniques
could yield definitive results, we tried to show functionally the consequences of
differences in the PolyT region. Currently Shailaja Hedge in our lab is performing
recombination cloning. This is a cloning technique that does not rely on PCR
amplification, but rather on a recombination competent E. coli strain. Utilizing this
technique will hopefully reduce the artifacts associated with amplification and determine
the true number of Ts of the polyT stretch between f/f and +/+ mice.
191
Functional consequences of the PolyT tract-- In vitro splicing assay. We utilized the
Exon Trapping vector (pSPL3), and cloned different genomic fragments (Greece,
Florence-Greece, fragment of Florence-Greece) between flexed-tail or wild-type mice,
verified the number of Ts in the polyT stretch, then used the constructs in a splicing assay
to determine whether there were specific differences in the spliced products dependent on
the size of the polyT stretch. Primer combinations to amplify the spliced products were
positioned within the splicing vector itself, or within exons to amplify more specific
products (Figure A-13). Predicted splice products (Exon3:4:5) as well as those seen in
vivo in the flexed-tail (aberrant 3:4:5) were obtained. Although promising, overall
analysis of the products using these techniques was difficult. There were many spliced
products produced, from both flexed-tail and wild-type, often varying by only one or two
bps at the splice junctions, including numerous exon:vector or vector:vector
combinations. The combinations were so infinite and inconsistent that no conclusive
results as to how the variations in the polyT stretch were specifically affecting splicing
could be determined.
192
References
1. Lyon, M., S. Rastan, and S. Brown, Genetic Variants and Strains of the Laboratory Mouse. 3rd ed. 1996, Oxford: Oxford University Press.
2. Marshall, C., C. Kinnon, and A. Thrasher, Polarized expression of bone morphogenetic protein-4 in the human aorta-gonad-mesonephros region. Blood, 2000. 96: p. 1591-1593.
3. Lenox, L.E., J.M. Perry, and R.F. Paulson, BMP4 and Madh5 regulate the erythroid response to acute anemia. Blood, 2005. 105(7): p. 2741-8.
4. Giannini, G., E. Ristori, F. Cerignoli, C. Rinaldi, M. Zani, A. Viel, L. Ottini, M. Crescenzi, S. Martinotti, M. Bignami, L. Frati, I. Screpanti, and A. Gulino, Human MRE11 is inactivated in mismatch repair-deficient cancers. EMBO Rep, 2002. 3(3): p. 248-54.
5. Nissim-Rafinia, M., O. Chiba-Falek, G. Sharon, A. Boss, and B. Kerem, Cellular and viral splicing factors can modify the splicing pattern of CFTR transcripts carrying splicing mutations. Hum Mol Genet, 2000. 9(12): p. 1771-8.
6. Chu, C.S., B.C. Trapnell, S. Curristin, G.R. Cutting, and R.G. Crystal, Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nat Genet, 1993. 3(2): p. 151-6.
7. Pagani, F., C. Stuani, M. Tzetis, E. Kanavakis, A. Efthymiadou, S. Doudounakis, T. Casals, and F.E. Baralle, New type of disease causing mutations: the example of the composite exonic regulatory elements of splicing in CFTR exon 12. Hum Mol Genet, 2003. 12(10): p. 1111-20.
193
D13Mit13D13Mit250Smad5
D13Mit208D13Mit13D13Mit250Smad5
D13Mit208
Figure A-1. Physical Map of Mus musculus Chr13 around region of Madh5(Smad5). http://www.ensembl.org/Mus_musculus/
194
GPSTM-1 Exon Trap
3 BAC’s
cDNA libraryfrom E16 fetal liver
Probe library with “trapped”
exons
Poly A+ RNA (from mouse fetal livers E16)
Marathon cDNA Adaptor
AP1 primerGene
specificF R AP1 primer
ds cDNA
5’-3’-x-
-x-3’
-x-3’
-5’
-5’
5’ and 3’ RACE
GPSTM-1 Exon Trap
3 BAC’s
cDNA libraryfrom E16 fetal liver
Probe library with “trapped”
exons
Poly A+ RNA (from mouse fetal livers E16)
Marathon cDNA Adaptor
AP1 primerGene
specificF R AP1 primer
ds cDNA
5’-3’-x-
-x-3’
-x-3’
-5’
-5’
5’ and 3’ RACE
Generate Sequence information between Mit13 and Mit250 and/oridentify transcription units
Generate Sequence information between Mit13 and Mit250 and/oridentify transcription units
Figure A-2. Strategy to find the flexed-tail (f) mutation. Sequence information from 3 BAC clones containing the flanking markers of flexed-tail (f) was generated using the GPS-1 (Clontech) Genome priming system while the Exon trapping system (Invitrogen) pulled out exons contained within the BAC clones. 5’ and 3’ Rapid Amplification of cDNA Ends (RACE) was used to determine the full length transcripts pulled from the BAC. Exons were also used to probed a cDNA library generated from E16 fetal liver RNA to determine genes that are expressed during the stage in development flexed-tail mice are anemic which are also contained on the BAC clones.
195
Figure A-3. Analysis for Madh5 (Smad5) on BAC clones. (A) PCR showing Madh5 on the E10 BAC as well as RT-PCR showing expression in the spleen of an adult f/f on day 3 following an acute anemia. (B) The BAC clones E10 and E14, were digested with a restriction enzyme to produce 15 Kb fragments. This DNA was used in a Southern blot to determine if Madh5 was contained within the BAC clones which contained the flanking markers of flexed-tail. Shown are the blots probed using a Madh5 probe (Smad5), as well as probes to the ends of the vector sequence of the BAC (T7 and SP6); (M) denotes lane for size markers.
T7 SP6Mouse Genomic DNA
~15kb
pBeloBAC
T7
E10
E14
Smad5
E10
E14M
25Kb
SP6E
10 E14
SP6E
10 E14
SP6E
10 E14
T7 SP6Mouse Genomic DNA
~15kb
pBeloBAC
T7
E10
E14
T7
E10
E14
Smad5
E10
E14M
25Kb
Smad5
E10
E14M
25Kb
SP6E
10 E14
SP6E
10 E14
SP6E
10 E14
SP6E
10 E14
80bps100bps
E10
BA
CD
3 PH
Z SP
L
PCR
80bps80bps100bps100bps
E10
BA
CD
3 PH
Z SP
L
PCR
A)
B)
196
DORSAL AORTA of E10.5 f /+ control mouse
DORSAL AORTA of E10.5 f /f mutant mouse
400X 400X
VIEW
Figure A-4. H&E stained sections of dorsal aorta from E10.5 f/f and f/+ littermates. (Top panel) Cross sections of embryos shown. Black arrow denotes position within the embryos. (Bottom panels) Blue arrows point to the ventral wall of the dorsal aorta. Hematopoietic clusters can be seen budding from the ventral wall in the f/+ mice, but these clusters are not as prominent in the f/f littermates at this stage.
197
f / + control f / f mutant
Smad5
Probe
HPRT(loading control)
Figure A-5. Northern blot for Madh5 (Smad5) mRNA levels in spleen of f/+ and f/f adult mice following an acute anemia. RNA from spleen of f/f and f/+ adult mice D=4 post phenylhydrazine treatment (injection on D=0, and D=1) probed for HPRT as a loading control, and a probe specific to the coding region of Madh5.
198
f / f f /+ +/+f / f f /+ +/+83 kDa
39 kDa
Figure A-6. Western blot for Madh5 (Smad5) protein levels in f/f, f/+ and +/+ mice. Whole cell extracts from 24 hr post phenylhydrazine treated adult spleens from f/f, f/+ and +/+ mice were immunoprecipitated with a Smad1/5/8 antibody (N-18 from Santa Cruz) and probed with a Smad5 specific antibody (D-20 from Santa Cruz). The molecular weight of Smad5 is 52kDa. The arrow denotes location of Smad5.
A) 199
Figure A-7. Short-term rescue of f/f mutant spleen cells through retroviral transduction of full length Madh5 (Smad5) cDNA. f/f, f/+ and +/+ spleen cells were retrovirally transduced with a full length Smad5 transcript (Neo22) and then 1X105 cells plated in a BFU-E colony assays. Colonies were stained with acid benzidine for presence of hemoglobin. (A) Spleen cells incubated with viral supernatant containing Epo (3 U/mL), IL-3(10 ng/mL) and SCF (5 ng/mL) for 5 hrs prior to plating in methylcellulose media containing Epo (3 U/ml) or Epo + BMP4 (15 ng/mL). Shown is number of hemoglobin positive cells per 2X106 spleen cells plated. (B) Spleen cells incubated in viral supernatant containing Epo (3 U/mL), IL-3 (10 ng/mL) and BMP4 (15 ng/mL) for 5 hrs prior to plating in methylcellulose media containing Epo (3 U/mL) or Epo + BMP4 (15 ng/mL). Shown is the number of BFU-E per 2X106 cells plated.
0
20
40
60
80
100
120
140
f/f S d5f/f f/f+BMP4
C57 C57+BMP4
f/f+Smad5
f/f+SMad5+BMP4
= BFU-E = Mixed-Burst = Mixed-clump
0
50
100
150
200
250
300
+BMP4 +BMP4 +BMP4(-) (-) (-)
= f/f = f/f + Smad5= C57
0
20
40
60
80
100
120
140
f/f S d5f/f f/f+BMP4
C57 C57+BMP4
f/f+Smad5
f/f+SMad5+BMP4
f/f f/f+BMP4
C57 C57+BMP4
f/f+Smad5
f/f+SMad5+BMP4
= BFU-E = Mixed-Burst = Mixed-clump
0
50
100
150
200
250
300
+BMP4 +BMP4 +BMP4(-) (-) (-)
= f/f = f/f + Smad5= C57B)
Num
ber o
f BFU
-E p
er 2
X10
6
cells
pla
ted
Num
ber o
f hem
oglo
bini
zed
colo
nies
pe
r 2X
106
cells
pla
ted
200
A)
E10
BA
C
(+) c
ontr
ol(-
) con
tro l
1434
1435
1436
1437
1438
*143
914
40
1441
1442
1443
1444
1445
1446
1447
1448
1449
1450
E10
BA
C
(+) c
ontr
ol(-
) con
tro l
1434
1435
1436
1437
1438
*143
914
40
1441
1442
1443
1444
1445
1446
1447
1448
1449
1450
E10
BA
C
(+) c
ontr
ol(-
) con
tro l
1434
1435
1436
1437
1438
*143
914
40
1441
1442
1443
1444
1445
1446
1447
1448
1449
1450
% H
emat
ocrit
Days post PHZ
% H
emat
ocrit
Days post PHZ
f/f BAC(+) n=8f/f BAC(-) n=8f/+ BAC(+) n=4f/+ BAC(-) n=4
f/f BAC(+) n=8f/f BAC(-) n=8f/+ BAC(+) n=4f/+ BAC(-) n=4
f/f BAC(+) n=8f/f BAC(-) n=8f/+ BAC(+) n=4f/+ BAC(-) n=4
Perc
ent h
emat
ocri
t
B)
Figure A-8. Long-term rescue of flexed-tail mutants: Madh5 transgenic f/fmice. (A) PCR for the chloramphenicol resistance gene carried on the E10 BAC used for transgenics. Founder #1439 shown in red. (B) The hematocrits of (C57BL/6J-f/f x B6D2F1 BAC Transgene [#1439])F1 x C57Bl/6J-f/f littermates were followed over the recovery from a phenylhydrazine induced acute anemia.
201
Figu
re A
-9.
Gen
ome
Wal
king
res
ults
of M
adh5
geno
mic
reg
ion
from
f/f,
+/+
and
E10
BA
C.
Full
leng
th M
adh5
show
n at
top.
Sol
id c
olor
ed b
oxes
repr
esen
t exo
ns, w
hile
dot
ted
boxe
srep
rese
nt sk
ippe
d ex
ons i
n th
e f/f
trunc
ated
tran
scrip
t.
Bla
ck a
rrow
s den
ote
loca
tions
of g
enom
e w
alki
ng p
rimer
s, w
hile
whi
te a
rrow
s rep
rese
nt se
quen
cing
prim
ers.
Inte
rcis
tern
alA
par
ticle
foun
d in
intro
n 1
is re
pres
ente
d by
the
gold
hex
agon
.
150
1954
bps
AP2
-C52
7-R5
R3-
4R
9-1
0
RC
-AP2
-CIA
PA
P2-D
3500
bps
IAP
(300
0+bp
s)
AP2
-C52
7-R5
R3-
4
RC
-AP2
-C(1
800b
ps to
IAP)
R 9
-10
AP2
-DR
11-
12
260
Pres
ent i
n B
AC
and
f/f
R3-
4
260
Pres
ent i
n B
AC
and
f/f
R3-
4
260
Pres
ent i
n B
AC
and
f/f
R3-
4
333b
ps
F 3-
4
(OR
)?30
25 b
ps13
4bps
AP2
-AA
P2-B
IntR
3In
tR4
R1-
2
1036
bps
(wt)
F 5-
6F
5-6
1110
bps
( f )
F 7-
8F1
-2; F
5-6
+/+
f/f
+/+ f/f
Gen
ome
Wal
king
us
ing
E10
BA
C
R1-
2
F1-2
R 5
-6R
3-4
R1-
2
F 5-
6
R7-
8
F 7-
8F
3-4
Gen
ome
Wal
king
Res
ults
F1
-2
R 5
-6R
3-4
R1-
2
F 5-
6
R7-
8
F 7-
8F
3-4
Gen
ome
Wal
king
Res
ults
F 7-
8 500b
ps (250
0bps
)
150
1954
bps
AP2
-C52
7-R5
R3-
4R
9-1
0
RC
-AP2
-CIA
PA
P2-D
3500
bps
IAP
(300
0+bp
s)
AP2
-C52
7-R5
R3-
4
RC
-AP2
-C(1
800b
ps to
IAP)
R 9
-10
AP2
-DR
11-
12
260
Pres
ent i
n B
AC
and
f/f
R3-
4
260
Pres
ent i
n B
AC
and
f/f
R3-
4
260
Pres
ent i
n B
AC
and
f/f
R3-
4
333b
ps
F 3-
4
(OR
)?30
25 b
ps13
4bps
AP2
-AA
P2-B
IntR
3In
tR4
R1-
2
1036
bps
(wt)
F 5-
6F
5-6
1110
bps
( f )
F 7-
8F1
-2; F
5-6
+/+
f/f
+/+ f/f
Gen
ome
Wal
king
us
ing
E10
BA
C
R1-
2
F1-2
R 5
-6R
3-4
R1-
2
F 5-
6
R7-
8
F 7-
8F
3-4
Gen
ome
Wal
king
Res
ults
F1
-2
R 5
-6R
3-4
R1-
2
F 5-
6
R7-
8
F 7-
8F
3-4
Gen
ome
Wal
king
Res
ults
F 7-
8 500b
ps (250
0bps
)
202
= exon unaltered in f/f truncated transcript
= exon altered in f/f truncated transcript = intron
= site of 14bp insertion
AlaskaBombay
ColoradoDublin
Egypt
Florence
Greece
Ireland
Hawaii
1680 bps
IAP
(3.57Kb)(3.97Kb)
(5.2Kb)(3.97Kb)
(3.36Kb)
(4.15Kb)
(4.63Kb)
(5.7Kb)
(3.16Kb)
(4.27Kb)
= exon unaltered in f/f truncated transcript
= exon altered in f/f truncated transcript = intron
= site of 14bp insertion
AlaskaBombay
ColoradoDublin
Egypt
Florence
Greece
Ireland
Hawaii
1680 bps
IAP
(3.57Kb)(3.97Kb)
(5.2Kb)(3.97Kb)
(3.36Kb)
(4.15Kb)
(4.63Kb)
(5.7Kb)
(3.16Kb)
(4.27Kb)
AlaskaBombay
ColoradoDublin
Egypt
Florence
Greece
Ireland
Hawaii
1680 bps
IAP
(3.57Kb)(3.97Kb)
(5.2Kb)(3.97Kb)
(3.36Kb)
(4.15Kb)
(4.63Kb)
(5.7Kb)
(3.16Kb)
(4.27Kb)
AlaskaBombay
ColoradoDublin
Egypt
Florence
Greece
Ireland
Hawaii
1680 bps
IAP
(3.57Kb)(3.97Kb)
(5.2Kb)(3.97Kb)
(3.36Kb)
(4.15Kb)
(4.63Kb)
(5.7Kb)
(3.16Kb)
(4.27Kb)
insertion
Figure A-10. Map of Madh5 subdivided for direct amplification, cloning and sequencing. Chr13: 56194401-56233706 Ensembl database (build 24) http://www.ensembl.org/Mus_musculus/. (10/2004 build 22: 55808625-55847352)
A) B)
Figure A-11. Secondary structure comparison between the difficult to amplify region of “Alaska” and the easily amplified comparable sized fragment of “Bombay” of the Madh5 gene. DNA Secondary Structure at 72°C (1187bps) using mFold (http://mfold.burnet.edu.au/). (A) Alaska fragment between the primers 6481F and 17937-A-R2-Amp which has a GC content of 68.8%. (B) 1-1186 bp of Bombay fragment which has a GC content of 43.1%.
203
0%
5%
10%
15%
20%
25%
30%
35%
12T's 13T's 14T's 15T's 16T's 17T's 18T's
Number of T's
Perc
enta
ge o
f clo
nes
C57
f/ff/f
Figure A-12. Number of Ts in PolyT region (Greece Fragment) from flexed-tail and wild-type mice. The region around the polyT tract of the Greece fragment (see Figure A-10) was amplified and cloned for sequencing. Graphed is the percentage of clones with a particular numbers of Ts. There were a total of 11 clones from seven C57 wild-type mice, and 32 clones from 10 flexed-tail mice.
204A)
Greece
3 4 5Tn2
Florence
B)
3 4 52 3 43 4 52 3 4 3 4 53 4 5
Greece constructFlorence/Greece construct
f/f wtC)
Figure A-13. In vitro splicing assays to determine the functional consequences of variations in the PolyT tract in flexed-tail and wild-type mice. A) Schematic of the region of Madh5 evaluated in the splicing assays (refer to Figure A-10). Numbers specify exons colored pink (aberrantly spliced exons in flexed-tail mice) or blue (unaffected exons). The PolyT tract is shown by the dotted vertical lines. B) Constructs of the pSPL3 exon trapping vector with regions of Madh5. In addition to labels from (A), yellow boxes represent the vector, while arrows show locations of primers for PCR to amplify splicing products. Clones used in assays were verified through sequences (14Ts in flexed-tail constructs; 16Ts in wild-type constructs). C) An example of the PCR amplification of splicing products from flexed-tail and wild-type mice using the pSPL3:Greece construct.
205
Appendix B
Supplementary Information: Genotyping of the Sideroflexin1 (Sfxn1) locus
10% of our flexed-tail colony screened (4/40 mice) were heterozygous at the sideroflexin
locus (Fleming et al. Genes and Development, 2001.15: p.652-657) as determined by two different
genotyping methods that I developed (see Figure B-1, B-2, B-3). There was a 100%
agreement between both methods in the genotypes of a particular mouse when all steps of
the procedures were completed successfully. Currently we are breeding to produce a f/f
mouse that is wild-type at the sideroflexin locus to evaluate any modifying role
sideroflexin may have in the flexed-tail phenotype.
206
Wildtype: GCGTCTTTACACACAGGT….CGAT CGGACCAGAGCACGTTCATT
Sfxn1 (mutant): GCGTCTTTACACACAGGT….CGAATCGGACCAGAGCACGTTCATT
GANTC Hinf1
CGRY CG BsiE1 R=A/G and Y=C/T
*
*
Mar
kers
Unc
ut
Bsi
E1
Hin
f1
Non specific amplification
Uncut
Cut
A.
Staining of a blood smear from a newborn f/f mouse with Prussian Blue stain to identify iron granule in the fetal erythrocytes. Blue dots in the erythrocytes indicate the presence of siderocytes.
B. Genotyping the Sideroflexin mutation in f/f mice from our colony.
(Top) Schematic of PCR primers and the diagnostic cut sites used to genotype the Sfxn1 mutation in f/f mice from our colony. The bold sequence is region around the A insertion mutant reported by Fleming et al.. Above and below this region are the sequences of the restriction sites used to differentiate between the alleles. The triangles mark the actual cut site. The * above the C base represents an inserted C nucleotide that generates the diagnostic restriction sites.
(Bottom) PCR analysis of DNA isolated from the mouse scored as a f/f in A. Both HinF1 and BsiE1 cut the PCR product indicating that this animal is heterozygous for the A insertion in Sfxn1. The lower band indicated by the arrow is a non-specific amplification.
Figure B-1. Genotyping for the Sideroflexin (Sfxn) mutation
207
Figure B-2. Direct sequencing of the Sfxn1 exon 2 in f/f mice. Sfxn1 exon 2 from the mouse in B-1(A) was PCR amplified and cloned in pTOPO-10 (Invitrogen). Multiple independent plasmids were sequenced. Two sequences were obtained as marked in the boxes, mutant-GAATC and wildtype-GATC.
Figure B-3. Analysis of Sfxn mutations in f/f mice by oligonucleotide ligationassay.
Allele specific reporter oligo
Common anchoring oligo
wild-type: ----ACGTGCTCTGGTCCCATCD
Sfxn mutant: ----ACGTGCTCTGGTCCCATTCF
(p)-GAGGCTCCTTGATGTTAATGTTG-- B
Allele specific reporter oligo
Common anchoring oligo
wild-type: ----ACGTGCTCTGGTCCCATCD
Sfxn mutant: ----ACGTGCTCTGGTCCCATTCF
(p)-GAGGCTCCTTGATGTTAATGTTG-- B
CTAC---------------- D
TAC-----------
CF
-----------GB
5’-------CGATG-------3’-
-----------GB
wild-type
T
5’-------CGATG-------3’-CTAC---------------- D
TAC-----------
CF
-----------GB
5’-------CGATG-------3’-
-----------GB
wild-type
T
5’-------CGATG-------3’-
Sfxn mutant
5’-------CGAATG--------3’
-----------GB
CTTAC----------- F
TAC---------------- D
5’-------CGAATG--------3’-----------GB
C
Sfxn mutant
5’-------CGAATG--------3’
-----------GB
CTTAC----------- F
TAC---------------- DTAC---------------- D
5’-------CGAATG--------3’-----------GB
C
y f f f y g g y
Streptavidin
F
B
AA
B
A
D
HRPAP
i.
ii.
iii. Oligonucleotide ligation assay (OLA) was used to confirm all PCR genotypes. (i)The technique utilizes a common anchoring oligo that is phosphorylated at its 5’ end and biotinylated at its 3’ end. Allele specific oligos that contain either a digoxigenin modification (wildtype) or a fluorescein (mutant) at its 5’ end. (ii) Ligation of the anchoring oligo to the allele specific oligo can only occur when the allele specific oligobinds the correct sequence. (iii) Anti-Dig conjugated to alkaline phosphatase and anti-Fitc conjugated to HRP are used to detect the ligatedproducts by ELISA.
We tested all f/f mice in our colony by the PCR assay and OLA. Both assays gave identical results. We conclude that in our colony, the mutation in Sfxn1 reported by Fleming et al. has been separated by recombination from the f/f mutant phenotype. We have identified numerous mice that exhibit the f/f phenotype, but are heterozygous for the Sfxn1 mutation. The f locus therefore cannot encode Sfxn1.
OLA was done as described in Single-well genotyping of diallelic sequence variations by a two-color ELISA-based oligonucleotide ligation assay. VO Tobe, SL Taylor and DA Nickerson. Nucleic Acids research 24:3728-2732, 1996.
208
VITA
L. E. Lenox
EDUCATION Penn State University 1997-present Ph.D. in Biochemistry, Microbiology and Molecular Biology University of Scranton 1993-1997 Bachelor of Science in Biology—magna cum laude HONORS AND AWARDS Penn State University College of Agriculture Science 2003 Competitive Grant Program winner for the proposal: β-Globin Minor Expression in the flexed-tail (f) mutant mouse Purdue University Applied Management Principles (AMP) Program for Science and Engineering Doctoral Students--6 Continuing Education Units 2002 Representative from PSU Eberly College of Science 1998/1999 Paul M. Althouse Outstanding Graduate Teaching Assistant Award--Honorable Mention 1998 Pela Fay Braucher Scholarship Award COMMITTEES 2002 Representative for the Eberly College of Science (BMMB Department) to Daniel J.Larson Advisory Board (Dean of Eberly College of Science) Topic Focus: How to measure success in the educational process PUBLICATIONS Laurie E. Lenox, John Perry and Robert Paulson. BMP4 and Madh5 regulate the erythroid response to acute anemia. Blood, 2005. 105(7): p. 2741-8. Laurie E. Lenox and Robert Paulson (in preparation). Extramedullary hematopoiesis following an acute anemia in splenectomized mice. ABSTRACTS AND NATIONAL MEETINGS Laurie Lenox, J.M. Perry and R.F. Paulson. The recovery of splenectomized mice to acute anemia. (Talk and Poster). August 2004. 23rd Summer Symposium in Molecular Biology: Hematopoiesis and Immune Cell Function. University Park, PA. Laurie Lenox, John Perry, Robert Paulson. BMP4/Smad5 Signaling Regulates the Expansion of a Novel Erythroid Progenitor in the Adult Spleen in Response to Acute Anemia (Talk and Poster). July 2003 FASEB Summer Research Conference: TGF-β Superfamily: Signaling and Development. Tucson, AZ. Robert Paulson, Laurie Lenox, John Perry, Prashanth Porayette (2002). BMP4 and Smad5 Regulate the Erythroid Response to Acute Anemia in the Adult Spleen (Poster). 44th Annual Meeting and Exposition of the American Society of Hematology. Philadelphia, PA. Laurie E. Lenox and Robert F. Paulson (1999). Positional Cloning of the flexed-tail locus (Poster). Thirteenth Annual International Mammalian Genome Society. Philadelphia, PA.
Top Related