Download - tower of babel

Transcript
Page 1: tower of babel

IInntttttttttttteeeeeeeeeeeeractive Deeeeeeeeeeeeeeeeeeeessssssssssssssssssssssign and MMMedia Apppplliiiiiiiiiiicccccccccaaaaaatttttttiiiiiionnnnn

gYYYYYYYYYYuuaann--TTing Tsaaii WWWiinnnntttteeeeeeeeeeerrrrrrrrrrrrr 2222200000000000000000000000000099

ITTTTTTTTTTTTTTTTTTTTTTTGM 770000000000000000005555555

Page 2: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

Tower of Babel is a fantasy adventure board game which

combining some features of monopoly and puzzle games.

In Tower of Babel, there are 8 chessmen which represent a

wizard, a princess, and 6 cavaliers, 48ieces of ladder which can

patch 3 octagons plants, 9 long stairs, 9 short stairs, 6 plats,

2 dices, 24 columns, 30 life cards, 12 read cards, 12 blue cards,

12 green cards, 12 chance cards, and 12 destiny cards.

The minimum players of Tower of Babel are three and the

maximum are six.

Introduction

Page 3: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

At the first, the players need to patch three floors of the tower by using

24 pieces of ladder and 24 columns, and then connect the floors by setting stairs

and plats. The maximum entrances and outlets of each floor are three which are

depends on how the players patch the stairs and plats. Second, the players need

to choose a chessman as his or her avatar, and the chessman of the wizard and

the chessman of princess need to be set up at the top floor. Then, the players use

the dices to decide the order. There are red, green, and green colors on each stair

which means when a player stop his or her avatar on different colors, s/he need

to draw a card which is the same color with the stair the avatar is standing.

There are different commands on the color cards, chance cards, and destiny cards,

and the players should follow the instructions of those cards to keep the game in

progress. The goal of players is to reach the princess, and the game will be finished.

Page 4: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

Page 5: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

Prototype Testing

Page 6: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

270mm

50mm

50mm

30mm30mm

30mm

20mm

30mm

Page 7: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

150mm

125mm

Page 8: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

Rules Only use one dice for game.

When 2 player stay in the same block, they have to duel with each other by using dices. The loser should move backward.

The princess and the wizard have to switch once when the tower rebuild.

Every player has 2 points of life point at first.

When a player doesn’t want to obey, they will lose 1 life point.

The first one who lose all the life point can control the princess’s chessman or wizard’s chessman.

Every player can only have 5 life point cards.

The first who reach the princess is the winner.

The one who reach the wizard need to leave his or her chessman with the wizard.

If a block doesn’t have any color, nothing will happen when a player moves to this block.

The rule of “Obey the leadder”is 1. Pick up the (red, green or, blue) cards whose amount are the same with the players. 2. Every player draw a card from the picked cards.3. The one who has “A” should show the card, and then become the leader.4. Other player who didn’t get the “A” should keep their own cards secretly without showing the cards or reading the number of the cards.5. The leader should start annonce his or her order, such as “No1 and No2 dance,” or “No2 and No3 shake hands.”6. Then the other players should show the number they have and obey the leader’s order.7. If anyone doesn’t want to obey, they will lose one point.8. This game only play once when someone drew the “destiny card.”

Page 9: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

Rules R G B

Return to the previous block if you arenot a warrior.*1 Go to the next red block if you are a warrior.*1

Go to the closest blue block and stay.*1

Go to the closest green block and stay.*1

If you are not a warrior, dice a odd number by using a dice than you can move.*1If you are a warrior, sing a song.*1

If you are a warrior, talk a joke.*1

If you are a warrior, mock a anmial.*1

If you are a warrior, use your bottom to write 3 numbers.*1

If you are a warrior, drink a cup of beverages that you have now.*1

If you are a warrior, tell everyone a enbarrassing story about you.*1

If you are a warrior, tell everyone asecret about you.*1

Return to the previous block if you arenot a ranger*1 Go to the next red block if you are a ranger.*1

Go to the closest blue block and stay.*1

Go to the closest red block and stay.*1

If you are not a ranger, dice a odd number by using a dice than you can move.*1If you are a ranger, sing a song.*1

If you are a ranger, talk a joke.*1

If you are a ranger, mock a anmial.*1

If you are a ranger, use your bottom to write 3 numbers.*1

If you are a ranger, drink a cup of beverages that you have now.*1

If you are a ranger, tell everyone a enbarrassing story about you.*1

If you are a ranger, tell everyone asecret about you.*1

Return to the previous block if you are not a magician.*1

Go to the next red block if you are a magician*1

Go to the closest blue block and stay.*1

Go to the closest red block and stay.*1

If you are not a magician, dice a odd number by using a dice than you can move.*1If you are a magician, sing a song.*1

If you are a magician, talk a joke.*1

If you are a magician, mock a anmial.*1

If you are a magician, use your bottom to write 3 numbers.*1

If you are a magician, drink a cup of beverages that you have now.*1

If you are a magician, tell everyone a enbarrassing story about you.*1

If you are a magician, tell everyone asecret about you.*1

Red Cards*12 Green Cards*12 Blue Cards*12

Page 10: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

Chance Destiny

All players join the game “Obey a leader.” *3

Rebuild the current floor (swith Princess and wizard) *2

Rebuild all the floors. *1

If you are a ranger, dice 1 or 4 that stay, or return to the first floor. *1

If you are a magician, dice 2 or 5 that stay, or return to the first floor.*1

If you are a warrior, dice 3 or 6 that stay, or return to the first floor.*1

If you are a ranger, dice 1 or 4 that stay, or return to the last floor. *1If you are a magician, dice 2 or 5 that stay, or return to the last floor.*1If you are a warrior, dice 3 or 6 that stay, or return to the last floor.*1

Order a ranger to do one thing you want.*1

Order a magician to do one thing you want.*1

Order a warrior to do one thing you want.*1

Lose 1 life point if you are a ranger.*1

Lose 1 life point if you are a magician.*1

Lose 1 life point if you are a warrior.*1

You can go to the last floor os you draw a card which has the larger number than other players’ cards.*1

Give 1 life point if you are a warrior.*1

Give 1 life point if you are a magician.*1

Give 1 life point if you are a ranger.*1

Send other palyers to the begin of this floor.*2

Chance card*12 Destiny card*12Life Point

Rules

Page 11: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

Problems

After the prototype testing, some problems were showed, suchas players easy to get

boried, and the game was progressing too fast.

Page 12: tower of babel

Tower of Babel Interactive Design and Media ApplicationITGM 705

FeedbackThe players should have more interaction.

Every floor needs entrance.

The rules should have more varities.

It might be not necessary to using different kinds of color cards.

The gmae is progressing too fast.

The rules can be more simple.