Download - TENDER NO. GAIL/RJY/C&P/SR20036987/RAO document for pmc...CONSULTANCY (PMC) SERVICES FOR DESIGN & ... PONNAMANDA PIPELINE DOMESTIC COMPETITIVE ... Domestic Competitive Bidding basis

Transcript

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 1 of 154

GAIL (India) Limited (A Government of India Undertaking)

A Navratna Company GAIL Bhawan A V A Road Rajahmundry

TENDER NO. GAIL/RJY/C&P/SR20036987/RAO

BIDDING DOCUMENT FOR HIRING OF PROJECT MANAGEMENT

CONSULTANCY (PMC) SERVICES FOR DESIGN & CONSTRUCTION OF KESANAPALLI (W) to

PONNAMANDA PIPELINE

DOMESTIC COMPETITIVE BIDDING

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 2 of 154

TABLE OF CONTENTS

SL NO SECTION NO DESCRIPTION

1.0 I INVITATION FOR BID (IFB) 2.0 II INSTRUCTIONS TO BIDDERS

3.0 III GENERAL CONDITIONS OF CONTRACT

4.0 IV FORMS & FORMATS

5.0 V PART A: SCOPE OF WORK

PART B: SPECIAL CONDITION OF CONTRACT

6.0 VI PRICE SCHEDULE

7.0 VII ATTACHMENTS ATTACHMENT-I : CONTRACT AGREEMENT FORM

ATTACHMENT-II: PERFORMANCE EVALUATION ATTACHMENT-III: AGEREED TERMS & CONDITIONS ATTACHMENT-IV: INTEGRITY PACT

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 3 of 154

SECTION I

INVITATION FOR BIDS (IFB)

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 4 of 154

GAIL (India) Limited (A Govt. of India Undertaking)

A Navratna Company GAIL Bhawan A V A Road Rajahmundry

INVITATION FOR BID (IFB) Ref.: GAIL/RJY/C&P/SR20036987/RAO Dated: 09.03.2012 Sub: HIRING OF PROJECT MANAGEMENT CONSULTANCY (PMC ) SERVICES

FOR KSP (W) to PONNAMANDA PIPELINE Dear Sirs, GAIL (India) Limited, Rajahmundry, invites bids on Domestic Competitive Bidding basis for HIRING OF PROJECT MANAGEMENT CONSULTANCY (PMC) SER VICES FOR KSP (W) to PONNAMANDA PIPELINE , under single stage two envelopes system from competent agencies meeting the Bidder’s Eligibility Criteria as stated in the detailed Bid Document attached. Bids, submitted on line shall only be considered for processing. 1.0 BRIEF SCOPE OF WORK

11..11 TThhee bbrriieeff ddeessccrriippttiioonn ooff tthhee pprroojjeecctt iiss aass uunnddeerr::

GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iinntteennddss ttoo iimmpplleemmeenntt 1100"" xx 44..55 kkmmss.. ((aapppprrooxx..))

KKeessaannaappaallllii((WW)) ttoo PPoonnnnaammaannddaa PPiippeelliinnee aalloonnggwwiitthh tteerrmmiinnaall uupp--

ggrraaddaattiioonn aatt KKeessaannaappaallllii((WW)) aanndd PPoonnnnaammaannddaa tteerrmmiinnaallss ffoorr

ttrraannssppoorrttiinngg NNaattuurraall GGaass ttoo GGAAIILL--TTaattiippaakkaa aanndd ffuurrtthheerr ttoo ootthheerr

ccuussttoommeerrss aalloonngg ppiippeelliinnee rroouuttee iinn KKGG BBaassiinn rreeggiioonn..

11..22 TThhee bbrriieeff ssccooppee ooff sseerrvviicceess iiss aass ppeerr sseeppaarraattee sseeccttiioonn oonn tthhee ““SSccooppee ooff

WWoorrkk”” ooff tthhiiss BBiidd DDooccuummeenntt,, bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg::

TThhee PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt ((PPMMCC)) iiss bbeeiinngg aappppooiinntteedd ffoorr

eexxeeccuuttiinngg tthhee pprroojjeecctt rriigghhtt ffrroomm DDeessiiggnn ttoo CCoommmmiissssiioonniinngg && pprroojjeecctt

cclloosseeoouutt oonn ttoottaall aanndd ssiinnggllee ppooiinntt rreessppoonnssiibbiilliittyy bbaassiiss.. TThhiiss sseeccttiioonn iiss ttoo

bbee rreeaadd iinn ccoonnjjuunnccttiioonn wwiitthh ""SSccooppee ooff wwoorrkk””.. TThhee PPMMCC PPrroojjeecctt

MMaannaaggeerr wwiillll bbee tthhee ""EEnnggiinneeeerr--iinn--CChhaarrggee"" ffoorr tthhee ssaaiidd PPrroojjeecctt.. TThhee

ssccooppee ooff wwoorrkk ooff tthhee PPMMCC iiss bbrrooaaddllyy ddeeffiinneedd uunnddeerr tthhee ffoolllloowwiinngg

hheeaaddss bbuutt nnoott lliimmiitteedd ttoo::

[[aa]] BBaassiicc EEnnggiinneeeerriinngg && HHyyddrraauulliicc SSTTUUDDYY..

[[bb]] DDeessiiggnn && DDeettaaiilleedd EEnnggiinneeeerriinngg..

[[cc]] CCaarrrryyoouutt aallll nneecceessssaarryy ccaallccuullaattiioonnss aanndd ccoonndduucctt aallll aapppprroopprriiaattee

ddeessiiggnn pprroocceedduurree aanndd aannaallyyssiiss,, aass rreeqquuiirreedd,, ttoo ooppttiimmiizzee tthhee ssiizziinngg

aanndd sseelleeccttiioonn ooff tthhee eeqquuiippmmeenntt aanndd ssppeecciiffiiccaattiioonn ooff mmaatteerriiaallss..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 5 of 154

[[dd]] PPrreeppaarree oovveerraallll ddeessiiggnn bbaassiiss..

[[ee]] PPrreeppaarraattiioonn ooff MMaatteerriiaall TTaakkee--ooffffss ((MMTTOO)),, MMaatteerriiaall RReeqquuiissiittiioonn

((MMRR))..

[[ff]] PPrreeppaarraattiioonn ooff iitteemm--wwiissee ccoosstt eessttiimmaattee ffoorr eeaacchh MMaatteerriiaall RReeqquuiissiittiioonn

aanndd TTeennddeerr..

[[gg]] PPrreeppaarraattiioonn ooff ddrraawwiinnggss,, MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPrroojjeecctt

DDooccuummeenntt IInnddeexx..

[[hh]] PPllaannnniinngg && SScchheedduulliinngg..

[[ii]] IIddeennttiiffyy aallll tthhee iinntteerrffaaccee ppooiinnttss // bbaatttteerryy lliimmiittss aanndd iinnccoorrppoorraattee

tthheemm oonn rreelleevvaanntt ddrraawwiinnggss aanndd ddooccuummeennttss..

[[jj]] RReevviieeww aanndd aapppprroovvaall ooff ddeessiiggnn // ddrraawwiinnggss // ddooccuummeennttss ssuubbmmiitttteedd

bbyy vveennddoorrss // ccoonnttrraaccttoorrss // ssuupppplliieerrss..

[[kk]] TThhee ccoonnssuullttaanntt sshhaallll pprroovviiddee aallll tteecchhnniiccaall ddooccuummeennttss ffoorr lliiaassiioonniinngg

aassssiissttaannccee wwiitthh ssttaattuuttoorryy aauutthhoorriittiieess lliikkee RR&&BB,, SSPPCCBB ((SSttaattee

PPoolllluuttiioonn CCoonnttrrooll BBooaarrdd)),, FFoorreesstt aauutthhoorriittiieess,,iirrrriiggaattiioonn,, CCCCOOEE ((CChhiieeff

CCoonnttrroolllleerr ooff EExxpplloossiivveess)) ffoorr oobbttaaiinniinngg vvaarriioouuss ssttaattuuttoorryy

ppeerrmmiissssiioonnss..

[[ll]] PPrreeppaarraattiioonn ooff TTeennddeerr DDooccuummeennttss,, iinnvviittee bbiiddss,, eevvaalluuaattiioonn ooff uunn--

pprriicceedd aanndd pprriiccee bbiiddss,, rreeccoommmmeennddaattiioonn ffoorr aawwaarrdd ooff jjoobb aass ppeerr

GGAAIILL''ss CC&&PP PPrroocceedduurree,, aassssiissttaannccee dduurriinngg nneeggoottiiaattiioonnss iiff ssiittuuaattiioonn

aarriisseess.. PPrreeppaarraattiioonn ooff LLeetttteerrss ooff IInntteenntt,, WWoorrkk OOrrddeerrss // PPuurrcchhaassee

OOrrddeerrss,, CCoonnttrraacctt DDooccuummeennttss // AAggrreeeemmeennttss,, PPuurrcchhaassee RReeqquuiissiittiioonnss

((PPRR''ss))..

[[mm]] TTeennddeerriinngg && OOrrddeerriinngg,, iinncclluuddiinngg PPuurrcchhaassee ooff aallll eeqquuiippmmeennttss aanndd

mmaatteerriiaallss,, CCuussttoommss CClleeaarraannccee aanndd TTrraannssppoorrttaattiioonn ooff mmaatteerriiaallss //

eeqquuiippmmeennttss ttoo ssiittee,, eettcc..

[[nn]] IInnssppeeccttiioonn // EExxppeeddiittiinngg ooff eeqquuiippmmeennttss // mmaatteerriiaallss bbeeiinngg

mmaannuuffaaccttuurreedd bbyy vveennddoorrss iinncclluuddiinngg ccoonnttrraaccttoorr--ssuupppplliieedd iitteemmss..

[[oo]] MMaannaaggeemmeenntt ooff CCoonnssttrruuccttiioonn SSttoorreess aanndd SSttoorreess AAccccoouunnttiinngg..

[[pp]] CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt && SSuuppeerrvviissiioonn

[[qq]] QQuuaalliittyy AAssssuurraannccee aanndd QQuuaalliittyy CCoonnttrrooll..

[[rr]] PPrroojjeecctt CCoommmmiissssiioonniinngg..

[[ss]] RReevviieeww aanndd aapppprroovvaall ooff ''AAss--BBuuiilltt DDooccuummeennttss // DDrraawwiinnggss''..

[[tt]] PPrroojjeecctt CCoosstt CCoonnttrrooll,, MMaannaaggeemmeenntt && MMoonniittoorriinngg..

[[uu]] CCoonnssttrruuccttiioonn ssuuppeerrvviissiioonn iinncclluuddiinngg cceerrttiiffiiccaattiioonn ooff ccoonnttrraaccttoorr’’ss

bbiillllss..

[[vv]] RRiisskk MMaannaaggeemmeenntt ooff tthhee PPrroojjeecctt aalloonngg wwiitthh ddeettaaiilleedd RRiisskk AAnnaallyyssiiss..

TThhee RRiisskk MMaannaaggeemmeenntt PPllaann ((RRMMPP)) && DDiissaasstteerr MMaannaaggeemmeenntt PPllaann

((DDMMPP)) aarree aallssoo ttoo bbee pprreeppaarreedd bbyy tthhee CCoonnssuullttaanntt..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 6 of 154

[[ww]] HHeeaalltthh && SSaaffeettyy MMaannaaggeemmeenntt..

[[xx]] PPrroojjeecctt CClloosseeoouutt..

2.0 SALIENT FEATURES OF BIDDING DOCUMENT: (i) Type of Enquiry

: Domestic Competitive Bidding basis

(ii) Bid Document No. : GAIL/RJY/C&P/SR20036987/RAO (iii) Tender Fee (Non-

refundable) : NOT APPLICABLE

(iv) Bid security/EMD/SD : Not applicable (v) Time Schedule : 08 months (including 02 months for project closure) (vi) Bid Evaluation Criteria : As per Clause no. 3.0 of IFB (vii) Bid Document on Website : From 09.03.2012 to 10.04.2012 (viii) Date, Time & Venue of Pre-

Bid Meeting : 1100 hrs. IST on 20.03.2012

GAIL (India) Limited GAIL Bhawan A V A ROAD RAJAHMUNDRY-533103

(ix) Bid Submission Date & Time

: 10.04.2012 Up to 1400 hrs. (IST)

(x) Date and Time of Opening of Un-priced Bids at GAIL’s Rajahmundry Office

: At 1500 hrs. (IST) on 10.04.2012 (If the particular day happens to be a declared holiday in GAIL, Rajahmundry, the next working day shall be considered)

(xi) Price Bid Opening : Public Opening; Date, Time & Venue shall be intimated later.

(xii) Evaluation & Comparison of Bids

: As per Clause No. 31.0 of ITB.

(xiii) Contact person : GAIL (India) Limited GAIL BHAWAN A V A ROAD RAJAHMUNDRY-533103 Shri Jan Mohammad, Chief Manager (C&P) Ph: 0883-2400720/21/22 Extn: 380 E-mail: [email protected] Shri T N M Rao, Manager (C&P) Ph: 0883-2400720/21/22 Extn: 382 E-mail: [email protected]

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 7 of 154

2.1 Bidders are requested to attend the Pre-Bid Meeting so that their queries, if any, related to the Bid Document and Scope of work can be addressed during the meeting..

If any of the days specified above happens to be a holiday in GAIL, the next working day shall be implied.

2.2 The bid will be submitted in two parts as follows:

PART- I (PART – A)

UN-PRICED BID

Complete with all technical details other than price (i.e. including price schedule WITH PRICES BLANKED OUT), Proforma on Agreed Terms and Conditions as enclosed at Attachment-III and original tender document, duly sealed and signed on every page.

PART-II (PART B - PRICED BID: 2 copies) Price bid should contain only the prices, without any condition whatsoever

Bids complete in all respects should reach the office of Manager (C&P), GAIL (India) Limited, AVA Road, Rajahmundry-533 103, on or before the due date & time. Bids received after the due date and time is liable to be rejected. Bids received through Fax/E-mail will not be acceptable. Bidder(s) are advised to quote strictly as per terms and conditions of the tender documents and not to stipulate any deviations/exceptions. Once quoted, the Bidder shall not make any subsequent price change, even if any deviation or exception may be specifically stated in the bid. Such price changes shall render the offer liable for rejection

3.0 BID EVALUATION CRITERIA

11..00 TTEECCHHNNIICCAALL CCRRIITTEERRIIAA

[[11..11]] TThhee bbiiddddeerr sshhoouulldd hhaavvee llaatteesstt vvaalliidd IISSOO 99000000 CCeerrttiiffiiccaattiioonn oorr eeqquuiivvaalleenntt

eessttaabblliisshheedd QQuuaalliittyy MMaannaaggeemmeenntt SSyysstteemm cceerrttiiffiiccaattiioonn iinn PPMMCC sseerrvviicceess ooff

PPiippeelliinnee jjoobbss..

[[11..22]] TThhee bbiiddddeerr sshhoouulldd hhaavvee eexxppeerriieennccee aass PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt iinn

DDeessiiggnn,, EEnnggiinneeeerriinngg,, PPllaannnniinngg,, PPrrooccuurreemmeenntt,, IInnssppeeccttiioonn,, QQuuaalliittyy CCoonnttrrooll

AAssssuurraannccee,, CCoonnssttrruuccttiioonn aanndd CCoommmmiissssiioonniinngg ooff ““hhiigghh pprreessssuurree HHyyddrrooccaarrbboonn

CCaarrbboonn SStteeeell PPiippeelliinnee”” aass ddeettaaiilleedd uunnddeerr SSll.. NNoo.. ##33..00,, BBiidd EEvvaalluuaattiioonn

MMeetthhooddoollooggyy ,,SSuubb ssll.. NNoo.. :: [[AA]],, tthhaatt hhaass bbeeeenn ssuucccceessssffuullllyy ccoommmmiissssiioonneedd

dduurriinngg tthhee llaasstt 55 yyeeaarrss rreecckkoonneedd ffrroomm tthhee bbiidd dduuee ddaattee..

[[11..33]] TThhee eexxppeerriieennccee ooff tthhee bbiiddddeerr ffoorr PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaannccyy sseerrvviicceess aass

ppeerr aabboovvee rreeqquuiirreemmeenntt mmuusstt bbee ooff tthheeiirr oowwnn aanndd nnoott wwiitthh tthhee ssuuppppoorrtt ooff

aannootthheerr ppaarrttyy//ppaarreenntt ccoommppaannyy//ssuubbssiiddiiaarryy //ppaarrttnneerr ffiirrmm// ggrroouupp ffiirrmm// bbaacckk--uupp

ccoonnssuullttaanntt eettcc..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 8 of 154

[[11..44]] BBiiddddeerr sshhaallll ffuurrnniisshh nneecceessssaarryy ddooccuummeennttaarryy eevviiddeenncceess ii..ee.. aatttteesstteedd ccooppyy ooff

IISSOO CCeerrttiiffiiccaattee,, ccooppyy ooff wwoorrkk oorrddeerrss,, ccooppyy ooff ccoommpplleettiioonn cceerrttiiffiiccaatteess aanndd aallll

ootthheerr nneecceessssaarryy ddooccuummeennttss ttoo aasscceerrttaaiinn tthhee ssttiippuullaatteedd qquuaalliiffiiccaattiioonn ccrriitteerriiaa.. IInn

tthhee aabbsseennccee ooff ssuucchh rreeqquuiissiittee ddooccuummeennttss,, GGAAIILL rreesseerrvveess tthhee rriigghhtt ttoo rreejjeecctt tthhee

bbiidd wwiitthhoouutt mmaakkiinngg aannyy rreeffeerreennccee ttoo tthhee bbiiddddeerr..

[[11..55]] AAllll tthhee ddooccuummeennttss mmuusstt bbee aatttteesstteedd bbyy GGaazzeetttteedd ooffffiicceerr oorr NNoottaarryy ppuubblliicc..

22..00 FFIINNAANNCCIIAALL CCRRIITTEERRIIAA

NNiill

33..00 BBIIDD EEVVAALLUUAATTIIOONN MMEETTHHOODDOOLLOOGGYY

TThhee bbiiddss ooff bbiiddddeerrss ttoo mmeeeett tthhee aabboovvee BBEECC TTeecchhnniiccaall CCrriitteerriiaa uunnddeerr ##11..00,, sshhaallll bbee

eevvaalluuaatteedd aass ppeerr tthhee ffoolllloowwiinngg eevvaalluuaattiioonn mmeetthhooddoollooggyy,, uunnddeerr tthhrreeee ssuubb ccllaauusseess wwiitthh

ffoolllloowwiinngg aass mmaaxxiimmuumm ssccoorreess::

[[AA]] CCoonnssuullttaanntt’’ss SSppeecciiffiicc EExxppeerriieennccee aanndd JJoobb VVoolluummee 5500 mmaarrkkss

[[BB]] KKeeyy PPeerrssoonnnneell DDaattaa 4400 mmaarrkkss

[[CC]] KKnnoowwlleeddggee BBaassee ooff PPMMCC 1100 mmaarrkkss

[[AA]] CCOONNSSUULLTTAANNTT’’SS SSPPEECCIIFFIICC EEXXPPEERRIIEENNCCEE AANNDD JJOOBB VVOOLLUUMMEE

SSll..

NNoo..

BBiiddddeerr EEvvaalluuaattiioonn PPaarraammeetteerr MMiinniimmuumm

SSccoorree

rreeqquuiirreedd

MMaaxxiimmuumm

SSccoorree

aassssiiggnneedd

AA.. CCoonnssuullttaanntt’’ss ssppeecciiffiicc eexxppeerriieennccee aanndd jjoobb vvoolluummee ::

PPaasstt EExxppeerriieennccee ooff OOnn--sshhoorree PPiippeelliinnee jjoobbss iinn hhyyddrrooccaarrbboonn

sseeccttoorr ddoonnee iinn llaasstt 55 yyeeaarrss ffrroomm tthhee bbiidd dduuee ddaattee..

TThhee nnuummbbeerr ooff oorrddeerrss eexxeeccuutteedd bbyy tthhee bbiiddddeerr wwhhiicchh aarree

ssaammee oorr aabboovvee tthhee BBEECC rreeqquuiirreemmeenntt wwiitthh rreessppeecctt ttoo ssiizzee &&

lleennggtthh dduurriinngg tthhee llaasstt 55 yyeeaarrss rreecckkoonneedd ffrroomm tthhee bbiidd dduuee

ddaattee aass ddeettaaiilleedd bbeellooww::

3300 5500

SSuubb ssll..

NNoo.. AA

CCrriitteerriiaa ffoorr

[[AA]] CCoonnssuullttaanntt’’ss ssppeecciiffiicc eexxppeerriieennccee aanndd jjoobb vvoolluummee

EEvvaalluuaattiioonn pprroocceedduurree MMaaxxiimmuumm

mmaarrkkss

AA..11 SSiinnggllee WWoorrkkoorrddeerr ooff PPiippeelliinnee lleennggtthh eeqquuaall ttoo 22..55 KKmm

oorr mmoorree iinn ssiinnggllee ssttrreettcchh aanndd ssiizzee mmoorree tthhaann 1100 iinncchh oorr

mmoorree ooff 660000## ccllaassss ooff hhiigghh pprreessssuurree HHyyddrrooccaarrbboonn CCSS

PPiippeelliinneess wwiitthh aatt lleeaasstt oonnee ddiissppaattcchh// rreecceeiipptt ssttaattiioonn iinn

aannyy ooff tthhee pprreecceeddiinngg 0055 yyeeaarrss ffrroomm tthhee bbiidd dduuee ddaattee..

FFuullll 2200 mmaarrkkss iiff ssiinnggllee WWOO

ooff PP//LL,,

LLeennggtthh:: ggrreeaatteerr tthhaann 22..55 kkmm

DDiiaa:: ggrreeaatteerr tthhaann 1100 iinncchh

CCllaassss:: 660000 ##

2200

AA..22 [[ii]] OOtthheerr tthhaann tthhee aabboovvee ssuubbmmiitttteedd wwoorrkkoorrddeerr ttoo mmeeeett

ccrriitteerriiaa uunnddeerr AA..11,, aannyy ootthheerr

SSiinnggllee WWoorrkkoorrddeerr hhaavviinngg ppiippeelliinnee ssiinnggllee lleennggtthh ooff 5500

kkmm oorr mmoorree aanndd ddiiaa ggrreeaatteerr tthhaann 1100 iinncchh ooff 660000## ccllaassss

hhiigghh pprreessssuurree hhyyddrrooccaarrbboonn CCSS ppiippeelliinneess..

1155 ppooiinnttss ffoorr eeaacchh WWOO..

LLeennggtthh :: 5500 kkmm oorr mmoorree

DDiiaa:: ggrreeaatteerr tthhaann 1100 iinncchh

CCllaassss:: 660000##

PPeerriioodd:: DDuurriinngg llaasstt ffiivvee

yyeeaarrss rreecckkoonneedd ffoorrmm tthhee

bbiidd dduuee ddaattee

3300

““AANNDD ““ // ““OORR””

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 9 of 154

AA..22 [[iiii]] OOtthheerr tthhaann tthhee wwoorrkkoorrddeerr ssuubbmmiitttteedd ttoo mmeeeett tthhee

ccrriitteerriiaa uunnddeerr AA..11 && AA..22[[ii]],, aannyy ootthheerr

SSiinnggllee IInnddeeppeennddeenntt WWoorrkk OOrrddeerrss ooff ppiippeelliinnee lleennggtthh

lleessss tthhaann 5500 kkmm aanndd ddiiaa ggrreeaatteerr tthhaann 1100 iinncchh hhaavviinngg

mmiinniimmuumm ssiinnggllee ssttrreettcchh ooff 22..55 kkmm ppiippeelliinnee lleennggtthh

aawwaarrddeedd aanndd ccoommpplleetteedd.. HHiigghh PPrreessssuurree hhyyddrrooccaarrbboonn

CCSS ppiippeelliinneess

66 ppooiinnttss ffoorr eeaacchh WWOO..

LLeennggtthh :: mmoorree tthhaann 22..55 kkmm

aanndd lleessss tthhaann 5500 kkmm

DDiiaa:: ggrreeaatteerr tthhaann 1100 iinncchh

CCllaassss:: 660000##

PPeerriioodd:: DDuurriinngg llaasstt ffiivvee

yyeeaarrss rreecckkoonneedd ffoorrmm tthhee

bbiidd dduuee ddaattee..

3300

NNoottee

ffoorr [[AA]]

aa)) BBiiddddeerrss mmeeeettiinngg tthhee mmaaxxiimmuumm mmaarrkkss ooff 3300 uunnddeerr AA..22[[ii]] nneeeedd nnoott rreeqquuiirreedd ttoo ssuubbmmiitt

rreeqquuiissiittee ddooccuummeennttss ttoo ccoommppllyy AA..22[[iiii]]..

bb)) AA ccoommbbiinnaattiioonn ooff bbootthh AA..22[[ii]] aanndd AA..22[[iiii]] iiss aallssoo aacccceeppttaabbllee..

cc)) HHoowweevveerr BBiiddddeerrss mmuusstt cclleeaarrllyy ssuubbmmiitt aa ccoovveerriinngg lleetttteerr ssttaattiinngg tthhee WWoorrkkoorrddeerr ttoo bbee

ccoonnssiiddeerreedd uunnddeerr AA..11 aanndd AA..22..

dd)) IInn nnoo ccaassee aa ssiinnggllee wwoorrkkoorrddeerr ccaannnnoott bbee rree--ssuubbmmiitttteedd // pprroodduucceedd ffoorr ttwwoo ccaatteeggoorriieess.. ii..ee..

ffoorr bbootthh AA..11 aanndd AA..22..

[[BB]] KKEEYY PPEERRSSOONNNNEELL DDAATTAA

SSll..

NNoo..

BBiiddddeerr EEvvaalluuaattiioonn PPaarraammeetteerr MMiinniimmuumm

SSccoorree

rreeqquuiirreedd

MMaaxxiimmuumm

SSccoorree

aassssiiggnneedd

BB.. KKeeyy ppeerrssoonnnneell ddaattaa

KKeeyy ppeerrssoonnnneell oonn ppeerrmmaanneenntt rroollee ooff tthhee ccoommppaannyy wwiitthh

mmiinniimmuumm eexxppeerriieennccee && eedduuccaattiioonnaall qquuaalliiffiiccaattiioonnss rreeqquuiirreedd

aass ppeerr bbiidd ddooccuummeenntt.. DDeettaaiillss bbeellooww::

3322 4400

BB..11 aa)) PPrroojjeecctt MMaannaaggeerr,, EEnnggiinneeeerriinngg MMaannaaggeerr,, CCoonnssttrruuccttiioonn

MMaannaaggeerr

MMaaxxiimmuumm 1100 ppooiinnttss wwiillll bbee aallllootttteedd ffoorr eeaacchh ssaaiidd aabboovvee

kkeeyy ppeerrssoonnnneell aass ppeerr mmeetthhooddoollooggyy mmeennttiioonneedd bbeellooww::

-- 88 ppooiinnttss,, iiff tthhee eexxppeerriieennccee && qquuaalliiffiiccaattiioonn iiss aass ppeerr tthhee

rreeqquuiirreemmeenntt ooff tthhee bbiidd ddooccuummeenntt..

-- 1100 ppooiinnttss,, iiff tthhee eexxppeerriieennccee iiss mmoorree tthhaann 55 yyeeaarrss oorr mmoorree,,

tthhaann tthhee mmiinniimmuumm mmaannddaattoorryy eexxppeerriieennccee rreeqquuiirreedd aass

ppeerr bbiidd rreeqquuiirreemmeenntt

2244 3300

BB..22 bb)) CCoonnttrraaccttss //PPllaannnniinngg MMaannaaggeerr aanndd IInnssppeeccttiioonn MMaannaaggeerr..

MMaaxxiimmuumm 55 ppooiinnttss wwiillll bbee aallllootttteedd ffoorr eeaacchh ooff tthhee aabboovvee

ttwwoo kkeeyy ppeerrssoonnnneell aass ppeerr mmeetthhooddoollooggyy mmeennttiioonneedd bbeellooww::

-- 44 ppooiinnttss,, iiff tthhee eexxppeerriieennccee && qquuaalliiffiiccaattiioonn iiss aass ppeerr tthhee

rreeqquuiirreemmeenntt ooff tthhee bbiidd ddooccuummeenntt..

-- 55 ppooiinnttss,, iiff tthhee eexxppeerriieennccee iiss mmoorree tthhaann 55 yyeeaarrss oorr mmoorree,,

tthhaann tthhee mmiinniimmuumm mmaannddaattoorryy eexxppeerriieennccee rreeqquuiirreedd aass

ppeerr bbiidd rreeqquuiirreemmeenntt

88 1100

[[CC]] KKNNOOWWLLEEDDGGEE BBAASSEE OOFF PPMMCC SSll..

NNoo..

BBiiddddeerr EEvvaalluuaattiioonn PPaarraammeetteerr MMiinniimmuumm

SSccoorree

rreeqquuiirreedd

MMaaxxiimmuumm

SSccoorree

aassssiiggnneedd

CC.. KKnnoowwlleeddggee bbaassee ooff tthhee PPMMCC oorrggaanniizzaattiioonn

TToottaall ssttrreennggtthh ooff BBiiddddeerrss oorrggaanniizzaattiioonn iinn tteerrmmss ooff

tteecchhnniiccaallllyy qquuaalliiffiieedd ppeerrssoonnnneell oonn tthhee ppeerrmmaanneenntt rroollee ooff

66 1100

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 10 of 154

tthhee ccoommppaannyy.. DDeettaaiillss bbeellooww::

CC..11 EEnnggiinneeeerriinngg DDeepptttt..

AAppaarrtt ffrroomm tthhee mmaannppoowweerr ddeettaaiillss pprroodduucceedd uunnddeerr CCllaauussee

[[BB]] ::

MMaaxxiimmuumm 55 ppooiinnttss wwiillll bbee aallllootttteedd aass ppeerr mmeetthhooddoollooggyy

mmeennttiioonneedd bbeellooww::

�� MMiinniimmuumm 55 ppeerrssoonnss ooff DDiipplloommaa // DDeeggrreeee

qquuaalliiffiiccaattiioonn -- 33 ppooiinnttss

�� MMoorree tthhaann 55 ppeerrssoonnss ooff DDiipplloommaa // DDeeggrreeee

qquuaalliiffiiccaattiioonn -- 55 ppooiinnttss

33 55

CC..22 CCoonnssttrruuccttiioonn SSuuppeerrvviissiioonn

AAppaarrtt ffrroomm tthhee mmaannppoowweerr ddeettaaiillss pprroodduucceedd uunnddeerr CCllaauussee

[[BB]] ::

MMaaxxiimmuumm 55 ppooiinnttss wwiillll bbee aallllootttteedd aass ppeerr mmeetthhooddoollooggyy

mmeennttiioonneedd bbeellooww::

�� MMiinniimmuumm 55 ppeerrssoonnss ooff DDiipplloommaa // DDeeggrreeee

qquuaalliiffiiccaattiioonn -- 33 ppooiinnttss

�� MMoorree tthhaann 55 ppeerrssoonnss ooff DDiipplloommaa // DDeeggrreeee

qquuaalliiffiiccaattiioonn -- 55 ppooiinnttss

33 55

TToottaall 110000

OOvveerraallll MMiinniimmuumm ssccoorree rreeqquuiirreedd ffoorr tteecchhnniiccaall qquuaalliiffiiccaattiioonn 7755

�� KKeeyy ppeerrssoonnnneell sshhoouulldd bbee rreegguullaarr eemmppllooyyeeee ooff tthhee ccoonnssuullttaanntt oonn tthheeiirr ppaayyrroollll oorr ffuullll

ttiimmee eemmppllooyyeeee..

�� TThhee ccuurrrriiccuulluumm vviittaaee ooff tthhee ccoonncceerrnneedd ppeerrssoonnnneell mmuusstt bbee ssuubbmmiitttteedd ffoorr CCllaauussee [[BB]]::

KKeeyy PPeerrssoonnnneell aanndd ccllaauussee [[CC]]:: KKnnoowwlleeddggee bbaassee ooff PPMMCC.. TThhee bbiioo--ddaattaa sshhoouulldd bbee

ccoommpplleettee hhaavviinngg aaccccuurraattee ddaattaa aanndd ssiiggnneedd bbyy aann aauutthhoorriizzeedd ooffffiicciiaall ooff tthhee ccoonnssuullttiinngg

ffiirrmm aanndd tthhee iinnddiivviidduuaall pprrooppoosseedd..

�� TThhee ccuurrrriiccuulluumm vviittaaee mmuusstt cclleeaarrllyy ssppeecciiffyy tthhee mmaannppoowweerr ddeettaaiillss,, pphhoottooggrraapphhss,,

eexxppeerriieennccee,, eettcc.. AAllll ddooccuummeennttss mmuusstt bbee aatttteesstteedd bbyy GGaazzeetttteedd ooffffiicceerr oorr nnoottaarryy ppuubblliicc..

�� BBiiddss ffrroomm aallll bbiiddddeerrss sshhaallll bbee eevvaalluuaatteedd aanndd ppooiinnttss sshhaallll bbee aallllooccaatteedd bbaasseedd oonn tthhee

ddooccuummeennttss ssuubbmmiitttteedd bbyy tthhee bbiiddddeerrss..

�� IInnddiivviidduuaall ppooiinnttss aawwaarrddeedd aafftteerr eevvaalluuaattiioonn ooff eeaacchh ccrriitteerriiaa sshhaallll bbee aaddddeedd uupp ffoorr

oobbttaaiinniinngg tthhee ttoottaall ssccoorree// mmaarrkk ooff eeaacchh bbiiddddeerr..

TTeecchhnnoo--CCoommmmeerrcciiaall aacccceeppttaannaaccee::

11.. MMiinniimmuumm ssccoorree uunnddeerr eeaacchh ccaatteeggoorryy mmuusstt bbee ssaattiissffiieedd ffoorr tteecchhnniiccaall

qquuaalliiffiiccaattiioonn.. BBiiddddeerrss ffaaiilliinngg ttoo ssccoorree ““mmiinniimmuumm qquuaalliiffyyiinngg mmaarrkkss”” uunnddeerr

eeaacchh ccaatteeggoorryy aass ddeettaaiilleedd bbeellooww sshhaallll bbee ““rreejjeecctteedd””

[[AA]] CCoonnssuullttaanntt’’ss SSppeecciiffiicc EExxppeerriieennccee aanndd JJoobb VVoolluummee 3300 mmaarrkkss

[[BB]] KKeeyy PPeerrssoonnnneell DDaattaa 3322 mmaarrkkss

[[CC]] KKnnoowwlleeddggee BBaassee ooff PPMMCC 66 mmaarrkkss

22.. TThhee oovveerraallll ccuummuullaattiivvee mmiinniimmuumm qquuaalliiffyyiinngg mmaarrkk ffoorr aallll tthhrreeee [[AA]] ,,[[BB]] && [[CC]]

CCrriitteerriiaa ffoorr tthhee bbiiddddeerrss aass ppeerr aabboovvee eevvaalluuaattiioonn mmeetthhooddoollooggyy iiss 7755%%.. BBiiddddeerrss

ffaaiilliinngg ttoo ssccoorree oovveerraallll 7755 %% ccuummuullaattiivvee sshhaallll bbee rreejjeecctteedd..

�� PPrriiccee BBiiddss ooff TTeecchhnnoo--ccoommmmeerrcciiaallllyy aacccceepptteedd bbiiddss oonnllyy sshhaallll bbee ooppeenneedd..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 11 of 154

�� AAfftteerr ooppeenniinngg ooff ffiinnaanncciiaall pprrooppoossaallss ((ii..ee.. PPrriiccee bbiiddss)) ooff aallll qquuaalliiffiieedd bbiiddddeerrss,, tthhee iinntteerr--

ssee rraannkkiinngg ooff bbiiddddeerrss sshhaallll bbee eessttaabblliisshheedd bbaasseedd oonn tthhee pprriicceess qquuootteedd && tteennddeerr

ssttiippuullaattiioonnss aanndd tthhee LL--11 bbiiddddeerr ooffffeerriinngg lloowweesstt pprriiccee sshhaallll tthheenn bbee sseelleecctteedd// aawwaarrddeedd

tthhee jjoobb..

CCOONNSSUULLTTAANNTT’’SS MMAANNPPOOWWEERR RREEQQUUIIRREEMMEENNTT TTOO MMEEEETT BBEECC

SSSSSSSSllllllll........ TTTTTTTTyyyyyyyyppppppppeeeeeeee QQQQQQQQuuuuuuuuaaaaaaaallllllll iiiiiiiiffffffffiiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn &&&&&&&& kkkkkkkknnnnnnnnoooooooowwwwwwwwlllllllleeeeeeeeddddddddggggggggeeeeeeee EEEEEEEExxxxxxxxppppppppeeeeeeeerrrrrrrriiiiiiiieeeeeeeennnnnnnncccccccceeeeeeee

[[11]] PPPPPPPPrrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt

MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn

aannyy DDiisscciipplliinnee

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss eexxppeerriieennccee iinn

eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122 yyeeaarrss

eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn

eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss..

[[22]] EEEEEEEEnnnnnnnnggggggggiiiiiiiinnnnnnnneeeeeeeeeeeeeeeerrrrrrrriiiiiiiinnnnnnnngggggggg

MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee // DDiipplloommaa iinn aannyy

ddiisscciipplliinnee ooff EEnnggiinneeeerriinngg..

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss eexxppeerriieennccee iinn

eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122 yyeeaarrss

eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn

ddeessiiggnn && eennggiinneeeerriinngg ooff HHyyddrrooccaarrbboonn ppiippeelliinnee

pprroojjeeccttss..

[[33]] CCCCCCCCoooooooonnnnnnnnssssssssttttttttrrrrrrrruuuuuuuuccccccccttttttttiiiiiiiioooooooonnnnnnnn

MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn

aannyy DDiisscciipplliinnee // DDiipplloommaa iinn

PPrroojjeecctt MMaannaaggeemmeenntt

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss eexxppeerriieennccee iinn

eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122 yyeeaarrss

eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn

ccoonnssttrruuccttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss..

[[44]] CCCCCCCCoooooooonnnnnnnnttttttttrrrrrrrraaaaaaaaccccccccttttttttssssssss

MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee // DDiipplloommaa // MMBBAA iinn

CCoonnttrraaccttss MMaannaaggeemmeenntt //

DDeeggrreeee iinn EEnnggiinneeeerriinngg aannyy

ddiisscciipplliinnee

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss eexxppeerriieennccee iinn

eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100 yyeeaarrss

eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn

iinn eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss..

[[55]] PPPPPPPPllllllllaaaaaaaannnnnnnnnnnnnnnniiiiiiiinnnnnnnngggggggg

MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee // DDiipplloommaa iinn

EEnnggiinneeeerriinngg // PPrroojjeecctt

MMaannaaggeemmeenntt..

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 88 yyeeaarrss eexxppeerriieennccee iinn

eexxeeccuuttiinngg pprroojjeeccttss iinn HHyyddrrooccaarrbboonn IInndduussttrryy..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 88 yyeeaarrss

eexxppeerriieennccee,, aatt lleeaasstt 44 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn

eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ggaass ppiippeelliinnee pprroojjeeccttss..

[[66]] IIIIIIIInnnnnnnnssssssssppppppppeeeeeeeeccccccccttttttttiiiiiiiioooooooonnnnnnnn

MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr DDeeggrreeee // DDiipplloommaa iinn

EEnnggiinneeeerriinngg iinn aannyy

DDiisscciipplliinnee aalloonngg wwiitthh AANNSSTT //

IINNSSTT LLeevveell IIII // IIIIII

cceerrttiiffiiccaattiioonn..

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss eexxppeerriieennccee iinn

eexxeeccuuttiioonn ooff pprroojjeeccttss // iinnssppeeccttiioonn iinn HHyyddrrooccaarrbboonn

IInndduussttrryy..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100 yyeeaarrss

eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss'' eexxppeerriieennccee mmuusstt bbee iinn

iinnssppeeccttiioonn wwoorrkkss rreellaatteedd ttoo ppiippeelliinnee mmaatteerriiaallss //

ppiippeelliinnee ccoonnssttrruuccttiioonn..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 12 of 154

DOCUMENTATION

3.1 Bidder shall furnish necessary documentary evidences i.e. attested copy of ISO Certificate, copy of work orders, copy of completion certificates, and other necessary documents to ascertain the stipulated qualification criteria. In the absence of such requisite documents, GAIL reserves the right to reject the bid without making any reference to the bidder.

4.0 CONTRACT PERIOD:

Contractual scheduled time for the PMC contract shall be 08 months from the date of FOI which is inclusive of 2 months for Project close out period. The PMC would prepare detail schedule in consultation with GAIL at the beginning / during kick-off. All efforts should be made to meet all the intermediate schedule and milestones. PMC is required to plan and put manpower and resources accordingly. PMC is required to work simultaneously in various packages and works and make all out efforts to complete the project on or before scheduled date. HHoowweevveerr,, aass ppeerr

eexxttaanntt pprraaccttiicceess tthhee pprroojjeecctt sshhaallll bbee mmoonniittoorreedd ww..rr..tt iinntteerrnnaall sscchheedduullee aass wweellll tthhee

sscchheedduulleedd ddeeaaddlliinnee..

5.0 GENERAL:

5.1 Bid document is non-transferable. 5.2 GAIL will not be responsible for cost incurred in preparation and delivery of bids. 5.3 Purchase preference to Central Public Sector Undertakings as admissible under the

prevailing Government of India policy shall be applicable. 5.4 This is a ZERO Deviation Bidding Document. Bidder is to ensure compliance of all

provisions of the Bidding Document and submit their bid accordingly. Bids with any deviation to the bid conditions shall be liable for rejection.

5.5 The Complete Bid document is also available on web sites of GAIL (India) Limited

(http://www.gailtenders.in). Further, the bidder has to meet the BEC criteria as specified in the bid document.

5.6 GAIL reserves the right to reject any or all the bids received at its discretion without

assigning any reason whatsoever. 5.7 This Invitation for Bids (IFB) is an integral and inseparable part of the enclosed Bid

Document. * Please specify Bid Document No. GAIL/RJY/C&P/SR20036987/RAO in all future correspondence.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 13 of 154

THIS IS NOT AN ORDER Yours faithfully, For GAIL (India) Limited T N M RAO Manager (C&P) GAIL (India) Limited RAJAHMUNDRY E-mail: [email protected]

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 14 of 154

GAIL (India) Limited (A Govt. of India Undertaking)

NOTICE INVITING TENDER

(DOMESTIC COMPETITIVE BIDDING)

GAIL (India) Limited invites bids from eligible bidders for Hiring of Project Management Consultancy (PMC) services as detailed below Sl. No.

Tender No. IFB and Bid Document available on website from

Date of Pre Bid Meeting Last date & time for submission of Bid

1 GAIL/RJY/C&P/SR20036987/RAO

09.03.2012 20.03.2012 at 1100 Hours (IST) at GAIL, Rajahmundry

10.04.2012 at 1400 Hours (IST)

For further details, please visit our Tender website (http://www.gailtenders.in). For any queries, bidders may contact Manager (C&P), GAIL (India) Limited, A V A Road Rajkahmundry-533103, Phone : 0883-2400720/21/22 Extn 380/382; e-mail: [email protected]

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 15 of 154

CUT-OUT SLIP

(OUTER ENVELOPE)

DO NOT OPEN-THIS IS A QUOTATION NAME OF WORK : HIRIRNG OF PMC SERVICES FOR

DESIGN & CONSTRUCTION OF KESANAPALLI (W) TO PONNAMANDA PIPELINE

TENDER DOCUMENT NO.: GAIL/RJY/C&P/SR20036987/RAO DUE DATE & TIME : 10.04.2012 UPTO 1400 HRS. FROM TO Name : Manager (C&P), Address: GAIL (India) Limited AVA Road Rajahmundry-533 103 Andhra Pradesh (To be pasted on the outer envelope containing “Priced”, “Un-priced” bids AND “Bid security”)

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 16 of 154

CUT-OUT SLIP

PART-A (UNPRICED BID)

DO NOT OPEN-THIS IS A QUOTATION NAME OF WORK : HIRIRNG OF PMC SERVICES FOR DESIGN &

CONSTRUCTION OF KESANAPALLI (W) TO PONNAMANDA PIPELINE

TENDER DOCUMENT NO.: GAIL/RJY/C&P/SR20036987/RAO DUE DATE & TIME : 10.04.2012 UPTO 1400 HRS.. FROM TO Name: Manager (C&P), Address: GAIL (India) Limited AVA Road, Rajahmundry-533 103 Andhra Pradesh

(To be pasted on the envelope containing “Un-priced” bids)

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 17 of 154

CUT-OUT SLIP

PART- B (PRICED BID)

DO NOT OPEN-THIS IS A QUOTATION NAME OF WORK: HIRIRNG OF PMC SERVICES FOR DESIGN &

CONSTRUCTION OF KESANAPALLI (W) TO PONNAMANDA PIPELINE

TENDER DOCUMENT NO.: GAIL/RJY/C&P/SR20036987/RAO DUE DATE & TIME : 10.04.2012 UPTO 1400 HRS. FROM TO Name : Manager (C&P), Address: GAIL (India) Limited AVA Road, Rajahmundry-533 103

(To be pasted on the envelope containing “Priced Bid”)

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 18 of 154

SECTION II

INSTRUCTIONS TO BIDDERS (ITB)

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 19 of 154

SECTION II: INSTRUCTION TO BIDDERS

INDEX ARTICLE TITLE

A General 1. Scope of Bid 2. Eligible Bidders 3. One Bid per Bidder 4. Deleted 5. Cost of Bidding 6. Site visit

B Bidding Document 7. Contents of Bidding Document 8. Clarification on Bid Document 9. Amendment of Bid Document

C Preparation of Bid 10. Language of Bid 11. Documents comprising the Bid 12. Bid prices 13. Bid currency 14. Period of validity of Bid 15. Bid Security 16. Pre Bid Meeting 17. Format and signing of Bid 18. Zero Deviation 19. E-Payments 20. Agent /Consultant/ Representative/Retainer/ Associate

D Submission of Bid 21. Sealing and marking of Bids 22. Deadline for submission of Bid 23. Late Bid 24. Modification and withdrawal of Bids

E Bid Opening and Evaluation 25. Bid Opening 26. Process to be confidential 27. Contacting the Owner 28. Examination of Bids and determination of responsiveness 29. Correction of errors 30. Priced Bid Opening 31. Conversion to single currency 32. Evaluation and comparison of Bids 33. Purchase Preference

F Award of Contract 34. Award of work 35. Owner’s right to accept any Bid and to reject any Bid 36. Notification of Award 37. Signing of Agreement 38. Contract Performance Bank Guarantee 39. Corruption and fraudulent practice

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 20 of 154

A: GENERAL

1.0 SCOPE OF BID:

1.1 The Employer / Purchaser / Owner / GAIL as defined in the General Conditions of Contract, hereinafter “the Employer / Purchaser / Owner / GAIL” wishes to receive bids as described in the Bidding Documents.

1.2 SCOPE OF WORK: The scope of work shall be as defined in the bidding document.

1.3 The successful bidder will be expected to complete the Scope of work within the

period stated in Bid Document.

1.4 Throughout this bidding documents, the term “bid” and “tender” and their derivatives (“bidder/tenderer”, “Bid/tendered/tender”, “bidding/tendering”, etc.) are synonymous, and day means calendar day. Singular also means plural.

2.0 ELIGIBLE BIDDERS:

2.1 Documents establishing Bidder’s Qualification:

2.1.1 Bidder shall, as part of their bid, submit a written power of attorney authorizing the signatory of the bid to commit the bidder.

2.1.2 Pursuant to Bid Evaluation criteria specified in Invitation for Bids (IFB) the bidder shall furnish all necessary supporting documentary evidence to establish the bidder’s claim of meeting the BEC.

2.1.3 The bidder shall furnish, as part of his bid, documents establishing the bidder’s eligibility to bid and his qualifications to perform the contract if his bid is accepted.

2.1.4 The documentary evidence of the bidder’s qualifications to perform the contract if his bid is accepted, shall establish to the OWNER’S satisfaction that, the bidder has the financial, technical and productions capacity necessary to perform the contract.

2.2 The invitation of bid is open to any bidder.

2.3 A bidder shall not be affiliated with a firm or entity: (i) that has provided consulting services related to the work to the OWNER

during the preparatory stages of the works or of the project of which the works form a part, or

(j) that has been hired by the Owner as engineer/consultant for the contract.

2.4 The bidder shall not be under a declaration of ineligibility by OWNER for corrupt or fraudulent practices as defined in Instruction to Bidders clause no 39.0.

2.5 The bidder is not put on holiday by GAIL or any of its PMC’s (EIL, MECON, Wood Group, Tractebel or Hydrocarbon Project Engineers Limited) or blacklisted by any Government Department / Public Sector on the due date of submission of bid. If the

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 21 of 154

documents were issued inadvertently / downloaded from website, offers submitted by such bidders shall not be considered for opening / evaluation / award.

2.6 While evaluating the bids, pursuant to Bid Evaluation Criteria (BEC) as specified in the Invitation for Bids (IFB), bidder’s past performance shall also be assessed for ascertaining the responsiveness of the bid. In such a case, the decision of the Owner shall be final and binding on the bidder.

2.7 Job executed by a bidder for its own plant / projects cannot be considered as experience for the purpose of meeting requirement of BEC of the tender. However, jobs executed for subsidiary / fellow subsidiary / holding company will be considered as experience for the purpose of meeting BEC, subject to submission of tax paid invoices(s) duly certified by Statutory Auditor of the bidder towards payments of statutory tax in support of the job executed for subsidiary / fellow subsidiary / holding company. Such bidders to submit these documents in addition to the documents specified in the bidding documents to meet Bid Evaluation Criteria.

3.0 ONE BID PER BIDDER

3.1 A Bidder shall submit only one bid in the same bidding process. A Bidder who submits or participates in more than one bid will cause all the proposals in which the bidder has participated to be disqualified.

3.2 Alternative bids are not acceptable.

3.3 BIDS FROM CONSORTIUM: Not acceptable

4.0 COST OF BIDDING 4.1 The bidder shall bear all costs associated with the preparation and submission of the

bid, and OWNER, will in no case be responsible or liable for this cost, regardless of the conduct or outcome of the bidding process.

5.0 SITE VISIT: 5.1 The bidder is advised to visit and examine the Site of Works and its surroundings and

obtain for itself on its own responsibility all information that may be necessary for preparing the bid. The costs of visiting the Site shall be at the bidder’s own expense.

5.2 The bidder and any of its personnel or agents will be granted permission by the Owner to enter upon its premises and lands for the purpose of such visit, but only upon the express condition that the bidder, its personnel, and agents will release and indemnify the Owner and its personnel and agents from and against all liability in respect thereof, and will be responsible for death or personal injury, loss of or damage to property, and any other loss, damage, costs, and expenses incurred as a result of the inspection.

B: BIDDING DOCUMENT

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 22 of 154

6.0 CONTENT OF BIDDING DOCUMENT 6.1 The complete Bid Documents are hosted on GAIL’s website

http://www.gailtenders.in and should be read in conjunction with any addenda / amendments issued / hosted in accordance with Clause No. 8 of ITB.

Volume I of I : Techno- Commercial

Section-I : Invitation for bid (IFB) Section-II : Instruction to Bidders (ITB) Section-III : General Conditions of Contract (GCC) Section-IV : Forms & Formats Section-V : Part-A Scope of consultancy Services

Part-B Payment terms and other important conditions Section-VI : Price Schedules Section-VII : Attachments

Attachment –I : Proforma for Contract Agreement Attachment –II: Performance Evaluation Attachment –III: Agreed terms and conditions Attachment –IV: Integrity Pact

6.2 The bidder is expected to examine IFB, bidding guidelines on GAIL’s website, all

sections of the Bid Document containing instructions, forms / formats, terms, specifications, drawings, etc., enclosed in the bidding document. The complete Bid Document together with all its attachment thereto, shall be considered to be read, understood and accepted by the bidder. Failure to furnish all information required by the Bidding Document or submission of a bid not substantially responsive to the Bidding Document in every respect will be at bidder’s risk and may result in the rejection of the bid.

7.0 CLARIFICATION ON BID DOCUMENT

7.1 A prospective bidder requiring any information or clarification of the Bidding Documents may notify the Employer in writing by e-mail / fax / post at Employer’s mailing address indicated in the Bid Document. All questions / queries should be referred to Employer at least 02 (two) days before scheduled date of pre-bid meeting. The Employer will respond in writing to any request for information / clarification of the bidding documents, which it receives at least 02 (two) days before the pre-bid meeting date. Written copies of Employer’s response (including an explanation of the query but without identifying the source of the query) will be hosted on the websites; http://www.gailtenders.in, before the bid due date and shall be integral part of the Bidding Documents.

8.0 AMENDMENT OF BID DOCUMENT

8.1 At any time prior to the deadline for submission of bids, the Employer may, for any

reason, whether on its own requirement or in response to a clarification requested by prospective bidders, modify the Bidding Documents by issuing addendum / corrigendum.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 23 of 154

8.1 Any addendum / corrigendum / clarifications / replies to queries thus issued shall be part of the Bidding Documents. The addendum / corrigendum / clarifications / replies to queries will be hosted on the GAIL websites http://www.gailtenders.in. Any addendum / corrigendum / clarifications to bid documents shall be available on GAIL websites before bid due date as and when issued and shall form integral part of Bid Document. Bidders have to take into consideration all the addendum(s) / corrigendum (s) / clarifications issued / replies to queries web hosted, before submitting the bid.

8.2 The Employer may, at its discretion, extend the date of submission of bids in order to allow the bidders a reasonable time to submit their most competitive bid taking into account all the amendments issued.

C: PREPARATION OF BID 9.0 LANGUAGE OF BID

9.1 The Bid prepared by the bidder, all correspondence documents relating to the bid

exchanged by the bidder with the Owner shall be in English Language alone provided that any printed literature furnished by the bidder may be written in another language so long as accompanied by an English translation, in which case, for the purpose of interpretation of the bid, the English translation shall govern.

9.2 In the event of submission of any document/ certificate by the Bidder in a language other than English, the English translation of the same duly authenticated by Chamber of Commerce of Bidder’s country shall be submitted by the Bidder. Metric measurement system shall be applied.

10.0 DOCUMENTS COMPRISING THE BID

10.1 The bid prepared by the bidder shall comprise the following:

10.1.1 Envelope - I: Super-scribing Techno-Commercial Un-priced Bid (Part-I)

10.1.1.1 Part-I : Techno-commercial / Un-priced Bid shall contain the following documents all pages of which are digitally signed by the authorised person and to be uploaded in collaboration folder and shall contain the following:

(a) Covering letter. (b) Bidder’s General Details/information as per format F-1. (c) Power of Attorney in favour of person (s) signing the bid that such person (s)

is/are authorised to sign the bid on behalf of the bidder and any consequence resulting due to such signing shall be binding on the bidder.

(d) A Bid Form as per format F-2. (e) Copies of documents as required in F-3. (f) Copy of Price Schedule/ Schedule of Rates (i.e. with prices blanked out)

mentioning “Quoted / Not Quoted.” (g) Document establishing the eligibility and conformity to the Bid Documents of

all Goods and services, which the bidder proposes to supply under the award. (h) Letter of authority in favour of any one of bidder’s executive having authority

to attend the Pre Bid Meeting, un-priced and price bid opening on specified dates and venue as per format F-4

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 24 of 154

(i) Confirmation of no deviation as per Format F-5. (j) Certificate as per Format F-6 for confirming the Government of India is not

party of Agreement. (k) Specific Experience, annual turnover and other details as called for in

qualifying requirements. Copy of work order and completion certificates should be enclosed with the F-7

(l) Current commitments strictly as per Format F-8 (m) Any other information/ details required as per Bidding Documents including

amendment if any. (n) Check list duly filled in as per Format F-10. (o) A confirmation from the Bidder that the bidder and/or its subcontractor have

not been put on Holiday by GAIL or black listed by any government department/ public sector.

(p) Details of Indian Agent applicable for foreign bidder. (q) Undertaking that the contents of the bidding document have not been altered

or modified in case bidder has downloaded the Bid Document from GAIL website.

10.1.2 Envelope - II: Price Bid – Not to be Opened with Techno-Commercial Un-priced Bid

(Part-II)

10.1.3 Part – II: Price Bid

10.1.3.1 Part – II shall contain original Price Schedule / Schedule of Rates (SOR) duly filled in, digitally signed and stamped on each page. In case of any correction, the bidders shall put his signature and his stamp.

10.1.3.2 Bidder shall download the Price Schedule / Schedule of Rates (SOR) which is uploaded on website as an excel attachment. Bidder shall submit Price Schedule / Schedule of Rates (SOR) duly filled in and signed strictly as per format without altering the content of it. The duly filled Price Schedule / Schedule of Rates (SOR) shall be uploaded by bidder on web site as per tendering procedure.

10.1.4 Envelope – III; Power of Attorney: Part-IV in physical form with the scanned copy of

same uploaded in e-bid. 10.1.4.1 Part-III shall contain one original and one copy of Power of Attorney in non-

judicial stamp paper in a separate sealed envelope.

10.1.5 Envelope – IV; Integrity Pact: Part-V in physical form. 10.1.5.1 Part-IV shall contain one original and one copy of Integrity Pact in a separate

sealed envelope.

10.1.6 Envelope – V; Consortium Agreement in case of Consortium bid in physical form with the scanned copy of same uploaded in e-bid.

10.1.6.1 Part-V shall contain one original and one copy of Consortium Agreement in a

separate sealed envelope.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 25 of 154

10.1.7 Documents to be submitted against Bid Evaluation Criteria (BEC): As per Invitation

for Bids.

11.0 BID PRICES

11.1 The bidder shall e-quote Bid Prices on the appropriate format for “Price Schedule” enclosed as part of Bid Document.

11.2 Prices shall be quoted, in the prescribed Price Schedule by the bidder separately for

each item of scope and in strict compliance to the format of the Price Schedule. 11.3 Prices quoted should be inclusive of fees towards complete scope of work, all taxes,

duties, levies, license fees, service tax and also payment towards third party charges towards surveys etc. However, applicable rate of statutory taxes & duties must be indicated separately.

11.4 Inspection/Certification of all work/services at all stages shall be done by GAIL

wherever GAIL so desires or by any third agency for which no extra charges shall be payable to the Bidder since all personal and incidental expenses of GAIL’s Inspectors shall be borne by GAIL.

11.5 Conditional discount, if offered, shall not be considered for evaluation. Bidders separation of the price components as aforesaid will be solely for the purpose of facilitating the comparison of bids by GAIL and will not in any way limit GAIL’s right to contract on any of the price basis/terms offered basis.

11.6 The cost of any other item / services, which are considered necessary for completion

of the job, is deemed to have been included in the lump-sum prices.

11.7 Prices quoted by the bidder shall be firm and fixed during the bidder’s performance of the contract. A bid submitted with an adjustable price quotation will be treated as non- responsive and rejected.

11.8 Statutory variation in service tax, if any, within the contractual completion period shall be borne by GAIL. No variation in taxes, duties or levies other than service tax shall be payable.

11.9 Prices shall be written both in words and figures. In the event of difference, the price in words shall be valid and binding.

11.10 Bidder shall be solely responsible for ascertaining all types of taxes and duties

applicable for providing the services as mentioned in the scope of work. GAIL shall deduct Indian income tax applicable from the payments due to the bidder under the contract. In case of foreign bidder, withholding tax at applicable rate shall be deducted for which Tax Deduction Certificate shall be issued by GAIL.

11.11 Quoted prices shall also be inclusive of all costs towards carrying out any surveys, travel to India, site visits by its personnel, stay in India, boarding, lodging, incidental expenses etc. required for Scope of Work.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 26 of 154

12.0 BID CURRENCY:

12.1 Indian bidders may submit bid in Indian Rupees Only. 13.0 PERIOD OF VALIDITY OF BID

13.1 The bid shall remain valid for acceptance for four (4) months from the bid due date.

Owner shall reject a bid valid for a shorter period being non-responsive. The Bidder shall not be entitled during the said period of 4 months, to revoke or cancel its Bid or to vary the Bid given or any term thereof.

13.2 In exceptional circumstances, prior to expiry of the original bid validity period, the Owner may request that the bidder extend the period of validity for a specified additional period. The requests and the responses thereto shall be made in writing (by fax/post/e-mail). A bidder agreeing to the request will not be required or permitted to modify his bid.

14.0 BID SECURITY: NOT APPLICABLE

15.0 PRE-BID MEETING

15.1 The bidder (s) or his authorized representative, to whom the bid document has been issued or who have downloaded the bid document from website are invited to attend the pre-bid meeting which will take place at GAIL (India) Ltd., GAIL Bhavan, A V A Road, Rajahmundry. Bidder shall carry Authority letter as per Format F-4 while attending above meeting.

15.2 The purpose of meeting will be to clarify issues and to answer queries on any matter that may be raised at that stage.

15.3 The bidder is requested, as far as possible, to submit any queries by courier or by fax to reach Owner’s office not later than two days before the meeting. All communication must be addressed to GAIL (India) Limited, GAIL Bhavan A V A Road, Rajahmundry. It may not be practicable at the meeting to answer queries received late, but queries and responses/clarifications will be transmitted in accordance with the following sub-clause.

15.4 The text of the queries raised and the responses given, together with any responses prepared after the meeting will be transmitted without delay (without identifying the sources of the questions) to all the purchasers of the bidding documents .Any modifications of the bidding documents listed in clause 7 of Instruction to Bidders that may become necessary as a result of the pre-bid meeting shall be made by the Owner exclusively through the issue of an addendum pursuant to clause 9 of Instruction To Bidders and not through the minutes of the pre-bid meeting

15.5 Non- attendance of the pre-bid meeting will not be a cause for disqualification of the bidder.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 27 of 154

16.0 FORMAT AND SIGNING OF BID 16.1 The-bid shall be signed by the person or persons duly authorised to sign on behalf of

the bidder. The name and position held by each person signing must be stated below the signature. All pages of the bid except any catalogues / literatures shall be signed and sealed by the person or persons signing the bid.

16.2 The bid shall contain no alterations, omissions or additions, unless such corrections are initialed by the person or persons signing the bid.

17.0 ZERO DEVIATION:

17.1 Bidder to note that this is a ZERO Deviation Bidding Document. Owner will appreciate submission of offer based on the terms and conditions in the enclosed General Conditions of Contract, Instruction to Bidders, Scope of Work, and Technical Specification etc. to avoid wastage of time and money in seeking clarifications on technical / commercial aspect of the offer. Bidder’s Bid shall be considered non-responsive and liable for rejection, if deviations are taken to the under mentioned provisions of Bid Documents by the Bidder:-

� Firm Price � Scope of Work � Specifications � Price Schedule / Schedule of Rates � Completion Period for total scope of work � Force Majeure. � Payment terms & conditions. � Contract Performance Bank Guarantee (CPBG). � Price Reduction Schedule (PRS) for delay in completion. � Liability Clause. � Period of validity of bid. � Arbitration / Resolution of Dispute � Termination of Contract � Applicable Laws � Any other condition specifically stated in the Bid Document elsewhere that

non- compliance of the clause lead to rejection of the Bid. 18.0 E-PAYMENTS

18.1 GAIL (India) Limited has initiated payments to suppliers and Consultants

electronically and to facilitate the payments electronically, the Indian bidder should have an account with HDFC Bank or ICICI Bank or State Bank of India so that the payment through e-banking be made to the bidder, in case work is awarded to him. The bidder should give their account number and other details in any one of the above banks to facilitate payment through E-banking.

19.0 AGENT/CONSULTANT/REPRESENTATIVE/RETAINER/ASSOCIATE

19.1 GAIL would prefer to deal directly with the manufacturers/ principals abroad without

involving any Indian Agent. But in case they decide to have their Agent/

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 28 of 154

Representative/Retainer/Associate in India and pay commission for their services against a particular tender it should be bare minimum and the principal would have to certify that such a commission is commensurate with the services rendered to them by such an Agent/ GAIL/ Representative/ Retainer/ Associate in India. The principal will also have to broadly list out services to be rendered by the Agent/ Representative/ Retainer/ Associate in India.

19.2 In the event bidder is having Agent/ GAIL/ Representative/ Retainer/ Associate/

servicing facilities in India (who is not an employee of the bidder) the bidder should indicate in their offer the name of such an Agent/ GAIL/ Representative /Retainer /Associate, they have for services in India. The bidder must also indicate clearly the commission payable to the Agent/ Representative/ Retainer/Associate in rupees in terms of Agreement (enclosing copy of the same). The bidder, in his bid will indicate the nature and extent of service to be provided by such an Agent/ Representative/ Retainer/Associate on behalf of the bidder and also remuneration therefore provided in the price, as a separate item, quoted by the bidder to GAIL. Such remuneration/commission will be paid by GAIL in non-convertible Indian currency in India. Should it be established at any subsequent point of time that the above statement of the bidder is not correct or that any other amount of remuneration/commission either in India or abroad is being paid to any one (who is not an employee of the bidder), the bidder would be liable to be debarred from participating in the future tenders of GAIL. Failure to give such information will lead to rejection of the offer.

The following particulars will also be furnished by the bidder:

(i) Name, address and precise relationship between the foreign

manufacturer/principal and their Agent/ Representative/Retainer/Associate in India.

(ii) The mutual interest which the manufacturer/principal and the Agent/ GAIL/

Representative/ Retainer/Associate in India have in the business of each other.

(iii)Any payment which the Agent/ GAIL/ Representative/ Retainer/ Associate receives in India or abroad from the manufacturer/principal whether as a commission for the contract or as a general fee. Bidder’s quoted price shall be treated as inclusive of such commission & fee.

(iv) Permanent Income Tax number of Agent/ GAIL/ Representative/ Retainer/

Associate in India. (v) Permanent income tax account number of foreign supplier.

(vi) All services to be rendered by the Agent/ GAIL/ Representative /

Retainer/Associate. Note: Tenders which do not comply with the above stipulations are liable to be ignored.

19.3 Overseas bidder should send e-bids directly. E-Bids sent through Agent/ GAIL

/Representative / Retainer /Associate will not be recognized. Agent/ GAIL/

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 29 of 154

Representative/Retainer/Associate of the overseas manufacturers/suppliers are, however, permitted to download biding documents and attend bid opening provided such as Agent/ GAIL/ Representative/Retainer/Associate has a power of attorney/letter of authority setting out very clearly his role, which will be limited to such areas of activity as downloading of bid documents, attending of bid opening and claiming of payment for their services, provided further that such a power of attorney/letter of authority is submitted to GAIL in advanced for scrutiny and acceptance or otherwise.

D: SUBMISSION OF BID

20.0 SEALING AND MARKING OF BIDS

As mentioned in above Invitation for Bids (IFB). 21.0 DEADLINE FOR SUBMISSION OF BID

The offers of the bidder should reach us within bid due date & time as mentioned above.

22.0 LATE BIDS

22.1 GAIL Shall not accept any late bids received after bid due date & time.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 30 of 154

23.0 MODIFICATION AND WITHDRAWAL OF BIDS

23.1 The bidder may modify, re-submit or withdraw their bid after the bid submission, but, before the bid due date of submission as per provision of tendering system of GAIL.

23.2 No bid shall be modified after the deadline for submission of bid. No bid shall be

allowed to be withdrawn in the interval between the deadline for submission of bids and the expiration of the period of bid validity specified by the bidder on the bid form.

E: BID OPENING AND EVALUATION

24.0 BID OPENING

24.1 Un-Priced Techno – Commercial bid opening:

24.1.1 The Employer will open, in the presence of bidders’ designated representatives, the

Un-priced part of bid at date and time as stipulated in IFB. The bidder’s representatives who are present shall sign bid-opening statement evidencing their attendance.

24.1.2 Bidder’s names, the presence (or absence) and amount of bid security, and any other such details as the Employer may consider appropriate will be announced by the owner.

25.0 PROCESS TO BE CONFIDENTIAL

25.1 Information relating to the examination, clarifications, evaluation and comparison of bids, and recommendations for the award of a Contract shall not be disclosed to bidders or any other person officially concerned with such process. Any effort by a bidder to influence the Owner in any manner in respect of bid evaluation or award will result in the rejection of that bid.

26.0 CONTACTING THE OWNER

26.1 Subject to clause 27, no Bidder shall contact GAIL on any matter relating to its Bid,

from the time of Bid opening to the time the Contract is awarded.

26.2 Any effort by a bidder to influence the Owner in any manner in respect of bid evaluation or bid comparison or award may result in the rejection of the bidder’s bid.

27.0 EXAMINATION OF BIDS AND DETERMINATION OF RESPONSIVE NESS

27.1 Owner will examine the bids to determine whether they are complete, whether any computational errors have been made, whether the documents have been properly signed and whether the bids are generally in order.

27.2 Once quoted, bidder shall not make any subsequent price changes, whether resulting

or arising out of any technical/commercial clarifications sought regarding the bid within the scope of work, even if any deviation or exclusion may be specifically

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 31 of 154

stated in the bid. Such price change shall render the bid liable for rejection. All responses to request for clarifications shall be in writing.

27.3 Unsolicited clarification to the Bid and/or change in price during its validity period

would render the Bid liable for outright rejection. 27.4 TECHNO-COMMERCIAL EVALUATION OF BIDS 27.4.1 Bids will be evaluated in accordance with the Bid Evaluation Criteria given in the Bid

Document. The price bid of only those bidders, who meet the Evaluation criteria and Techno-commercial requirement and are found to be responsive shall be opened. Conditional bids shall be liable for rejection.

27.4.2 Bids will be evaluated as received and no query will be asked from the bidders. To assist in the examination, evaluation and comparison of bids if it becomes absolutely necessary, Owner may, at its discretion, ask the bidder for a clarification of its bid. The request for such clarification and the response shall be in writing and no change in the price or substance of bids shall be sought, offered or permitted.

27.4.3 Prior to the evaluation and comparison of bids pursuant to Article-32, Owner will determine the substantial responsiveness of each bid to the bidding documents. For purpose of this Article a substantially responsive bid is one which conforms to all the terms and conditions of the bidding document without material deviations or reservations. Owner’s determination of a bid’s responsiveness is to be based on the contents of the bid itself without recourse to the extrinsic evidence.

27.4.4 A bid determined as substantially non-responsive will be rejected by Owner and may not subsequently be allowed by the Owner to be made responsive by the bidder by correction of the non-conformity.

27.4.5 Bids not confirming to technical specification/requirements (refer Scope of Services) as mentioned in the Bid document will be rejected.

27.4.6 Conditional bids will be liable for rejection. 28.0 CORRECTION OF ERRORS

28.1 Bids will be checked by the Owner for any arithmetic errors. Errors will be corrected

by the Owner as follows in the following sequential order: (a) Where there is a discrepancy between the amounts in words and in figures, the

amount in words will govern; and (b) Where there is a discrepancy between the unit rate and the total resulting from

multiplying the unit rate by the quantity, the unit rate as quoted will prevail and total price will be corrected.

(c) If there is a discrepancy between the total amount and the sum of total prices,

the sum of total prices shall prevail and the total bid amount will be corrected.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 32 of 154

28.2 The amount stated in the bid will be adjusted by the Owner in accordance with the above procedure for the correction of errors and, with the concurrence of the bidder, shall be considered as binding upon the bidder. If the bidder does not accept the corrected amount of bid, its bid will be rejected.

29.0 PRICE BID OPENING

29.1 The Owner shall inform the time, date and venue for price bid opening to all such

bidders who qualify pursuant to techno-commercial bid evaluation. Bidders may be required to attend price bid opening at a short notice of 24 hours. Bidder shall carry authority letter as per Format F-4 while attending opening.

29.2 The Owner will open price bids of all Techno-Commercially acceptable notified to attend price bid opening in presence of authorized bidders’ representatives. The bidder’s representatives who are present shall sign bid-opening register evidencing their attendance.

29.3 The bidder’s name, prices, and such other details as the Owner, at its discretion, may consider appropriate will be announced and recorded at the time of bid opening.

30.0 CONVERSION TO SINGLE CURRENCY

30.1 To facilitate evaluation and comparison, the Owner will covert all bid prices expressed in the amounts in various currencies in which the bid price is payable to single currency and that will be Indian Rupees only at the Bill selling exchange rate published by the State Bank of India on one day prior to the price bid opening date.

31.0 EVALUATION AND COMPARISON OF BIDS As mentioned in BEC.

32.0 PURCHASE PREFREENCE

32.1 Purchase Preference to Central Government Public Sector Undertakings shall be

allowed as per government guidelines in vogue.

F: AWARD OF CONTRACT

33.0 AWARD OF WORK

33.1 The Owner will award the contract to the successful bidder (s) whose bid has been determined to be substantially responsive and/or have been determined as a lowest on least cost to Owner and is determined to be qualified to satisfactorily perform the Contract.

34.0 OWNER’S RIGHT TO ACCEPT ANY BID AND TO REJECT ANY B ID

34.1 The Owner reserves the right to accept or reject any bid, and to annul the bidding process and reject all bids at any time prior to award of the contract without thereby incurring any liability to the affected bidder or bidders or any obligations to inform the affected bidder or bidders of the ground for Owner’s action.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 33 of 154

35.0 NOTIFICATION OF AWARD

35.1 Prior to the expiration of period of bid validity GAIL will notify the successful bidder

in writing by fax/e-mail to be confirmed in writing, that his bid has been accepted. The notification of award / Fax of Intent will constitute the formation of the Contract.

35.2 The Contract period shall commence from the date of notification of award / Fax of Acceptance (FOA).

35.3 The notification of award will constitute the formation of a Contract, until the Contract has been effected pursuant to signing of contract as per Clause 36 of Instruction To Bidders.

36.0 SIGNING OF AGREEMENT

36.1 After the successful bidder has been notified for acceptance of his bid, the bidder is required to execute the Contract Agreement within 15 days of receipt of Fax of Intent in the form provided in the Bidding Documents. The Contract Agreement is to be executed on the non-judicial paper of Andhra Pradesh of appropriate value (the cost of stamp paper shall be borne by the Bidder).

36.2 In the event of failure on the part of the successful bidder to sign the AGREEMENT within the above-stipulated period, the acceptance of the tender shall be considered as cancelled.

37.0 CONTRACT PERFORMANCE BANK GUARANTEE NOT APPLICABLE

38.0 CORRUPT AND FRAUDULENT PRACTICES

38.1 The Owner requires that Bidders/Consultant observe the highest standard of ethics during the execution of Contract. In pursuance of this policy, the Owner defines, for the purposes of this provision, the terms set forth below as follows:

i) “Corrupt Practice” means the offering, giving, receiving, or soliciting of

anything of value to influence the action of public official in contract execution; and

ii) “Fraudulent Practice” means a misrepresentation of facts in order to influence

the execution of a Contract to the detriment of the Owner, and includes collusive practise among bidders (prior to or after bid submission) designed to establish bid prices at artificial non-competitive levels and to deprive the Owner of the benefits of free and open competition;

38.2 The Owner will reject a proposal for award if it determines that the bidder

recommended for award has engaged corrupt or fraudulent practices in competing for the Contract in question:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 34 of 154

38.3 The Owner will declare a firm ineligible for a period pursuant to GCC.

38.4 The bidder(s) are required to execute the “Integrity Pact” attached in the bid document as Attachment IV. In case a bidder does not sign the Integrity Pact, his bid shall be liable for rejection.

38.5 a) Bidder is required to furnish the complete and correct information/ documents required for evaluation of their bids. If the information/ documents forming basis of evaluation is found to be false/ forged, the same shall be considered adequate ground for rejection of the bids and forfeiture of Earnest Money Deposit.

b) In case, the information/ document furnished by the vendor/ contractor

forming basis of evaluation of his bid is found to be false / forged after the award of the contract, GAIL shall have full right to terminate the contract and get the remaining job executed at the risk & cost of such vendor/ contractor without any prejudice to other rights available to GAIL under the contract such as forfeiture of CPBG / Security Deposit, withholding of payment etc.

c) In case, this issue of submission of false documents comes to the notice after

execution of work, GAIL shall have full right to forfeit any amount due to the vendor/ contractor along with forfeiture of CPBG/ Security Deposit furnished by the vendor/ contractor.

d) Further, such bidder/ vendor / contractor shall be put on Blacklist/ Holiday list

of GAIL debarring them from future business with GAIL.

39.0 WAIVER OR TRANSFER OF THE AGREEMENT

39.1 The successful bidder shall not waive the Agreement or transfer it to third parties, whether in part or in whole, nor waive any interest that is included in the Agreement without the prior written permission of the Owner.

40.0 ORDER OF PRECEDENCE

40.1 The Articles contained in this Section shall supplement to the Scope of Work and terms & conditions of contract, General Conditions of Contract. Where any portion of Scope of Works and terms & conditions of contract and General Conditions of Contract is repugnant or at variance with any provisions of Instructions to Bidders. Instructions to Bidders shall be deemed to over-ride the provision(s) of scope of work and terms & conditions of contract, and General Conditions of Contract only to the extent that such repugnancies of variations in Instructions to Bidders are not possible of being reconciled with the provisions of scope of work and terms & conditions of contract, General Conditions of Contract.

41.0 DISPUTE RESOLUTION Clause no. 3.9 GCC for Procurement of Goods has been modified to the extent that the following provision “Dispute Resolution Clause” shall be part of said clause:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 35 of 154

41.1 GAIL (India) limited has framed the Conciliation Rules 2010 in conformity with supplementary to Part –III of the Indian Arbitration and Conciliation Act 1996 for speedier cost effective and amicable settlement of dispute through conciliation. A copy of the said rules made available on GAIL’s website www.gailonline.com for reference. Unless otherwise specified, the matter where decision of the Engineer-in-Charges is deemed to be final and binding as provided in the agreement and the issues/ disputes which cannot be mutually resolved with a reasonable time, all disputes shall be settled in accordance with the Conciliation Rules 2010.

41.2 Any dispute(s)/ difference(s)/issue(s) of any kind whatsoever between/ amongst the Parties arising under/ out of/ in connection with this agreement shall be settled in accordance with the aforesaid rules.

41.3 In case of any dispute(s)/ difference(s)/issue(s), as mentioned above, a Party shall notify the other party (ies) in writing about such a dispute(s)/ difference(s)/issue(s) between/ amongst the Parties and that such a Party wishes to refer the dispute(s)/ difference(s)/issue(s) to Conciliation. Such Invitation for Conciliation shall contain sufficient information as to the dispute(s)/ difference(s)/issue(s) to enable the other Party (ies) to be fully informed as to the nature of the dispute(s)/ difference(s)/issue(s), the amount of monetary claim, if any, and apparent cause(s) of action.

41.4 Conciliation proceedings commence when the other Party(ies) accept(s) the invitation to conciliate and confirmed in writing. If the other Party(ies) reject(s) the invitation, there will be no conciliation proceedings.

41.5 If the Party initiating conciliation does not receive a reply within thirty days from the date on which he/she sends the invitation, or within such other period of time as specified in the invitation, he/she may elect to treat this as a rejection of the invitation to conciliate. If he/ she so elects, he/she shall inform to other Party(ies) accordingly.

41.6 Where Invitation for Conciliation has been furnished, the Parties shall attempt to settle such dispute(s) amicably under Part-III of the Indian arbitration and Conciliation Act, 1996 and GAIL (India) Limited Conciliation Rules, 2010. It would be only after exhausting the option of Conciliation as an Alternate Dispute Resolution Mechanism that the Parties hereto shall go for Arbitration as per the provisions of arbitration clause. For the purpose of this Article, the option of ‘Conciliation’ shall be deemed to have been exhausted, even in case of rejection of ‘Conciliation’ by any of the Parties.

41.7 The cost of Conciliation proceeding including but not limited to fees for Conciliator(s), Airfare, Local Transport, Accommodation, cost towards conference facility etc. shall be borne by the Parties equally.

41.8 The Parties shall freeze claims (s) of interest, if any, and shall not claim the same during pendency of Conciliation proceedings. The Settlement Agreement, as and when reached/ agreed upon, shall be signed between the Parties and Conciliation proceeding shall stand terminated on the date of the Settlement Agreement.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 36 of 154

42.0 UNSOLICITED POST TENDER MODIFICATIONS

42.1 Bidders are advised to quote as per terms and conditions of the Bidding Document and not to stipulate deviations/exceptions. Once quoted, the bidder shall not make any subsequent price changes, whether resulting or arising out of any technical / commercial clarifications and details sought on any deviations, exceptions or stipulations mentioned in the bid unless any amendment to Bidding Document is issued by Owner. Similarly, no revision in quoted price shall be allowed should the deviations stipulated by him are not accepted by GAIL and are required to be withdrawn by him in favour of stipulation of the Bidding Document. Any unsolicited proposed price change is likely to render the bid liable for rejection.

43.0 CENVAT / VAT CREDIT

43.1 Bidders shall provide required documents for availing Cenvat / VAT Credit applicable on Excise duty, CST/VAT/ LST and Service Tax as per prevailing rules.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 37 of 154

SECTION III

GENERAL CONDITIONS OF CONTRACT

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 38 of 154

SECTION-III:

GENERAL CONDITIONS OF CONTRACT ARTICLE 3.1: DEFINITIONS AND INTERPRETATIONS In this Document, as hereunder defined, the following terms and expressions shall have the meaning hereby assigned to them except where the context otherwise requires: AGREEMENT means the agreement concluded on non-judicial stamp paper between GAIL and Consultant for Services as per this Bid document. GAIL/OWNER shall mean GAIL (India) Limited GAIL'S REPRESENTATIVE means the person appointed or authorized from time to time by GAIL for execution of the contract. CONSULTANT'S REPRESENTATIVE means the person appointed from time to time by CONSULTANT for execution of the Contract. ENGINEER-IN-CHARGE/EXECUTIVE-IN-CHARGE shall mean the person designated from time to time by the GAIL and shall include those who are expressly authorized by him to act for and on his behalf for operation of this CONTRACT. SIGN OFF means a recorded statement for completion of a milestone/major activity by Consultant as envisaged in this document and accepted by GAIL. CONTRACT shall mean Letter of Acceptance and all attached exhibits and document referred to therein and all terms and conditions thereof together with any subsequent modifications thereto. SERVICES mean the duties to be performed and the services to be rendered by Consultant according to the terms and conditions of the Contract. HEADINGS the headings appearing herein are for convenience only and shall not be taken in consideration in the interpretation or construction of the Contract. SINGULAR AND PLURAL WORDS importing the singular only also include the plural and vice-versa where the context requires. ARTICLE 3.2: PERFORMANCE OF DUTIES AND SERVICES BY CONSULTNT 3.2.1 Consultant shall perform its Services in full accordance with the terms and conditions

of the Contract and any applicable local laws and regulations and shall exercise all reasonable professional skill, care and diligence in the discharge of said Project work.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 39 of 154

Consultant shall in all professional matters act as a faithful advisor to GAIL, and will provide all the expert commercial/technical advice and skills which are normally required for the class of Services for which it is engaged.

Consultant, its staff, employees shall carry out all its responsibilities in accordance with the best professional standards.

Consultant shall prepare and submit documents /reports etc. in due time and in accordance with the Tender Conditions.

3.2.2 Consultant will maintain for the performance of the Contract, personnel as determined

to be responsible for carrying out this job and such persons shall not be replaced or substituted without written approval of GAIL.

ARTICLE 3.3: GAIL'S REPRESENTATIVE 3.3.1 GAIL shall nominate its Representative(s) who shall be entitled to act on behalf of

GAIL with respect to any decision it is empowered to make. The bill / invoice of Consultant will be certified for payment by such representatives.

ARTICLE 3.4: CONSULTANT’S REPRESENTATIVE 3.4.1 Consultant shall nominate a qualified and experienced person as its Representative

who will be the contact person between GAIL and Consultant for the performance of the Contract. This nomination shall be done within ten (10) days after the coming into force of the Contract. Consultant shall notify GAIL in writing prior to the appointment of a new representative. Consultant's Representative may be replaced only with GAIL's consent after getting approved his CV’s from GAIL.

GAIL shall be at liberty to object to any nomination and to require Consultant to remove Consultant's representative for good causes. Consultant shall replace immediately such person by competent substitute at no extra cost to GAIL.

3.4.2 Consultant’s Representative shall be entitled to act on behalf of Consultant with

respect to any decisions to be made under the Contract. ARTICLE 3.5: PAYMENT TERMS 3.5.1 GAIL shall pay for the services rendered as per stipulation in the tender through E-

Banking only (through ICICI Bank, HDFC Bank or State Bank of India). All Bank charges of consultant’s Bankers shall be to the consultant’s account.

3.5.2 Consultant will invoice GAIL according to the terms and conditions provided in the

tender. 3.5.3 Payment terms shall be as per clause No. 07 of Special Condition of Contract. 3.5.4 In case of disputes concerning invoice(s), GAIL shall return said invoice(s) to

Consultant within fifteen (15) days from its/their receipt specifying in writing the reasons for its / their rejection.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 40 of 154

� GAIL shall pay the undisputed amount of the invoice(s) according to Article -

3.5.3 hereof. � The disputed amount, if any, shall be paid after mutual settlement between

GAIL and Consultant. � Total or partial rejection of the invoice(s) shall not release Consultant from

any of its obligations under the Contract. ARTICLE 3.6: PERFORMANCE GUARANTEE 3.6.1 Consultant shall submit to GAIL an unconditional, irrevocable and on first demand

guarantee from any Indian scheduled bank or a branch of an International bank situated in India and registered with Reserve Bank of India as scheduled foreign bank. However, other than the Nationalized Indian Banks, the banks whose BGs are furnished, must be commercial banks having net worth in excess of Rs. 100 Crores and a declaration to this effect should be made by such commercial bank either in the bank guarantee itself or separately on a letter head.

The value of Contract Performance Guarantee shall be 5% of contract value for the due performance of the Contract. The Contract Performance Guarantee shall be valid as per Special Conditions of Contract. The format of performance guarantee is annexed hereto. All expenses incurred in obtaining of such guarantee shall be borne by Consultant.

3.6.2 In case of extension of completion period, Consultant shall be required to extend the performance guarantee for an appropriate period of time as per contractual requirements.

ARTICLE 3.7: CONFIDENTIALITY 3.7.1 Consultant/GAIL shall treat all matters in connection with the Contract as strictly

confidential and undertakes not to disclose, in any way, information, documents, technical data, experience and know-how given to him by GAIL/Consultant without the prior written consent of the latter.

3.7.2 Consultant further undertakes to limit the access to confidential information to those

of its employees, Implementation Partners who reasonably require the same for the proper performance of the Contract provided however that Consultant shall ensure that each of them has been informed of the confidential nature of the confidentiality and non-disclosure provided for hereof.

ARTICLE 3.8: TAXES AND DUTIES 3.8.1 Consultant shall pay any and all taxes including service tax, duties, levies etc. which

are payable in relation to the performance of the Contract. The quoted price shall be inclusive of all such taxes and duties.

3.8.2 Statutory variation in taxes (CST, LST, WCT, withholding tax, service tax etc.) and

duties, if any, within the contractual completion period shall be borne by GAIL. No variation in taxes duties or levies other than statutory taxes & duties shall be payable.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 41 of 154

3.8.3 Consultant will not claim from GAIL any taxes paid by him. 3.8.4 GAIL shall deduct Income tax at source at applicable rates. ARTICLE 3.9: RESOLUTION OF DISPUTES / ARBITRATION 3.9.1 GAIL and Consultant shall make every effort to resolve amicably by direct informal

negotiations any disagreement or dispute arising between them under or in connection with the Contract.

3.9.2 All disputes, controversies, or claims between the parties (except in matters where the

decision of the Executive/Engineer-in-Charge is deemed to be final and binding) which cannot be mutually resolved within a reasonable time shall be referred to Arbitration by sole arbitrator.

GAIL shall suggest a panel of three independent and distinguished persons to the

other party (Consultant) to select any one among them to act as the sole Arbitrator. In the event of failure of the other party to select the Sole Arbitrator within 30 days

from the receipt of the communication suggesting the panel of arbitrators, the right of selection of sole Arbitrator by the other party shall stand forfeited and GAIL shall have discretion to proceed with the appointment of the sole Arbitrator. The decision of the GAIL on the appointment of Sole Arbitrator shall be final and binding on the parties.

The award of the Sole Arbitrator shall be final and binding on the parties and unless

directed/awarded otherwise by the Sole Arbitrator, the cost of arbitration proceedings shall be shared equally by the PARTIES. The arbitration proceeding shall be in English language and the venue shall be at New Delhi, India.

Subject to the above, the provisions of (Indian) Arbitration & Conciliation Act, 1996

and the rules framed there-under shall be applicable. All matters relating to this contract are subject to the exclusive jurisdiction of the Courts situated in the State of Delhi (India).

3.9.3 Consultant may please note that the Arbitration & Conciliation Act 1996 was enacted

by the Indian Parliament and is based on United Nations Commission on International Trade Law (UNCITRAL model law), which were prepared after extensive consultation with Arbitral Institutions and centers of International Commercial Arbitration. The United Nations General Assembly vide resolution 31/98 adopted the UNCITRAL Arbitration rules on 15 December 1976.

ARTICLE 3.10: LEGAL CONSTRUCTION 3.10.1 Subject to the provisions of this Article, the Contract shall be, in all respects,

constructed and operated as an Indian Contract and in accordance with Indian Laws as in force for the time being and is subject to and referred to the Court of Law situated at New Delhi.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 42 of 154

ARTICLE 3.11: SUSPENSION OF THE PREFORMANCE OF DUTIES AND SERVICES

3.11.1 GAIL may suspend in whole or in part – the performance of services of Consultants

any time upon giving not less than fifteen (15) days notice.

3.11.2 Upon notice of suspension, Consultant shall suspend immediately the services and reduce expenditure to a minimum to be agreed upon by both the parties.

3.11.3 Upon suspension of the performance of services, Consultant shall be entitled to reimbursement of the costs which shall have been actually incurred prior to the date of such suspension. However, the total reimbursement shall be restricted to contract price.

3.11.4 By fifteen days prior notice, GAIL may request Consultant to resume the performance of the services, without any additional cost to GAIL.

3.11.5 In case of suspension of work by consultant on GAIL’s request for more than 10 days, demobilization and remobilization charges will be paid to consultant as per Schedule of Rates.

3.11.6 If the suspension of the duties and services exceeds six months, either party shall be entitled to terminate contract according to Article 3.16 hereunder.

ARTICLE 3.12: PRICE REDUCTION SCHEDULE (PRS) 3.12.1 In case Consultant fails to complete the services within stipulated period then unless

such failure is due to force majeure as defined in Article 3.19 hereinafter or due to GAIL’s default, there will be a reduction in contract price @ 1/2% for each week of delay or part thereof subject to maximum of 5 % of contract price.

3.12.2 GAIL may without prejudice to any methods of recovery, deduct the amount of such

PRS from any money due or which may at any time become due to Consultant from its obligations and liabilities under the contract or by recovery against the Performance Bank Guarantee. Both Consultant and GAIL agree that the above percentage of price reduction are genuine pre-estimates of the loss/damage which GAIL would have suffered on account of delay/ breach on the part of Consultant and the said amount will be payable on demand without there being any proof of the actual loss/or damage caused by such breach/delay. A decision of GAIL in the matter of applicability of price reduction shall be final and binding.

ARTICLE 3.13: ASSIGNMENT 3.13.1 Consultant shall not have the right to assign or transfer the benefit and obligations of

the contract or any part thereof to the third party without the prior express approval in writing of GAIL which it shall do at its discretion. However, in event of that all legal/contractual obligations shall be binding on Consultant only.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 43 of 154

ARTICLE 3.14: INDUSTRIAL AND INTELLECTUAL PROPERTY 3.14.1 In order to perform the services, Consultant must obtain at its sole account, the

necessary assignments, permits and authorizations from the titleholder of the corresponding patents, models, trademarks, names or other protected rights and shall keep GAIL harmless and indemnify GAIL from and against claims, proceedings, damages, costs and expenses (including but not limited to legal costs) for and/or on account of infringements of said patents, models, trademarks names or other protected rights.

3.14.2 All documents, report, information, data etc. collected and prepared by Consultant in

connection with the scope of work submitted to GAIL will be property of GAIL. 3.14.3 Consultant shall not be entitled either directly or indirectly to make use of the

documents, reports given by GAIL for carrying out of any services with any third parties.

3.14.4 Consultant shall not without the prior written consent of GAIL be entitled to publish

studies or descriptive article with or without illustrations or data in respect of or in connection with the performance of services.

ARTICLE 3.15: LIABILITIES 3.15.1 Without prejudice to any express provision in the contract, Consultant shall be solely

responsible for any delay, lack of performance, breach of agreement and/or any default under this contract.

3.15.2 Consultant shall remain liable for any damages due to its gross negligence within the

next 12 months after the issuance of the provisional acceptance certificate of the contract.

3.15.3 The amount of liability will be limited to 10% of the contract value. ARTICLE 3.16: TERMINATION OF CONTRACT 3.16.1 Termination for Default

GAIL reserves its right to terminate / short close the contract, without prejudice to any other remedy for breach of CONTRACT, by giving one month notice if Consultant fails to perform any obligation(s) under the CONTRACT and if Consultant, does not cure his failure within a period of 30 days (or such longer period as GAIL may authorise in writing) after receipt of the default notice from GAIL.

3.16.2 Termination for Insolvency GAIL may at any time terminate the CONTRACT by giving written notice without

compensation to Consultant, if Consultant becomes bankrupt or otherwise insolvent, provided that such termination will not prejudice or affect any right of action or remedy which has accrued or will accrue thereafter to GAIL.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 44 of 154

3.16.3 Termination for convenience

GAIL may by written notice sent to consultant, terminate the contract, in whole or part, at any time for its convenience. However, the payment shall be released to the extent to which performance of work executed as determined by GAIL till the date upon which such termination becomes effective.

3.16.4 Summary of Termination of Contract Due To Submission of False Documents:

Bidders are required to furnish the complete and correct information/documents

required for evaluation of their bids. If the information/documents forming basis

of evaluation is found to be false/ forged, the same shall be considered adequate

ground for rejection of the Bids and forfeiture of Earnest Money Deposit.

In case, the information/document furnished by the contractor forming basis of

evaluation of his bid is found to be false/forged after the award of the contract,

GAIL shall have full right to terminate the contract and get the remaining job

executed at the risk & cost of such contractor without any prejudice to other

rights available to GAIL under the contract such as forfeiture of Security Deposit,

withholding of payments etc.

In case the issue of submission of false document comes to the notice after

execution of the work, GAIL shall have full right to forfeit any amount due to the

contractor along with forfeiture of Security Deposit furnished by the contractor.

Further, such contractor/bidder shall be blacklisted for future business with GAIL

(India) Limited.

ARTICLE 3.17: MODIFICATION Any modification of or addition to the contract shall not be binding unless made in

writing and agreed by both the parties. ARTICLE 3.18: CONTRACT/AGREEMENT The notification of award along with agreement on non judicial stamp paper of

appropriate value of as per proforma within 10 days from the date of receipt of FOA, the cost of stamp paper is to be borne by Consultant, and its enclosures shall constitute the contract between the parties and supersedes all other prior agreements, arrangements and communications, whether oral or written, between the parties relating to the subject matter hereof.

ARTICLE 3.19: FORCE MAJEURE

Shall mean and be limited to the following:

a) War/hostilities b) Riot or Civil commotion c) Earthquake, flood, tempest, lightening or other natural physical disaster. d) Restrictions imposed by the Government or other statutory bodies which

prevents or delays the execution of the Contract by Consultant.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 45 of 154

CONSULTANT shall advise GAIL by a registered letter duly certified by the local Chamber of Commerce or statutory authorities, the beginning and end of the above causes of delay within seven (7) days of the occurrence and cessation of such Force Majeure Conditions. In the event of delay lasting over one month, if arising out of causes of Force Majeure, GAIL reserves the right to cancel the Contract and the provisions governing termination stated under Article 3.16 shall apply.

For delays arising out of Force Majeure, Consultant shall not claim extension in completion date for a period exceeding the period of delay attributable to the causes of Force Majeure and neither GAIL nor Consultant shall be liable to pay extra costs provided it is mutually established that Force Majeure Conditions did actually exist.

Consultant shall categorically specify the extent of Force Majeure Conditions prevalent in their works at the time of submitting their bid and whether the same have been taken into consideration or not in their quotations. In the event of any force majeure cause, Consultant or the GAIL shall not be liable for delays in performing their obligations under this order and the completion dates will be extended to Consultant without being subject to price reduction for delayed completion, as stated elsewhere.

ARTICLE – 3.20: RECTIFICATION PERIOD

All services shall be rendered strictly in accordance with the terms and conditions stated in the Contract.

No deviation from such conditions shall be made without GAIL’S agreement in writing which must be obtained before any work against the order is commenced. All services rendered by Consultant pursuant to the Contract (irrespective of whether engineering, design data or other information has been furnished, reviewed or approved by GAIL) are guaranteed to be of the best quality of their respective kinds.

Consultant shall rectify at his own cost any mistake in assumption of any data in the study or use of wrong data or faulty study observed within twelve months of the acceptance of his report and will submit the rectified report incorporating the changes wherever applicable within 30 days of observance of mistake.

ARTICLE – 3.21: SUB CONTRACT

Any sub contract to be made by the CONSULTANT relating to the services shall be made only to such extent and with such duly qualified specialists and entities as shall be approved in writing in advance by GAIL. Upon the request of GAIL, the consultant shall submit for GAIL’s prior approval, the terms of reference or any amendment thereof for such sub contractor’s SERVICES. Notwithstanding such approval, the consultant shall remain fully responsible for the performance of services under the CONTRACT.

ARTICLE – 3.22: NOTICES 3.22.1 Any notice given by one party to the other pursuant to the CONTRACT shall be sent

in writing or by telegram or fax, telex/cable confirmed in writing.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 46 of 154

3.22.2 A notice shall be effective when delivered or on the notice’s effective date, whichever

is later. ARTICLE – 3.23: ACQUISITION OF DATA

If required, CONSULTANT shall be responsible for carrying out any surveys and acquisition of all data from necessary sources. GAIL, if requested in writing by CONSULTANT, may assist the consultant in the said acquisition by way of issue of recommendatory letters only. All requisite clearances, co-ordination, fees, charges, etc. and compliance to the local laws required for completion of the job shall be the responsibility of the CONSULTANT.

ARTICLE -3.24: ABNORMALLY HIGH RATED ITEMS (AHR ITEMS):

"In items rate contract where the quoted rates for the items exceed 50% of the GAIL's estimated rates, such items will be considered as Abnormally

High Rates Items (AHR) and payment of AHR items beyond the SOR stipulated quantities shall be made at the least of the following rates:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 47 of 154

SECTION-IV

FORMS AND FORMATS

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 48 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-1 BIDDER’S GENERAL INFORMATION

To GAIL (India) Limited GAIL Bhavan, A V A ROAD Rajahmundry-533103 A.P., India 1-1 Bidder Name:

1-2 Number of Years in Operation

1-3 Address of Registered Office

___________________________________________ City: ______________________________________ District: ____________________________________ State: ______________________________________ PIN/ZIP :___________________________________

1-4 Operation Address (if different from above)

___________________________________________ City: ______________________________________ District: ____________________________________ State: ______________________________________ PIN/ZIP :___________________________________

1-5 Telephone Number ____________________________________________ (Country Code) (Area Code) (Telephone Number)

1-6 E-mail address

1-7 Fax Number ____________________________________________ (Country Code) (Area Code) (Telephone Number)

1-8 Website

1-9 ISO Certification, if any {If yes, please furnish details}

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 49 of 154

1-10 Bid Currency

1-11 Banker’s Name

1-12 Branch

1-13 Branch Code

1-14 Bank Account Number

1-15 Service Tax Registration No. (for Indian Bidder)

1-16 PAN No. (for Indian Bidder)

1-17 PAN No. in India (for Foreign Bidder)

Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 50 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-2 BID FORM

To Dear Sir, After examining/reviewing the Bidding Documents for Project Management Consultancy services for ……………………………………………….. including technical specifications, drawings, General and Special Conditions of Contract and schedule of rates, etc. the receipt of which is hereby duly acknowledged, we, the undersigned, are pleased to offer to execute the whole of the Job for all specified items as per Schedule of Rates in conformity with, the said Bid Documents, including Addenda Nos. ____________. We undertake, if our bid is accepted, to complete entire work as specified in the Bid Document within the completion schedule specified therein. We confirm that this bid is valid for a period of three (3) months from the date of opening of Techno-Commercial Bid, and it shall remain binding upon us and may be accepted by any time before the expiration of that period. If our bid is accepted, we will provide the performance guarantee equal to 5% (Five per cent) of the Contract Price, for the due performance with in fifteen days of such award. Until a final Contract is prepared and executed, the bid together with your written acceptance thereof in your notification of award shall constitute a binding Contract between us. We understand that Bid Document is not exhaustive and any action and activity not mentioned in Bid Documents but may be inferred to be included to meet the intend of the Bid Documents shall be deemed to be mentioned in Bid Documents unless otherwise specifically excluded and we confirm to perform for fulfilment of Agreement and completeness of the Work in all respects within the time frame and agreed price. We understand that you are not bound to accept the lowest priced or any bid that you may receive. Dated this Day of 200_

Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 51 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-3

LIST OF ENCLOSURES Dear Sir,

We are enclosing the following documents as part of the bid:

1. Power of Attorney of the signatory to the Bidding Document.

2. Document showing annual turnover for the last three years such as annual reports, profit and loss account, net worth etc. along with information as sought in enclosed formats F-3A and F-3B.

3. Organisation chart of the bidder and the structure assigned for execution of the work under this bid with details of Bidder’s infrastructure in India as well as internationally and local support offices.

4. Methodology of execution of work

5. Copy of Bidding Documents along with addendum/corrigendum no….. duly signed and sealed on each page, in token of confirmation that Bid Documents are considered in full while preparing the bid and in case of award, work will be executed in accordance with the provisions detailed in Bid Documents.

6. Bidder declaration that they are not under any liquidation, court receivership or similar proceedings.

7. Disclaimer: Format F-11 duly filled in.

8. Attachment III: Agreed Terms & Conditions duly filled in.

Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 52 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-3A

Annual Turnover

NOT APPLICABLE

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 53 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-3B

FINANCIAL SITUATION

NOT APPLICABLE

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 54 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-4 LETTER OF AUTHORITY

PROFORMA FOR LETTER OF AUTHORITY FOR ATTENDING AND SUBSEQUENT NEGOTIATIONS/CONFERENCES

No. Date:

Dear Sir,

We _____________________________________ hereby authorize following representative(s) to attend Pre Bid Meeting / un-priced bid opening / Price bid opening and for any other correspondence and communication against above Bidding Document:

1) Name & Designation _______________________ Signature _________________

2) Name & Designation _______________________ Signature _________________

We confirm that we shall be bound by all commitments made by aforementioned authorised representatives.

Yours faithfully, Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

Note: This letter of authority should be on the letterhead of the bidder and should be signed by a person competent and having the power of attorney to bind the bidder.

Not more than two persons are permitted to attend techno –commercial un-priced and

price bid opening.

Bidder’s authorized executive is required to carry a copy of this authority letter while attending the Pre Bid Meeting, Un-priced bid opening and price bid opening and submit the same to GAIL.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 55 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-5 NO DEVIATION CONFIRMATION

Dear Sir, We understand that any deviation/exception in any form may result in rejection of bid. We, therefore, certify that we have not taken any exceptions/deviations anywhere in the bid and we agree that if any deviation/exception is mentioned or noticed, our bid may be rejected. Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 56 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-6 CERTIFICATE

Dear Sir,

If we become a successful bidder and pursuant to the provisions of the Bidding Documents award is given to us for the following certificate shall be automatically enforceable:

“We agree and acknowledge that the Employer is entering into the Agreement solely on its own behalf and not on behalf of any other person or entity. In particular, it is expressly understood and agreed that the Government of India is not a party to the Agreement and has no liabilities, obligations or rights there under. It is expressly understood and agreed that the Employer is authorised to enter into Agreement, solely on its own behalf under the applicable laws of India. We expressly agree, acknowledge and understand that the Employer is not an agent, representative or delegate of the Government of India. It is further understood and agreed that the Government of India is not and shall not be liable for any acts, omissions, commissions, breaches or other wrongs arising out of the Agreement. Accordingly, we hereby expressly waive, release and forego any and all actions or claims, including cross claims, VIP claims or counter claims against the Government of India arising out of the Agreement and covenants not to sue to Government of India as to any manner, claim, cause of action or things whatsoever arising of or under the Agreement.” Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 57 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-7 DETAILS OF SIMILAR WORK DONE AS PER BID EVALUATION CRITERIA /

SCOPE OF WORK Sr.

No.

Description of the work

Location of the work

Full Postal Address

and phone nos. of

Client & Name of

Officer-in-Charge

Value of Contract

Date of Commence-

ment of Work

Scheduled Completion

Time (Months)

Date of Actual

Completion

Reasons for delay in project

completion, if any

Note: Copies of Letter of awards and completion certificate for the above works to be

enclosed.

The Work completed earlier than the period indicated in Bid Evaluation Criteria / Scope of Work need not be indicated here. The list of work, not of similar nature need not be indicated here. Failing to comply aforementioned instructions may lead to rejection of bid.

Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 58 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-8

PRESENT COMMITMENTS OF THE BIDDER

Sr. No.

Full Postal Address and phone nos. of Client & Name of Officer-in-Charge

Description of the Work

Date of Commencement

of Work

Scheduled Comp. Period

Total Contractual

Value

%Age Comp. as on Date

Expected Date of

Completion

Remarks

NOT APPLICABLE

Note: This list must be a full list of all type of works in hand. Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 59 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-9

PROFORMA OF BANK GUARANTEE FOR CONTRACT PERFORMANCE GUARANTEE

PERFORMANCE SECURITY (CONTRACT PERFORMANCE BANK GUA RANTEE) – UNCONDITIONAL

(TO BE STAMPED IN ACCORDANCE WITH STAMP ACT)

REF.

Bank Guarantee No.: Date:

To GAIL ( India) Limited ________________________ ________________________ ________________________ Dear Sirs, In consideration of the GAIL ( India) Limited, New Delhi (India) (herein referred to as the OWNER which expression shall unless repugnant to the context or meaning thereof include successors, administrators and assigns) having awarded to M/s_______________ having principal office at _______________________________________(hereinafter referred to as the “CONSULTANT” which expression shall unless repugnant to the context or meaning thereof include their respective successors, administrators, executors and assigns) the work of ------------------------by issue of OWNER Order No. _______________dated ___________and the same having been accepted by the Consultant resulting into CONTRACT for --------------------------- as per above referred Order having a total value of _______________________for the work of --------------------------and the CONSULTANT having agreed to provide a Contract Performance and warranty guarantee for faithful performance of the aforementioned Contract to Owner. We (bank) _________________________________having Head Office at (hereinafter referred to as the Bank, which expressly shall, unless repugnant to the context or meaning thereof include successors, administrators, executors and assigns) do hereby guarantee to undertake to pay the OWNER on demand any and all moneys payable by the Consultant to the extent of 5%(Five percent) of the Contract Prices as aforesaid at any time up to __________________________________ without a reference to the CONSULTANT. Any such demand made by OWNER on bank shall be inclusive and binding not withstanding any difference between OWNER and CONSULTANT discharges this guarantee. OWNER and CONSULTANT or any dispute pending before any Court, Tribunals, arbitrators or any other Authority. The bank undertakes not to revoke this guarantee during its currency without previous consent of OWNER and further agrees that the guarantee herein contained shall continue to be enforceable till the OWNER discharges this guarantee. OWNER shall have the fullest liberty without affecting in any way the liability of the BANK under this guarantee from time

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 60 of 154

to time to extend the time for performance by CONSULTANT of the afore mentioned CONTRACT, OWNER shall have the fullest liberty, without affecting this guarantee, to postpone from time to time the exercise of any power vested in them or of any right which they might have against CONSULTANT, and to exercise the same at any time in any manner, and either to enforce to forebear to enforce any covenants contained or implied, in the aforementioned CONTRACT between OWNER and CONSULTANT or any other course of or remedy or security available to OWNER. The BANK shall not be released of its obligations under these presents by any exercise by OWNER of its liability with reference to the matters aforesaid or any of them or by reason or any other acts of omission or commission on the part of OWNER or any other indulgence shown by OWNER or by any other matter or thing whatsoever which under law would, but for this provision, have the effect or relieving the BANK. The BANK also agrees that OWNER at its option shall be entitled to enforced this Guarantee against the Bank as a Principal debtor, in the first instance without proceeding against CONSULTANT and notwithstanding any security or other guarantee that OWNER may have in relation to the CONSULTANT’S liabilities. Notwithstanding anything contained herein above our liability under this Guarantees restricted to AND it shall remain in force upto and including ________and shall be extended from time to time for such period as may be desired by the CONSULTANT on whose behalf this Guarantee has been given. Therefore, we hereby affirm that we are guarantors and responsible to you on behalf of the Consultant up to a total amount of (amount of guarantees in words and figures) and we undertake to pay you, upon your first written demand declaring the Consultant to be in default under the contract and without caveat or argument, any sum or sums within the limits of (amount of guarantee) as aforesaid, without your needing to prove or show grounds or reasons for your demand or the sum specified therein. This guarantee is valid until the ________day of _______200 We have power to issue this guarantee in your favour under memorandum and Article of Association and the undersigned has full powers to do so under the Power of Attorney/Resolution of the Board of Directors dated ________ accorded to him by the bank. Dated The ___________day of _____________200 WITNESS: (SIGNATURE) (SIGNATURE)

BANK RUBBER STAMP (NAME) (NAME) (OFFICIAL SEAL) Designation with bank stamp

Plus Attorney as per Power Of Attorney/Resolution Board of Directors Date:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 61 of 154

INSTRUCTIONS FOR FURNISHING CONTRACT PERFORMANCE BA NK

GUARANTEE

1. The Bank Guarantee by successful bidder(s) will be given on non-judicial stamp paper as per stamp duty applicable. The non-judicial stamp paper should be in name of the issuing bank. In case of foreign bank, the said bank guarantee to be issued by its correspondent bank in India on requisite non-judicial stamp paper and place of bid to be considered as Delhi.

2. The bank guarantee by bidders will be given from bank as specified in ITB.

3. A letter from the issuing bank of the requisite Bank Guarantee confirming that said bank guarantee and all future communication relating to the Bank Guarantee shall be forwarded to Owner.

4. If a bank guarantee is issued by a commercial bank, then a letter to Owner confirming its net worth is more than Rs. 1,000,000,000/- (Rupees one hundred crore) or U S $ 22 million in foreign currency along with a documentary evidence.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 62 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

F-12

CHECKLIST Bidders are requested to duly fill in the following checklist. This checklist gives only certain important items to facilitate the bidder to make sure that the necessary data / information as called for in the Bid Document has been submitted by them along with their offer. This, however, does not relieve the bidder of his responsibilities to make sure that his offer is otherwise complete in all respects. Please ensure compliance and tick (√) against following points:

Sl. Particulars Status

1. Offer complete in all respects with pages in sequential order, original Bid Document including drawings, addendum (if any)

2.

Confirm that the following details have been submitted in the Un-priced part:

a) Cover Letter, Letter of Submission

b) Power of Attorney in the name of person(s) signing the bid

c) Bidder's declaration that they are not under any liquidation, court receivership or similar proceedings.

d)

Confirmation that bidder and/or its sub-contractor have not been put on 'holiday' by GAIL or 'blacklisted' by any Government Department / Public Sector Enterprise.

f) Agreed Terms & Conditions (as per Attachment-III) submitted duly filled in each copy of the Un-priced Bid.

3. Confirm that all forms are enclosed with the bid duly signed / digital signed by authorized person(s)

4. Confirm that the Price Bid (in requisite formats strictly complying with the requirements) has been duly filled in for each item & signed

5. Confirm that proper page nos. have been given in a sequential way in all the documents submitted along with your offer with Index.

6. Confirm that any correction in the Un-priced part has been initialled and stamped by an authorized person.

7. Confirm that any correction in the Priced part has been signed in full and stamped by the authorized person.

8. Confirmation that no deviations are taken against commercial and technical specifications of the Bid Document.

10. Confirm that copies of documents establishing the bidder's eligibility are enclosed.

11. Details of local support office in India, infrastructure in India as well as International level.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 63 of 154

Sl. Particulars Status

12. Bio-Data of Key personnel viz. Project Manager, Engineering Manager, Construction Manager, Planning Manager, Inspection Manager, Contracts Manager, as per format enclosed.

(Signature of authorized signatory)

Name: ________________________

Date: Designation: Place: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 64 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

Format F-11 DISCLAIMER

Bidders should ensure that bidding document is complete in all respects. In the event that the bidding document or any part thereof is mutilated or missing, the bidder shall notify GAIL immediately at the following address: GAIL (India) Limited GAIL BHAWAN A V A ROAD RAJAHMUNDRY-533103 A.P., INDIA Attn.: Mr. T N M RAO E-mail: [email protected] Ph: +0883-2400720/21/222 Extn: 382

In the event such written notice is not received at the aforementioned office within seven (7) days from the date of issue of the bidding document to the bidder, the bidding documents received by the bidder shall be deemed to be complete in all respects. No extension of time shall be granted under any circumstances to any bidder for submission of its bid on the grounds that the bidder did not obtain a complete set of the bidding document. GAIL makes no representation or warranty, express or implied, as to the accuracy, correctness and completeness of the information contained in the bidding documents.

Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 65 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

F-12 A DECLARATION

We confirm that we are not under any liquidation, court receivership or similar proceedings. We also confirm that we have not been banned or delisted by any Government or Quasi Government agencies of PSU. Further, we confirm that we have not been put on Holiday list of GAIL or any of its PMC (i.e. M/s EIL, MECON, Tracabel & HRC Projects, Wood Group Kenny). We confirm that contents of Bid Document have not been altered or modified. Place: [Signature of Authorized Signatory of Bidder] Date: Name: Designation: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 66 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

F-13

CERTIFICATE FOR NON-INVOLVEMENT OF AGENT To, GAIL (India) Limited GAIL Bhavan, A V A ROAD Rajahmundry-533103 A.P., India Dear Sir, This is to certify that we have not engaged involve any Agent / Consultant / Retainer / Associate who is not an employee of _____________________ (name of your company) for payment of any remuneration thereof in India or abroad. Therefore, no Agent's / Representative's / Consultant's commission is payable in India or abroad against this Contract.

(Signature of authorized signatory)

Name: ________________________

Date: Designation: ___________________

Place: Seal: Note:

(1) This Certificate should be issued on the Letterhead of the Bidder. (2) This Certificate is to be issued only if there is no Agent / Consultant / Retainer / Associate is

involved.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 67 of 154

Bid Document No.: GAIL/RJY/C&P/SR20036987/RAO

F-10

PROFORMA FOR DETAILS OF INDIAN AGENT

To, GAIL (India) Limited GAIL Bhavan, A V A ROAD Rajahmundry-533103 A.P., India Dear Sir, Following are the details of Indian Agent / Consultant / Representative:

Sl. Description Bidder’s Response

1. Name & address of Agent / Consultant / Representative in India

2. The precise relationship between the bidder and their Agent / Consultant / Representative in India

3. The mutual interest which the bidder and Agent / Consultant / Representative in India have in the Business of each other.

4.

Any payment which the Agent / Consultant / Representative in India or abroad receives from the bidder whether as a commission for the Contract or as a general retainer fee.

5. Permanent Income Tax Account number of Agent / Consultant / Representative in India.

6. Permanent Income Tax account of bidder in his country and also in India, if applicable.

7. All services to be rendered by the Agent / Consultant / Representative

8. Bidder to confirm copy of Agreement with their Indian Agent is enclosed in Un-priced bid.

Note: Aforementioned information need to be supported with necessary documents.

(Signature of authorized signatory) Name: ________________________

Date: Designation: Place: Seal:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 68 of 154

SECTION – V

PART-A SCOPE OF WORK

PART-B

SPECIAL CONDITION OF CONTRACT

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 69 of 154

PART-A

SCOPE OF WORK

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 70 of 154

GAIL (India) Limited (A Government of India Undertaking)

A Navratna Company

GAIL Bhavan

AVA Road

Rajahmundry

TENDER NO.: GAIL/RJY/C&P/SR20036987/RAO

BIDDING DOCUMENT FOR

HIRING OF PROJECT MANAGEMENT

CONSULTANCY (PMC) SERVICES FOR DESIGN &

CONSTRUCTION OF KESANAPALLI(WEST) TO

PONNAMANDA P/L

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 71 of 154

SCOPE OF WORK

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 72 of 154

SSCCOOPPEE OOFF WWOORRKK

OOFF

PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT CCOONNSSUULLTTAANNCCYY ((PPMMCC)) SSEERRVVIICCEESS

FFOORR

KKEESSAANNAAPPAALLLLII((WW)) TTOO PPOONNNNAAMMAANNDDAA PPIIPPEELLIINNEE PPRROOJJEECCTT

11.. IINNTTRROODDUUCCTTIIOONN

11..11 GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iiss ooppeerraattiinngg PPiippeelliinnee NNeettwwoorrkkss iinn KKrriisshhnnaa GGooddaavvaarrii

((KKGG)) BBaassiinn iinn SSttaattee ooff AAnnddhhrraa PPrraaddeesshh,,IInnddiiaa.. GGaass iiss bbeeiinngg iinnjjeecctteedd ffrroomm

vvaarriioouuss ssoouurrcceess ooff OONNGGCC // CCaaiirrnn // RReelliiaannccee KKGG DD66 aanndd bbeeiinngg ttrraannssppoorrtteedd ttoo

vvaarriioouuss ccuussttoommeerrss ooff KKGG bbaassiinn..

22.. BBRRIIEEFF SSCCOOPPEE OOFF WWOORRKK

22..11 TThhee bbrriieeff ddeessccrriippttiioonn ooff tthhee pprroojjeecctt iiss aass uunnddeerr::

GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iinntteennddss ttoo iimmpplleemmeenntt 1100"" xx 44..55 kkmmss.. ((aapppprrooxx..))

KKeessaannaappaallllii((WW)) ttoo PPoonnnnaammaannddaa PPiippeelliinnee aalloonnggwwiitthh tteerrmmiinnaall uupp--ggrraaddaattiioonn aatt

KKeessaannaappaallllii((WW)) aanndd PPoonnnnaammaannddaa tteerrmmiinnaallss ffoorr ttrraannssppoorrttiinngg NNaattuurraall GGaass ttoo

GGAAIILL--TTaattiippaakkaa aanndd ffuurrtthheerr ttoo ootthheerr ccuussttoommeerrss aalloonngg ppiippeelliinnee rroouuttee iinn KKGG

BBaassiinn rreeggiioonn..

22..22 TThhee bbrriieeff ssccooppee ooff sseerrvviicceess iiss aass ppeerr sseeppaarraattee sseeccttiioonn oonn tthhee ““SSccooppee ooff WWoorrkk””

ooff tthhiiss BBiidd DDooccuummeenntt,, bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg::

TThhee PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt ((PPMMCC)) iiss bbeeiinngg aappppooiinntteedd ffoorr eexxeeccuuttiinngg

tthhee pprroojjeecctt rriigghhtt ffrroomm DDeessiiggnn ttoo CCoommmmiissssiioonniinngg && pprroojjeecctt cclloosseeoouutt oonn ttoottaall

aanndd ssiinnggllee ppooiinntt rreessppoonnssiibbiilliittyy bbaassiiss.. TThhiiss sseeccttiioonn iiss ttoo bbee rreeaadd iinn ccoonnjjuunnccttiioonn

wwiitthh ""SSccooppee ooff wwoorrkk””.. TThhee PPMMCC PPrroojjeecctt MMaannaaggeerr wwiillll bbee tthhee ""EEnnggiinneeeerr--iinn--

CChhaarrggee"" ffoorr tthhee ssaaiidd PPrroojjeecctt.. TThhee ssccooppee ooff wwoorrkk ooff tthhee PPMMCC iiss bbrrooaaddllyy ddeeffiinneedd

uunnddeerr tthhee ffoolllloowwiinngg hheeaaddss bbuutt nnoott lliimmiitteedd ttoo::

[[aa]] BBaassiicc EEnnggiinneeeerriinngg && HHyyddrraauulliicc SSTTUUDDYY..

[[bb]] DDeessiiggnn && DDeettaaiilleedd EEnnggiinneeeerriinngg..

[[cc]] CCaarrrryyoouutt aallll nneecceessssaarryy ccaallccuullaattiioonnss aanndd ccoonndduucctt aallll aapppprroopprriiaattee

ddeessiiggnn pprroocceedduurree aanndd aannaallyyssiiss,, aass rreeqquuiirreedd,, ttoo ooppttiimmiizzee tthhee ssiizziinngg

aanndd sseelleeccttiioonn ooff tthhee eeqquuiippmmeenntt aanndd ssppeecciiffiiccaattiioonn ooff mmaatteerriiaallss..

[[dd]] PPrreeppaarree oovveerraallll ddeessiiggnn bbaassiiss..

[[ee]] PPrreeppaarraattiioonn ooff MMaatteerriiaall TTaakkee--ooffffss ((MMTTOO)),, MMaatteerriiaall RReeqquuiissiittiioonn

((MMRR))..

[[ff]] PPrreeppaarraattiioonn ooff iitteemm--wwiissee ccoosstt eessttiimmaattee ffoorr eeaacchh MMaatteerriiaall RReeqquuiissiittiioonn

aanndd TTeennddeerr..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 73 of 154

[[gg]] PPrreeppaarraattiioonn ooff ddrraawwiinnggss,, MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPrroojjeecctt

DDooccuummeenntt IInnddeexx..

[[hh]] PPllaannnniinngg && SScchheedduulliinngg..

[[ii]] IIddeennttiiffyy aallll tthhee iinntteerrffaaccee ppooiinnttss // bbaatttteerryy lliimmiittss aanndd iinnccoorrppoorraattee

tthheemm oonn rreelleevvaanntt ddrraawwiinnggss aanndd ddooccuummeennttss..

[[jj]] RReevviieeww aanndd aapppprroovvaall ooff ddeessiiggnn // ddrraawwiinnggss // ddooccuummeennttss ssuubbmmiitttteedd

bbyy vveennddoorrss // ccoonnttrraaccttoorrss // ssuupppplliieerrss..

[[kk]] TThhee ccoonnssuullttaanntt sshhaallll pprroovviiddee aallll tteecchhnniiccaall ddooccuummeennttss ffoorr lliiaassiioonniinngg

aassssiissttaannccee wwiitthh ssttaattuuttoorryy aauutthhoorriittiieess lliikkee RR&&BB,, SSPPCCBB ((SSttaattee

PPoolllluuttiioonn CCoonnttrrooll BBooaarrdd)),, FFoorreesstt aauutthhoorriittiieess,,iirrrriiggaattiioonn,, CCCCOOEE ((CChhiieeff

CCoonnttrroolllleerr ooff EExxpplloossiivveess)) ffoorr oobbttaaiinniinngg vvaarriioouuss ssttaattuuttoorryy

ppeerrmmiissssiioonnss..

[[ll]] PPrreeppaarraattiioonn ooff TTeennddeerr DDooccuummeennttss,, iinnvviittee bbiiddss,, eevvaalluuaattiioonn ooff uunn--

pprriicceedd aanndd pprriiccee bbiiddss,, rreeccoommmmeennddaattiioonn ffoorr aawwaarrdd ooff jjoobb aass ppeerr

GGAAIILL''ss CC&&PP PPrroocceedduurree,, aassssiissttaannccee dduurriinngg nneeggoottiiaattiioonnss iiff ssiittuuaattiioonn

aarriisseess.. PPrreeppaarraattiioonn ooff LLeetttteerrss ooff IInntteenntt,, WWoorrkk OOrrddeerrss // PPuurrcchhaassee

OOrrddeerrss,, CCoonnttrraacctt DDooccuummeennttss // AAggrreeeemmeennttss,, PPuurrcchhaassee RReeqquuiissiittiioonnss

((PPRR''ss))..

[[mm]] TTeennddeerriinngg && OOrrddeerriinngg,, iinncclluuddiinngg PPuurrcchhaassee ooff aallll eeqquuiippmmeennttss aanndd

mmaatteerriiaallss,, CCuussttoommss CClleeaarraannccee aanndd TTrraannssppoorrttaattiioonn ooff mmaatteerriiaallss //

eeqquuiippmmeennttss ttoo ssiittee,, eettcc..

[[nn]] IInnssppeeccttiioonn // EExxppeeddiittiinngg ooff eeqquuiippmmeennttss // mmaatteerriiaallss bbeeiinngg

mmaannuuffaaccttuurreedd bbyy vveennddoorrss iinncclluuddiinngg ccoonnttrraaccttoorr--ssuupppplliieedd iitteemmss..

[[oo]] MMaannaaggeemmeenntt ooff CCoonnssttrruuccttiioonn SSttoorreess aanndd SSttoorreess AAccccoouunnttiinngg..

[[pp]] CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt && SSuuppeerrvviissiioonn

[[qq]] QQuuaalliittyy AAssssuurraannccee aanndd QQuuaalliittyy CCoonnttrrooll..

[[rr]] PPrroojjeecctt CCoommmmiissssiioonniinngg..

[[ss]] RReevviieeww aanndd aapppprroovvaall ooff ''AAss--BBuuiilltt DDooccuummeennttss // DDrraawwiinnggss''..

[[tt]] PPrroojjeecctt CCoosstt CCoonnttrrooll,, MMaannaaggeemmeenntt && MMoonniittoorriinngg..

[[uu]] CCoonnssttrruuccttiioonn ssuuppeerrvviissiioonn iinncclluuddiinngg cceerrttiiffiiccaattiioonn ooff ccoonnttrraaccttoorr’’ss

bbiillllss..

[[vv]] RRiisskk MMaannaaggeemmeenntt ooff tthhee PPrroojjeecctt aalloonngg wwiitthh ddeettaaiilleedd RRiisskk AAnnaallyyssiiss..

TThhee RRiisskk MMaannaaggeemmeenntt PPllaann ((RRMMPP)) && DDiissaasstteerr MMaannaaggeemmeenntt PPllaann

((DDMMPP)) aarree aallssoo ttoo bbee pprreeppaarreedd bbyy tthhee CCoonnssuullttaanntt..

[[ww]] HHeeaalltthh && SSaaffeettyy MMaannaaggeemmeenntt..

[[xx]] PPrroojjeecctt CClloosseeoouutt..

33.. SSCCOOPPEE OOFF CCUURRRREENNTT PPRROOJJEECCTT

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 74 of 154

SSccooppee uunnddeerr tthhee ccuurrrreenntt pprroojjeecctt iiss aass ffoolllloowwss::

LLaayyiinngg ooff 1100"" ddiiaammeetteerr,, aapppprrooxx.. 44..66 kkmmss.. PPiippeelliinnee ffrroomm KKeessaannaappaallllii((WWeesstt)) ttoo

PPoonnnnaammaannddaa ((iinn tthhee ssaammee RRooUU ppaarraalllleell ttoo eexxiissttiinngg 1122”” ddiiaa ppiippeelliinnee 55 mmttrrss..

aappaarrtt)) aalloonnggwwiitthh hhooookk--uupp wwiitthh ccrreeaattiioonn ooff nneeww tteerrmmiinnaall ffaacciilliittiieess aatt

KKeessaannaappaallllii((WW)) aanndd uuppggrraaddaattiioonn ooff eexxiissttiinngg PPoonnnnaammaannddaa aanndd hhooookk--uupp wwiitthh

eexxiissttiinngg ssttaattiioonn ppiippiinngg nneettwwoorrkk aatt PPoonnnnaammaannddaa.. SScchheemmaattiicc iinnddiiccaattiinngg eexxiissttiinngg

ppiippeelliinnee ffaacciilliittiieess && pprrooppoosseedd nneeww ffaacciilliittiieess ffoorr ssuuppppllyyiinngg NNaattuurraall GGaass iiss aass

uunnddeerr::

44.. SSAALLIIEENNTT DDEETTAAIILLSS::

44..11 PPiippeelliinneess::

[[ii]] LLaayyiinngg aanndd iinnssttaallllaattiioonn ooff 1100"" xx 44..55 kkmmss.. ppiippeelliinnee aanndd aassssoocciiaatteedd

ffaacciilliittiieess..

[[iiii]] TThhee ssccrraappeerr LLaauunncchheerr,, RReecceeiivveerr aanndd aassssoocciiaatteedd ffaacciilliittiieess wwoouulldd bbee

pprroovviiddeedd aatt ssuuiittaabbllee ddiissttaanncceess ttoo ffaacciilliittaattee aallll kkiinnddss ooff PPiiggggiinngg

iinncclluuddiinngg iinntteelllliiggeenntt ppiiggggiinngg..

[[iiiiii]] TThhee ppiippeelliinnee wwiillll bbee pprrootteecctteedd bbyy 33--LLaayyeerr PPEE eexxtteerrnnaall ccooaattiinngg,,

iinntteerrnnaall eeppooxxyy ccooaattiinngg aanndd iimmpprreesssseedd ccuurrrreenntt ccaatthhooddiicc pprrootteeccttiioonn

ssyysstteemm

[[iivv]] TThhee sseeccttiioonnaalliizziinngg vvaallvveess wwoouulldd bbee pprroovviiddeedd iinn aaccccoorrddaannccee wwiitthh tthhee

rreeqquuiirreemmeennttss ooff tthhee ccooddee iinn oorrddeerr ttoo iissoollaattee vvaarriioouuss sseeccttiioonnss ooff tthhee

ppiippeelliinnee.. TThheessee vvaallvveess wwiillll bbee ffuullll bboorree bbaallll vvaallvveess wwiitthh rreemmoottee

aaccttuuaatteedd aanndd mmaannuuffaaccttuurreedd iinn aaccccoorrddaannccee wwiitthh AAPPII--66DD oorr ootthheerr

eeqquuiivvaalleenntt ccooddee..

[[vv]] TThhee iinnssuullaattiinngg jjooiinnttss wwoouulldd bbee pprroovviiddeedd aatt ttrraannssiittiioonn ppooiinntt ooff aabboovvee

ggrroouunndd aanndd uunnddeerrggrroouunndd ppoorrttiioonn ooff tthhee ppiippeelliinnee ffoorr eelleeccttrriiccaall

iissoollaattiioonn..

[[vvii]] AAllll ppiippeelliinneess aanndd aassssoocciiaatteedd ssyysstteemmss wwoouulldd bbee ddeessiiggnneedd,, ccoonnssttrruucctteedd

aanndd tteesstteedd aass ppeerr llaatteesstt eeddiittiioonn ooff AASSMMEE BB3311..88 aanndd ootthheerr rreelleevvaanntt

aapppplliiccaabbllee ccooddeess..

44..22 DDiissppaattcchh TTeerrmmiinnaall::

TThhee DDiissppaattcchh TTeerrmmiinnaall wwiillll bbee llooccaatteedd aatt KKeessaannaappaallllii((WW)).. FFoolllloowwiinngg sshhaallll bbee

bbrrooaaddllyy pprroovviiddeedd::

((ii)) PPiigg llaauunncchhiinngg aarrrraannggeemmeenntt..

((iiii)) FFiilltteerriinngg aanndd PPrreessssuurree rreedduuccttiioonn,, iiff rreeqquuiirreedd..

((iiiiii)) MMeetteerriinngg ffaacciilliittiieess,, iiff rreeqquuiirreedd..

((iivv)) TTeerrmmiinnaall wwoorrkkss –– bboouunnddaarryy wwaallll,, ccoonnttrrooll bbuuiillddiinngg ((ppoottaa ccaabbiinn // cciivviill

ssttrruuccttuurree)),, sseeccuurriittyy bbooootthh,, ppaavveemmeenntt,, aapppprrooaacchh rrooaaddss eettcc..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 75 of 154

((vv)) AAllll vvaallvveess aass rreeqquuiirreedd ffoorr tthhee tteerrmmiinnaallss..

44..33 RReecceeiipptt tteerrmmiinnaall::

GGaass RReecceeiipptt TTeerrmmiinnaall wwiillll bbee aatt GGAAIILL--PPoonnnnaammaannddaa tteerrmmiinnaall.. FFoolllloowwiinngg sshhaallll

bbee bbrrooaaddllyy pprroovviiddeedd::

((ii)) PPiigg rreecceeiivviinngg aarrrraannggeemmeenntt..

((iiii)) FFiilltteerriinngg aanndd PPrreessssuurree rreedduuccttiioonn,, iiff rreeqquuiirreedd..

((iiiiii)) TTaapp--ooffff ffoorr NNeeaarrbbyy CCoonnssuummeerrss

((iivv)) MMeetteerriinngg ffaacciilliittiieess,, iiff rreeqquuiirreedd..

((vv)) TTeerrmmiinnaall wwoorrkkss –– bboouunnddaarryy wwaallll,, ppaavveemmeenntt,, aapppprrooaacchh rrooaaddss eettcc..

((vvii)) AAllll vvaallvveess aass rreeqquuiirreedd ffoorr tthhee tteerrmmiinnaallss..

44..44 TTeelleeccoommmmuunniiccaattiioonn && SSCCAADDAA::

OOppttiiccaall FFiibbeerr CCaabbllee bbaasseedd tteelleeccoommmmuunniiccaattiioonn ssyysstteemm sshhaallll bbee llaaiidd aalloonngg tthhee

pprrooppoosseedd ppiippeelliinnee rroouuttee.. TThhee nneeww ssyysstteemm sshhaallll bbee ddeessiiggnneedd ssuuiittaabbllyy aass ppeerr

llaatteesstt tteecchhnnoollooggiieess iinn tteelleeccoomm // SSCCAADDAA ssyysstteemm..

44..55 AAddvvaanncceedd AAccttiioonnss TTaakkeenn bbyy GGAAIILL::

((ii)) TThhee ppiippeess aarree aallrreeaaddyy wwiitthh GGAAIILL aanndd iitt hhaass bbeeeenn ddeecciiddeedd ffoorr 1100iinncchh ddiiaa

ppiippeelliinnee.. TThhee ppiippeess aarree aatt GGAAIILL--VViizzaagg.. PPMMCC sshhaallll ttaakkee rreessppoonnssiibbiilliittyy ooff

ttrraannssppoorrttiinngg ttoo ssiittee aanndd tthheeiirr rreeccoonncciilliiaattiioonn..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 76 of 154

CCOONNSSUULLTTAANNTT’’SS SSCCOOPPEE OOFF WWOORRKK

55.. EENNGGIINNEEEERRIINNGG::

55..11 PPrroocceessss DDeessiiggnn::

TThhiiss wwiillll ccoommpprriissee ooff bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg aanndd ddeelliivveerreedd ttoo GGAAIILL

bbootthh iinn hhaarrdd aanndd ssoofftt ffoorrmmss::

[[ii]] PPrroocceessss DDeessiiggnn BBaassiiss iinncclluuddiinngg PPrroocceessss DDeessccrriippttiioonn,, OOppeerraattiioonn &&

CCoonnttrrooll PPhhiilloossoopphhyy

[[iiii]] EEqquuiippmmeenntt PPrroocceessss DDaattaasshheeeettss

[[iiiiii]] EEqquuiippmmeenntt LLiisstt

[[iivv]] PPrroocceessss FFllooww DDiiaaggrraammss

[[vv]] PPiippiinngg aanndd IInnssttrruummeennttaattiioonn DDiiaaggrraammss ((PP&&IIDD’’ss)),, HHAAZZOOPP SSttuuddyy

[[vvii]] IInnssttrruummeenntt LLiisstt aanndd DDaattaasshheeeettss

[[vviiii]] UUttiilliittiieess rreeqquuiirreemmeenntt aanndd tthheeiirr ssppeecciiffiiccaattiioonnss

[[vviiiiii]] PPiippiinngg MMaatteerriiaall SSppeecciiffiiccaattiioonnss

[[iixx]] LLiinnee SScchheedduullee

[[xx]] PPrroocceessss DDeessccrriippttiioonn

[[xxii]] OOppeerraattiioonn aanndd CCoonnttrrooll PPhhiilloossoopphhyy

55..22 PPiippeelliinnee // PPiippiinngg ((SSppeecciiffiiccaattiioonnss ffoorr aallll PPiippeelliinnee LLaayyiinngg // CCiivviill // MMeecchhaanniiccaall

aanndd RReellaatteedd WWoorrkkss))::

[[ii]] PPrreeppaarraattiioonn ooff DDeessiiggnn bbaassiiss..

[[iiii]] CCoommpplleettiioonn ooff AAlliiggnnmmeenntt SShheeeettss aanndd ootthheerr CCoonnssttrruuccttiioonn DDrraawwiinnggss

iinncclluuddiinngg tthhoossee ffoorr CCrroossssiinnggss aalloonngg tthhee PPiippeelliinnee rroouuttee..

[[iiiiii]] VVeerriiffyy//IInnssppeecctt SSppeecciiffiiccaattiioonnss ffoorr LLiinnee PPiippeess,, LLiinnee MMaatteerriiaallss aanndd

TTeerrmmiinnaall MMaatteerriiaallss..

[[iivv]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss ffoorr LLiinnee PPiippee TTrraannssppoorrttaattiioonn,, llaayyiinngg

aanndd ccoonnssttrruuccttiioonn,, tteerrmmiinnaallss,, HHDDDD CCrroossssiinnggss eettcc..

[[vv]] PPrreeppaarree EEqquuiippmmeenntt LLaayyoouuttss..

[[vvii]] PPrreeppaarree GGeenneerraall AArrrraannggeemmeenntt DDrraawwiinnggss..

[[vviiii]] SSeeiissmmiicc AAnnaallyyssiiss..

[[vviiiiii]] PPeerrffoorrmm PPiippeelliinnee SSttrreessss AAnnaallyyssiiss ttoo ddeetteerrmmiinnee tthhee ssyysstteemm fflleexxiibbiilliittyy..

[[iixx]] CCaarrrryy oouutt PPiippiinngg SSttrreessss aanndd FFlleexxiibbiilliittyy AAnnaallyyssiiss ffoorr tthhee SSttaattiioonn PPiippiinngg..

[[xx]] PPrreeppaarree MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee RReeqquuiissiittiioonnss.. SSttaattiioonn

ppiippiinngg mmaatteerriiaallss –– vvaallvveess,, llaauunncchheerrss//rreecceeiivveerrss,, eettcc..

[[xxii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 77 of 154

[[xx]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeennttss..

[[xxii]] PPrreeppaarree aallll tthhee PPiippeelliinnee // PPiippiinngg DDrraawwiinnggss rreeqquuiirreedd ffoorr CCoonnssttrruuccttiioonn..

[[xxiiii]] RReevviieeww ooff ssuurrvveeyy ccaarrrriieedd oouutt bbyy TThhiirrdd ppaarrttyy aaggeennccyy..

55..33 EElleeccttrriiccaall::

[[ii]] PPrreeppaarree DDeessiiggnn BBaassiiss

[[iiii]] PPrreeppaarree EElleeccttrriiccaall LLooaadd DDeettaaiillss ffoorr DDiissppaattcchh // RReecceeiivviinngg TTeerrmmiinnaallss //

hhiigghh mmaasstt lliigghhttiinngg aatt KKSSPP((WW)) aanndd PPoonnnnmmaannddaa

[[iiiiii]] CCaarrrryy oouutt CCoommppaarraattiivvee SSttuuddyy ffoorr vvaarriioouuss ttyyppeess ooff PPoowweerr SSoouurrcceess aatt

SSVV // CCPP SSttaattiioonnss..

[[iivv]] RReevviieeww SSooiill RReessiissttiivviittyy RReeppoorrttss pprreeppaarreedd bbyy tthhee CCoonnttrraaccttoorrss..

[[vv]] PPrreeppaarree SSppeecciiffiiccaattiioonnss ffoorr CCaatthhooddiicc PPrrootteeccttiioonn ssyysstteemm,, bbootthh TTCCPP((iiff

rreeqquuiirreedd)) && PPCCPP..

[[vvii]] PPrreeppaarree DDaattaasshheeeettss aanndd MMaatteerriiaall TTaakkee--OOffff..

[[vviiii]] PPrreeppaarree MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee RReeqquuiissiittiioonnss..

[[vviiiiii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..

[[iixx]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss ffoorr EElleeccttrriiccaall aanndd CCPP wwoorrkkss..

[[xx]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeennttss..

[[xxii]] PPrreeppaarree tthhee EElleeccttrriiccaall DDrraawwiinnggss ffoorr ccoonnssttrruuccttiioonn..

[[xx]] PPrreeppaarree AArreeaa CCllaassssiiffiiccaattiioonn DDrraawwiinngg..

55..44 MMeecchhnniiccaall::

[[ii]] PPrreeppaarree MMeecchhaanniiccaall DDeessiiggnn BBaassiiss –– tteerrmmiinnaall,, llaauunncchheerrss// rreecceeiivveerrss,,

bbaallll vvaallvveess eettcc..

[[iiii]] PPrreeppaarree EEqquuiippmmeenntt DDaattaasshheeeettss aanndd MMaatteerriiaall TTaakkee--OOffff..

[[iiiiii]] PPrreeppaarree MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee RReeqquuiissiittiioonnss..

[[iivv]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..

[[vv]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss ffoorr MMeecchhaanniiccaall WWoorrkkss..

[[vvii]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeennttss..

[[vviiii]] LLaayyoouutt,, GGeenneerraall AArrrraannggeemmeenntt DDrraawwiinnggss aanndd DDeessiiggnn ooff vvaarriioouuss

PPiippiinngg vvaarriioouuss SSttaattiioonnss lliikkee IIPP // SSVV //DDeessppaattcchh // RReecceeiipptt SSttaattiioonnss

[[vviiiiii]] DDaattaasshheeeettss ffoorr aallll AAcccceessssoorriieess // SSppaarreess rreellaatteedd ttoo IItteemmss // WWoorrkkss

ddeettaaiilleedd iinn tthhee TTeennddeerr DDooccuummeennttss..

[[iixx]] DDeettaaiilleedd TTeecchhnniiccaall SSppeecciiffiiccaattiioonnss ffoorr aallll MMeecchhaanniiccaall rreellaatteedd iitteemmss..

55..55 TTeelleeccoomm::

[[ii]] PPrreeppaarree DDeessiiggnn BBaassiiss iinncclluuddiinngg rreeqquuiirreemmeenntt ooff eexxiissttiinngg aanndd

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 78 of 154

pprrooppoosseedd TTeelleeccoomm SSyysstteemm bbaasseedd oonn ssiittee vviissiitt iiff rreeqquuiirreedd..

[[iiii]] PPrreeppaarree MMRR''ss // TTeecchhnniiccaall SSppeecciiffiiccaattiioonnss,, eettcc..

[[iiiiii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..

[[iivv]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeenntt

[[vv]] PPrreeppaarree TTeelleeccoomm // SSCCAADDAA IInntteerrffaaccee DDrraawwiinnggss // DDooccuummeennttss..

[[vvii]] RReevviieeww aanndd AApppprroovvee aallll EEnnggiinneeeerriinngg aanndd FFAATT DDooccuummeennttss..

[[vviiii]] PPrreeppaarree FFAATT // SSAATT PPrroocceedduurree..

[[vviiiiii]] CCaarrrryy oouutt FFaaccttoorryy AAcccceeppttaannccee TTeessttiinngg..

[[iixx]] TTrraaiill RRuunn ooff tthhee SSyysstteemm..

[[xx]] PPrreeppaarree DDrraawwiinngg RReeqquuiirreemmeenntt ffoorr CCoonnssttrruuccttiioonn..

[[xxii]] OOvveerraallll PPaacckkaaggee SSuuppeerrvviissiioonn aanndd CCoommmmiissssiioonniinngg ooff TTeelleeccoomm SSyysstteemm

aanndd IInntteeggrraattiioonn..

[[xxiiii]] CCaarrrryy oouutt SSiittee AAcccceeppttaannccee TTeessttiinngg..

[[xxiiiiii]] CCoooorrddiinnaattiioonn aanndd SSuuppeerrvviissiioonn dduurriinngg IInnssttaallllaattiioonn aanndd

CCoommmmiissssiioonniinngg..

55..66 IInnssttrruummeennttaattiioonn::

[[ii]] RReevviieeww PP&&IIDD''ss aanndd CCoonnttrrooll PPhhiilloossoopphhyy ffoorr SSCCAADDAA ccoommppaattiibbiilliittyy

aanndd AAPPPPSS rreeqquuiirreemmeenntt

[[iiii]] RReevviieeww IInnssttrruummeennttaattiioonn,, CCiivviill WWoorrkkss,, CCoommppoossiittee TTeennddeerrss,, EElleeccttrriiccaall,,

CCPP aanndd TTeelleeccoomm SSyysstteemmss ttoo eennssuurree tthhaatt SSCCAADDAA && AAPPPPSS

rreeqquuiirreemmeennttss aarree mmeett..

[[iiiiii]] PPrreeppaarree DDeessiiggnn BBaassiiss..

[[iivv]] FFiinnaalliizzee IInnssttrruummeenntt DDaattaasshheeeettss aanndd pprreeppaarree MMaatteerriiaall TTaakkee--ooffff..

[[vv]] PPrreeppaarree mmaattcchhiinngg IInnssttrruummeennttaattiioonn aanndd SSCCAADDAA PPhhiilloossoopphhyy..

[[vvii]] PPrreeppaarree SSyysstteemm SSppeecciiffiiccaattiioonnss,, MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee

RReeqquuiissiittiioonnss..

[[vviiii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..

[[vviiiiii]] PPrreeppaarree FFAATT aanndd SSAATT TTeesstt PPllaannss aanndd PPrroocceedduurree DDooccuummeennttss..

[[iixx]] PPrreeppaarree DDrraawwiinnggss rreeqquuiirreedd ffoorr CCoonnssttrruuccttiioonn..

[[xx]] PPrroovviiddee aassssiissttaannccee dduurriinngg IInntteeggrraattiioonn aanndd CCoommmmiissssiioonniinngg ooff

SSCCAADDAA // AAPPPPSS SSyysstteemm..

[[xxii]] PPrreeppaarree IInnssttrruummeennttaattiioonn && SSCCAADDAA IInntteerrffaaccee DDrraawwiinnggss //

DDooccuummeennttss..

55..77 GGeenneerraall CCiivviill::

[[ii]] PPrreeppaarree tthhee DDeessiiggnn BBaassiiss iinncclluuddiinngg rreeqquuiirreemmeennttss ffoorr FFiirree FFiigghhttiinngg

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 79 of 154

aanndd SSaaffeettyy aassppeeccttss..

[[iiii]] PPrreeppaarree PPlloott PPllaannss ffoorr DDiissppaattcchh // RReecceeiivviinngg TTeerrmmiinnaallss,, SSVV''ss // IIPP''ss //

CCPP SSttaattiioonnss..

[[iiiiii]] PPrreeppaarree AArreeaa DDrraawwiinnggss..

[[iivv]] PPrreeppaarree MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPuurrcchhaassee RReeqquuiissiittiioonnss..

[[vv]] PPrreeppaarree MMaatteerriiaall TTaakkee--OOffff..

[[vvii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..

[[vviiii]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss ffoorr TTooppooggrraapphhiiccaall SSuurrvveeyyss aanndd

ggeenneerraall CCiivviill WWoorrkkss..

[[vviiiiii]] RReevviieeww VVeennddoorrss'' // CCoonnttrraaccttoorrss'' DDooccuummeennttss..

[[iixx]] PPrreeppaarree && iissssuuee DDrraawwiinnggss rreeqquuiirreedd ffoorr CCoonnssttrruuccttiioonn iinncclluuddiinngg

FFoouunnddaattiioonn DDrraawwiinnggss..

[[xx]] AAllll CCiivviill wwoorrkkss rreellaatteedd wwiitthh IInntteerrmmeeddiiaattee PPiiggggiinngg SSttaattiioonnss ((IIPP)) //

CCaatthhooddiicc PPrrootteeccttiioonn SSttaattiioonnss ((CCPP)),, DDiissppaattcchh // RReecceeiivviinngg SSttaattiioonnss aanndd

SSeeccttiioonnaalliizziinngg VVaallvvee SSttaattiioonnss ((SSVV)).. AAllll CCiivviill ccoonnssttrruuccttiioonn wwoorrkkss

rreellaatteedd ttoo IIPP // CCPP //SSVV // DDiissppaattcchh // RReecceeiipptt SSttaattiioonnss aarree ttoo bbee iinncclluuddeedd

bbyy tthhee PPMMCC iinn tthhee wwoorrkk ppaacckkaaggee ooff ccoommppoossiittee PPiippeelliinnee LLaayyiinngg

CCoonnttrraacctt..

55..88 AArrcchhiitteeccttuurree::

[[ii]] PPrreeppaarree AArrcchhiitteeccttuurraall DDrraawwiinnggss ffoorr SSuubb--ssttaattiioonn,, CCoonnttrrooll RRoooomm,,

AAddmmiinniissttrraattiivvee BBuuiillddiinngg,, eettcc..

[[iiii]] PPrreeppaarree MMaatteerriiaall TTaakkee--OOffff..

[[iiiiii]] PPrreeppaarree TTeennddeerr SSppeecciiffiiccaattiioonnss..

[[iivv]] OOvveerraallll PPlloott PPllaann ooff tthhee SSVV // IIPP // CCPP // DDeessppaattcchh // RReecceeiipptt SSttaattiioonnss..

[[vv]] AArrcchhiitteeccttuurraall DDrraawwiinnggss ffoorr vvaarriioouuss BBuuiillddiinnggss aatt CCPP // IIPP // SSVV //

DDeessppaattcchh // RReecceeiipptt SSttaattiioonnss..

[[vvii]] SSiittee GGrraaddiinngg PPllaann aanndd llaayyoouutt ooff rrooaaddss // ssttoorrmm--wwaatteerr ddiissppoossaall //

sseewwaaggee ddiissppoossaall aatt aabboovvee llooccaattiioonnss..

[[vviiii]] FFiirree--ffiigghhttiinngg ffaacciilliittiieess aatt DDiissppaattcchh // RReecceeiipptt SSttaattiioonnss aanndd ootthheerr

llooccaattiioonnss..

[[vviiiiii]] DDeettaaiilleedd TTeecchhnniiccaall SSppeecciiffiiccaattiioonnss ffoorr EEqquuiippmmeenntt ffoouunnddaattiioonnss,, rrooaaddss,,

ddrraaiinnss,, ccoommppoouunnddss wwaallll,, eettcc..

[[iixx]] MMTTOO aanndd MMRR ffoorr aallll iitteemmss..

55..99 SSttrruuccttuurraall::

[[ii]] PPrreeppaarree DDeessiiggnn BBaassiiss..

[[iiii]] PPrreeppaarree LLaayyoouutt DDrraawwiinnggss ffoorr BBuuiillddiinnggss..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 80 of 154

[[iiiiii]] PPrreeppaarree MMaatteerriiaall TTaakkee--OOffff..

[[iivv]] PPrreeppaarree SSppeecciiffiiccaattiioonnss ffoorr SSttrruuccttuurraall WWoorrkkss..

[[vv]] PPrreeppaarree DDrraawwiinnggss rreeqquuiirreedd ffoorr CCoonnssttrruuccttiioonn..

55..1100 SSCCAADDAA // AAPPPPSS::

[[ii]] PPrreeppaarree DDeessiiggnn BBaassiiss..

[[iiii]] PPrreeppaarree MMRR''ss // TTeecchhnniiccaall SSppeecciiffiiccaattiioonnss,, DDrraawwiinnggss,, IInnssttrruummeennttaattiioonn

AAddeeqquuaaccyy RReeppoorrtt ffoorr AAPPPPSS..

[[iiiiii]] CCaarrrryy oouutt TTeecchhnniiccaall EEvvaalluuaattiioonn ooff BBiiddss..

[[iivv]] RReevviieeww aanndd AApppprroovvee ooff aallll EEnnggiinneeeerriinngg // FFAATT DDooccuummeennttss..

[[vv]] CCaarrrryy oouutt SSCCAADDAA // AAPPPPSS PPrroojjeecctt MMaannaaggeemmeenntt aaccttiivviittiieess..

[[vvii]] CCaarrrryy oouutt FFaaccttoorryy AAcccceeppttaannccee TTeessttiinngg

[[vviiii]] PPrreeppaarree CCaabbllee SScchheedduullee aanndd TTeerrmmiinnaattiioonn DDrraawwiinngg ffoorr SSCCAADDAA..

[[vviiiiii]] CCaarrrryy oouutt SSiittee AAcccceeppttaannccee TTeessttiinngg..

[[iixx]] CCaarrrryy oouutt ssiittee // CCoonnssttrruuccttiioonn SSuuppeerrvviissiioonn..

[[xx]] CCoommmmiissssiioonniinngg..

[[xxii]] CCoo--oorrddiinnaattee wwiitthh IInnssttrruummeennttaattiioonn,, CCiivviill,, CCoommppoossiittee WWoorrkk,, EElleeccttrriiccaall,,

CCPP && TTeelleeccoomm SSyysstteemm VVeennddoorrss ffoorr oovveerraallll SSCCAADDAA // AAPPPPSS

rreeqquuiirreemmeenntt aanndd CCoommmmiissssiioonniinngg..

55..1111 SSaaffeettyy::

[[ii]] PPMMCC wwiillll bbee rreessppoonnssiibbllee ffoorr ccaarrrryyiinngg oouutt tthhee HHAAZZOOPP ssttuuddyy dduurriinngg

ddeettaaiill eennggiinneeeerriinngg,, ccoonnssttrruuccttiioonn && ccoommmmiissssiioonniinngg aanndd eennssuurree tthhaatt aallll

ddeessiiggnn cchhaannggeess rreeqquuiirreedd ttoo bbee iinnccoorrppoorraatteedd dduurriinngg ccoonnssttrruuccttiioonn

hhaavvee bbeeeenn ttaakkeenn ccaarree..

[[iiii]] PPMMCC wwiillll bbee rreessppoonnssiibbllee ffoorr pprreeppaarriinngg tthhee DDiissaasstteerr MMaannaaggeemmeenntt

PPllaann,, OOnnssiittee aanndd OOffffssiittee EEmmeerrggeennccyy AAccttiioonn PPllaann,, SSaaffeettyy MMaannuuaall,, aanndd

ssuubbmmiitt tthhee ssaammee ttoo GGAAIILL bbeeffoorree tthhee ccoommmmeenncceemmeenntt ooff

ccoommmmiissssiioonniinngg tthhee ppiippeelliinnee ssyysstteemm.. TThhee PPMMCC iiss aallssoo rreeqquuiirreedd ttoo

pprreeppaarree SSaaffeettyy PPaammpphhlleettss,, DDoo''ss && DDoonn''ttss,, eettcc.. rreeqquuiirreedd ttoo bbee

ddiissttrriibbuutteedd ttoo ssttaattuuttoorryy aauutthhoorriittiieess,, vviillllaaggeerrss dduurriinngg ccoonnssttrruuccttiioonn..

[[iiiiii]] PPMMCC ttoo ccaarrrryy oouutt EEnnvviirroonnmmeenntt IImmppaacctt AAsssseessssmmeenntt ((EEIIAA)) aanndd

pprreeppaarree EEnnvviirroonnmmeenntt MMaannaaggeemmeenntt PPllaann ((EEMMPP)) aass ppeerr pprreevvaaiilliinngg

eennvviirroonnmmeenntt pprrootteeccttiioonn aacctt ffoorr oobbttaaiinniinngg ssttaattuuaarryy cclleeaarraanncceess..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 81 of 154

66.. PPRROOCCUURREEMMEENNTT SSEERRVVIICCEESS

66..11 PPuurrcchhaassee::

TThhee PPMMCC wwiillll bbee rreessppoonnssiibbllee ffoorr pprreeppaarriinngg aallll tthhee TTeennddeerr DDooccuummeennttss ffoorr aallll

tthhee PPuurrcchhaassee aanndd WWoorrkk OOrrddeerrss.. TThhee TTeennddeerr DDooccuummeennttss wwiillll iinnccoorrppoorraattee tthhee

GGAAIILL''ss ssttaannddaarrddiizzeedd ""GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt [[GGCCCC –– GGooooddss //GGCCCC ––

WWoorrkkss ((aass aapppplliiccaabbllee))]]"" aanndd ""IInnssttrruuccttiioonnss ttoo BBiiddddeerrss"" wwhhiicchh wwiillll bbee pprroovviiddeedd

bbyy GGAAIILL ttoo PPMMCC.. TThhee tteennddeerriinngg wwiillll bbee ddoonnee ssttrriiccttllyy aass ppeerr GGAAIILL’’ss ""CCoonnttrraaccttss

aanndd PPrrooccuurreemmeenntt PPrroocceedduurree"" aanndd nnoottiiffiiccaattiioonnss // gguuiiddeelliinneess bbeeiinngg iissssuueedd bbyy

MMiinniissttrryy,, GGoovveerrnnmmeenntt ooff IInnddiiaa,, CCeennttrraall VViiggiillaannccee CCoommmmiissssiioonn,, eettcc.. ffrroomm ttiimmee

ttoo ttiimmee.. TThhee eennvviissaaggeedd aaccttiivviittiieess iinncclluuddee::

[[11]] PPrreeppaarriinngg aanndd ffllooaattiinngg ooff TTeennddeerr IInnqquuiirriieess ((iinn nneewwssppaappeerrss,, GGAAIILL''ss

wweebbssiittee,, PPMMCC''ss wweebbssiittee,, eettcc..)) iinncclluuddiinngg ffoorrmmuullaattiioonn ooff BBiidd

EEvvaalluuaattiioonn CCrriitteerriiaa ((BBEECC)).. AAllll tteennddeerrss aarree rreeqquuiirreedd ttoo bbee ppuubblliisshheedd

oonn GGAAIILL''ss // PPMMCC''ss wweebbssiittee.. AAllll rreeqquuiissiittee hheellpp ffrroomm GGAAIILL--

RRaajjaahhmmuunnddrryy CC&&PP sshhaallll bbee pprroovviiddeedd..

[[22]] IIssssuuee IICCBB // ddoommeessttiicc eennqquuiirriieess ttoo tthhee bbiiddddeerrss..

[[33]] CCaarrrryy oouutt tteecchhnnoo--ccoommmmeerrcciiaall eevvaalluuaattiioonn ooff bbiiddss aanndd pprreeppaarree tthhee

ppuurrcchhaassee rreeccoommmmeennddaattiioonn iinnlliinnee wwiitthh GGAAIILL''ss pprroocceedduurreess..

[[44]] CCoonnssuullttaanntt sshhaallll mmaakkee eeffffoorrttss ffoorr ggeettttiinngg mmaaxxiimmuumm nnuummbbeerr ooff

tteecchhnnoo--ccoommmmeerrcciiaallllyy vvaalliidd ooffffeerrss ((aatt lleeaasstt 33)) ffoorr aallll mmaatteerriiaall

rreeqquuiissiittiioonnss // tteennddeerrss ttoo eennssuurree pprrooppeerr ccoommppeettiittiioonn.. HHoowweevveerr,, ffoorr

eexxcceeppttiioonnaall ccaasseess wwhheerree tthhiiss iiss nnoott ppoossssiibbllee ccoonnssuullttaanntt wwiillll pprroovviiddee

aapppprroopprriiaattee rreeaassoonniinngg // jjuussttiiffiiccaattiioonn ffoorr nnoott eennssuurriinngg tthhee ssaammee..

[[55]] PPrreeppaarree ddrraafftt PPuurrcchhaassee OOrrddeerr // WWoorrkk OOrrddeerr ffoorr iissssuuaannccee bbyy GGAAIILL..

[[66]] PPrreeppaarree ppuurrcchhaassee ssttaattuuss rreeppoorrttss aanndd mmoonniittoorr pprrooccuurreemmeenntt pprrooggrreessss..

[[77]] AApppprroovvaall ooff ssuupppplliieerr ddrraawwiinnggss // ddeessiiggnnss iinn ttiimmee..

[[88]] EEnnssuurriinngg pprrooppeerr ttrraannssppoorrttaattiioonn,, llooggiissttiiccss aanndd mmaatteerriiaall mmaannaaggeemmeenntt..

[[99]] MMaasstteerr VVeennddoorr LLiisstt:: AA mmaasstteerr vveennddoorr lliisstt iiss ttoo bbee pprreeppaarreedd ffoorr

ssuuppppllyy ooff aallll mmaatteerriiaallss aanndd eeqquuiippmmeennttss,, ccoonnttrraaccttss.. TThhiiss lliisstt wwiillll bbee

bbaasseedd oonn ccoonnssuullttaanntt''ss eexxppeerriieennccee wwiitthh IInnddiiaann aanndd wwoorrllddwwiiddee

vveennddoorrss.. EEffffoorrttss wwiillll bbee mmaaddee ttoo iinncclluuddee aass mmaannyy IInnddiiaann vveennddoorrss aass

ppoossssiibbllee.. VVeennddoorrss oonn hhoolliiddaayy lliisstt ooff GGAAIILL // CCoonnssuullttaanntt dduurriinngg

tteennddeerriinngg wwiillll nnoott bbee ccoonnssiiddeerreedd..

[[1100]] WWaarrrraannttiieess aanndd GGuuaarraanntteeeess:: PPMMCC sshhaallll oobbttaaiinn ffrroomm tthhee vveennddoorrss //

ssuupppplliieerrss,, tthhee bbeesstt ppoossssiibbllee wwaarrrraannttiieess aanndd gguuaarraanntteeeess ccoovveerriinngg

wwoorrkkmmaannsshhiipp aanndd mmaatteerriiaallss ffoorr tthhee bbeenneeffiitt ooff tthhee oowwnneerr aanndd wwiillll

ttaakkee aallll sstteeppss ttoo eennssuurree tthhaatt ssuucchh wwaarrrraannttiieess aanndd gguuaarraanntteeeess aarree

eennffoorrcceedd ((ssaammee sshhaallll bbee wwiitthhiinn tthhee ffrraammeewwoorrkk ooff GGAAIILL''ss CC&&PP

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 82 of 154

PPrroocceedduurree)).. TThhee PPMMCC sshhaallll bbee ccoommpplleetteellyy rreessppoonnssiibbllee ffoorr aallll

wwaarrrraannttiieess // gguuaarraanntteeeess rreellaatteedd ttoo tthhee ddeessiiggnn && eennggiinneeeerriinngg bbeeiinngg

ddoonnee bbyy tthheemm..

[[1111]] EEnnqquuiirriieess:: TThhee PPMMCC sshhaallll aassssiiggnn aa cceennttrraall pprrooccuurreemmeenntt tteeaamm ttoo

mmaannaaggee aanndd ccoonndduucctt tthhee ppuurrcchhaassee ooff aallll eeqquuiippmmeennttss aanndd mmaatteerriiaallss..

EEnnqquuiirryy aaccttiivviittiieess sshhaallll bbee ccoonnttrroolllleedd bbyy tthhee ccoonnssuullttaanntt.. CCoonnssuullttaanntt

sshhaallll bbee rreessppoonnssiibbllee ffoorr iissssuuiinngg eennqquuiirriieess ttoo tthhoossee vveennddoorrss oonn

aapppprroovveedd vveennddoorr lliissttss,, eexxppeeddiittiinngg rreecceeiipptt ooff qquuoottaattiioonnss,, eevvaalluuaattiinngg

tthhee bbiiddss aanndd ssuubbmmiittttiinngg rreeccoommmmeennddaattiioonnss ttoo OOwwnneerr ffoorr aapppprroovvaall..

WWhhiillee tthhee eennqquuiirriieess aarree ffllooaatteedd bbyy PPMMCC,, iitt wwiillll bbee tthhee rreessppoonnssiibbiilliittyy

ooff tthhee PPMMCC ttoo iinnccoorrppoorraattee GGAAIILL''ss MMaatteerriiaall CCooddee aaggaaiinnsstt eeaacchh iitteemm..

FFoorr iinnccoorrppoorraattiinngg tthhee MMaatteerriiaall CCooddee tthhee PPMMCC wwiillll bbee ggiivveenn tthhee

GGAAIILL''ss MMaatteerriiaall CCooddee ddaattaabbaassee..

[[1122]] PPrreessss AAddvveerrttiisseemmeenntt ffeeee wwoouulldd bbee rreeiimmbbuurrsseedd ttoo tthhee PPMMCC iinncclluuddiinngg

sseerrvviiccee ttaaxx aass aapppplliiccaabbllee,, aanndd pprroocceeeeddss ooff tteennddeerr ffeeeess sshhaallll bbee

ffoorrwwaarrddeedd ttoo tthhee OOwwnneerr bbyy tthhee PPMMCC..

[[1133]] RReeaassoonnss ffoorr ccoosstt vvaarriiaattiioonn bbeettwweeeenn eessttiimmaatteedd ccoosstt ssuubbmmiitttteedd wwiitthh

rreeccoommmmeennddaattiioonn ffoorr pprriiccee bbiidd ooppeenniinngg aanndd oorrddeerr vvaalluuee..

[[1144]] TThhee ccyyccllee ttiimmee ffoorr ccoommpplleettiioonn ooff eeaacchh iinntteerrmmiitttteenntt aaccttiivviittyy ffoorr pprree--

oorrddeerriinngg // ppoosstt--oorrddeerriinngg wwiillll bbee mmaaiinnttaaiinneedd ssoo aass ttoo aacchhiieevvee ttiimmeellyy

ccoommpplleettiioonn ooff tthhee pprroojjeecctt aass ppeerr ttaarrggeetteedd ccoommpplleettiioonn sscchheedduullee..

[[1155]] HHoowweevveerr,, ttiimmeelliinneess ssppeecciiffiieedd aatt ffuuttuurree sseeccttiioonnss wwiillll bbee ffoolllloowweedd bbyy

tthhee PPMMCC.. TThhee ssaammee wwiillll bbee hhiigghhlliigghhtteedd iinn tthhee EExxeeccuuttiioonn PPllaann ttoo bbee

ssuubbmmiitttteedd bbyy PPMMCC..

[[1166]] CCuussttoomm cclleeaarraannccee aanndd ttrraannssppoorrttaattiioonn ooff mmaatteerriiaallss // eeqquuiippmmeennttss iiss

iinncclluuddeedd iinn ssccooppee ooff tthhee PPMMCC.. GGAAIILL sshhaallll ppaayy tthhee ccuussttoommss dduuttyy..

HHoowweevveerr tthhee cclleeaarriinngg,, ffoorrwwaarrddiinngg && ttrraannssppoorrttaattiioonn ooff tthhee mmaatteerriiaallss

// eeqquuiippmmeennttss sshhaallll bbee ccaarrrriieedd oouutt tthhrroouugghh GGAAIILL aapppprroovveedd // eennggaaggeedd

aaggeennccyy aanndd ccoossttss ooff ssaammee sshhaallll bbee rreeiimmbbuurrsseedd bbyy GGAAIILL aass ppeerr aaccttuuaall..

[[1177]] MMaatteerriiaall // PPuurrcchhaassee RReeqquuiissiittiioonnss ((MMRR // PPRR)) aarree ttoo bbee pprroocceesssseedd

tthhrroouugghh EERRPP ((SSAAPP)).. NNeecceessssaarryy hheellpp wwoouulldd bbee pprroovviiddeedd ttoo tthhee PPMMCC

ppeerrssoonnnneell..

[[1188]] CCoonnssuullttaanntt wwiillll pprreeppaarree MMRR iinn ssuucchh wwaayy tthhaatt ssuurrpplluuss ggeenneerraattiioonn iiss

mmiinniimmuumm.. MMiilleessttoonnee ffoorr tthhiiss wwiillll bbeeccoommee ppaayyaabbllee iiff tthhee ssuurrpplluuss

ggeenneerraattiioonn,, aass ppaarrtt ooff tthhee ttoottaall pprrooccuurreemmeenntt iiss 33%% oorr lleessss..

[[1199]] TThhee ccoonnssuullttaanntt sshhaallll ffoorrwwaarrdd tthhee bbiillllss ttoo GGAAIILL,, aafftteerr eenntteerriinngg iinn

GGAAIILL’’ss BBiillll WWaattcchh SSyysstteemm ((BBWWSS)),, dduullyy cceerrttiiffiieedd ffoorr ppaayymmeenntt,, wwiitthhiinn

tthhee ssttiippuullaatteedd ttiimmee ooff rreecceeiipptt.. AAssssiissttaannccee ooff GGAAIILL sshhaallll bbee pprroovviiddeedd..

66..22 MMaannuuffaaccttuurriinngg,, IInnssppeeccttiioonn && EExxppeeddiittiinngg::

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 83 of 154

[[11]] GGrraannttiinngg aapppprroovvaall ttoo aallll ddrraawwiinnggss // ddooccuummeennttss ssuubbmmiitttteedd bbyy

vveennddoorr ffoorr ssttaarrtt && dduurriinngg mmaannuuffaaccttuurriinngg wwiitthhiinn ttwwoo ((0022)) wweeeekkss ooff

tthhee ssuubbmmiissssiioonn ooff ddooccuummeenntt bbyy vveennddoorr // ccoonnttrraaccttoorr.. TThhee PPMMCC

sshhoouulldd eexxppeeddiittee ssuubbmmiissssiioonn ooff rreeqquuiirreedd ddrraawwiinnggss,, QQAAPP,, pprroocceedduurree,,

eettcc.. bbyy vveennddoorrss iinn oorrddeerr ttoo eexxppeeddiittee tthhee pprrooccuurreemmeenntt ooff mmaatteerriiaallss..

[[22]] PPrreeppaarree iinnssppeeccttiioonn aanndd eexxppeeddiittiinngg pprroocceedduurree..

[[33]] EEssttaabblliisshh vveennddoorrss mmaannuuffaaccttuurriinngg aanndd ddeelliivveerryy sscchheedduulleess..

[[44]] EExxppeeddiittee vveennddoorrss ffoorr ttiimmeellyy aaccttiioonn oonn ssuubb--ccoonnttrraacctteedd iitteemmss..

[[55]] QQuuaalliiffyy aanndd aapppprroovvee vveennddoorr''ss pprroocceedduurreess iinn ttiimmee ffoorr

mmaannuuffaaccttuurriinngg..

[[66]] CCaarrrryy oouutt MMaatteerriiaall iiddeennttiiffiiccaattiioonn aanndd mmaarrkkiinngg..

[[77]] CCaarrrryy oouutt iinnssppeeccttiioonn ooff aallll iitteemmss ddiirreeccttllyy ppuurrcchhaasseedd bbyy GGAAIILL // PPMMCC..

CCaarrrryy oouutt iinnssppeeccttiioonn ooff bboouugghhtt--oouutt iitteemmss ooff ccoonnttrraaccttoorrss'' ssuuppppllyy,, aass

ssppeecciiffiieedd eellsseewwhheerree iinn tthhee tteennddeerr..

[[88]] AAllll cchhaarrggeess ffoorr iinnssppeeccttiioonn // eexxppeeddiittiinngg iiss iinn tthhee ssccooppee ooff tthhee PPMMCC..

[[99]] CCaarrrryy oouutt IInnssppeeccttiioonn ooff iitteemmss pprrooppoosseedd ttoo bbee uusseedd ffrroomm GGAAIILL

ssuurrpplluuss ssttoorreess..

[[1100]] EEnnssuurree tthhaatt iitteemmss pprrooccuurreedd bbyy ccoonnttrraaccttoorrss aarree aacccceeppttaabbllee aass ppeerr PPOO

ssppeecciiffiiccaattiioonnss aanndd ssttaannddaarrddss..

[[1111]] CCaarrrryy oouutt iinnssppeeccttiioonn ooff tthhee iitteemmss pprrooccuurreedd tthhrroouugghh tthhee ccoonnttrraaccttoorrss

bbyy pprrooffeessssiioonnaallss ooff ccoonncceerrnneedd ddiisscciipplliinnee // ssyysstteemm..

[[1122]] CCaarrrryy oouutt iinnssppeeccttiioonn ooff tthhee iitteemmss pprrooccuurreedd tthhrroouugghh tthhee ccoonnttrraaccttoorrss

bbyy pprrooffeessssiioonnaallss ooff ccoonncceerrnneedd ddiisscciipplliinnee // ssyysstteemm..

[[1133]] WWiittnneessss ppeerrffoorrmmaannccee // aacccceeppttaannccee tteessttss aass aapppplliiccaabbllee..

[[1144]] PPMMCC sshhoouulldd eennssuurree tthhee ccoommpplliiaannccee ooff tthhee rreeqquuiirreemmeennttss ooff 33..22

cceerrttiiffiiccaattiioonn..

[[1155]] CCaarrrryy oouutt eexxppeeddiittiinngg tthhee ddeelliivveerriieess ooff mmaatteerriiaallss // eeqquuiippmmeennttss..

[[1166]] PPrreeppaarree ppeerriiooddiicc iinnssppeeccttiioonn aanndd eexxppeeddiittiinngg rreeppoorrttss..

[[1177]] TThhee ffoolllloowwiinngg sshhaallll bbee aapppplliiccaabbllee ffoorr IInnssppeeccttiioonn // ttoouurr oouuttssiiddee IInnddiiaa::

((aa)) SSttaaggee iinnssppeeccttiioonn wwiillll bbee ccaarrrriieedd oouutt sseelleeccttiivveellyy bbaasseedd oonn PPuurrcchhaassee

RReeqquuiissiittiioonn..

((bb)) FFoorr ccrriittiiccaall // mmaajjoorr iitteemmss ffiinnaall tteesstt iinncclluuddiinngg hhyyddrroo--tteessttss,, FFAATT,,

eettcc.. sshhaallll bbee wwiittnneesssseedd aanndd cceerrttiiffiieedd.. HHoowweevveerr,, ffoorr ccoommppoonneennttss,, nnoonn--

ccrriittiiccaall // mmiinnoorr eeqquuiippmmeennttss aanndd bbuullkk mmaatteerriiaallss aacccceeppttaannccee wwiillll bbee oonn

tthhee bbaassiiss ooff rreevviieeww ooff rreelleevvaanntt tteesstt cceerrttiiffiiccaatteess // aaccttuuaall iinnssppeeccttiioonn aass

ddeecciiddeedd bbyy tthhee iinnssppeeccttoorr iinn ccoonnssuullttaattiioonn wwiitthh GGAAIILL((CCrriittiiccaall // mmaajjoorr

iitteemmss mmaayy iinncclluuddee LLiinnee PPiippeess,, SSeeccttiioonnaalliizziinngg VVaallvveess,, UUllttrraassoonniicc

FFllooww MMeetteerrss,, MMeetteerriinngg SSkkiiddss,, eettcc..))..

((cc)) AAllll eexxppeennddiittuurreess sshhaallll bbee bboorrnnee bbyy tthhee ccoonnssuullttaanntt wwiitthhiinn tthhee

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 84 of 154

qquuootteedd pprriiccee..

((dd)) FFoorr GGAAIILL,, tthhee CCoonnssuullttaanntt iiss wwhhoollllyy aanndd ffuullllyy rreessppoonnssiibbllee ffoorr aallll

iinnssppeeccttiioonn dduurriinngg mmaannuuffaaccttuurriinngg aanndd ccoonnssttrruuccttiioonn ffoorr wwhhiicchh tthhee

ccoonnssuullttaanntt mmaayy iissssuuee nneecceessssaarryy cceerrttiiffiiccaatteess aass ddeeeemmeedd ffiitt.. AAllll ccoossttss ooff

tthhee iinnssppeeccttiioonn ooff ggooooddss bbeeffoorree ddeelliivveerryy ffrroomm tthhee vveennddoorr wwoorrkkss wwiillll

bbee bboorrnnee bbyy tthhee ccoonnssuullttaanntt aanndd iinncclluuddeedd iinn tthhee PPMMCC--ffeeee aass iinnddiiccaatteedd

aatt SSll..--((cc)) aabboovvee..

PPMMCC sshhaallll cceerrttiiffyy FFAATT aanndd SSAATT ooff vvaarriioouuss pprrooccuurreemmeenntt iitteemmss

bbeessiiddeess wwiittnneessssiinngg tthhee ssaammee..

AAllll aaccttiivviittiieess ppeerrttaaiinniinngg ttoo IInnssppeeccttiioonn aatt vveennddoorrss && ccoonnttrraaccttoorrss

wwoorrkkss ssiitteess sshhaallll bbee tthhee ccoommpplleettee rreessppoonnssiibbiilliittyy ooff tthhee PPMMCC.. PPMMCC iiss

rreeqquuiirreedd ttoo iissssuuee ffiinnaall ""IInnssppeeccttiioonn RReelleeaassee NNoottee"" aafftteerr iinnssppeeccttiioonn..

TThhee IInnssppeeccttiioonn aanndd tteesstt ppllaannss ffoorr mmaatteerriiaall aanndd ccoonnssttrruuccttiioonn ssiittee

aaccttiivviittiieess sshhaallll bbee ddeevveellooppeedd bbyy tthhee PPMMCC aanndd ggoott aapppprroovveedd ffrroomm tthhee

OOwwnneerr..

66..33 CCuussttoommss cclleeaarraannccee aanndd ttrraannssppoorrttaattiioonn::

CCuussttoommss cclleeaarraannccee aanndd ttrraannssppoorrttaattiioonn ooff mmaatteerriiaallss // eeqquuiippmmeennttss iiss iinncclluuddeedd iinn

ssccooppee ooff tthhee PPMMCC.. GGAAIILL sshhaallll ppaayy tthhee CCuussttoommss DDuuttyy.. HHoowweevveerr tthhee cclleeaarriinngg,,

ffoorrwwaarrddiinngg && ttrraannssppoorrttaattiioonn ooff tthhee mmaatteerriiaallss // eeqquuiippmmeennttss sshhaallll bbee ccaarrrriieedd oouutt

tthhrroouugghh GGAAIILL aapppprroovveedd // eennggaaggeedd aaggeennccyy aanndd ccoossttss ooff ssaammee sshhaallll bbee

rreeiimmbbuurrsseedd bbyy GGAAIILL aass ppeerr aaccttuuaall aanndd sseerrvviiccee ttaaxx aass aapppplliiccaabbllee..

66..44 CCoonnttrraaccttiinngg::

[[11]] PPrreeppaarree BBiidd EEvvaalluuaattiioonn CCrriitteerriiaa ((BBEECC)) && lliisstt ooff ccoonnttrraaccttoorrss ffoorr

vvaarriioouuss wwoorrkkss..

[[22]] PPrreeppaarree TTeennddeerr DDooccuummeennttss ffoorr aallll wwoorrkkss..

[[33]] RReelleeaassee ooff NNIITT ffoorr ppuubblliiccaattiioonn // iissssuuee EEnnqquuiirriieess ttoo ccoonnttrraaccttoorrss.. AAllll

EEnnqquuiirriieess aarree ttoo bbee ppuubblliisshheedd iinn tthhee wweebbssiitteess ooff GGAAIILL // PPMMCC..

[[44]] CCaarrrryy oouutt TTeecchhnniiccaall aanndd CCoommmmeerrcciiaall EEvvaalluuaattiioonn ooff BBiiddss aanndd

PPrreeppaarree RReeccoommmmeennddaattiioonnss..

[[55]] PPrreeppaarree FFOOAA // WWoorrkk OOrrddeerr..

[[66]] PPrreeppaarree CCoonnttrraacctt DDooccuummeennttss..

[[77]] PPrreeppaarree TTeennddeerriinngg SSttaattuuss RReeppoorrtt..

[[88]] TThhee ccoonnssuullttaanntt sshhaallll ffoollllooww GGAAIILL''ss CC&&PP PPrroocceedduurree,, GGCCCC,, IITTBB,, eettcc..

ffoorr aallll CCoonnttrraaccttss ((CCoonnssuullttaanntt bbeeffoorree ssuubbmmiittttiinngg tthhee bbiidd,, iiff ddeessiirreess ttoo

ssttuuddyy tthhee GGAAIILL''ss CC&&PP PPrroocceedduurree,, GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt &&

IInnssttrruuccttiioonnss ttoo BBiiddddeerrss ccaann rreeffeerr tthhee ccooppyy ooff ssaammee aatt GGAAIILL’’ss ooffffiiccee))..

66..55 CCoosstt EEnnggiinneeeerriinngg::

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 85 of 154

[[11]] PPrreeppaarree PPeerriiooddiicc CCoosstt SSttaattuuss RReeppoorrttss ((MMoonntthhllyy))..

[[22]] PPrreeppaarree MMRR aanndd ddeettaaiilleedd ccoosstt eessttiimmaatteess ffoorr bbiidd ccoommppaarriissoonn

ppuurrppoosseess..

[[33]] PPrreeppaarraattiioonn ooff aaccccuurraattee eessttiimmaatteess iinn ttiimmee ((bbaasseedd oonn ppaasstt ddaattaa //

CCPPWWDD bbaassiiss // MMaarrkkeett rraattee AAnnaallyyssiiss)) ffoorr pprrooccuurreemmeenntt iitteemmss aanndd

wwoorrkkss iiss aann iimmppoorrttaanntt aaccttiivviittyy iinn CCoosstt EEnnggiinneeeerriinngg.. OOwwnneerr llaayyss

ssttrroonngg eemmpphhaassiiss oonn aaccccuurraaccyy ooff ccoosstt eessttiimmaatteess aanndd pprriiccee ddiiffffeerreennccee

bbeeyyoonndd ((±±)) 1100%% sshhaallll ccaallll ffoorr aannaallyyssiiss.. IInn ccaassee ooff ddeevviiaattiioonn bbeettwweeeenn

ccoosstt eessttiimmaatteess && LL--11 pprriiccee bbiidd bbeeiinngg mmoorree tthhaann ((±±)) 1100%% nnoott bbaacckkeedd

bbyy jjuussttiiffiiaabbllee rreeaassoonnss aanndd nnoott bbeeyyoonndd tthhee ccoonnttrrooll ooff PPMMCC sshhaallll bbee

ttrreeaatteedd aass ddeeffiicciieennccyy ooff sseerrvviicceess bbyy PPMMCC..

[[44]] IInn ccaassee ooff tthhee ddeevviiaattiioonn bbeettwweeeenn ccoosstt eessttiimmaattee pprroovviiddeedd bbyy tthhee PPMMCC

aatt tthhee ttiimmee ooff bbiidd ssuubbmmiissssiioonn aanndd tthhee aaccttuuaall LL11--pprriiccee bbeeiinngg mmoorree

tthhaann ((±±)) 2200%%,, tthheenn rreeccoovveerryy sshhaallll bbee eeffffeecctteedd ffrroomm tthhee PPMMCC’’ss

ppaayymmeenntt aass bbeellooww::

LLeett tthhee aaccttuuaall aawwaarrddeedd ccoosstt ooff aa ppaarrttiiccuullaarr ppaacckkaaggee == YY

LLeett tthhee ttoottaall aawwaarrddeedd ccoosstt ooff aallll tthhee ppaacckkaaggeess iinn tthhee pprroojjeecctt == XX

TThheerreeffoorree rreeccoovveerryy ffoorr aa ppaacckkaaggee,, wwhheerree tthhee ccoosstt eessttiimmaattee ddeevviiaattiioonn

iiss mmoorree tthhaann ((±±)) 2200%% ddeevviiaattiioonn iiss ggiivveenn bbyy::

((YY // XX)) ** ((22%% ooff aawwaarrddeedd PPMMCC ccoosstt))

TThhuuss tthhee ppaayymmeenntt aaggaaiinnsstt tthhee mmiilleessttoonnee ffoorr ""AAccccuurraattee CCoosstt

EEssttiimmaattee"" mmeennttiioonneedd iinn ""PPaayymmeenntt TTeerrmmss"" ooff BBiidd DDooccuummeenntt sshhaallll bbee

mmaaddee oonnllyy aafftteerr oorrddeerr ppllaacceemmeenntt ooff aallll tthhee ppuurrcchhaassee // wwoorrkk

ppaacckkaaggeess,, aass tthhee vvaalluuee ooff XX ccaann bbee ddeetteerrmmiinneedd oonnllyy tthheenn..

[[55]] PPrroovviiddee aassssiissttaannccee iinn sseettttlliinngg aallll ccoommmmeerrcciiaall iissssuueess wwiitthh aallll tthhee

vveennddoorrss // ccoonnttrraaccttoorrss ttiillll tthhee ffiinnaall cclloosseeoouutt..

[[66]] FFoorrmmaatt ffoorr rreeppoorrttiinngg ccoosstt eessttiimmaatteess sshhaallll bbee ggiivveenn llaatteerr bbyy GGAAIILL..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 86 of 154

77.. CCOONNSSTTRRUUCCTTIIOONN::

77..11 CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt::

[[11]] OOnnllyy oonnee sspprreeaadd.. TThhee pprroojjeecctt iiss vveerryy ccrriittiiccaall aanndd aallll eeffffoorrttss sshhaallll bbee

mmaaddee bbyy PPMMCC ttoo eennssuurree ppaarraalllleell jjoobbss aanndd ffaasstteerr ccoommpplleettiioonn ooff tthhee

wwoorrkk..

[[22]] PPrroovviiddiinngg ssppeecciiaalliizzeedd gguuiiddaannccee aanndd aassssiissttaannccee ffoorr ddeevveellooppmmeenntt ooff

ccoonnssttrruuccttiioonn mmeetthhooddoollooggyy ffoorr aallll ccoonnssttrruuccttiioonn aaccttiivviittiieess iinncclluuddiinngg

rreevviieeww aanndd aapppprroovvaall ooff ccoonnssttrruuccttiioonn pprroocceedduurreess aanndd mmeetthhooddoollooggyy..

[[33]] RReevviieeww ccoonnttrraaccttoorr''ss rreessoouurrcceess aanndd sscchheedduulleess..

[[44]] MMoobbiilliizzee aaddeeqquuaattee mmaannppoowweerr ttoo ccaarrrryy oouutt tthhee ccoonnssttrruuccttiioonn

ssuuppeerrvviissiioonn aaccttiivviittiieess..

[[55]] SSuuppeerrvviissiioonn dduurriinngg tthhee ssuurrvveeyyss aanndd ssooiill iinnvveessttiiggaattiioonnss wwhheenn ccaarrrriieedd

oouutt bbyy tthhee ccoonnttrraaccttoorrss.. CCaarrrryy oouutt ccoonnssttrruuccttiioonn ssuuppeerrvviissiioonn aaccttiivviittiieess

bbaasseedd oonn tthhee aapppprroovveedd ccoonnssttrruuccttiioonn ddrraawwiinnggss..

[[66]] CCaarrrryy oouutt pprrooggrreessss mmeeaassuurreemmeenntt,, ssccrruuttiinnyy,, wwoorrkkss cceerrttiiffiiccaattiioonn ooff

ccoonnttrraaccttoorr''ss bbiillllss ffoorr ppaayymmeennttss ((iinncclluuddiinngg ffiinnaall bbiillllss))..

[[77]] DDeevviiaattiioonnss,, eexxttrraa iitteemmss,, AAHHRR iitteemmss,, ttiimmee eexxtteennssiioonn,, eettcc.. ooff tthhee

ccoonnttrraaccttoorrss aarree ttoo bbee aannaallyyzzeedd aanndd ffoorrwwaarrdd tthhee rreeccoommmmeennddaattiioonnss

wwiitthhiinn 1155 ddaayyss ooff ooccccuurrrreennccee ffoorr aapppprroovvaall ooff GGAAIILL..

[[88]] CCoooorrddiinnaattee wwiitthh ccoonnttrraaccttoorrss // GGAAIILL..

[[99]] CCaarrrryy oouutt ssttoorreess mmaannaaggeemmeenntt iinncclluuddiinngg hhaannddiinngg oovveerr ttoo GGAAIILL tthhee

lleeffttoovveerr ccoonnssttrruuccttiioonn ssuurrpplluuss mmaatteerriiaallss aalloonngg wwiitthh tthheeiirr IInnssppeeccttiioonn

CCeerrttiiffiiccaatteess aanndd ffiinnaall ddrraawwiinnggss aanndd ddooccuummeennttss.. CCoonnssuullttaanntt sshhaallll bbee

rreessppoonnssiibbllee ffoorr pprrooppeerr mmaaiinntteennaannccee aanndd uuppkkeeeepp ooff tthhee mmaatteerriiaallss..

RReeccoovveerryy sshhaallll bbee lleevviieedd ffoorr lloossss oorr sshhoorrttaaggee ooff mmaatteerriiaallss..

[[1100]] CCaarrrryy oouutt ccoonnttrraacctt mmaannaaggeemmeenntt

[[1111]] PPrreeppaarree mmoonntthhllyy // wweeeekkllyy pprrooggrreessss ssttaattuuss rreeppoorrttss..

[[1122]] CCaarrrryy oouutt QQAA // QQCC dduurriinngg ccoonnssttrruuccttiioonn.. CCoonnssuullttaanntt sshhaallll uussee iittss

CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt PPrroocceedduurree ((CCMMPP)) aanndd rreevviieeww aallll tthhee QQAA

// QQCC ffoorrmmaattss ssuubbmmiitttteedd bbyy tthhee eexxeeccuuttiioonn ccoonnttrraaccttoorrss iinn oorrddeerr ttoo

mmaaiinnttaaiinn rreeqquuiirreedd qquuaalliittyy dduurriinngg ccoonnssttrruuccttiioonn ppeerriioodd..

[[1133]] NNeecceessssaarryy tteecchhnniiccaall aassssiissttaannccee ffoorr sseettttlleemmeenntt ooff eexxttrraa ccllaaiimmss rraaiisseedd

bbyy tthhee ccoonnttrraaccttoorrss // vveennddoorrss aanndd aarrbbiittrraattiioonn ccaasseess sshhaallll bbee pprroovviiddeedd

bbyy tthhee ccoonnssuullttaanntt ttiillll aa ppeerriioodd ooff ttwweennttyy--ffoouurr ((2244)) mmoonntthhss aafftteerr tthhee

ccoommpplleettiioonn ooff tthhee pprroojjeecctt aatt nnoo eexxttrraa ccoosstt ttoo GGAAIILL.. CCoonnssuullttaanntt sshhaallll

ggiivvee rreeccoommmmeennddaattiioonnss oonn eexxttrraa ccllaaiimmss rraaiisseedd bbyy tthhee ccoonnttrraaccttoorrss //

vveennddoorrss.. FFiinnaall aacccceeppttaannccee // sseettttlleemmeenntt wwiillll bbee ttaakkeenn ccaarree ooff bbyy GGAAIILL..

[[1144]] TThhee ccoonnssuullttaanntt sshhaallll ffoorrwwaarrdd bbiillllss,, aafftteerr eenntteerriinngg iinn GGAAIILL''ss BBiillll

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 87 of 154

WWaattcchh SSyysstteemm ((BBWWSS)),, dduullyy cceerrttiiffiieedd ffoorr ppaayymmeenntt ttoo GGAAIILL wwiitthhiinn

sseevveenn ((0077)) wwoorrkkiinngg ddaayyss ffrroomm tthhee ddaattee ooff rreecceeiipptt..

[[1155]] IInn aaddddiittiioonn ttoo aabboovvee,, PPMMCC sshhaallll ddoo aallll aaccttiivviittiieess ttoo ddoo CCoonnssttrruuccttiioonn

MMaannaaggeemmeenntt eeffffiicciieennttllyy..

[[1166]] AAss rreeggaarrdd ddeeppllooyymmeenntt ooff CCoonnssttrruuccttiioonn MMaannppoowweerr bbyy PPMMCC iiss

ccoonncceerrnneedd,, tthhee mmiinniimmuumm nnuummbbeerr ooff mmaannppoowweerr ttoo bbee ddeeppllooyyeedd iiss aass

ppeerr rreessppeeccttiivvee ccllaauussee ooff tthhiiss tteennddeerr..

[[1177]] PPMMCC hhaass ttoo aarrrraannggee iittss oowwnn ccaammpp ffaacciilliittiieess aatt ccoonnssttrruuccttiioonn ssiitteess wwiitthh

rreeaassoonnaabbllee BBooaarrddiinngg aanndd llooddggiinngg,, ttrraannssppoorrttaattiioonn,, mmoobbiillee eexxppeennsseess,,

ccaammpp--ooffffiiccee ffaacciilliittiieess,, eettcc.. IInn oorrddeerr ttoo hhaavvee cclloossee ccoooorrddiinnaattiioonn aammoonngg

GGAAIILL aanndd PPMMCC ppeerrssoonnnneell,, tthhee ccaammpp--ooffffiiccee sshhaallll bbee llooccaatteedd aatt

RRaajjaahhmmuunnddrryy vveerryy cclloossee ttoo GGAAIILL OOffffiiccee,, AAVVAA RRooaadd,, RRaajjaahhmmuunnddrryy,,

EEGG ddiisstttt.. PPMMCC mmuusstt hhaavvee iittss oowwnn ssiittee ooffffiiccee aatt KKSSPP((WW)) oorr

PPoonnnnaammaannddaa..

TThhee PPMMCC sshhaallll qquuoottee aallll cchhaarrggeess iinncclluussiivvee..

NNoo sseeppaarraattee ppaayymmeenntt // rree--iimmbbuurrsseemmeenntt sshhaallll bbee mmaaddee bbyy GGAAIILL..

77..22 SSttoorreess aanndd MMaatteerriiaall mmaannaaggeemmeenntt::

PPMMCC sshhaallll bbee ffuullllyy rreessppoonnssiibbllee ffoorr mmaatteerriiaallss mmaannaaggeemmeenntt ffoorr ggooooddss // mmaatteerriiaall

ppuurrcchhaasseedd ffrroomm vvaarriioouuss ssuupppplliieerrss.. CC&&PP SSttoorreess aatt GGAAIILL--RRaajjaahhmmuunnddrryy sshhaallll bbee

ssttoocckk ssiittee.. PPMMCC iiss rreessppoonnssiibbllee ffoorr iinnssppeeccttiioonn aanndd mmaatteerriiaall cclleeaarraannccee ffoorr

ppaayymmeenntt.. TThhee ssccooppee ooff mmaatteerriiaall

mmaannaaggeemmeenntt sseerrvviicceess ttoo bbee pprroovviiddeedd bbyy tthhee CCoonnssuullttaanntt sshhaallll iinncclluuddee,, bbuutt nnoott

lliimmiitteedd ttoo::

[[11]] RReecceeiivvee eeqquuiippmmeennttss // mmaatteerriiaallss ffrroomm ssuupppplliieerrss aanndd iinnssppeecctt aanndd

cceerrttiiffyy tthheeiirr iinnvvooiicceess ffoorr ppaayymmeenntt..

[[22]] IInnssppeecctt tthhee ccoonnddiittiioonn ooff ggooooddss rreecceeiivveedd aanndd aassssiisstt GGAAIILL iiss pprreeppaarriinngg

GGooooddss RReecceeiipptt VVoouucchheerr..

[[33]] IInnssppeecctt aanndd cceerrttiiffyy uunnuusseedd mmaatteerriiaall rreettuurrnneedd bbyy tthhee ccoonnttrraaccttoorrss..

PPrreeppaarree rreeccoonncciilliiaattiioonn ssttaatteemmeennttss ttoo eennaabbllee OOwwnneerr ttoo cchheecckk aanndd ttaakkee

oovveerr bbaallaannccee ssttoorreess,, aalloonngg wwiitthh rreeqquuiissiittee iinnssppeeccttiioonn cceerrttiiffiiccaatteess,,

ddooccuummeennttss,, eettcc.. aanndd cceerrttiiffyy mmaatteerriiaall rree--ccoonncciilliiaattiioonn aass ppeerr tteennddeerr

ccoonnddiittiioonnss..

[[44]] RReessppoonnssiibbiilliittyy ooff hhaannddoovveerr ooff pprroojjeecctt ssuurrpplluuss mmaatteerriiaallss ttoo GGAAIILL..

[[55]] AAllll eeffffoorrttss sshhaallll bbee mmaaddee bbyy PPMMCC ttoo uuttiilliizzee GGAAIILL mmaatteerriiaallss –– ffoorr

ootthheerr pprroojjeecctt ssuurrpplluuss..

77..33 AAss--bbuuiilltt ddrraawwiinnggss::

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 88 of 154

[[11]] FFoollllooww uupp wwiitthh vveennddoorrss aanndd ccoonnttrraaccttoorrss ffoorr aass--bbuuiilltt ddrraawwiinnggss //

ddooccuummeennttss iinn rreeqquuiirreedd ssooffttwwaarree aanndd hhaarrddccooppyy ffoorrmmaatt,, rreevviieeww //

aapppprroovvee tthhee ssaammee aanndd ffoorrwwaarrdd ttoo GGAAIILL..

[[22]] AAllll pprroojjeecctt rreellaatteedd ddooccuummeennttss ffoorr ffuuttuurree rreeffeerreennccee aanndd rreeccoorrddss wwiillll

bbee hhaannddeedd oovveerr ttoo GGAAIILL aass ppeerr ssttaannddaarrdd iinntteerrnnaattiioonnaall pprraaccttiiccee..

SSuubbmmiissssiioonn ooff ffiinnaall ddooccuummeennttss sshhaallll bbee uunnddeerr tthhee ffoolllloowwiinngg hheeaaddss::

((aa)) AAss--bbuuiilltt DDrraawwiinnggss..

((bb)) DDeettaaiilleedd OOppeerraattiinngg MMaannuuaall..

((cc)) SSeeppaarraatteellyy hhiigghhlliigghhttiinngg rreeccoommmmeennddaattiioonnss ooff tthhee EEIIAA ((iiff

aapppplliiccaabbllee)),, HHAAZZOOPP SSttuuddyy && RRiisskk AAnnaallyyssiiss ccoovveerriinngg QQuuaalliittaattiivvee //

QQuuaannttiittaattiivvee rriisskkss aanndd RRiisskk MMaannaaggeemmeenntt PPllaann ((RRMMPP)) && DDiissaasstteerr

MMaannaaggeemmeenntt PPllaann ((DDMMPP)),, eettcc..

((dd)) PPrroobblleemmss ffaacceedd dduurriinngg tthhee pprroojjeecctt eexxeeccuuttiioonn aanndd mmiittiiggaattiioonn

mmeeaassuurreess ttaakkeenn aanndd rreeaassoonnss ffoorr ffuuttuurree..

88.. PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT AANNDD CCOONNTTRROOLL

88..11 PPllaannnniinngg aanndd SScchheedduulliinngg::

TThhee PPMMCC wwiillll bbee ccoommpplleetteellyy rreessppoonnssiibbllee ffoorr pprreeppaarriinngg pprroojjeecctt ppllaannss aanndd

sscchheedduullee iinnlliinnee wwiitthh tthhee OOvveerraallll PPrroojjeecctt SScchheedduullee pprroovviiddeedd bbyy tthhee cclliieenntt.. TThhiiss

wwiillll iinncclluuddee tthhee pprreeppaarraattiioonn aanndd ssuubbmmiissssiioonn ooff::

[[AA]] WWOORRKK BBRREEAAKKDDOOWWNN SSTTRRUUCCTTUURREE IINNCCOORRPPOORRAATTIINNGG

[[ii]] AAssssiisstt GGAAIILL iinn ddooccuummeennttaattiioonn rreeqquuiirreedd ffoorr SSttaattuuttoorryy

PPeerrmmiissssiioonnss // NNOOCC''ss ffrroomm vvaarriioouuss aauutthhoorriittiieess ffoorr CCrroossssiinngg

PPeerrmmiissssiioonnss,, NNOOCC ffrroomm SSttaattee PPoolllluuttiioonn CCoonnttrrooll BBooaarrddss,, CCCCOOEE

CClleeaarraannccee,, MMOOEE&&FF CClleeaarraannccee,, aannyy ootthheerr ppeerrmmiissssiioonn rreeqquuiirreedd

ffoorr pprroojjeecctt eexxeeccuuttiioonn..

[[iiii]] EEnnggiinneeeerriinngg ((DDeettaaiill EEnnggiinneeeerriinngg && PPrroocceessss DDeessiiggnn BBaassiiss))

[[iiiiii]] TTeennddeerriinngg

[[iivv]] OOrrddeerriinngg

[[vv]] MMaannuuffaaccttuurriinngg

[[vvii]] IInnssppeeccttiioonn && EExxppeeddiittiinngg

[[vviiii]] DDeelliivveerryy

[[vviiiiii]] CCoonnssttrruuccttiioonn

[[iixx]] CCoommmmiissssiioonniinngg

[[BB]] PPrroojjeecctt NNeettwwoorrkk DDiiaaggrraammss,, PPEERRTT // GGNNAATT CChhaarrtt // II--JJ lliisstt

[[CC]] PPrroojjeecctt AAccttiivviittyy LLiisstt,, MMiilleessttoonneess iinnccoorrppoorraattiinngg tthhee EEaarrllyy SSttaarrtt,, EEaarrllyy

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 89 of 154

FFiinniisshh,, LLaattee SSttaarrtt && LLaattee FFiinniisshh DDaatteess,, TToottaall FFllooaatt,, FFrreeee FFllooaatt aaggaaiinnsstt

eeaacchh AAccttiivviittyy

[[DD]] PPrroojjeecctt OOvveerraallll PPeerrcceennttaaggee SScchheedduullee:: MMoonntthhllyy BBrreeaakkuuppss,, aanndd

CCuummuullaattiivvee BBrreeaakkuuppss

[[EE]] PPeerrcceennttaaggee SScchheedduullee MMoonntthhllyy BBrreeaakkuuppss ffoorr eeaacchh eelleemmeenntt // ddiisscciipplliinnee

ooff WWBBSS

[[FF]] PPrroojjeecctt CCoosstt EEssttiimmaattee ffoorr eeaacchh PPuurrcchhaassee aanndd WWoorrkk OOrrddeerr

[[GG]] PPrroojjeecctt FFiinnaanncciiaall CCoommmmiittmmeenntt SScchheedduullee iinn aaccccoorrddaannccee wwiitthh tthhee

eennvviissaaggeedd // aaccttuuaall ddaatteess ffoorr oorrddeerr ppllaacceemmeenntt

[[HH]] PPrroojjeecctt PPllaannnneedd CCaasshh OOuuttffllooww iinn aaccccoorrddaannccee ttoo tthhee eennvviissaaggeedd // aaccttuuaall

ddaatteess ooff ddeelliivveerryy // ccoonnssttrruuccttiioonn

[[II]] PPMMCC OOrrggaannooggrraamm ffoorr PPrroojjeecctt OOffffiiccee && CCoonnssttrruuccttiioonn SSiittee OOffffiiccee

[[JJ]] PPMMCC MMaannppoowweerr DDeeppllooyymmeenntt SScchheedduullee ((MMoonntthh--wwiissee))

[[KK]] PPrroojjeecctt CCoommmmuunniiccaattiioonn // CCoooorrddiinnaattiioonn PPllaann ((CClliieenntt && PPMMCC

IInntteerraaccttiioonn MMooddeell))

[[LL]] IInnssppeeccttiioonn SScchheedduullee aanndd PPllaann

[[MM]] SSuubbmmiissssiioonn ooff MMoonntthhllyy RReeppoorrttss aass ppeerr tthhee rreeqquuiirreemmeenntt ooff MMiinniissttrryy

MMoonniittoorriinngg CCeellll ((MMMMCC)) iinnccoorrppoorraattiinngg tthhee aabboovvee ddeettaaiillss ((AA.. ttoo HH..))

TThhee vvaarriioouuss eelleemmeennttss wweeiigghhttaaggeess ttoo bbee ffoolllloowweedd ffoorr oovveerraallll PPrroojjeecctt sscchheedduulliinngg

aanndd pphhyyssiiccaall pprrooggrreessss mmoonniittoorriinngg iiss aass uunnddeerr::

SSll.. EElleemmeennttss WWeeiigghhttaaggee

[[ii]] AAssssiissttaannccee ffoorr SSttaattuuttoorryy PPeerrmmiissssiioonnss // NNOOCC''ss 22

[[iiii]] EEnnggiinneeeerriinngg ((DDeettaaiill EEnnggiinneeeerriinngg && PPrroocceessss DDeessiiggnn

BBaassiiss))

44

[[iiiiii]] TTeennddeerriinngg 1122

[[iivv]] OOrrddeerriinngg 1155

[[vv]] MMaannuuffaaccttuurriinngg 2255

[[vvii]] DDeelliivveerryy 1100

[[vviiii]] CCoonnssttrruuccttiioonn 2288

[[vviiiiii]] CCoommmmiissssiioonniinngg 22

[[iixx]] PPrroojjeecctt CClloossee--oouutt 22

FFoolllloowwiinngg aarree ttoo bbee ssttrriiccttllyy nnootteedd::

PPrreeppaarree mmoonntthhllyy pprrooggrreessss rreeppoorrttss ffoorr tthhee PPrroojjeecctt aanndd pprroovviiddee aallll aassssiissttaannccee ttoo

GGAAIILL ffoorr pprreeppaarriinngg rreeppoorrttss rreeqquuiirreedd bbyy ttoopp ccoorrppoorraattee mmaannaaggeemmeenntt.. SSttrriicctt

aaddhheerreennccee ttoo ssuubbmmiissssiioonn ooff aallll ddooccuummeennttss,, rreeppoorrttss,, pprreesseennttaattiioonnss,, qquueerriieess ffrroomm

vvaarriioouuss aaggeenncciieess nneeeeddss ttoo bbee pprreeppaarreedd aanndd ssuubbmmiitttteedd oonn ttiimmee.. FFoorr ssuucccceessssffuull

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 90 of 154

aanndd ttiimmeellyy iimmpplleemmeennttaattiioonn,, tthhee ccoonnssuullttaanntt sshhaallll aaddhheerree ttoo,, bbuutt nnoott lliimmiitteedd ttoo,,

tthhee ffoolllloowwiinngg::

[[11]] TThhee ccoonnssuullttaanntt sshhaallll pprreeppaarree tthhee OOvveerraallll PPrroojjeecctt SScchheedduullee aass ppeerr tthhee

GGAAIILL''ss aapppprroovvaall aanndd aallssoo aass ppeerr tthhee iinntteerrnnaall sscchheedduullee wwhhiicchh wwiillll bbee

ddeecciiddeedd dduurriinngg tthhee PPrroojjeecctt kkiicckk--ooffff mmeeeettiinngg..

[[22]] TThhee PPrroojjeecctt SScchheedduullee ((NNeettwwoorrkk DDiiaaggrraamm && IIJJ LLiisstt)) wwiillll bbee pprreeppaarreedd

ffoorr iitteemmss lliisstteedd aass ((AA)) aabboovvee aanndd ssuubbmmiitt ttoo GGAAIILL wwiitthhiinn oonnee ((0011))

wweeeekk ooff kkiicckk--ooffff mmeeeettiinngg.. TThhiiss sshhaallll aallssoo iinncclluuddee tthhee AAccttiivviittyy lliisstt,, lliisstt

ooff MMiilleessttoonneess,, WWoorrkk--BBrreeaakkddoowwnn SSttrruuccttuurree ((WWBBSS)),, eettcc.. PPrreeppaarraattiioonn ooff

aallll tthheessee ddooccuummeennttss iinn PPrriimmaavveerraa // SSAAPP--PPSS mmoodduullee iiss rreeqquuiirreedd.. TThhee

ccoonnssuullttaanntt sshhaallll aallssoo pprreeppaarree tthhee ffiinnaanncciiaall mmoonntthh--wwiissee ccaasshh ffllooww

ddiiaaggrraamm,, aappaarrtt ffrroomm tthhee mmoonntthhllyy aappaarrtt ffrroomm tthhee mmoonntthhllyy pphhyyssiiccaall

pprrooggrreessss sscchheedduullee aass ppeerr iinntteerrnnaall aanndd bbooaarrdd aapppprroovveedd sscchheedduullee..

[[33]] PPrreeppaarree vvaarriioouuss SSttaattuuss RReeppoorrttss,, ee..gg.. PPrree--OOrrddeerr,, PPoosstt--OOrrddeerr,, MMaatteerriiaall

EExxppeeddiittiinngg,, CCoonnssttrruuccttiioonn,, eettcc..

[[44]] PPrreeppaarree PPrroojjeecctt CClloosseeoouutt RReeppoorrtt,, iinncclluuddiinngg ppeerrffoorrmmaannccee rreeppoorrtt ooff

vveennddoorrss // ccoonnttrraaccttoorrss..

[[55]] AAppaarrtt ffrroomm tthhee aabboovvee ddeelliivveerraabblleess ooff tthhee ccoonnssuullttaanntt,, tthhee ccoonnssuullttaanntt

wwiillll bbee rreeqquuiirreedd ttoo ssuubbmmiitt ootthheerr ddooccuummeennttss iinn tthhee ffoorrmm ooff rreeppoorrttss,, aass

ddeeeemmeedd nneecceessssaarryy ffoorr ssuucccceessssffuull aanndd ttiimmeellyy PPrroojjeecctt iimmpplleemmeennttaattiioonn..

88..22 PPrroojjeecctt MMaannaaggeemmeenntt::

TThhee PPMMCC wwiillll bbee ccoommpplleetteellyy rreessppoonnssiibbllee ffoorr tthhee eennttiirree PPrroojjeecctt MMaannaaggeemmeenntt

wwhheerreeiinn tthheeyy wwiillll bbee rreeqquuiirreedd ttoo wwoorrkk iinn cclloossee ccoooorrddiinnaattiioonn wwiitthh GGAAIILL tteeaamm..

FFoorr eeffffiicciieenntt aanndd ttiimmeellyy ccoommpplleettiioonn ooff tthhee pprroojjeecctt tthhee PPMMCC wwiillll bbee rreeqquuiirreedd ttoo::

[[11]] EEssttaabblliisshh CCoommmmuunniiccaattiioonn PPrroocceedduurreess iinn ccoonnccuurrrreennccee wwiitthh GGAAIILL..

[[22]] EEssttaabblliisshh PPrroocceedduurreess ffoorr vvaarriioouuss aaccttiivviittiieess ttoo bbee ppeerrffoorrmmeedd ffoorr

vvaarriioouuss WWBBSS eelleemmeennttss vviizz.. TTeennddeerriinngg,, OOrrddeerriinngg,, MMaannuuffaaccttuurriinngg,,

IInnssppeeccttiioonn,, DDeelliivveerryy,, eettcc..

[[33]] DDeeffiinnee SSccooppee ooff WWoorrkk ffoorr vvaarriioouuss ggrroouuppss..

[[44]] AAtttteenndd MMoonntthhllyy PPrroojjeecctt RReevviieeww MMeeeettiinnggss wwiitthh GGAAIILL MMaannaaggeemmeenntt..

[[55]] AAtttteenndd wweeeekkllyy PPrroojjeecctt MMeeeettiinngg wwiitthh PPrroojjeecctt MMaannaaggeerr..

[[66]] SSuurrvveeiillllaannccee oonn tthhee eennttiirree PPrroojjeecctt--rreellaatteedd aaccttiivviittiieess..

[[77]] MMoonniittoorr pprrooggrreessss ooff tthhee PPrroojjeecctt aanndd ssuubbmmiitt ppeerriiooddiicc ssttaattuuss rreeppoorrttss ttoo

GGAAIILL..

[[88]] CCoooorrddiinnaattiioonn wwiitthh vveennddoorrss // ccoonnttrraaccttoorrss rreellaattiinngg ttoo tthhee pprrooccuurreemmeenntt

ooff iitteemmss aanndd eexxeeccuuttiioonn ooff tthhee wwoorrkk..

[[99]] PPrroovviiddee ttiimmeellyy iinnppuuttss iinn tteerrmmss ooff mmaatteerriiaallss && ddrraawwiinnggss ttoo

ccoonnttrraaccttoorrss ffoorr ccaarrrryyiinngg oouutt ccoonnssttrruuccttiioonn aaccttiivviittiieess..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 91 of 154

[[1100]] PPrreeppaarree vvaarriioouuss rreeppoorrttss // ddrraafftt rreeppllyy lleetttteerrss aass rreeqquuiirreedd ffrroomm ttiimmee ttoo

ttiimmee ffoorr GGAAIILL''ss mmaannaaggeemmeenntt aanndd ffoorr oonnwwaarrdd ssuubbmmiissssiioonn ttoo

GGoovveerrnnmmeenntt && ssttaattuuttoorryy aauutthhoorriittiieess.. NNoorrmmaall ttiimmee sshhaallll bbee 33

wwoorrkkiinngg ddaayyss aatt mmaaxx..

[[1111]] PPrroovviiddee iinnffoorrmmaattiioonn oonn bbeesstt iinntteerrnnaattiioonnaall pprraaccttiicceess bbeeiinngg ffoolllloowweedd

aaccrroossss tthhee gglloobbee ffoorr ggaass ppiippeelliinnee pprroojjeeccttss aass aanndd wwhheenn tthhee

iinnffoorrmmaattiioonn iiss ddeessiirreedd bbyy GGAAIILL ffoorr eeffffeeccttiivvee aanndd ttiimmeellyy PPrroojjeecctt

ccoommpplleettiioonn..

[[1122]] BBaasseedd oonn rreeqquuiirreemmeenntt tthhee PPMMCC sshhaallll ccoommee ffoorr mmeeeettiinnggss wwiitthh GGAAIILL

wwiitthhiinn tthhee sshhoorrtteesstt ppoossssiibbllee ttiimmee wwhheerreeiinn aapppprroopprriiaattee lleevveell ooff

ppeerrssoonn sshhaallll bbee ddeeppllooyyeedd..

88..33 PPrroojjeecctt MMoonniittoorriinngg aanndd ccoonnttrrooll::

TThhee PPMMCC sshhaallll aallssoo pprroovviiddee tthhee PPrroojjeecctt MMoonniittoorriinngg SSeerrvviicceess iinncclluuddiinngg tthhee

ffoolllloowwiinngg SSccooppee ooff WWoorrkk::

[[11]] PPrreeppaarraattiioonn ooff ddeettaaiilleedd PPrroojjeecctt SScchheedduullee..

[[22]] IIddeennttiiffiiccaattiioonn ooff aallll aaccttiivviittiieess ffaalllliinngg oonn tthhee ccrriittiiccaall ppaatthh ooff tthhee

PPrroojjeecctt..

[[33]] IIddeennttiiffiiccaattiioonn ooff aallll aaccttiivviittiieess rreeqquuiirriinngg cclloossee ccoo--oorrddiinnaattiioonn //

ssyynncchhrroonniizzaattiioonn..

[[44]] PPrreeppaarraattiioonn ooff aa llooookk--aahheeaadd mmooddeell // ccaattcchh--uupp ppllaann ffoorr tthhee PPrroojjeecctt

ffrroomm ttiimmee ttoo ttiimmee..

[[55]] GGeenneerraattiioonn ooff aallll pprroojjeecctt mmoonniittoorriinngg rreeppoorrttss ffoorr tthhee PPrroojjeecctt ddrraawwiinngg

aatttteennttiioonn ttoowwaarrddss ccrriittiiccaall jjoobbss,, aaccttiivviittiieess aanndd ffuunnccttiioonnss..

[[66]] IIddeennttiiffiiccaattiioonn ooff aallll aaccttiivviittiieess // sstteeppss rreeqquuiirreedd ffoorr eexxeeccuuttiioonn ooff tthhee

PPrroojjeecctt wwiitthhiinn aapppprroovveedd ccoosstt..

[[77]] IIddeennttiiffiiccaattiioonn ooff aallll aaccttiivviittiieess // sstteeppss rreeqquuiirreedd ffoorr eexxeeccuuttiioonn ooff tthhee

PPrroojjeecctt wwiitthhiinn ssttiippuullaatteedd ttiimmee..

[[88]] HHiigghhlliigghhtt ppiittffaallllss,, iiff aannyy,, ccaauusseedd bbyy tthhee PPrroojjeecctt CCoonnssuullttaanntt // aannyy

aaggeennccyy hhiinnddeerriinngg eeffffiicciieenntt eexxeeccuuttiioonn ooff tthhee pprroojjeecctt..

[[99]] MMoonniittoorriinngg ooff ccoonnttrraaccttoorr llooggiissttiiccss ffoorr ccoonnssttrruuccttiioonn..

[[1100]] GGeenneerraattiioonn ooff MMIISS rreeppoorrttss ffoorr tthhee PPrroojjeecctt,, aanndd iiddeennttiiffyy ccrriittiiccaall ppaatthh

oonn ffoorrttnniigghhttllyy bbaassiiss..

[[1111]] PPrroovviiddiinngg aallll iinnppuuttss // ppeerrffoorrmmiinngg aallll PPrroojjeecctt mmoonniittoorriinngg aaccttiivviittiieess aass

ddeessiirreedd bbyy tthhee GGAAIILL MMaannaaggeemmeenntt // PPrroojjeecctt--ggrroouupp ffrroomm ttiimmee ttoo ttiimmee

ffoorr ttiimmeellyy ccoommpplleettiioonn ooff tthhee PPrroojjeecctt..

[[1122]] CCaarrrryyiinngg oouutt qquuaalliittyy aauuddiittss aanndd IIddeennttiiffyyiinngg tthhee rroooott ccaauusseess ooff tthhee

pprroobblleemmss eennccoouunntteerreedd iinn ppiippeelliinnee ccoonnssttrruuccttiioonn aaccttiivviittiieess..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 92 of 154

[[1133]] IInn aaddddiittiioonn ttoo aabboovvee,, PPMMCC sshhaallll ddoo aallll aaccttiivviittiieess ttoo ddoo PPrroojjeecctt

MMoonniittoorriinngg SSeerrvviicceess eeffffiicciieennttllyy..

[[1144]] RRiisskk MMaannaaggeemmeenntt:: TThhee PPMMCC sshhoouulldd iiddeennttiiffyy aanndd eevvaalluuaattee tthhee

eexxeeccuuttiioonn rriisskkss aatt ddiiffffeerreenntt ssttaaggeess,, rreeccoommmmeenndd aanndd iimmpplleemmeenntt

aapppprroopprriiaattee rriisskk mmiittiiggaattiioonn mmeeaassuurreess.. TThheessee aarree ttoo bbee rreefflleecctteedd iinn

mmoonntthhllyy pprrooggrreessss rreeppoorrtt,, rreevviieeww mmeeeettiinnggss aanndd tthhrroouugghh ootthheerr

aapppprroopprriiaattee ccoommmmuunniiccaattiioonnss..

99.. CCOOMMMMIISSSSIIOONNIINNGG,, SSTTAARRTT--UUPP AANNDD PPEERRFFOORRMMAANNCCEE TTEESSTTSS::

99..11 MMeecchhaanniiccaall CCoommpplleettiioonn::

[[11]] AAtt aa ddaattee pprriioorr ttoo mmeecchhaanniiccaall ccoommpplleettiioonn ttoo bbee aaggrreeeedd wwiitthh OOwwnneerr,,

PPMMCC sshhaallll rreeccoommmmeenndd ttoo OOwwnneerr ffoorr aapppprroovvaall ooff tthhee OOppeerraattiinngg

MMaannuuaall pprreeppaarreedd bbyy PPMMCC..

[[22]] PPMMCC sshhaallll rreevviieeww aanndd rreeccoommmmeenndd ffoorr aapppprroovvaall ooff tthhee pprrooggrraamm,, aanndd

ssuuppeerrvviissee tthhee mmeecchhaanniiccaall ccoommpplleettiioonn wwoorrkk ppeerrffoorrmmeedd bbyy

ccoonnttrraaccttoorrss.. UUppoonn ssuucccceessssffuull ccoommpplleettiioonn ooff mmeecchhaanniiccaall ccoommpplleettiioonn

wwoorrkk,, PPMMCC sshhaallll rreevviieeww aanndd rreeccoommmmeenndd aapppprroovvaall ooff CCoonnssttrruuccttiioonn

CCoommpplleettiioonn CCeerrttiiffiiccaattee ddooccuummeennttaattiioonn..

[[33]] PPMMCC sshhaallll aapppprroovvee aass rreeqquuiirreedd aallll pprroocceedduurreess,, ppllaannss,, sscchheedduulleess aanndd

nneecceessssaarryy cceerrttiiffiiccaattiioonn ffoorr ccoonnssttrruuccttiioonn ccoommpplleettiioonn bbyy tthhee ootthheerr

ccoonnttrraaccttoorrss.. TThhee ccoonnssttrruuccttiioonn ccoommpplleettiioonn ooff iinnddiivviidduuaall sseeccttiioonnss ooff

tthhee PPrroojjeecctt sshhaallll bbee pprrooggrraammmmeedd iinn aaccccoorrddaannccee wwiitthh tthhee oovveerraallll

CCoommmmiissssiioonniinngg PPllaann..

[[44]] PPMMCC sshhaallll eennssuurree tthhaatt aallll nneecceessssaarryy ppeerrssoonnnneell ffrroomm eeqquuiippmmeenntt

ssuupppplliieerrss aarree ccaalllleedd ttoo aatttteenndd tthhee pprreeccoommmmiissssiioonniinngg aaccttiivviittiieess aass

pprroovviiddeedd ffoorr iinn tthhee EEqquuiippmmeenntt PPuurrcchhaassee OOrrddeerrss..

[[55]] PPMMCC sshhaallll pprreeppaarree ffoorr aapppprroovvaall bbyy OOwwnneerr aanndd iimmpplleemmeenntt aallll

nneecceessssaarryy pprroocceedduurreess ttoo eennssuurree ssaaffeettyy ooff ppeerrssoonnnneell wwoorrkkiinngg oonn

ccoonnssttrruuccttiioonn aaccttiivviittiieess aatt tthhee ssaammee ttiimmee aass ffiieelldd iinnssppeeccttiioonn,, tteessttiinngg

aanndd ccoommmmiissssiioonniinngg iiss iinn pprrooggrreessss..

[[66]] PPMMCC sshhaallll ssuuppeerrvviissee ccoonnttrraaccttoorrss,, wwoorrkk ssuucchh tthhaatt pphhaassee mmeecchhaanniiccaall

ccoommpplleettiioonn aanndd ccoommmmiissssiioonniinngg ttaakkeess ppllaaccee aass ddeetteerrmmiinneedd bbyy

OOwwnneerr''ss bbuussiinneessss nneeeeddss..

[[77]] IItt sshhaallll bbee oobblliiggaattoorryy oonn tthhee ppaarrtt ooff PPMMCC ttoo iissssuuee tthhee ""MMeecchhaanniiccaall

CCoommpplleettiioonn CCeerrttiiffiiccaattee""..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 93 of 154

99..22 CCoommmmiissssiioonniinngg aanndd SSttaarrtt--uupp::

[[11]] CCoommmmiissssiioonniinngg aanndd ssttaarrtt--uupp iiss ttoo bbee ccaarrrriieedd oouutt wwiitthh aassssiissttaannccee ffrroomm

ootthheerr ccoonnttrraaccttoorrss..

[[22]] UUppoonn OOwwnneerr''ss aapppprroovvaall ooff tthhee mmeecchhaanniiccaall ccoommpplleettiioonn ooff tthhee wwoorrkk,,

aanndd wwhheenn iitt iiss ddeeeemmeedd ssuuiittaabbllee bbyy OOwwnneerr,, tthheeccoommmmiissssiioonniinngg wwoorrkk

mmaayy ccoommmmeennccee aaccccoorrddiinngg ttoo tthhee ppllaannss aanndd sscchheedduulleess pprreeppaarreedd bbyy

PPMMCC..

[[33]] PPMMCC sshhaallll ssuubbmmiitt CCoommmmiissssiioonniinngg PPrroocceedduurree,, oorrggaanniizzee aa ssttaarrtt--uupp

tteeaamm ttoo ssuuppeerrvviissee aanndd mmoonniittoorr tthhee ccoommmmiissssiioonniinngg,, ssttaarrttuupp,,

ppeerrffoorrmmaannccee tteesstt aanndd iinniittiiaall ooppeerraattiioonn ooff tthhee ffaacciilliittiieess ccoonnssiissttiinngg ooff

rreepprreesseennttaattiivvee ooff OOwwnneerr''ss ooppeerraattiinngg ppeerrssoonnnneell,, eeqquuiippmmeenntt ssuupppplliieerrss,,

PPMMCC aanndd ccoonnttrraaccttoorrss aanndd sshhaallll eennssuurree tthhaatt tthhee ccoonnttrraaccttoorrss pprroovviiddee

ssuuffffiicciieenntt nnuummbbeerrss ooff sskkiilllleedd llaabboouurr tthhaatt iiss nneeeeddeedd ttoo ccoommpplleemmeenntt tthhee

OOwwnneerr''ss ssttaarrttuupp ppeerrssoonnnneell aanndd ttoo ppeerrffoorrmm aallll aaccttiivviittiieess wwhhiicchh iinncclluuddee

tthhee rruunnnniinngg oorr ooppeerraattiioonn ooff aallll eeqquuiippmmeennttss..

[[44]] PPMMCC sshhaallll eennssuurree tthhaatt tthhee ccoonnttrraaccttoorr pprroovviiddee ssuuffffiicciieenntt mmaannppoowweerr,,

ssppeecciiaall ttoooollss aanndd ssppaarree ppaarrttss nneecceessssaarryy ffoorr tthhee ccoommmmiissssiioonniinngg

aaccttiivviittiieess wwiillll,, aass aa mmiinniimmuumm iinncclluuddee::

●● OOppeerraattiioonnaall tteessttiinngg..

●● PPrree--ssttaarrttuupp iinnssppeeccttiioonnss..

●● FFiilllliinngg ooff lluubbrriiccaannttss,, wwhheerreevveerr nneecceessssaarryy..

●● EEqquuiippmmeenntt ooppeerraattiioonn ttoo mmaakkee vviibbrraattiioonn aanndd ssaaffeettyy ddeevviiccee

cchheecckkss,, aanndd ootthheerr rreeqquuiirreedd ooppeerraattiinngg tteessttss aanndd aaddjjuussttmmeennttss..

●● FFlluusshhiinngg,, bblloowwiinngg aanndd cchheemmiiccaall cclleeaanniinngg..

●● IInnssttaallllaattiioonn ooff tteemmppoorraarryy ssccrreeeennss,, ssttrraaiinneerrss aanndd bblliinnddss..

●● NNeecceessssaarryy ppuurrggee ooppeerraattiioonnss,, iinncclluuddiinngg iinnssttaallllaattiioonn ooff tteemmppoorraarryy

ppuurrggee ppiippiinngg,, hhoosseess oorr eeqquuiippmmeenntt ccoonnnneeccttiioonnss..

●● CChheecckkiinngg ooff bboorreess ooff oorriiffiiccee ppllaatteess aanndd iinnssttaalllliinngg tthheessee ppllaatteess

aafftteerr fflluusshhiinngg ooppeerraattiioonnss..

●● FFuunnccttiioonnaall cchheecckk oonn aallll iinnssttrruummeennttss aanndd ccoonnttrroolllleerrss,, iinnssttrruummeenntt

ccaalliibbrraattiioonnss wwiitthh ssttaannddaarrdd tteesstt..

●● EEqquuiippmmeenntt aanndd aallll rreeqquuiirreedd aaddjjuussttmmeennttss aanndd ccoonnttrrooll ppooiinntt

sseettttiinnggss..

●● CChheecckk aallll iinnssttrruummeenntt llooooppss ffoorr pprrooppeerr ffuunnccttiioonniinngg..

●● CChheecckkss aallll ppiippee ssuuppppoorrttss,, aanndd gguuiiddeess ffoorr sseettttiinnggss hhoott // ccoolldd aanndd

nneecceessssaarryy aaddjjuussttmmeennttss..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 94 of 154

●● CChheecckkiinngg aanndd rreeccoorrddiinngg ppoossiittiioonnss ooff aallll vvaallvveess..

●● CCoonndduucctt ssiimmuullaattiioonn rruunnss ttoo aallllooww rruunn--iinn ooppeerraattiioonnaall tteessttiinngg ooff

tthhee eeqquuiippmmeenntt..

[[55]] PPMMCC sshhaallll eennssuurree tthhaatt aallll ddeeffeeccttss aanndd ddeeffiicciieenncciieess ffoouunndd dduurriinngg tthhee

ccoouurrssee ooff ccoommmmiissssiioonniinngg sshhaallll bbee rreeccttiiffiieedd bbyy tthhee ccoonnttrraaccttoorrss..

[[66]] PPMMCC sshhaallll ssuuppeerrvviissee aanndd mmoonniittoorr aallll ccoommmmiissssiioonniinngg aanndd ssttaarrtt--uupp

aaccttiivviittiieess aanndd aallll ppeerrffoorrmmaannccee tteesstt--rruunnss wwhhiicchh wwiillll bbee ccaarrrriieedd oouutt bbyy

tthhee ccoonnttrraaccttoorrss.. AAllll ppeerrffoorrmmaannccee tteesstt rreessuullttss sshhaallll bbee rreevviieewweedd aanndd

cceerrttiiffiieedd bbyy PPMMCC..

[[77]] PPMMCC sshhaallll rreeppoorrtt ttoo OOwwnneerr oonn aa wweeeekkllyy bbaassiiss oonn tthhee pprrooggrreessss aanndd

ssttaattuuss ooff ccoommmmiissssiioonniinngg aanndd ssttaarrttuupp wwoorrkk..

[[88]] PPMMCC sshhaallll eennssuurree tthhaatt aallll ccoommmmiissssiioonniinngg rreeccoorrddss aanndd lloogg--sshheeeettss aarree

pprrooppeerrllyy ccoollllaatteedd aanndd ssuubbmmiitttteedd ttoo OOwwnneerr aass ppaarrtt ooff ccoonnttrraaccttoorrss''

MMeecchhaanniiccaall CCoommpplleettiioonn CCeerrttiiffiiccaattee aapppprroovvaall ddooccuummeennttss aanndd

pprroovviissiioonnaall aacccceeppttaannccee ddooccuummeennttss aass rreelleevvaanntt..

[[99]] IItt sshhaallll bbee oobblliiggaattoorryy oonn tthhee ppaarrtt ooff PPMMCC ttoo iissssuuee tthhee ""CCoommmmiissssiioonniinngg

CCeerrttiiffiiccaattee""..

99..33 [[AA]] FFaaccttoorryy AAcccceeppttaannccee TTeessttss::

PPMMCC sshhaallll wwiittnneessss && cceerrttiiffyy tthhee FFaaccttoorryy AAcccceeppttaannccee TTeessttss ((FFAATT)) iinn tthhee

pprreemmiisseess ooff ccoonnttrraaccttoorr ffoorr TTeelleeccoomm,, SSCCAADDAA && AAPPPPSS,, IInnssttrruummeennttaattiioonn ssyysstteemm,,

CCPP ssyysstteemm,, eettcc.. wwhhiicchh wwiillll bbee ccaarrrriieedd oouutt bbyy tthhee rreessppeeccttiivvee ccoonnttrraaccttoorrss..

[[BB]] SSiittee AAcccceeppttaannccee TTeessttss::

RReessppeeccttiivvee ccoonnttrraaccttoorrss sshhaallll ccaarrrryy oouutt tthhee SSiittee AAcccceeppttaannccee TTeessttss ((SSAATT)) ooff

TTeelleeccoomm,, SSCCAADDAA && AAPPPPSS,, IInnssttrruummeennttaattiioonn ssyysstteemm,, CCPP ssyysstteemm,, eettcc.. sshhaallll bbee

wwiittnneesssseedd && cceerrttiiffiieedd bbyy PPMMCC aatt ssiittee..

1100.. PPRROOJJEECCTT DDOOCCUUMMEENNTTSS // CCOOMMPPLLEETTIIOONN // CCLLOOSSEEOOUUTT RREEPPOORRTT::

CCoonnsseeqquueenntt uuppoonn tthhee ssuucccceessssffuull ccoommpplleettiioonn aanndd ccoommmmiissssiioonniinngg ooff tthhee pprroojjeecctt

tthhee PPMMCC sshhaallll bbee rreessppoonnssiibbllee ffoorr tthhee ffoolllloowwiinngg::

((ii)) FFoollllooww uupp wwiitthh vveennddoorrss aanndd ccoonnttrraaccttoorrss ffoorr aass--bbuuiilltt ddrraawwiinnggss //

ddooccuummeennttss iinn rreeqquuiirreedd ssooffttwwaarree aanndd hhaarrddccooppyy ffoorrmmaatt,, rreevviieeww //

aapppprroovvee tthhee ssaammee aanndd ffoorrwwaarrdd GGAAIILL..

((iiii)) SSuubbmmiissssiioonn ooff aallll PPrroojjeecctt--rreellaatteedd ddooccuummeennttss ttoo GGAAIILL ffoorr ffuuttuurree

rreeffeerreennccee aanndd rreeccoorrddss aass ppeerr ssttaannddaarrdd iinntteerrnnaattiioonnaall pprraaccttiiccee..

SSuubbmmiissssiioonn ooff ffiinnaall ddooccuummeennttss sshhaallll bbee uunnddeerr tthhee ffoolllloowwiinngg hheeaaddss::

((aa)) AAss--bbuuiilltt DDrraawwiinnggss..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 95 of 154

((bb)) DDeettaaiilleedd OOppeerraattiinngg MMaannuuaall hhiigghhlliigghhttiinngg rreeccoommmmeennddaattiioonnss ooff

tthhee EEIIAA,, HHAAZZOOPP SSttuuddyy && RRiisskk AAnnaallyyssiiss,, eettcc..

((cc)) PPrroobblleemmss ffaacceedd dduurriinngg tthhee pprroojjeecctt eexxeeccuuttiioonn aanndd mmiittiiggaattiioonn

mmeeaassuurreess ttaakkeenn iinn ffuuttuurree..

((iiiiii)) SSuubbmmiissssiioonn ooff aallll eevvaalluuaattiioonn sshheeeettss ooff ppeerrffoorrmmaannccee ffoorr aallll vveennddoorrss,,

ccoonnttrraaccttss iinn lliinnee wwiitthh eessttaabblliisshheedd pprroocceedduurreess ttoo wwhhoomm oorrddeerrss wweerree

ppllaacceedd..

((iivv)) HHaarrdd && ssoofftt ccooppiieess ooff PPrroojjeecctt CClloosseeoouutt RReeppoorrtt iinnccoorrppoorraattiinngg tthhee

ffoolllloowwiinngg::

((aa)) PPrroojjeecctt BBrriieeff

((bb)) PPiippeelliinnee LLiinnee DDiiaaggrraamm

((cc)) CChhrroonnoollooggyy ooff AApppprroovvaallss

((dd)) PPMMCC HHeeaadd OOffffiiccee && SSiittee OOffffiiccee OOrrggaannooggrraamm

((ee)) NNaammeess ooff PPMMCC PPeerrssoonnnneell wwoorrkkiinngg ffoorr tthhee pprroojjeecctt aalloonngg wwiitthh aallll

ccoonnttaacctt ddeettaaiillss..

((ff)) PPiippeelliinnee CCoonnffiigguurraattiioonn aanndd SSpprreeaadd DDeettaaiillss..

((gg)) DDeettaaiillss ooff vvaarriioouuss TTyyppeess ooff CCrroossssiinnggss..

((hh)) NNaammeess ooff SSttaannddaarrddss rreeffeerrrreedd aanndd uusseedd iinn DDeessiiggnn && EEnnggiinneeeerriinngg

ffoorr vvaarriioouuss IItteemmss,, CCoonnssttrruuccttiioonn,, IInnssppeeccttiioonn..

((ii)) WWBBSS--eelleemmeenntt wwiissee ""SS"" CCuurrvvee aanndd OOvveerraallll PPhhyyssiiccaall PPrrooggrreessss

CCuurrvvee

((jj)) LLiisstt ooff KKeeyy MMiilleessttoonneess aanndd ddaattee ooff aaccttuuaall aacchhiieevveemmeenntt..

((kk)) LLiisstt ooff PPOO''ss // WWOO''ss,, iinncclluuddiinngg VVeennddoorr''ss nnaammee aanndd ccoonnttaacctt

ddeettaaiillss..

((ll)) EExxppeerriieennccee ggaaiinneedd dduurriinngg PPrroojjeecctt EExxeeccuuttiioonn aanndd iimmpprroovveemmeennttss

ffoorr ffuuttuurree pprroojjeeccttss..

((mm)) CCoonnssttrruuccttiioonn PPhhoottooggrraapphhss..

1111.. CCOONNSSUULLTTAANNTT’’SS MMAANNPPOOWWEERR

1111..11 TThhee CCoonnssuullttaanntt sshhaallll ddeeppllooyy rreeqquuiirreedd nnuummbbeerr ooff mmaannppoowweerr,, qquuaalliiffiieedd aanndd

eexxppeerriieenncceedd ppeerrssoonnnneell ee..gg.. pprrooffeessssiioonnaall eennggiinneeeerrss,, ssuubboorrddiinnaattee eennggiinneeeerriinngg

ppeerrssoonnnneell,, ccoonnssttrruuccttiioonn ssuuppeerrvviissoorrss,, iinnssppeeccttoorrss aanndd ootthheerr ssppeecciiaalliissttss ooff

aapppprroopprriiaattee lleevveellss ttoo eennssuurree::

•• QQuuaalliittyy iinn aallll ssttaaggeess aanndd aassppeeccttss aass ppeerr rreeqquuiirreemmeenntt ooff ccooddeess,,

ssttaannddaarrddss,, ssppeecciiffiiccaattiioonnss aanndd bbeesstt iinntteerrnnaattiioonnaall pprraaccttiicceess..

•• TTiimmeellyy && eexxppeeddiittiioouuss ccoommpplleettiioonn ooff tthhee pprroojjeecctt..

•• EEccoonnoommiizzee pprroojjeecctt eexxppeennsseess..

1111..22 QQuuaalliiffiiccaattiioonn aanndd eexxppeerriieennccee rreeqquuiirreemmeenntt ooff tthhee ccoonnssuullttaanntt ppeerrssoonnnneell aarree

ggiivveenn hheerreeuunnddeerr aatt CCllaauussee 1111..44..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 96 of 154

1111..33 TThhee ccoonnssuullttaanntt sshhaallll ssuubbmmiitt tthhee ffoolllloowwiinngg ffoorr aapppprroovvaall ooff tthhee oowwnneerr aafftteerr

aawwaarrdd ooff aaggrreeeemmeenntt

__ OOrrggaannooggrraamm aatt PPrroojjeecctt –– HHOO && SSiittee

__ MMaannnniinngg SScchheedduullee

1111..44 TThhee PPMMCC wwiillll bbee rreeqquuiirreedd ttoo ddeeppuuttee qquuaalliiffiieedd,, eexxppeerriieenncceedd mmaannppoowweerr ffoorr tthhee

eexxeeccuuttiioonn ooff tthhee PPrroojjeecctt.. TThhee ccoonnssuullttaanntt wwiillll eennssuurree tthhaatt tthhee ccoommpplleettee

mmaannppoowweerr wwhhoossee nnaammeess hhaavvee bbeeeenn pprrooppoosseedd ttoo bbee ddeeppllooyyeedd ffoorr tthhee PPrroojjeecctt

eexxeeccuuttiioonn aatt tthhee ttiimmee ooff ssuubbmmiissssiioonn ooff tthhee bbiiddss aarree nnoott cchhaannggeedd dduurriinngg PPrroojjeecctt

eexxeeccuuttiioonn.. IInn ccaassee ooff cchhaannggee iinn pprrooppoosseedd ppeerrssoonnnneell,, tthhee PPMMCC wwiillll ssuubbmmiitt bbiioo

ddaattaa ooff tthhee ssuubbssttiittuuttee mmaannppoowweerr pprrooppoosseedd aanndd ttaakkee GGAAIILL''ss aapppprroovvaall.. TThhee

vvaarriioouuss ccaatteeggoorriieess ooff mmaannppoowweerr rreeqquuiirreedd ttoo bbee ddeeppllooyyeedd ffoorr tthhee PPrroojjeecctt aarree

ddeettaaiilleedd uunnddeerr::

SSll.. TTyyppee QQuuaall ii ff iiccaatt iioonn && kknnoowwlleeddggee EExxppeerriieennccee

[[11]] PPrroojjeecctt

MMaannaaggeerr

•• DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn aannyy

DDiisscciipplliinnee

•• KKnnoowwlleeddggee ooff PPrroojjeecctt

MMaannaaggeemmeenntt,, CCoonnttrraaccttss

MMaannaaggeemmeenntt,, CCooddeess aanndd

SSttaannddaarrddss ppeerrttaaiinniinngg ttoo ggaass

ppiippeelliinneess,, IInndduussttrryy aacccceepptteedd

BBeesstt PPrraaccttiicceess iinn eexxeeccuuttiinngg

ppiippeelliinnee pprroojjeeccttss,,

GGoovveerrnnmmeenntt GGuuiiddeelliinneess

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss

eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn

HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn

PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn //

CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall PPllaanntt,,

LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122

yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss''

eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn

eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee

pprroojjeeccttss..

[[22]] AAssssiissttaanntt //

DDeeppuuttyy

PPrroojjeecctt

MMaannaaggeerr

•• DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn aannyy

DDiisscciipplliinnee

•• KKnnoowwlleeddggee ooff PPrroojjeecctt

MMaannaaggeemmeenntt,, CCoonnttrraaccttss

MMaannaaggeemmeenntt,, CCooddeess aanndd

SSttaannddaarrddss ppeerrttaaiinniinngg ttoo ggaass

ppiippeelliinneess,, IInndduussttrryy aacccceepptteedd

BBeesstt PPrraaccttiicceess iinn eexxeeccuuttiinngg

ppiippeelliinnee pprroojjeeccttss..

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss

eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn

HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn

PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn //

CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall PPllaanntt,,

LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100

yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss''

eexxppeerriieennccee mmuusstt bbee iinn eexxeeccuuttiioonn ooff

hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss

[[33]] CCoonnttrraaccttss

MMaannaaggeerr

•• DDeeggrreeee // DDiipplloommaa // MMBBAA iinn

CCoonnttrraaccttss MMaannaaggeemmeenntt //

DDeeggrreeee iinn EEnnggiinneeeerriinngg

KKnnoowwlleeddggee ooff PPrrooccuurreemmeenntt

&& CCoonnttrraaccttss ffoorr ggooooddss

rreellaatteedd ttoo hhyyddrrooccaarrbboonn

iinndduussttrryy,, ppiippeelliinneess

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss

eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn

HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn

PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn

// CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall

PPllaanntt,, LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 97 of 154

•• KKnnoowwlleeddggee ooff rreegguullaattiioonnss,,

nnoottiiffiiccaattiioonnss,, aaccttss ppeerrttaaiinniinngg

ttoo pprrooccuurreemmeenntt ooff ggooooddss,,

wwoorrkkss ccoonnttrraacctt,, llooccaall ttaaxx

ssttrruuccttuurree,, ssttoorreess

mmaannaaggeemmeenntt,, eettcc..

yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss''

eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn

eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ppiippeelliinnee

pprroojjeeccttss..

[[44]] PPllaannnniinngg

MMaannaaggeerr

•• DDeeggrreeee // DDiipplloommaa iinn

EEnnggiinneeeerriinngg // PPrroojjeecctt

MMaannaaggeemmeenntt..

•• KKnnoowwlleeddggee ooff PPllaannnniinngg &&

SScchheedduulliinngg ffoorr pprroojjeeccttss

rreellaatteedd ttoo hhyyddrrooccaarrbboonn

iinndduussttrryy,, ppiippeelliinneess..

•• KKnnoowwlleeddggee ooff vvaarriioouuss

aaccttiivviittiieess rreellaatteedd ttoo

eexxeeccuuttiioonn ooff ppiippeelliinnee

pprroojjeeccttss..

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 88 yyeeaarrss

eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn

HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn

PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn

// CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall

PPllaanntt,, LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 88

yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 44 yyeeaarrss''

eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn

eexxeeccuuttiioonn ooff hhyyddrrooccaarrbboonn ggaass ppiippeelliinnee

pprroojjeeccttss..

[[55]] EEnnggiinneeeerriinngg

MMaannaaggeerr

•• DDeeggrreeee // DDiipplloommaa iinn aannyy

ddiisscciipplliinnee ooff EEnnggiinneeeerriinngg..

•• KKnnoowwlleeddggee ooff aallll ssttaannddaarrddss,,

ccooddeess rreeqquuiirreedd ffoorr tthhee

ddeessiiggnn aanndd eennggiinneeeerriinngg ooff

ppiippeelliinnee pprroojjeeccttss..

•• KKnnoowwlleeddggee ooff mmaatteerriiaallss aanndd

mmeettaalllluurrggiiccaall pprrooppeerrttiieess ffoorr

mmaatteerriiaallss uusseedd iinn ppiippeelliinnee

pprroojjeeccttss..

•• KKnnoowwlleeddggee ooff IInndduussttrryy

aacccceepptteedd BBeesstt PPrraaccttiicceess iinn

ddeessiiggnniinngg && eennggiinneeeerriinngg

ppiippeelliinnee pprroojjeeccttss..

•• KKnnoowwlleeddggee ooff wwoorrkkiinngg iinn

ssooffttwwaarree ttoooollss rreellaatteedd ttoo

ssyysstteemm ssiizziinngg,, ssyysstteemm

ooppttiimmiizzaattiioonn,, ssiimmuullaattiioonn,,

eennggiinneeeerriinngg,, eettcc..

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss

eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn

HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn

PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn

//CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall PPllaanntt,,

LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122

yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss''

eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn

ddeessiiggnn && eennggiinneeeerriinngg ooff HHyyddrrooccaarrbboonn

ppiippeelliinnee pprroojjeeccttss..

[[66]] FFiinnaannccee

MMaannaaggeerr

•• GGrraadduuaattee iinn CCoommmmeerrccee //

IICCWWAA // CCAA // MMBBAA iinn

FFiinnaannccee

•• KKnnoowwlleeddggee ooff aacctt // rruulleess //

rreegguullaattiioonnss// nnoottiiffiiccaattiioonnss

ppeerrttaaiinniinngg ttoo FFiinnaanncciiaall

MMaannaaggeemmeenntt ii..ee.. ttaaxxeess &&

OOvveerraallll EExxppeerriieennccee:: 1100 yyeeaarrss ooff rreelleevvaanntt

eexxppeerriieennccee..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 98 of 154

dduuttiieess

•• KKnnoowwlleeddggee ooff ttaaxx // dduuttyy

ssttrruuccttuurree ffoorr iinnddiiggeennoouuss &&

iimmppoorrtteedd pprrooccuurreemmeenntt..

[[77]] CCoonnssttrruuccttiioonn

MMaannaaggeerr

•• DDeeggrreeee iinn EEnnggiinneeeerriinngg iinn

aannyy DDiisscciipplliinnee // DDiipplloommaa iinn

PPrroojjeecctt MMaannaaggeemmeenntt

•• KKnnoowwlleeddggee ooff PPrroojjeecctt

MMaannaaggeemmeenntt,, CCoonnssttrruuccttiioonn

MMaannaaggeemmeenntt,, hhaannddlliinngg ooff

CCoonnttrraaccttss,, CCooddeess aanndd

SSttaannddaarrddss ppeerrttaaiinniinngg ttoo

ccoonnssttrruuccttiioonn ooff ggaass

ppiippeelliinneess,, IInndduussttrryy aacccceepptteedd

BBeesstt PPrraaccttiicceess iinn eexxeeccuuttiinngg

ppiippeelliinnee pprroojjeeccttss..

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1122 yyeeaarrss

eexxppeerriieennccee iinn eexxeeccuuttiinngg pprroojjeeccttss iinn

HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee.. HHyyddrrooccaarrbboonn

PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn //

CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall PPllaanntt,,

LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1122

yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 66 yyeeaarrss''

eexxppeerriieennccee mmuusstt bbee iinn sseenniioorr ppoossiittiioonn iinn

wwoorrkkss rreellaatteedd ttoo ccoonnssttrruuccttiioonn ooff

hhyyddrrooccaarrbboonn ppiippeelliinnee pprroojjeeccttss..

[[88]] IInnssppeeccttiioonn

MMaannaaggeerr

•• DDeeggrreeee // DDiipplloommaa iinn

EEnnggiinneeeerriinngg iinn aannyy

DDiisscciipplliinnee aalloonngg wwiitthh AANNSSTT

// IINNSSTT LLeevveell IIII // IIIIII

cceerrttiiffiiccaattiioonn..

•• KKnnoowwlleeddggee ooff ccooddeess //

ssttaannddaarrddss ffoorr mmaannuuffaaccttuurriinngg

aanndd iinnssppeeccttiioonn ooff lliinnee

mmaatteerriiaallss ffoorr ppiippeelliinnee

pprroojjeeccttss..

OOvveerraallll EExxppeerriieennccee:: AAtt lleeaasstt 1100 yyeeaarrss

eexxppeerriieennccee iinn eexxeeccuuttiioonn ooff pprroojjeeccttss //

iinnssppeeccttiioonn iinn HHyyddrrooccaarrbboonn IInndduussttrryy,, ii..ee..

HHyyddrrooccaarrbboonn PPrroocceessss PPllaannttss,, PPiippeelliinneess

((HHyyddrrooccaarrbboonn // CCrruuddee // OOiill // GGaass)),,

PPeettrroocchheemmiiccaall PPllaanntt,, LLPPGG PPllaanntt,,

RReeffiinneerryy,, eettcc..

MMaannddaattoorryy EExxppeerriieennccee:: OOuutt ooff tthhee 1100

yyeeaarrss eexxppeerriieennccee,, aatt lleeaasstt 55 yyeeaarrss''

eexxppeerriieennccee mmuusstt bbee iinn iinnssppeeccttiioonn wwoorrkkss

rreellaatteedd ttoo ppiippeelliinnee mmaatteerriiaallss // ppiippeelliinnee

ccoonnssttrruuccttiioonn..

TThhee ssuuppppoorrttiinngg ssttaaffff // mmaannppoowweerr uunnddeerr eeaacchh ttyyppee mmuusstt hhaavvee tthhee wwoorrkkiinngg

eexxppeerriieennccee ooff aatt lleeaasstt 77 yyeeaarrss iinn HHyyddrrooccaarrbboonn IInndduussttrryy ii..ee.. HHyyddrrooccaarrbboonn

PPrroocceessss PPllaannttss,, PPiippeelliinneess ((HHyyddrrooccaarrbboonn // CCrruuddee // OOiill // GGaass)),, PPeettrroocchheemmiiccaall

PPllaanntt,, LLPPGG PPllaanntt,, RReeffiinneerryy,, eettcc.. oouutt ooff wwhhiicchh aatt lleeaasstt 33 yyeeaarrss'' eexxppeerriieennccee mmuusstt

bbee iinn tthhee rreelleevvaanntt wwoorrkkiinngg aarreeaa..

1111..55 FFoorr tthhee ppiippeelliinnee ccoonnssttrruuccttiioonn aaccttiivviittiieess tthhee iinnddiiccaattiivvee ssttrruuccttuurree ooff mmaannppoowweerr

ttoo bbee ddeeppllooyyeedd bbyy tthhee PPMMCC ffoorr ooppttiimmaall wwoorrkk oouuttppuutt iiss aass uunnddeerr::

1111..55..11 PPiippeelliinnee LLaayyiinngg aanndd TTeerrmmiinnaall WWoorrkkss::

PPiippeelliinnee LLaayyiinngg iiss aa SSppeecciiaalliizzeedd JJoobb wwhheerreeiinn lloott ooff rreessoouurrccee

iinncclluuddiinngg mmaannppoowweerr aanndd eeqquuiippmmeenntt hhaass ttoo bbee mmoobbiilliizzeedd bbeeffoorree tthhee

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 99 of 154

aaccttuuaall ffrroonntt eenndd aaccttiivviittiieess ssttaarrttss.. TThhee ffoolllloowwiinngg aaccttiivviittiieess aarree

iinnvvoollvveedd iinn llaayyiinngg wwoorrkkss::

[[11]] RROOUU AAccqquuiissiittiioonn

[[22]] SSttrriinnggiinngg

[[33]] TTrreenncchhiinngg

[[44]] WWeellddiinngg

[[55]] JJooiinntt CCooaattiinngg

[[66]] LLoowweerriinngg && BBaacckkffiilllliinngg

[[77]] TTiiee--IInn

[[88]] HHyyddrroo--tteessttiinngg

[[99]] DDrryyiinngg,, PPiiggggiinngg,, GGaass--IInn

[[1100]] AAtttteennddiinngg aanndd lliiqquuiiddaattiinngg cchheecckk lliisstt ppooiinnttss

1111..55..22 TTeerrmmiinnaall WWoorrkkss::

FFoorr TTeerrmmiinnaall WWoorrkkss ffoolllloowwiinngg aaccttiivviittiieess aarree nnoorrmmaallllyy ccaarrrriieedd oouutt,,

bbuutt nnoott lliimmiitteedd ttoo ffoolllloowwiinngg::

[[11]] SSiittee GGrraaddiinngg..

[[22]] CCiivviill WWoorrkkss aanndd CCoonnssttrruuccttiioonn AAccttiivviittiieess..

[[33]] IInnssttaallllaattiioonn ooff GGaass MMeetteerriinngg SSyysstteemm,, PPCCVV''ss,, SSDDVV''ss,, FFiillttrraattiioonn

SSyysstteemm,, GGaass CChhrroommaattooggrraapphh..

[[44]] WWoorrkkss ppeerrttaaiinniinngg ttoo iinnssttaallllaattiioonn ooff MMeecchhaanniiccaall EEqquuiippmmeennttss //

TTeelleeccoomm // SSCCAADDAA ssyysstteemm..

[[55]] WWoorrkkss ppeerrttaaiinniinngg ttoo EElleeccttrriiccaall aanndd IInnssttrruummeennttaattiioonn..

[[66]] TTeessttiinngg && ccoommmmiissssiioonniinngg..

TThhee PPMMCC hhaass ttoo mmaaiinnttaaiinn mmiinniimmuumm 0022 nnooss.. ooff mmaannppoowweerr aatt ccoonnssttrruuccttiioonn

ssiittee ffoorr bbootthh mmaaiinnlliinnee aanndd ssttaattiioonn wwoorrkkss aatt aallll ttiimmee aatt ssiittee..

IINNDDIICCAATTIIVVEE SSIITTEE OORRGGAANNIIZZAATTIIOONN CCHHAARRTT FFOORR PPMMCC MMAANNPPOOWWEERR

PPrroojjeecctt IInn--CChhaarrggee

RROOUU

SSttrriinnggiinngg

TTrreenncchhiinngg

WWeellddiinngg &&

NNDDTT

JJooiinntt CCooaattiinngg

LLoowweerriinngg

BBaacckkffiilllliinngg

TTiiee--iinn

HHyyddrrootteessttiinngg

DDrryyiinngg--ppiiggggiinngg

GGaass iinn

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 100 of 154

11 nnuummbbeerr ooff

qquuaalliiffiieedd

ccoonnssttrruuccttiioonn

mmaannppoowweerr

22 nnuummbbeerrss ooff

qquuaalliiffiieedd

mmaannppoowweerr ffoorr

ssuuppeerrvviissiioonn

22 nnuummbbeerrss ooff

qquuaalliiffiieedd

ccoonnssttrruuccttiioonn

mmaannppoowweerr

22 nnuummbbeerrss ooff

qquuaalliiffiieedd

ccoonnssttrruuccttiioonn

mmaannppoowweerr

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 101 of 154

PPMMCC MMAANNPPOOWWEERR EESSTTIIMMAATTEESS -- MMaaiinnlliinnee

SSll.. TTyyppee AAccttiivviittyy CCoonnssuullttaanntt

[[11]] FFrroonntt--EEnndd

AAccttiivviittiieess

RROOUU OOppeenniinngg 0011

[[22]] SSttrriinnggiinngg

[[33]] TTrreenncchhiinngg

[[44]] WWeellddiinngg 0022

[[55]] BBaacckk--EEnndd

AAccttiivviittiieess

JJooiinntt CCooaattiinngg 0022

[[66]] LLoowweerriinngg &&

BBaacckkffiilllliinngg

[[77]] TTiiee--IInn 0044**

[[88]] HHyyddrroo--tteessttiinngg

[[99]] DDrryyiinngg,, PPiiggggiinngg,, GGaass

IInn

[[1100]] SSCCAADDAA // TTeelleeccoomm

[[1111]] CCaatthhooddiicc PPrrootteeccttiioonn

[[1122]] SSuubb--ttoottaall 0099

[[1133]] OOppeenniinngg // SSpprreeaadd IInn--cchhaarrggee 0011

[[1144]] TTOOTTAALL 1100

NNoottee:: ** -- FFrroonntt eenndd ppeerrssoonnss mmaayy bbee rreeddeeppllooyyeedd,, iiff aaccttiivviittiieess aarree nnoott ssiimmuullttaanneeoouuss..

PPMMCC MMAANNPPOOWWEERR EESSTTIIMMAATTEESS -- TTeerrmmiinnaall

SSll.. AAccttiivviittyy CCoonnssuullttaanntt

MMaannppoowweerr

[[11]] CCiivviill WWoorrkkss aanndd CCoonnssttrruuccttiioonn

AAccttiivviittiieess

0011

[[22]] TTeerrmmiinnaall wweellddiinngg wwoorrkkss ––

ffaabbrriiccaattiioonn aanndd eerreeccttiioonn

0011

TThhee CCoonnssuullttaanntt sshhaallll ssuubbmmiitt tthhee ffoolllloowwiinngg aalloonngg wwiitthh tthhee BBiidd DDooccuummeenntt::

[[11]] BBiioo--DDaattaa ooff tthhee KKeeyy ppeerrssoonnnneell aanndd tthheeiirr eexxppeerriieennccee vviizz.. PPrroojjeecctt

MMaannaaggeerr,, EEnnggiinneeeerriinngg MMaannaaggeerr,, CCoonnssttrruuccttiioonn MMaannaaggeerr,, PPllaannnniinngg

MMaannaaggeerr,, IInnssppeeccttiioonn MMaannaaggeerr,, CCoonnttrraaccttss MMaannaaggeerr mmuusstt bbee eenncclloosseedd

aalloonngg wwiitthh tthhee bbiidd..

[[22]] SSuubbssttiittuuttiinngg ooff PPMMCC''ss ppeerrssoonnnneell wwiitthh ootthheerr PPMMCC''ss ppeerrssoonnnneell wwiillll bbee

ddoonnee wwiitthh eeiitthheerr ssaammee lleevveell && eexxppeerriieennccee oorr hhiigghheerr lleevveell &&

eexxppeerriieenncceedd ppeerrssoonnnneell..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 102 of 154

[[33]] TThhee PPMMCC hhaass ttoo mmaaiinnttaaiinn mmiinniimmuumm 0022 nnooss.. ooff mmaannppoowweerr aatt

ccoonnssttrruuccttiioonn ssiittee ffoorr bbootthh mmaaiinnlliinnee aanndd ssttaattiioonn wwoorrkkss.. IInn oorrddeerr ttoo

eexxppeeddiittee pprrooggrreessss,, wwiitthhiinn tthhee ssaammee ssccooppee ooff wwoorrkk,, PPMMCC mmaayy bbee

rreeqquuiirreedd ttoo aauuggmmeenntt wwiitthh mmoorree mmaannppoowweerr wwiitthhoouutt aannyy aaddddiittiioonnaall

ffiinnaanncciiaall iimmpplliiccaattiioonnss ttoo GGAAIILL..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 103 of 154

1122.. PPRROOJJEECCTT EEXXEECCUUTTIIOONN MMEETTHHOODDOOLLOOGGYY

1122..11 TThhee PPMMCC wwiillll bbee rreeqquuiirreedd ttoo pprreeppaarree aann EExxeeccuuttiioonn MMeetthhooddoollooggyy ffoorr eexxeeccuuttiinngg

tthhee ppiippeelliinnee PPrroojjeecctt wwiitthh tthhee aaiimm ttoo eexxeeccuuttee tthhee PPrroojjeecctt iinn sscchheedduullee ttiimmee,,

eeccoonnoommiizzee tthhee PPrroojjeecctt ccoosstt aanndd eexxeeccuuttee tthhee PPrroojjeecctt iinn tthhee mmoosstt eeffffeeccttiivvee wwaayy..

TThhee mmeetthhooddoollooggyy wwiillll bbee pprreeppaarreedd wwiitthhiinn tthhee ffrraammeewwoorrkk ooff tthhee GGAAIILL''ss

pprroocceedduurreess iinn vvoogguuee.. TThhee ffoolllloowwiinngg sseeccttiioonnss oouuttlliinnee tthhee aarreeaa wwhhiicchh nneeeeddss ttoo

bbee ccoovveerreedd iinn tthhee EExxeeccuuttiioonn MMeetthhooddoollooggyy..

SS..NN IItteemm DDeessccrriippttiioonn

[[AA]] DDeettaaiill EEnnggiinneeeerriinngg TThhiiss wwiillll ccoovveerr tthhee ddeettaaiillss ffoorr eennggiinneeeerriinngg

ttoo bbee ddoonnee uunnddeerr vvaarriioouuss ddiisscciipplliinneess,,

lliissttiinngg ooff rreeqquuiirreemmeennttss,, pprreeppaarraattiioonn ooff

ssppeecciiffiiccaattiioonnss,, mmaatteerriiaall rreeqquuiissiittiioonnss,,

pprroocceessss ddeessiiggnn bbaassiiss,, ppiippeelliinnee ssiizziinngg,,

rreecceeiipptt // ddiissppaattcchh tteerrmmiinnaallss,, eettcc.. LLiissttiinngg ooff

SSttaannddaarrddss bbaasseedd oonn wwhhiicchh tthhee eennggiinneeeerriinngg

hhaass bbeeeenn ddoonnee iitteemm--wwiissee..

[[BB]] SSeelleeccttiioonn ooff

TTeecchhnnoollooggyy ffoorr vvaarriioouuss

MMaatteerriiaallss // EEqquuiippmmeennttss

TThhiiss wwiillll hhiigghhlliigghhtt tthhee ddeettaaiillss ffoorr tthhee

tteecchhnnoollooggyy ttoo bbee sseelleecctteedd ffoorr hhiigghh vvaalluuee

iitteemmss lliikkee tteerrmmiinnaall ppiippeess,, ppoowweerr ssoouurrccee,,

SSCCAADDAA,, tteelleeccoomm,, mmeetteerriinngg,, eettcc.. TTyyppee ooff

ppiippeess,, ppiippee ggrraaddee,, eettcc..

[[CC]] CCoonnttrraaccttss

MMaannaaggeemmeenntt::

PPrrooccuurreemmeenntt SSttrraatteeggyy

((OOppeenn TTeennddeerrss,,

LLiimmiitteedd TTeennddeerrss,,

MMVVLL)) ffoorr PPrrooccuurreemmeenntt

PPaacckkaaggee,, WWoorrkkss

PPaacckkaaggee

TThhiiss wwiillll hhiigghhlliigghhtt tthhee iiddeennttiiffiiccaattiioonn ooff aallll

mmaatteerriiaallss aanndd wwoorrkkss aanndd tthheeiirr ppaacckkaaggiinngg

ffoorr tteennddeerriinngg aanndd eexxeeccuuttiioonn.. EEssttiimmaattiinngg

tthhee ccoosstt ooff eeaacchh mmaatteerriiaall,, wwoorrkkss ppaacckkaaggee..

MMooddee ooff tteennddeerriinngg iinnlliinnee wwiitthh GGAAIILL

CCoonnttrraaccttss && PPrrooccuurreemmeenntt PPrroocceedduurree.. LLiisstt

ooff vveennddoorrss aass ppeerr tthhee MMaasstteerr VVeennddoorr LLiisstt

ooff PPMMCC ffoorr iitteemmss ttoo bbee pprrooccuurreedd tthhrroouugghh

lliimmiitteedd tteennddeerriinngg..

[[DD]] CCoonnssttrruuccttiioonn

MMaannaaggeemmeenntt

IIddeennttiiffiiccaattiioonn aanndd ffiinnaalliizzaattiioonn ooff nnuummbbeerr ooff

sseeccttiioonnss // sspprreeaadd iinn lliinnee wwiitthh bbeesstt

iinntteerrnnaattiioonnaall pprraaccttiicceess.. IIddeennttiiffiiccaattiioonn aanndd

ffiinnaalliizzaattiioonn ooff llooccaattiioonnss ffoorr ccaammpp ooffffiicceess

aalloonngg ppiippeelliinnee rroouuttee.. IIddeennttiiffiiccaattiioonn aanndd

llooccaattiioonn ooff dduummpp--ssiitteess ffoorr lliinnee ppiippeess..

CCoonnssttrruuccttiioonn ssttrraatteeggyy aanndd sscchheedduullee..

CCeerrttiiffiiccaattiioonn ooff ccoonnttrraaccttoorrss'' bbiillllss..

[[EE]] IInnssppeeccttiioonn PPllaann DDeettaaiilleedd ppllaann && mmeetthhooddoollooggyy ffoorr

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 104 of 154

iinnssppeeccttiioonn ffoorr vvaarriioouuss ccaatteeggoorriieess ooff

mmaatteerriiaallss aanndd ccoonnssttrruuccttiioonn iinncclluuddiinngg::

__ PPiippiinngg MMaatteerriiaallss

__ MMaaiinn LLiinnee VVaallvveess,, TTeerrmmiinnaall VVaallvveess

__ CCoonnssttrruuccttiioonn

__ FFAATT // SSAATT ffoorr SSCCAADDAA,, TTeelleeccoomm aanndd

ootthheerr PPaacckkaaggeess..

MMeetthhooddoollooggyy ffoorr rreelleeaassee ooff mmaatteerriiaallss aafftteerr

iinnssppeeccttiioonn.. DDeeppllooyymmeenntt sscchheedduullee ooff

mmaannppoowweerr ffoorr IInnssppeeccttiioonn..

[[FF]] SSttoorreess && MMaatteerriiaallss

MMaannaaggeemmeenntt

TTeennddeerriinngg aanndd aassssiissttiinngg GGAAIIll CC&&PP ––SSttoorreess

ooff mmaatteerriiaall rreecceeiipptt aanndd iinnssppeeccttiioonn

[[GG]] PPrroojjeecctt CCoommmmiissssiioonniinngg

&& SSttaarrttuupp

MMeetthhooddoollooggyy ffoorr CCoommmmiissssiioonniinngg &&

SSttaarrttuupp.. PPrreeppaarraattiioonn ooff OOppeerraattiioonn aanndd

MMaaiinntteennaannccee MMaannuuaallss,, DDiissaasstteerr

MMaannaaggeemmeenntt PPllaann,, EEmmeerrggeennccyy AAccttiioonn

PPllaann..

[[HH]] HHSSEE PPllaann HHeeaalltthh && SSaaffeettyy gguuiiddeelliinneess rreeqquuiirreedd ttoo bbee

ffoolllloowweedd iinn ccoonnssttrruuccttiioonn,,ccoommmmiissssiioonniinngg &&

ssttaarrttuupp..

[[II]] PPrroojjeecctt PPllaannnniinngg &&

SScchheedduulliinngg

DDeettaaiilleedd ppllaannss aanndd sscchheedduullee ffoorr vvaarriioouuss

eelleemmeennttss ooff WWBBSS.. OOvveerraallll PPrroojjeecctt SScchheedduullee

&& PPllaann.. FFiinnaanncciiaall CCoommmmiittmmeenntt SScchheedduullee &&

aanndd CCaasshh ffllooww PPllaann ffoorr vvaarriioouuss oorrddeerrss..

[[JJ]] PPrroojjeecctt HHaarrdd CCoossttss BBaassiiss ooff ccoosstt eessttiimmaattee aanndd eessttiimmaatteedd ccoosstt

aaggaaiinnsstt vvaarriioouuss pprrooccuurreemmeenntt && wwoorrkkss

ppaacckkaaggee..

[[KK]] RReessoouurrccee RReeqquuiirreemmeenntt SScchheedduullee ffoorr ddeeppllooyymmeenntt ooff mmaannppoowweerr ffoorr

PPrroojjeecctt OOffffiiccee aanndd CCoonnssttrruuccttiioonn SSiittee..

OOrrggaannooggrraamm ffoorr PPrroojjeecctt OOffffiiccee &&

CCoonnssttrruuccttiioonn SSiittee..

[[LL]] PPrroojjeecctt CClloosseeoouutt PPMMCC wwiillll ddeevviissee aanndd ssuuggggeesstt tthhee

mmeetthhooddoollooggyy ffoorr pprroojjeecctt cclloosseeoouutt,,

ddeelliivveerraabblleess rreeqquuiirreedd ttoo bbee ssuubbmmiitttteedd

dduurriinngg cclloosseeoouutt,, sscchheedduullee ffoorr cclloosseeoouutt..

1122..22 PPrrooccuurreemmeenntt // WWoorrkkss PPaacckkaaggeess::

DDeettaaiill EEnnggiinneeeerriinngg iiss ttoo bbee ccaarrrriieedd oouutt bbyy tthhee PPMMCC iinncclluuddiinngg tthhee ssiizziinngg aanndd

eennggiinneeeerriinngg ooff aallll tthhee mmaajjoorr iitteemmss.. IInnssppeeccttiioonn ooff tthhee aallll mmaajjoorr iitteemmss mmeennttiioonneedd

bbeellooww iiss ttoo bbee ccaarrrriieedd oouutt bbyy tthhee PPMMCC.. TThhee lliisstt bbeellooww iiss iinnddiiccaattiivvee.. TThheerree mmaayy

bbee ssoommee iitteemmss wwhhiicchh ccaann bbee ddiirreeccttllyy pprrooccuurreedd tthhrroouugghh tteennddeerriinngg.. TThhee lliisstt wwiillll

bbee ffiinnaalliizzeedd aatt aapppprroopprriiaattee ttiimmee,, pprreeffeerraabbllyy dduurriinngg kkiicckk--ooffff mmeeeettiinngg.. NNoo

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 105 of 154

aaddddiittiioonnaall aammoouunntt iiss ppaayyaabbllee ttoo tthhee PPMMCC ffoorr tteennddeerriinngg ooff mmoorree oorr lleessss nnooss..

ppaacckkaaggeess tthhaann mmeennttiioonneedd bbeellooww::

SS..NN PPaacckkaaggee DDeessccrriippttiioonn

[[11]] TTrraannssppoorrttaattiioonn aanndd ssttoorraaggee ooff LLiinnee PPiippeess

[[22]] SSccrraappppeerrss,, FFllooww TTeeeess,, PPiigg SSiiggnnaalleerrss,, QQOOEECC

[[33]] IInnssuullaattiinngg JJooiinnttss

[[44]] PPiippee LLiinnee BBaallll VVaallvveess

[[55]] OOtthheerr BBaallll VVaallvveess

[[66]] PPrreessssuurree RReedduuccttiioonn aanndd MMeetteerriinngg SSkkiiddss

[[77]] CCoommppoossiittee CCoonnssttrruuccttiioonn PPaacckkaaggee iinncclluuddiinngg ffoolllloowwiinngg PPrrooccuurreemmeennttss

aanndd WWoorrkkss ::

PPrrooccuurreemmeenntt::

ii.. OOFFCC aanndd HHDDPPEE DDuuccttss

iiii.. TTeelleeccoommmmuunniiccaattiioonn SSyysstteemm

iiiiii.. RRTTUU && SSCCAADDAA

iivv.. GGaass DDeetteeccttiioonn SSyysstteemmss

vv.. TTeerrmmiinnaall BBaallll VVaallvveess

vvii.. AAssssoorrtteedd PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, BBoollttss,, NNuuttss,, GGaasskkeettss aanndd aallll

rreellaatteedd hhaarrddwwaarree ((ootthheerr tthhaann pprrooccuurreedd aabboovvee))

vviiii.. GGlloobbee VVaallvveess,, CChheecckk VVaallvveess,, NNRRVV''ss,, PPlluugg VVaallvveess

vviiiiii.. CCaabblleess,, IInnssttrruummeennttss,, UUPPSS,, BBaatttteerriieess

iixx.. PPoowweerr SSoouurrcceess

xx.. AAllll ootthheerr MMaatteerriiaallss nnoott iinncclluuddeedd aabboovvee..

WWoorrkkss::

ii.. LLaayyiinngg ooff PPiippeelliinnee aanndd AAssssoocciiaatteedd FFaacciilliittiieess

iiii.. CCaatthhooddiicc PPrrootteeccttiioonn WWoorrkkss

iiiiii.. CCoonnssttrruuccttiioonn aanndd EErreeccttiioonn ooff TTeerrmmiinnaall FFaacciilliittiieess,, iinncclluuddiinngg

IInnssttaallllaattiioonn ooff aallll EEqquuiippmmeennttss

iivv.. AAllll CCiivviill,, MMeecchhaanniiccaall,, EElleeccttrriiccaall,, IInnssttrruummeennttaattiioonn WWoorrkkss

vv.. CCoommmmiissssiioonniinngg

vvii.. HHyyddrroollooggiiccaall SSuurrvveeyy && GGeeootteecchhnniiccaall SSeerrvviicceess..

1122..33 EExxeeccuuttiioonn PPllaann::

PPrroojjeecctt eexxeeccuuttiioonn mmeetthhooddoollooggyy ttoo ccoommpplleettee tthhee pprroojjeecctt wwiitthhiinn tthhee ggiivveenn

sscchheedduullee sshhaallll bbee ssuubbmmiitttteedd bbyy tthhee PPMMCC iimmmmeeddiiaatteellyy aafftteerr aawwaarrdd ooff tthhee

ccoonnttrraacctt.. SSuucchh eexxeeccuuttiioonn ooff mmeetthhooddoollooggyy wwiillll bbee ddiissccuusssseedd aanndd iinn ccaassee aannyy

aammeennddmmeenntt// mmooddiiffiiccaattiioonnss iinn tthhee mmeetthhooddoollooggyy aarree rreeqquuiirreedd ttoo aacchhiieevvee tthhee

ttaarrggeett ccoommpplleettiioonn ooff PPrroojjeecctt,, tthheenn ssaammee wwiillll bbee rreevviisseedd.. TThhee ddeessccrriippttiioonn sshhaallll

ccoovveerr aallll aassppeeccttss ooff tthhee PPrroojjeecctt ffrroomm aawwaarrdd ooff CCoonnttrraacctt,, tthhrroouugghh aanndd iinncclluuddiinngg

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 106 of 154

aassppeeccttss ooff tthhee bbaassiicc ddeessiiggnn aanndd ddeettaaiilleedd eennggiinneeeerriinngg,, ccoonnssttrruuccttiioonn,,

ccoommpplleettiioonn,, ccoommmmiissssiioonniinngg aanndd hhaannddoovveerr ooff tthhee PPrroojjeecctt..

1122..44 QQuuaalliittyy AAssssuurraannccee::

BBiiddddeerr sshhaallll pprroovviiddee ddeettaaiillss ooff iittss iinntteennddeedd ccoommpplliiaannccee wwiitthh PPrroojjeecctt QQuuaalliittyy

AAssssuurraannccee rreeqquuiirreemmeennttss.. TThhiiss ccoommpplliiaannccee sshhaallll bbee ssuuppppoorrtteedd bbyy qquuaalliittyy

ssttaatteemmeennttss aanndd qquuaalliittyy mmaannuuaallss ooff tthhee bbiiddddeerr aanndd aallll mmaajjoorr ssuubbccoonnttrraaccttoorrss..

1122..55 DDeessiiggnn SSttaannddaarrddss::

TThhee ffoolllloowwiinngg ddeessiiggnn ssttaannddaarrddss sshhaallll bbee uusseedd aass aa mmiinniimmuumm iinn tthhee ssccooppee ooff

wwoorrkk::

((ii)) IInntteerrnnaattiioonnaall SSttaannddaarrddss:: AANNSSII,, AASSMMEE,, AASSTTMM,, AAPPII,, SSAA,, NNAACCEE,, IISSOO,,

DDIINN,, EENN,, eettcc..

((iiii)) IInnddiiaann SSttaannddaarrddss..

((iiiiii)) OOiill IInndduussttrryy SSaaffeettyy DDiirreeccttoorraattee ((OOIISSDD)) SSttaannddaarrddss..

((iivv)) OOtthheerr ppuubblliisshheedd SSttaannddaarrddss // SSttaannddaarrdd PPrraaccttiicceess..

((vv)) PPNNGGRRBB gguuiiddeelliinneess

IInn ccaassee ooff ccoonnfflliicctt aammoonngg IInnddiiaann SSttaannddaarrddss oorr wwiitthh IInntteerrnnaattiioonnaall SSttaannddaarrddss,,

oowwnneerr sshhoouulldd bbee ccoonnssuulltteedd ffoorr ddeevviiaattiioonnss wwhhiicchh iinn CCoonnssuullttaanntt''ss ooppiinniioonn hhaavvee

ccoosstt iimmppaacctt..

1133.. EEXXCCLLUUSSIIOONNSS FFRROOMM CCOONNSSUULLTTAANNTT’’SS SSCCOOPPEE

TThhee ffoolllloowwiinngg aarree ssppeecciiffiiccaallllyy eexxcclluuddeedd ffrroomm tthhee ssccooppee,, hhoowweevveerr,, aallll tteecchhnniiccaall

aassssiissttaannccee wwiillll bbee pprroovviiddeedd bbyy tthhee CCoonnssuullttaanntt::

((ii)) RROOUU ffoorr ppiippeelliinnee llaayyiinngg aanndd llaanndd aaccqquuiissiittiioonn..

((iiii)) IInnssuurraannccee ppoolliicciieess sshhaallll bbee ttaakkeenn eeiitthheerr bbyy GGAAIILL oorr bbyy VVeennddoorr //

CCoonnttrraaccttoorr ((hhoowweevveerr,, llooddggiinngg ooff iinnssuurraannccee ccllaaiimmss aanndd rreeaalliizzaattiioonn ooff tthhee

ssaammee sshhaallll bbee ddoonnee bbyy tthhee CCoonnssuullttaanntt))..

((iiiiii)) IInndduussttrriiaall rreellaattiioonn ffuunnccttiioonnss aanndd iimmpplleemmeennttaattiioonn ooff LLaabboouurr LLaawwss aatt

wwoorrkkssiitteess..

((iivv)) TTeennddeerr // NNIITT aaddvveerrttiisseemmeenntt ffeeeess sshhaallll bbee iinn GGAAIILL''ss ssccooppee aanndd sshhaallll bbee

rreeiimmbbuurrsseedd ttoo tthhee CCoonnssuullttaanntt aatt aaccttuuaall.. TTeennddeerr ffeeeess rreecceeiivveedd aaggaaiinnsstt

ssaallee ooff TTeennddeerr DDooccuummeennttss ffrroomm vvaarriioouuss aaggeenncciieess sshhaallll bbee ffoorrwwaarrddeedd ttoo

GGAAIILL..

((vv)) PPaayymmeenntt ooff CCuussttoommss dduuttyy aammoouunntt aanndd ttrraannssppoorrttaattiioonn cchhaarrggeess ooff

iimmppoorrtteedd mmaatteerriiaallss..

((vvii)) IInn ccaassee ooff rreeiimmbbuurrsseemmeenntt,, aapppplliiccaabbllee sseerrvviiccee ttaaxx wwiillll bbee ppaaiidd oonn

ssuubbmmiissssiioonn ooff CCeennvvaattaabbllee IInnvvooiicceess ooff PPMMCC..

1144.. AADDDDIITTIIOONN,, RREEDDUUCCTTIIOONN IINN SSCCOOPPEE AANNDD RREE--TTEENNDDEERRIINNGG

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 107 of 154

1144..11 AAddddiittiioonn // rreedduuccttiioonn ooff PPMMCC--ffeeeess wwoouulldd bbee ccoonnssiiddeerreedd iinn ccaassee ooff aaddddiittiioonn oorr

ddeelleettiioonn iinn tthhee ssccooppee ooff tthhee PPrroojjeecctt..

1144..22 CChhaannggee iinn ddrraawwiinnggss // ddooccuummeennttss iinn ccaassee ooff ssiittee ddeecciissiioonnss,, llaanndd aavvaaiillaabbiilliittyy,,

eettcc.. iiss ttoo bbee ccaarrrriieedd oouutt bbyy tthhee PPMMCC wwiitthhoouutt aannyy eexxttrraa ccoosstt..

1144..33 RRee--wwoorrkkiinngg // rree--tteennddeerriinngg // rree--ddeessiiggnniinngg,, eettcc..,, iiff aannyy,, sshhaallll bbee ddoonnee wwiitthhoouutt

eexxttrraa ccoosstt ttoo GGAAIILL.. RRee--tteennddeerriinngg ffoorr nnoonn--rreessppoonnssiivveenneessss,, lleessss ccoommppeettiittiioonn

hhiigghheerr pprriiccee,, eettcc..,, tthhee ssaammee iiss ttoo bbee ccaarrrriieedd oouutt bbyy PPMMCC wwiitthhiinn tthhee qquuootteedd ccoosstt..

1144..44 IInn ccaassee CCoonnssuullttaanntt iiss rreeqquuiirreedd ttoo eexxeeccuuttee cceerrttaaiinn eexxttrraa aaccttiivviittiieess nnoott eennvviissaaggeedd

iinn tthhee oorriiggiinnaall ssccooppee ooff wwoorrkk,, tthheenn CCoonnssuullttaanntt sshhaallll ssuubbmmiitt ttoo EEIICC ooff GGAAIILL,,

tthhee ddeettaaiilleedd ssccooppee ooff wwoorrkk aalloonngg wwiitthh eessttiimmaatteedd mmaann--hhoouurrss.. MMaann--hhoouurrss sshhaallll

bbee mmuuttuuaallllyy aaggrreeeedd bbeettwweeeenn GGAAIILL && CCoonnssuullttaanntt bbeeffoorree pprroocceeeeddiinngg ooff tthhee

wwoorrkk aanndd sshhaallll bbee ppaaiidd aatt tthhee rraattee ooff mmaann--hhoouurr // mmaann--ddaayy rraatteess ssppeecciiffiieedd iinn

tthhee SSOORR ffoorr eexxttrraa wwoorrkk

1155.. OOTTHHEERR CCOONNDDIITTIIOONNSS

1155..11 TThhee CCoonnssuullttaanntt sshhaallll ppeerrffoorrmm tthhee wwoorrkk uunnddeerr tthhiiss CCoonnttrraacctt wwiitthh ddiilliiggeennccee

aanndd ccoonnffoorrmmiinngg ttoo tthhee bbeesstt iinntteerrnnaattiioonnaall pprraaccttiicceess aavvaaiillaabbllee iinn tthhiiss aarreeaa..

1155..22 TThhee CCoonnssuullttaanntt sshhaallll ppeerrffoorrmm tthheeiirr oobblliiggaattiioonnss ccoonnffoorrmmiinngg ttoo rruulleess,,

rreegguullaattiioonnss aanndd pprroocceedduurreess pprreessccrriibbeedd bbyy llaaww..

1155..33 TThhee CCoonnssuullttaanntt sshhaallll ttaakkee aapppprroovvaall // ccoonnccuurrrreennccee ffrroomm GGAAIILL oonn mmaajjoorr aanndd

ccrriittiiccaall iissssuueess,, ee..gg.. DDeessiiggnn BBaassiiss,, PP&&IIDD''ss,, eettcc..

1155..44 TThheerree mmaayy bbee mmiinnoorr cchhaannggeess iinn ssccooppeess dduurriinngg tthhee iimmpplleemmeennttaattiioonn ooff tthhee

PPrroojjeecctt.. TThhee CCoonnssuullttaanntt sshhaallll nnoott bbee eennttiittlleedd ffoorr eexxttrraa ppaayymmeenntt ffoorr tthhee ssaammee..

1155..55 TThhee CCoonnssuullttaanntt sshhaallll ssuuggggeesstt mmeeaassuurreess ttoo ccuutt ddoowwnn ccoossttss aanndd ttiimmee oovveerrrruunnss

wwiitthhoouutt ccoommpprroommiissiinngg tthhee qquuaalliittyy ooff wwoorrkk rreeqquuiirreedd iinn iimmpplleemmeennttiinngg tthhee

pprroojjeecctt..

1155..66 TThhee CCoonnssuullttaanntt sshhoouulldd iinnttiimmaattee iinn aaddvvaannccee aannyy cclliieenntt''ss oobblliiggaattiioonnss ffoorr ttiimmeellyy

ccoommpplleettiioonn ooff aaccttiivviittiieess,, ee..gg.. rreeqquuiirreemmeennttss ooff ssttaattuuttoorryy nnoorrmmss,, rreegguullaattoorryy

aauutthhoorriittiieess,, eettcc..

1155..77 TThhee CCoonnssuullttaanntt sshhaallll pprroovviiddee aapppprroovveedd ddrraawwiinnggss,, eettcc.. wweellll iinn ttiimmee ttoo tthhee

ccoonnttrraaccttoorr ffoorr ccoommmmeenncciinngg aanndd pprroocceeeeddiinngg wwiitthh tthhee wwoorrkk aass ppeerr aaggrreeeedd

sscchheedduullee..

1155..88 FFoorreeiiggnn bbiiddddeerr mmuusstt ddeeppllooyy EExxppaattrriiaattee PPrroojjeecctt MMaannaaggeerr..

1155..99 AApppprroovvaallss ffrroomm GGAAIILL:: AApppprroovvaallss wwiillll bbee ggiivveenn bbyy GGAAIILL ffoorr DDeessiiggnn bbaassiiss,,

PP&&IIDD''ss aanndd aallll mmaajjoorr ddooccuummeennttss,, ssttaaggee wwiissee aapppprroovvaallss ffoorr pprrooccuurreemmeenntt,,

iissssuuaannccee ooff PPuurrcchhaassee OOrrddeerrss,, eexxeeccuuttee AAggrreeeemmeenntt wwiitthh vveennddoorrss // ccoonnttrraaccttoorrss,,

RReelleeaassiinngg ooff ppaayymmeennttss aass ppeerr PPOO // WWOO tteerrmmss,, ooppeenniinngg ooff LLeetttteerrss ooff CCrreeddiitt iinn

ffaavvoorr ooff vveennddoorrss,, eettcc.. ffoorr aallll ccaasseess..

1155..1100 AAnnyy aaccttiivviittyy rreeqquuiirreedd ttoo bbee ccaarrrriieedd oouutt ffoorr ccoommpplleettiioonn ooff tthhee PPrroojjeecctt tthhoouugghh

nnoott ssppeecciiffiiccaallllyy mmeennttiioonneedd iinn tthhee TTeennddeerr DDooccuummeenntt sshhaallll bbee ccaarrrriieedd oouutt aatt nnoo

eexxttrraa ccoosstt ttoo GGAAIILL..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 108 of 154

1155..1111 AAllll aassssiissttaannccee rreeqquuiirreedd bbyy GGAAIILL ((vviizz.. bbuutt nnoott lliimmiitteedd ttoo pprreeppaarraattiioonn ooff

ddrraawwiinnggss,, ddooccuummeennttss,, rreeppoorrttss,, eettcc..)) ffoorr OObbttaaiinniinngg ppeerrmmiissssiioonnss aanndd cclleeaarraanncceess

ffrroomm ssttaattuuttoorryy aauutthhoorriittiieess sshhaallll bbee ppeerrffoorrmmeedd bbyy tthhee CCoonnssuullttaanntt aatt nnoo eexxttrraa

ccoosstt ttoo GGAAIILL..

1155..1122 TThhee CCoonnssuullttaanntt sshhaallll bbee rreessppoonnssiibbllee ttoo pprreeppaarree ddaaiillyy,, wweeeekkllyy,, ffoorrttnniigghhttllyy &&

mmoonntthhllyy pprrooggrreessss rreeppoorrttss ooff tthhee pprroojjeecctt iinn aapppprroovveedd ffoorrmmaattss wwiitthhiinn tthhee

qquuootteedd lluummpp--ssuumm pprriiccee oonnllyy..

1155..1133 TThhee CCoonnssuullttaanntt sshhaallll aatttteenndd ((aanndd ccoonnttrriibbuuttee)) ttoo PPrroojjeecctt && CCoonnssttrruuccttiioonn rreevviieeww

mmeeeettiinnggss ttaakkeenn bbyy GGAAIILL mmaannaaggeemmeenntt aatt PPrroojjeecctt // CCoorrppoorraattee // SSiittee ooffffiicceess ooff

GGAAIILL aanndd aallssoo aatt VVeennddoorr''ss // CCoonnttrraaccttoorr''ss ooffffiicceess ffrroomm ttiimmee ttoo ttiimmee ffoorr

eexxppeeddiittiioouuss ccoommpplleettiioonn ooff tthhee PPrroojjeecctt wwiitthhiinn tthhee qquuootteedd lluummpp--ssuumm pprriiccee oonnllyy,,

wwhhiicchh sshhaallll bbee ppaarrttiicciippaatteedd aatt aapppprroopprriiaattee lleevveell bbyy PPMMCC..

1155..1144 TThhee CCoonnssuullttaanntt sshhaallll ppuutt iinn rreeqquuiissiittee eeffffoorrttss ttoo aacchhiieevvee aacccceelleerraatteedd ttiimmee--

sscchheedduulleess ffoorr PPrroojjeecctt ccoommpplleettiioonn,, iiff ssoo rreeqquuiirreedd,, aatt nnoo eexxttrraa ccoosstt ttoo GGAAIILL..

1155..1155 PPMMCC''ss pprriimmaarryy rreessppoonnssiibbiilliittiieess,, hhoowweevveerr nnoott lliimmiitteedd ttoo,, ffoorr aarrbbiittrraattiioonn ccaasseess

ttiillll tthhee ffiinnaall aawwaarrdd ooff aarrbbiittrraattiioonn::

((ii)) EExxaammiinniinngg && pprroovviiddiinngg rreeppllyy ooff ccllaaiimmss,, eettcc..

((iiii)) PPaarrttiicciippaattiioonn iinn aarrbbiittrraattiioonn pprroocceeeeddiinnggss..

1155..1166 OOnnee sseenniioorr--lleevveell PPMMCC ppeerrssoonnnneell sshhoouulldd bbee hheelldd rreessppoonnssiibbllee aatt ffoorr ddaayy--ttoo--ddaayy

ccoooorrddiinnaattiioonn aaccttiivviittiieess bbeettwweeeenn GGAAIILL && PPMMCC..

1155..1177 TTeecchhnniiccaall QQuueerriieess ((TTQQ)) // CCoommmmeerrcciiaall QQuueerriieess ((CCQQ)),, iiff rreeqquuiirreedd iinn tteennddeerriinngg

pprroocceessss,, sshhoouulldd bbee rraaiisseedd wwiitthh tthhee pprriioorr aapppprroovvaall ooff GGAAIILL..

1155..1188 TThhee CCoonnssuullttaanntt wwiillll bbee nnoottiiffiieedd aabboouutt tthheeiirr ppeerrffoorrmmaannccee oonn ppeerriiooddiicc bbaassiiss..

1155..1199 CCaappiittaalliizzaattiioonn ooff tthhee ppiippeelliinnee oorr aa sseeccttiioonn ooff tthhee ppiippeelliinnee::

PPMMCC ttoo ccaarrrryy oouutt aallll tthhee mmaatteerriiaall ttrraannssaaccttiioonnss aanndd kkeeeepp rreeccoorrddss ppeerrttaaiinniinngg ttoo

tthhee mmoovveemmeenntt ooff mmaatteerriiaallss aanndd tthheeiirr ttrraacceeaabbiilliittyy // aaccccoouunnttiinngg aass wweellll aass

pphhyyssiiccaall uussaaggee ww..rr..tt.. tthhee sseeccttiioonn ooff tthhee ppiippeelliinnee.. PPMMCC ttoo bbiiffuurrccaattee tthhee ccoosstt aass

ppeerr GGAAIILL ffoorrmmaattss ffoorr tthhee ppuurrppoossee ooff ccaappiittaalliizzaattiioonn ooff aasssseettss.. AAtt tthhee ttiimmee ooff

ccaappiittaalliizzaattiioonn,, CCoonnssuullttaanntt mmaayy bbee rreeqquuiirreedd ttoo ddeeppuuttee tthheeiirr rreepprreesseennttaattiivveess aatt

GGAAIILL ooffffiiccee..

1166.. KKEEYY RREESSUULLTT AARREEAASS AANNDD RREECCOOVVEERRIIEESS::

IItt iiss tthhee pprriimmee rreessppoonnssiibbiilliittyy ooff tthhee PPMMCC ttoo ccoommpplleettee tthhee pprroojjeecctt iinn sscchheedduullee

ttiimmee.. TThhee ccoonnssuullttaanntt wwoouulldd sscchheedduullee aanndd eexxeeccuuttee pprroojjeecctt aaccttiivviittiieess ssuucchh aass ttoo

ccoommpplleettee tthhee eennttiirree pprroojjeecctt wwiitthhiinn tthhee sscchheedduullee.. RReeccoovveerriieess wwoouulldd bbee eeffffeecctteedd

ffoorr tthhee ddeellaayyss aattttrriibbuuttaabbllee ttoo tthhee PPMMCC.. TThhee PPMMCC sshhaallll bbee ppeerriiooddiiccaallllyy

iinnttiimmaatteedd aabboouutt tthheeiirr ppeerrffoorrmmaannccee..

KKeeyy rreessuulltt aarreeaass ooff tthhee ppeerrffoorrmmaannccee ooff tthhee PPMMCC aalloonngg wwiitthh tthhee iinnddiiccaatteedd

rreeccoovveerriieess aarree mmeennttiioonneedd iinn tthhee ffoolllloowwiinngg ttaabbllee.. TThhiiss iiss iinn aaddddiittiioonn ttoo PPrriiccee

RReedduucciinngg SScchheedduullee aass ppeerr aarrttiiccllee 33..1122 ooff tthhee GGCCCC.. RReeccoovveerriieess uunnddeerr tthhiiss

ccllaauussee aanndd PPRRSS aarree ssuubbjjeecctt ttoo aarrttiiccllee 33..1155 ooff GGCCCC oonn lliimmiittaattiioonn ooff lliiaabbiilliittiieess..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 109 of 154

SS NN.. AAccttiivviittyy TTiimmee lliinnee RReeccoovveerryy

11 FFiinnaalliizzaattiioonn ooff DDeessiiggnn aanndd

ddeettaaiilleedd eennggiinneeeerriinngg 1100 ddaayyss ffrroomm FFOOII

55 %% ooff tthhee rreessppeeccttiivvee

mmiilleessttoonnee aammoouunntt

22 FFiinnaalliizzaattiioonn ooff PP&&IIDDSS 2255 ddaayyss ffrroomm FFOOII 55 %% ooff tthhee rreessppeeccttiivvee

mmiilleessttoonnee aammoouunntt

33

EEvvaalluuaattiioonn ooff bbiiddss && ssuubbmmiissssiioonn

ooff PPBBOO rreeccoommmmeennddaattiioonn

iinncclluuddiinngg TTQQ // CCQQ,, iiff aannyy..

1100 ddaayyss ffrroomm

ooppeenniinngg ooff bbiiddss

55 %% ooff tthhee rreessppeeccttiivvee

mmiilleessttoonnee aammoouunntt

44 SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr

ppllaacceemmeenntt rreeccoommmmeennddaattiioonnss..

77 ddaayyss ffrroomm tthhee ddaattee

ooff aapppprroovvaall ooff PPBBOO

bbyy GGAAIILL..

55 %% ooff tthhee rreessppeeccttiivvee

mmiilleessttoonnee aammoouunntt

55

SSuubbmmiissssiioonn ooff ddrraafftt LLOOAA aanndd

aassssiisstt ffoorr eennttrryy ooff PPOO// LLOOAA iinn

SSAAPP

77 ddaayyss ffrroomm tthhee ddaattee

ooff FFaaxx ooff IInntteenntt..

55 %% ooff tthhee rreessppeeccttiivvee

mmiilleessttoonnee aammoouunntt

66

AApppprroovvaall ooff DDrraawwiinnggss//

DDooccuummeennttss ooff VVeennddoorrss ffoorr

mmaannuuffaaccttuurriinngg ooff EEqquuiippmmeenntt//

MMaatteerriiaallss..

WWiitthhiinn 77 ddaayyss ooff

rreecceeiipptt ffrroomm VVeennddoorrss

55 %% ooff tthhee rreessppeeccttiivvee

mmiilleessttoonnee aammoouunntt

77 CCoommmmeenncceemmeenntt ooff iinnssppeeccttiioonn ffoorr

EEqquuiippmmeennttss// MMaatteerriiaallss

WWiitthhiinn 33 ddaayyss ooff

iinnssppeeccttiioonn ccaallll

55 %% ooff tthhee rreessppeeccttiivvee

‘‘DDeelliivveerryy’’ mmiilleessttoonnee

aammoouunntt..

88

NNoonn ddeeppllooyymmeenntt ooff kkeeyy

ppeerrssoonnnneell aass ppeerr ddeeppllooyymmeenntt

rreeqquuiirreemmeenntt ((ffoorr PPrroojjeecctt MMaannaaggeerr

aanndd CCoonnssttrruuccttiioonn MMaannaaggeerr))..

RRss 1100,,000000 ppeerr ddaayy

NNootteess::

((11)) IInn aallll tthhee aabboovvee,, ccaalleennddaarr ddaayyss aarree ttoo bbee ccoonnssiiddeerreedd..

((22)) AAppaarrtt ffrroomm aabboovvee,, ppaayymmeennttss ttoowwaarrddss aaccccuurraattee ccoosstt eessttiimmaattee aanndd nnoonn

ggeenneerraattiioonn ooff ssuurrpplluuss wwoouulldd bbee rreegguullaatteedd aass ppeerr tteerrmmss ooff mmiilleessttoonnee

ppaayymmeenntt aanndd ootthheerr tteennddeerr ccoonnddiittiioonnss..

((33)) IInn ccaassee pprroojjeecctt iiss ccoommpplleetteedd wwiitthhiinn tthhee ccoonnttrraaccttuuaall ccoommpplleettiioonn sscchheedduullee

ii..ee.. 88 mmoonntthhss iinncclluuddiinngg 22 mmoonntthhss ppeerriioodd ffoorr pprroojjeecctt cclloossee oouutt ttiimmee ffrroomm

ddaattee ooff FFOOII,, rreetteennttiioonn // RReeccoovveerriieess mmaaddee aaggaaiinnsstt kkeeyy rreessuulltt aarreeaa iiff aannyy

sshhaallll bbee rreeiimmbbuurrsseedd ttoo tthhee ccoonnssuullttaanntt..

((44)) FFuurrtthheerr,, iinn ccaassee ffiinnaall ttiimmee eexxtteennssiioonn iiss ggrraanntteedd wwiitthhoouutt PPRRSS,, nnoo

rreeccoovveerryy wwiillll bbee mmaaddee..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 110 of 154

HHEEAALLTTHH,, SSAAFFEETTYY && EENNVVIIRROONNMMEENNTTAALL RREEQQUUIIRREEMMEENNTTSS

IItt iiss GGAAIILL''ss oobbjjeeccttiivvee ppoolliiccyy ttoo eennssuurree tthhaatt ppootteennttiiaall hheeaalltthh aanndd ssaaffeettyy ffaaccttoorrss aanndd

eennvviirroonnmmeennttaall eeffffeeccttss aarree aasssseesssseedd ffoorr aallll pprroodduuccttss,, pprroojjeeccttss aanndd aaccttiivviittiieess aanndd

aaccqquuiissiittiioonnss.. FFoorr pprroojjeeccttss,, tthhiiss iiss iimmpplleemmeenntteedd bbyy ssttaaggeedd aauuddiittss ooff hheeaalltthh,, ssaaffeettyy aanndd

eennvviirroonnmmeennttaall aassppeeccttss ffrroomm ccoonncceepptt ssttaaggee ttoo ppoosstt ccoommmmiissssiioonniinngg iinn oorrddeerr ttoo

ddeetteerrmmiinnee aannyy sshhoorrttccoommiinnggss oorr nnoonn ccoommpplliiaannccee..

TThhee ssppeecciiffiicc rreeqquuiirreemmeenntt iinncclluuddeess tthhee ffoolllloowwiinngg::

AA.. PPrroojjeecctt SSaaffeettyy RReevviieeww

AA ffoorrmmaall pprroojjeecctt ssaaffeettyy rreevviieeww iiss ttoo bbee ccaarrrriieedd oouutt bbyy OOwwnneerr aanndd iinntteeggrraatteedd

aaccrroossss tthhee vvaarriioouuss ccoonnttrraaccttss.. TThhee OOwwnneerr''ss rreevviieeww tteeaamm wwiillll rreeqquuiirree ddaattaa,, iinnppuutt

ffrroomm kkeeyy ppeerrssoonnnneell ffrroomm ootthheerr ccoonnttrraaccttoorrss aanndd aacccceessss ttoo aallll llooccaattiioonnss bbeeiinngg

uusseedd bbyy ccoonnttrraaccttoorr,, ssuubb--ccoonnttrraaccttoorrss aanndd ssuupppplliieerrss.. PPMMCC sshhaallll mmaakkee aallll

nneecceessssaarryy aarrrraannggeemmeennttss ffoorr ssuucchh rreevviieewwss aass rreeqquuiirreedd bbyy OOwwnneerr aanndd sshhaallll

eennssuurree tthhaatt ccoonnttrraaccttoorrss mmaakkee aavvaaiillaabbllee ssuucchh ddaattaa,, ppeerrssoonnnneell aanndd llooccaattiioonnss aass

rreeqquuiirreedd.. PPMMCC sshhaallll eennssuurree tthhaatt aallll rreeccoommmmeennddaattiioonnss aanndd ffiinnddiinnggss ffrroomm

ssaaffeettyy rreevviieewwss aarree iimmpplleemmeenntteedd bbyy ccoonnttrraaccttoorrss iinn aa ttiimmeellyy mmaannnneerr..

BB.. EEnnvviirroonnmmeennttaall IImmppaacctt AAsssseessssmmeenntt ((EEIIAA))

PPMMCC sshhaallll eennssuurree tthhaatt aallll rreeccoommmmeennddaattiioonnss rreessuullttiinngg ffrroomm tthhee EEIIAA // RRRRAA

ssttuuddiieess,, oonn aapppprroovvaall bbyy OOwwnneerr,, aarree iinnccoorrppoorraatteedd iinn tthhee TTeennddeerr DDooccuummeennttss ffoorr

iimmpplleemmeennttaattiioonn bbyy ccoonnttrraaccttoorrss..

CC.. HHAAZZOOPP

PPMMCC sshhaallll pprroovviiddee aa tteeaamm,, wwiitthh GGAAIILL''ss aapppprroovvaall,, ffoorr ccaarrrryyiinngg oouutt HHAAZZOOPP

ssttuuddyy dduurriinngg ddeessiiggnn ssttaaggee,, ccoonnssttrruuccttiioonn ssttaaggee,, ccoommmmiissssiioonniinngg ssttaaggee aanndd sshhaallll

eennssuurree tthhaatt aallll rreeccoommmmeennddaattiioonnss aanndd ffiinnddiinnggss aarree iimmpplleemmeenntteedd bbyy

ccoonnttrraaccttoorrss iinn aa ttiimmeellyy mmaannnneerr.. NNoonn--CCoommpplliiaannccee ooff tthhee HHAAZZOOPP

rreeccoommmmeennddaattiioonnss bbyy ccoonnttrraaccttoorr sshhaallll bbee tthhee rreessppoonnssiibbiilliittyy ooff PPMMCC..

DD.. HHeeaalltthh,, SSiittee SSaaffeettyy aanndd SSeeccuurriittyy

PPMMCC sshhaallll bbee rreessppoonnssiibbllee,, oonn bbeehhaallff ooff OOwwnneerr ffoorr eennssuurriinngg aa hhiigghh ssttaannddaarrdd ooff

ooccccuuppaattiioonnaall hheeaalltthh aanndd ssiittee ssaaffeettyy mmaannaaggeemmeenntt aanndd ffoorr eennssuurriinngg tthhee

rreeqquuiirreemmeennttss ffoorr hheeaalltthh,, ssaaffeettyy aanndd sseeccuurriittyy ttoo bbee mmaaiinnttaaiinneedd bbyy ccoonnttrraaccttoorrss,,

ssuubb--ccoonnttrraaccttoorrss aanndd ootthheerr ppeerrssoonnnneell wwoorrkkiinngg aatt ssiittee.. PPMMCC sshhaallll ccoommppiillee tthhee

ssaaffeettyy rreeqquuiirreemmeenntt oonn ccoonnttrraaccttoorrss..

TThhee ppuurrppoossee ooff tthheessee ssaaffeettyy rreeqquuiirreemmeennttss sshhaallll bbee ttoo pprreevveenntt aannyy aacccciiddeennttss,,

iinncciiddeennttss oorr eevveennttss tthhaatt ccoouulldd rreessuulltt iinn iinnjjuurryy oorr ffaattaalliittyy ttoo ppeerrssoonnnneell ffrroomm

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 111 of 154

ccoonnttrraaccttoorrss,, ssuubb--ccoonnttrraaccttoorrss oorr PPMMCC,, OOwwnneerr oorr tthhiirrdd ppaarrttiieess aanndd//oorr ddaammaaggee

oorr ddeessttrruuccttiioonn ttoo ccoonnttrraaccttoorr''ss oorr OOwwnneerr''ss pprrooppeerrttyy,, eeqquuiippmmeenntt aanndd mmaatteerriiaallss..

TThhee rreeqquuiirreemmeennttss sshhaallll bbee iinntteennddeedd ttoo ssuupppplleemmeenntt aannyy GGoovveerrnniinngg AAuutthhoorriittyy

ooff IInnddiiaa,, ssttaattee,, mmuunniicciippaall,, llooccaall oorr ootthheerr rreegguullaattiioonnss aapppplliiccaabbllee aatt tthhee ssiittee

wwhhiicchh PPMMCC sshhaallll bbee oobblliiggeedd ttoo eennffoorrccee oonn bbeehhaallff ooff OOwwnneerr.. PPMMCC sshhaallll aaggrreeee

wwiitthh OOwwnneerr''ss rreepprreesseennttaattiivvee aatt ssiittee aannyy vvaarriiaattiioonnss bbeettwweeeenn tthheessee

rreeqquuiirreemmeennttss.. PPMMCC sshhaallll mmoonniittoorr rreeppoorrtt aanndd eennssuurree tthhaatt tthhee aabboovvee

rreeqquuiirreemmeennttss aarree ffuullllyy aaddhheerreedd ttoo..

EE.. SSiittee SSaaffeettyy OOrrggaanniizzaattiioonn

PPMMCC iiss ttoo aappppooiinntt ssaaffeettyy ooffffiicceerrss wwiitthh aapppprroopprriiaattee ssttaaffff ssuuppppoorrtt wwhhoossee

rreessppoonnssiibbiilliittyy iiss ttoo mmoonniittoorr aallll ssaaffeettyy aaccttiivviittiieess oonn tthhee jjoobb aanndd rreeppoorrtt hhiiss

ffiinnddiinnggss ttoo PPMMCC.. TThhee ssaaffeettyy ooffffiicceerr sshhaallll mmaakkee ppeerriiooddiicc ssaaffeettyy iinnssppeeccttiioonnss ooff

tthhee jjoobb--ssiittee oonn aa sscchheedduullee tthhaatt wwiillll pprroovviiddee oonnggooiinngg ccoovveerraaggee.. TThhee iinnssppeeccttiioonnss

sshhoouulldd bbee mmaaddee jjooiinnttllyy wwiitthh tthhee ssuuppeerriinntteennddeennttss ooff tthhee ccoonnttrraaccttoorrss

rreessppoonnssiibbllee ffoorr oonnggooiinngg wwoorrkk iinn tthhee aarreeaass ttoo bbee iinnssppeecctteedd.. AAnnyy iinnffrraaccttiioonnss oorr

ppoooorr ssaaffeettyy pprraaccttiicceess uunnccoovveerreedd bbyy tthheessee iinnssppeeccttiioonnss sshhaallll bbee pprroommppttllyy

ccoorrrreecctteedd.. SSaaffeettyy rreeqquuiirreemmeennttss sshhaallll bbee eennffoorrcceedd oonn tthhee eennttiirree ssuuppeerrvviissoorryy

oorrggaanniizzaattiioonn ooff tthhee ccoonnttrraaccttoorr aanndd ssuubb--ccoonnttrraaccttoorrss.. EEaacchh llooccaattiioonn sshhaallll rreeqquuiirree

eennffoorrcceemmeenntt ooff aapppprroovveedd ssaaffeettyy rruulleess aanndd pprroocceedduurreess bbyy ccoonnttrraaccttoorrss aanndd ssuubb--

ccoonnttrraaccttoorrss..

FF.. SSiittee SSaaffeettyy PPllaannnniinngg

PPrriioorr ttoo aawwaarrdd ooff ccoonnssttrruuccttiioonn ccoonnttrraaccttss oorr ssttaarrtt ooff ssiittee wwoorrkk,, PPMMCC sshhaallll ppllaann

jjoobb ssaaffeettyy rreeqquuiirreemmeenntt iinn ccoonnjjuunnccttiioonn wwiitthh ccoonnttrraaccttoorrss ggiivviinngg dduuee

ccoonnssiiddeerraattiioonn ttoo::

((ii)) GGAAIILL''ss // PPMMCC''ss SSaaffeettyy rreeqquuiirreemmeennttss;;

((iiii)) LLooccaattiioonn ooff jjoobb--ssiittee((ss));;

((iiiiii)) TTyyppee,, bbaacckkggrroouunndd aanndd qquuaalliittyy ooff llaabboorr rreessoouurrcceess aanndd aannttiicciippaatteedd

ttrraaiinniinngg pprrooggrraammmmee;;

((iivv)) NNaattuurree ooff ccoonnssttrruuccttiioonn wwoorrkk,, ttyyppeess ooff hhaazzaarrddss aannttiicciippaatteedd aanndd hhaazzaarrdd

pprreevveennttiioonn mmeetthhooddss;;

((vv)) IInnssppeeccttiioonn,, tteessttiinngg aanndd ccoommmmiissssiioonniinngg aaccttiivviittiieess oovveerrllaappppiinngg wwiitthh

ccoonnssttrruuccttiioonn iinncclluuddiinngg ttrraaiinniinngg aanndd iimmpplleemmeennttaattiioonn ooff ppeerrmmiitt ttoo wwoorrkk

ssyysstteemm

((vvii)) CCoonnssttrruuccttiioonn eeqquuiippmmeennttss aanndd mmaatteerriiaallss ttoo bbee uusseedd;;

((vviiii)) MMiinniimmiizziinngg tthhee nnuummbbeerr ooff ccoonnttrraaccttoorrss // ssuubb--ccoonnttrraaccttoorrss wwoorrkkiinngg iinn aannyy

aarreeaa aatt tthhee ssaammee ttiimmee

((vviiiiii)) PPeerrssoonnaall pprrootteeccttiivvee ccllootthhiinngg aanndd eeqquuiippmmeenntt rreeqquuiirreemmeennttss mmuusstt bbee

eessttaabblliisshheedd,, aanndd oorrddeerrss ppllaacceedd ffoorr ttiimmeellyy ddeelliivveerryy ttoo jjoobb ssiittee ooff ssuucchh

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 112 of 154

eeqquuiippmmeenntt.. PPMMCC wwiillll eennssuurree tthhaatt ccoonnttrraaccttoorrss eexxeeccuuttee oobblliiggaattiioonnss iinn

tthhiiss aarreeaa..

GG.. SSiittee SSaaffeettyy MMaannuuaall

PPrriioorr ttoo ssttaarrtt ooff wwoorrkk aatt eeaacchh jjoobb--ssiittee,, PPMMCC sshhaallll ppuubblliisshh aanndd ddiissttrriibbuuttee aa

SSaaffeettyy MMaannuuaall,, SSaaffeettyy BBuulllleettiinn,, DDoo''ss && DDoonn''ttss aabboouutt ssaaffeettyy aapppprroovveedd bbyy

OOwwnneerr ttoo ccoovveerr ssaaffeettyy aaccttiivviittiieess.. TThhee MMaannuuaall sshhaallll bbee ppuubblliisshheedd bbootthh iinn

EEnngglliisshh aanndd HHiinnddii aanndd iinn aannyy ootthheerr llaanngguuaaggee ssuuiittiinngg wwoorrkkeerrss'' lliinngguuiissttiicc

rreeqquuiirreemmeennttss..

TThhee ddeessiiggnn ooff tthhee MMaannuuaall sshhaallll ppeerrmmiitt eeaassyy ccoommmmuunniiccaattiioonn ooff iittss ccoonntteennttss ttoo

aallll ppeerrssoonnnneell,, rreeccooggnniizziinngg llaanngguuaaggeess aanndd lliitteerraaccyy ccoonnddiittiioonnss aatt tthhee jjoobb ssiittee..

AAllll GGAAIILL''ss,, PPMMCC''ss aanndd ccoonnttrraaccttoorrss'' ssuuppeerrvviissoorryy ppeerrssoonnnneell wwiillll bbee iissssuueedd aa

ccooppyy ooff tthhee MMaannuuaall.. FFuurrtthheerr ddiissttrriibbuuttiioonn ooff tthhee MMaannuuaall,, oorr ssppeecciiffiicc sseeccttiioonnss,,

sshhaallll bbee ddeetteerrmmiinneedd ddeeppeennddeenntt uuppoonn tthhee nneeeeddss ooff tthhee aaddoopptteedd ccoonnssttrruuccttiioonn

ssttrraatteeggyy aanndd oorrggaanniizzaattiioonn.. CCooppyy ooff tthhee MMaannuuaall wwiillll bbee ssttrriiccttllyy ddiissttrriibbuutteedd ttoo

aallll ssttaattuuttoorryy aauutthhoorriittiieess..

TThhee ccoonntteennttss ooff tthhee MMaannuuaall sshhaallll iinncclluuddee,, aass aa mmiinniimmuumm,, tthhee ffoolllloowwiinngg::

((ii)) OOwwnneerr''ss && PPMMCC''ss ssaaffeettyy oorrggaanniizzaattiioonn,, pphhiilloossoopphhyy aanndd rreessppoonnssiibbiilliittiieess..

((iiii)) OOwwnneerr''ss && PPMMCC''ss ssaaffeettyy rreeqquuiirreemmeennttss..

((iiiiii)) TThhee ggeenneerraall ssaaffeettyy rruulleess aapppplliiccaabbllee ttoo tthhee jjoobb--ssiittee..

((iivv)) NNeeaarr--mmiissss AAcccciiddeenntt RReeppoorrtt..

((vv)) MMoonntthhllyy ssaaffeettyy aauuddiitt rreeppoorrtt iinnlliinnee wwiitthh OOIISSDD gguuiiddeelliinneess // cchheecckklliisstt..

((vvii)) TThhee rreeqquuiirreemmeennttss,, aavvaaiillaabbiilliittyy aanndd pprroovviissiioonn ooff ppeerrssoonnaall pprrootteeccttiivvee

ccllootthhiinngg && eeqquuiippmmeennttss ffoorr ssppeecciiffiicc aaccttiivviittiieess tthhaatt wwiillll ooccccuurr aatt jjoobb ssiittee..

((vviiii)) TTrraaffffiicc rreegguullaattiioonnss aatt tthhee wwoorrkk--ssiitteess..

((vviiiiii)) RReeqquuiirreemmeennttss aanndd ssttaannddaarrddss ffoorr uussee ooff ssccaaffffoollddiinngg // llaaddddeerrss..

((iixx)) RReeqquuiirreemmeennttss ffoorr ggrroouunnddiinngg eelleeccttrriiccaall ccoonnssttrruuccttiioonn eeqquuiippmmeennttss aanndd

ttoooollss..

((xx)) TTyyppee,, aavvaaiillaabbiilliittyy aanndd rreessppoonnssiibbiilliittyy ffoorr uussee ooff ffiirree--ffiigghhttiinngg

eeqquuiippmmeennttss..

((xxii)) WWoorrkk ppeerrmmiitt pprroocceedduurreess..

((xxiiii)) PPrroocceedduurreess ttoo bbee ffoolllloowweedd wwhheenn aann aacccciiddeenntt,, iinnjjuurryy oorr ffiirree ooccccuurrss..

((xxiiiiii)) SSiimmppllee pprroocceedduurreess ttoo bbee ffoolllloowweedd bbyy eennttiirree ccoonnttrraaccttoorr''ss oorrggaanniizzaattiioonn

sshhoouulldd mmaajjoorr aacccciiddeenntt ooccccuurr..

((xxiivv)) CCoonnttrrooll oorr aacccceessss ttoo ssiittee..

PPMMCC wwiillll iissssuuee uuppddaattee aanndd rreevviissee bbooookklleettss pprriioorr ttoo ccoommmmeenncciinngg

ccoommmmiissssiioonniinngg aaccttiivviittiieess aass nneeww hhaazzaarrddss aarriissee aanndd nneeww wwoorrkkiinngg pprroocceedduurreess

aarree rreeqquuiirreedd..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 113 of 154

HH.. PPrreeppaarraattiioonn ooff EEmmeerrggeennccyy AAccttiioonn PPllaann

PPMMCC sshhaallll pprreeppaarree tthhee oonnssiittee && ooffffssiittee EEmmeerrggeennccyy AAccttiioonn PPllaann ffoorr ssiittee aappaarrtt

ffrroomm pprreeppaarriinngg DDiissaasstteerr MMaannaaggeemmeenntt PPllaann iinnlliinnee wwiitthh tthhee rreeqquuiirreemmeennttss ooff

GGAAIILL''ss IISSOO pprroocceedduurreess aanndd OOIISSDD nnoorrmmss.. TThhee ssaammee wwiillll bbee hhaannddeedd oovveerr ttoo

GGAAIILL ffoorr aapppprroovvaall aanndd ssuubbsseeqquueenntt cciirrccuullaattiioonn..

II.. SSaaffeettyy AAccttiivviittiieess

PPMMCC sshhaallll eennssuurree tthhaatt ccoonnttrraaccttoorrss // ssuubb--ccoonnttrraaccttoorrss ccaarrrryy oouutt tthheeiirr aaccttiivviittiieess iinn

aaccccoorrddaannccee wwiitthh tthhee ssaaffeettyy ppllaann tthhrroouugghhoouutt tthhee ccoouurrssee ooff tthhee ccoonnssttrruuccttiioonn ooff

tthhee pprroojjeecctt ttoo iinnccuullccaattee aanndd mmaaiinnttaaiinn ssaaffeettyy aawwaarreenneessss aammoonngg tthheeiirr

eemmppllooyyeeeess..

EEaacchh eemmppllooyyeeee,, pprriioorr ttoo bbeeggiinnnniinngg wwoorrkk,, sshhaallll bbee ggiivveenn aa ssaaffeettyy oorriieennttaattiioonn

ccoouurrssee.. PPMMCC sshhaallll bbee rreessppoonnssiibbllee ffoorr aarrrraannggiinngg tthhee pprroovviiddiinngg ssuucchh aanndd

eennssuurriinngg ccoonnssiisstteennccyy ooff kknnoowwlleeddggee aanndd uunnddeerrssttaannddiinngg aaccrroossss aallll aanndd wwoorrkk

ggrroouuppss.. AAllll ppeerrssoonnnneell mmuusstt bbee ffuullllyy kknnoowwlleeddggeeaabbllee ooff tthhee ppootteennttiiaall hhaazzaarrddss

iinnvvoollvveedd iinn tthhee wwoorrkk tthheeyy ssuuppeerrvviissee aanndd tthhee ssaaffee pprraaccttiicceess ttoo bbee ffoolllloowweedd iinn

tthheeiirr wwoorrkk..

JJ.. AAcccciiddeenntt IInnvveessttiiggaattiioonn aanndd RReeppoorrttiinngg

AAnnyy aacccciiddeenntt oorr iinncciiddeenntt rreessuullttiinngg iinn aa lloosstt ttiimmee iinnjjuurryy,, ddeeaatthh,, oorr ddaammaaggee ttoo

pprrooppeerrttyy oorr eeqquuiippmmeenntt iiss ttoo bbee iinnvveessttiiggaatteedd bbyy PPMMCC.. EEvveerryy iinncciiddeenntt sshhaallll bbee

ddooccuummeenntteedd pprroommppttllyy aafftteerr tthhee iinncciiddeenntt iinncclluuddiinngg tthhee rreessuullttss ooff iinnvveessttiiggaattiioonn

aanndd rreeccoommmmeennddaattiioonnss ffoorr pprreevveennttiivvee aaccttiioonn.. PPMMCC sshhaallll aallssoo eennssuurree tthhaatt aallll

nneecceessssaarryy ppuubblliicciittyy iiss ggiivveenn,, wwiitthhiinn tthhee ssiittee,, ttoo eennssuurree ffuurrtthheerr iinncciiddeennttss ddoo nnoott

ooccccuurr.. TThhiiss iinnvveessttiiggaattiioonn aanndd rreeppoorrtt sshhaallll nnoott pprreecclluuddee aannyy ssiimmiillaarr

iinnvveessttiiggaattiioonnss aanndd rreeppoorrttss rreeqquuiirreedd bbyy ggoovveerrnnmmeennttaall rreegguullaattiioonn,, bbuutt mmaayy bbee

hhaannddlleedd ccoonnccuurrrreennttllyy wwiitthh tthheemm..

PPMMCC sshhaallll mmaaiinnttaaiinn ssaaffeettyy ppeerrffoorrmmaannccee aanndd aacccciiddeenntt ssttaattiissttiiccss rreeccoorrddss ffoorr tthhee

wwhhoollee ssiittee iinn ccoonnffoorrmmaannccee ttoo aann aaggrreeeedd iinntteerrnnaattiioonnaall ssttaannddaarrdd oorr ssyysstteemm ttoo bbee

aapppprroovveedd bbyy OOwwnneerr.. UUppddaatteedd ssaaffeettyy ppeerrffoorrmmaannccee aanndd aacccciiddeenntt ssttaattiissttiiccss sshhaallll

bbee iinncclluuddeedd iinn PPMMCC''ss eevveerryy mmoonntthhllyy rreeppoorrtt..

KK.. HHeeaalltthh PPrrooggrraamm

TThhee PPMMCC iiss ttoo aappppooiinntt aann OOccccuuppaattiioonnaall HHeeaalltthh MMaannaaggeerr wwiitthh aapppprroopprriiaattee

ssttaaffff wwhhoossee rreessppoonnssiibbiilliittyy wwiillll bbee ttoo mmoonniittoorr aallll ooccccuuppaattiioonnaall hheeaalltthh aaccttiivviittiieess

oonn tthhee wwoorrkk ssiittee aanndd hhiiss ffiinnddiinnggss ttoo tthhee PPMMCC.. TThhiiss rroollee ccoouulldd bbee ccoouupplleedd wwiitthh

tthhaatt ooff tthhee SSaaffeettyy MMaannaaggeerr.. TThhee OOccccuuppaattiioonnaall HHeeaalltthh MMaannaaggeerr wwiillll bbee

rreessppoonnssiibbllee ffoorr::

•• FFoorrmmaattiioonn ooff hheeaalltthh oorrggaanniizzaattiioonn;;

•• PPrreeppaarraattiioonn aanndd ssuubbmmiissssiioonn ttoo OOwwnneerr ooff aa hheeaalltthh pprrooggrraamm;;

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 114 of 154

•• PPrroommoottiioonn ooff hheeaalltthh eedduuccaattiioonn aatt tthhee wwoorrkk ssiittee aanndd aannaallyyssiiss;;

•• IInnvveessttiiggaattiioonn aanndd rreeppoorrttiinngg ooff hhaazzaarrddss aanndd iinncciiddeennttss oonn tthhee ssiittee..

AAddddiittiioonnaallllyy,, tthhee ooccccuuppaattiioonnaall hheeaalltthh mmaannaaggeerr sshhaallll mmaakkee ppeerriiooddiicc

iinnssppeeccttiioonnss ooff tthhee ssiittee,, wwiitthh ssppeecciiffiicc rreeffeerreennccee ttoo::

•• SSaanniittaattiioonn;;

•• LLaayyoouutt ooff tteemmppoorraarryy aanndd ppeerrmmaanneenntt iinnssttaallllaattiioonnss;;

•• PPrroovviissiioonn ooff aaddeeqquuaattee mmeeddiiccaall ppeerrssoonnnneell,, ffaacciilliittiieess,, eeqquuiippmmeenntt aanndd

ssuupppplliieess;;

•• IImmpplleemmeennttaattiioonn ooff mmeeaassuurreess ffoorr ddeeaalliinngg wwiitthh iinnjjuurriieess // iillllnneessss..

BBiiddddeerr sshhaallll pprroovviiddee ddeettaaiillss ooff iittss ccoommpplliiaannccee wwiitthh tthhee PPrroojjeecctt hheeaalltthh,, ssaaffeettyy

aanndd eennvviirroonnmmeennttaall rreeqquuiirreemmeennttss iinncclluuddeedd wwiitthh tthhiiss TTeennddeerr DDooccuummeennttss.. TThhiiss

ccoommmmiittmmeenntt sshhaallll bbee ssuuppppoorrtteedd bbyy HHSSEE ssttaatteemmeennttss aanndd mmaannuuaallss // pprroocceedduurreess

ffoorr bbiiddddeerr aanndd aallll mmaajjoorr ssuubb--ccoonnttrraaccttoorrss..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 115 of 154

PPMMCC DDEELLIIVVEERRAABBLLEESS

TThhee PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt ((PPMMCC)) iiss rreeqquuiirreedd ttoo ssuubbmmiitt aallll

ddeelliivveerraabblleess wwiitthhiinn tthhee sscchheedduullee iinnlliinnee wwiitthh tthhee rreeqquuiirreemmeennttss mmeennttiioonneedd iinn

vvaarriioouuss sseeccttiioonnss ooff tthhiiss BBiidd DDooccuummeenntt.. TThhee ddeelliivveerraabblleess iinncclluuddee aallll

ddooccuummeennttss,, ddrraawwiinnggss,, ppllaann,, bbeesstt pprraaccttiicceess,, rreepplliieess,, eettcc.. mmeennttiioonneedd uunnddeerr

vvaarriioouuss ddiisscciipplliinneess ooff tthhee WWBBSS eelleemmeennttss.. TThhee ddeelliivveerraabblleess aarree ssuummmmaarriizzeedd aass

uunnddeerr,, bbuutt nnoott lliimmiitteedd ttoo::

[[11]] AAllll PPeerriiooddiicc RReeppoorrttss,, DDaaiillyy PPrrooggrreessss RReeppoorrttss dduurriinngg CCoonnssttrruuccttiioonn,,

CCuussttoommiizzeedd RReeppoorrttss,, PPrreesseennttaattiioonnss,, BBeesstt PPrraaccttiicceess// IInntteerrnnaattiioonnaall

PPrraaccttiicceess rreeqquuiirreedd ffoorr ssuubbmmiissssiioonn ttoo MMaannaaggeemmeenntt // EExxtteerrnnaall

AAggeenncciieess..

[[22]] AAllll DDooccuummeennttss rreellaatteedd ttoo EEnnggiinneeeerriinngg,, TTeennddeerriinngg,, OOrrddeerriinngg,,

MMaannuuffaaccttuurriinngg,, DDeelliivveerryy,, CCoonnssttrruuccttiioonn,, CCoommmmiissssiioonniinngg..

[[33]] SSttaaggee--wwiissee RReeccoommmmeennddaattiioonnss..

[[44]] DDeessiiggnn bbaassiiss,, DDaattaasshheeeettss,, PP&&IIDD’’ss,, EEnnggiinneeeerriinngg DDrraawwiinnggss..

[[55]] PPrroojjeecctt CCoosstt RReeppoorrttss..

[[66]] VVaarriioouuss ttyyppeess ooff PPllaannss,, MMaannuuaallss,, iinncclluuddiinngg DDiissaasstteerr MMaannaaggeemmeenntt

PPllaann..

[[77]] DDooccuummeennttaattiioonn ffoorr CCCCOOEE,, NNaaggppuurr ccoommpplliiaannccee..

[[88]] PPeerrffoorrmmaannccee EEvvaalluuaattiioonn RReeppoorrttss ooff VVeennddoorrss // CCoonnttrraaccttoorrss

[[99]] PPrroojjeecctt CClloosseeoouutt RReeppoorrttss..

[[1100]] SSttaattuuttoorryy DDooccuummeennttss..

[[1111]] AAnnyy ootthheerr DDeelliivveerraabbllee nnoott mmeennttiioonneedd hheerreeiinn bbuutt rreeqquuiirreedd eellsseewwhheerree

iinn TTeennddeerr..

[[1122]] BBootthh hhaarrdd aanndd eeddiittaabbllee ssoofftt ccooppiieess aarree ttoo bbee pprroovviiddeedd..

TTIIMMEELLYY CCOOMMPPLLEETTIIOONN IISS TTHHEE EESSSSEENNCCEE OOFF TTHHEE

PPRROOJJEECCTT

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 116 of 154

SECTION V

PART-B

SPECIAL CONDITION OF CONTRACT

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 117 of 154

GGAAIILL ((IInnddiiaa)) LLiimmiitteedd ((AA GGoovveerrnnmmeenntt ooff IInnddiiaa UUnnddeerrttaakkiinngg))

AA NNaavvrraattnnaa CCoommppaannyy

GGAAIILL BBhhaavvaann

AAVVAA RRooaadd

RRaajjaahhmmuunnddrryy

TTEENNDDEERR NNOO..:: GAIL/RJY/C&P/SR20036987/RAO

BBIIDDDDIINNGG DDOOCCUUMMEENNTT FFOORR

HHIIRRIINNGG OOFF PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT

CCOONNSSUULLTTAANNCCYY ((PPMMCC)) SSEERRVVIICCEESS FFOORR DDEESSIIGGNN &&

CCOONNSSTTRRUUCCTTIIOONN OOFF KKEESSAANNAAPPAALLLLII((WWEESSTT)) TTOO

PPOONNNNAAMMAANNDDAA PP//LL

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 118 of 154

SSPPEECCIIAALL CCOONNDDIITTIIOONNSS

OOFF TTHHEE

CCOONNTTRRAACCTT

[[SSCCCC]]

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 119 of 154

SSPPEECCIIAALL CCOONNDDIITTIIOONNSS OOFF CCOONNTTRRAACCTT

OOFF

PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT CCOONNSSUULLTTAANNCCYY ((PPMMCC)) SSEERRVVIICCEESS FFOORR

KKEESSAANNAAPPAALLLLII((WW)) TTOO PPOONNNNAAMMAANNDDAA PPIIPPEELLIINNEE PPRROOJJEECCTT

11.. IINNTTRROODDUUCCTTIIOONN

11..11 GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iiss ooppeerraattiinngg PPiippeelliinnee NNeettwwoorrkkss iinn KKrriisshhnnaa GGooddaavvaarrii ((KKGG))

BBaassiinn iinn SSttaattee ooff AAnnddhhrraa PPrraaddeesshh,,IInnddiiaa.. GGaass iiss bbeeiinngg iinnjjeecctteedd ffrroomm vvaarriioouuss ssoouurrcceess ooff

OONNGGCC // CCaaiirrnn // RReelliiaannccee KKGG DD66 aanndd bbeeiinngg ttrraannssppoorrtteedd ttoo vvaarriioouuss ccuussttoommeerrss ooff KKGG

bbaassiinn..

22.. BBRRIIEEFF SSCCOOPPEE OOFF WWOORRKK

22..11 TThhee bbrriieeff ddeessccrriippttiioonn ooff tthhee pprroojjeecctt iiss aass uunnddeerr::

GGAAIILL ((IInnddiiaa)) LLiimmiitteedd iinntteennddss ttoo iimmpplleemmeenntt 1100"" xx 44..55 kkmmss.. ((aapppprrooxx..)) KKeessaannaappaallllii((WW))

ttoo PPoonnnnaammaannddaa PPiippeelliinnee aalloonnggwwiitthh tteerrmmiinnaall uupp--ggrraaddaattiioonn aatt KKeessaannaappaallllii((WW)) aanndd

PPoonnnnaammaannddaa tteerrmmiinnaallss ffoorr ttrraannssppoorrttiinngg NNaattuurraall GGaass ttoo GGAAIILL--TTaattiippaakkaa aanndd ffuurrtthheerr

ttoo ootthheerr ccuussttoommeerrss aalloonngg ppiippeelliinnee rroouuttee iinn KKGG BBaassiinn rreeggiioonn..

22..22 TThhee bbrriieeff ssccooppee ooff sseerrvviicceess iiss aass ppeerr sseeppaarraattee sseeccttiioonn oonn tthhee ““SSccooppee ooff WWoorrkk”” ooff tthhiiss

BBiidd DDooccuummeenntt,, bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg::

TThhee PPrroojjeecctt MMaannaaggeemmeenntt CCoonnssuullttaanntt ((PPMMCC)) iiss bbeeiinngg aappppooiinntteedd ffoorr eexxeeccuuttiinngg tthhee

pprroojjeecctt rriigghhtt ffrroomm DDeessiiggnn ttoo CCoommmmiissssiioonniinngg && pprroojjeecctt cclloosseeoouutt oonn ttoottaall aanndd ssiinnggllee

ppooiinntt rreessppoonnssiibbiilliittyy bbaassiiss.. TThhiiss sseeccttiioonn iiss ttoo bbee rreeaadd iinn ccoonnjjuunnccttiioonn wwiitthh ""SSccooppee ooff

wwoorrkk””.. TThhee PPMMCC PPrroojjeecctt MMaannaaggeerr wwiillll bbee tthhee ""EEnnggiinneeeerr--iinn--CChhaarrggee"" ffoorr tthhee ssaaiidd

PPrroojjeecctt.. TThhee ssccooppee ooff wwoorrkk ooff tthhee PPMMCC iiss bbrrooaaddllyy ddeeffiinneedd uunnddeerr tthhee ffoolllloowwiinngg hheeaaddss

bbuutt nnoott lliimmiitteedd ttoo::

[[aa]] BBaassiicc EEnnggiinneeeerriinngg && HHyyddrraauulliicc SSTTUUDDYY..

[[bb]] DDeessiiggnn && DDeettaaiilleedd EEnnggiinneeeerriinngg..

[[cc]] CCaarrrryyoouutt aallll nneecceessssaarryy ccaallccuullaattiioonnss aanndd ccoonndduucctt aallll aapppprroopprriiaattee ddeessiiggnn

pprroocceedduurree aanndd aannaallyyssiiss,, aass rreeqquuiirreedd,, ttoo ooppttiimmiizzee tthhee ssiizziinngg aanndd sseelleeccttiioonn

ooff tthhee eeqquuiippmmeenntt aanndd ssppeecciiffiiccaattiioonn ooff mmaatteerriiaallss..

[[dd]] PPrreeppaarree oovveerraallll ddeessiiggnn bbaassiiss..

[[ee]] PPrreeppaarraattiioonn ooff MMaatteerriiaall TTaakkee--ooffffss ((MMTTOO)),, MMaatteerriiaall RReeqquuiissiittiioonn ((MMRR))..

[[ff]] PPrreeppaarraattiioonn ooff iitteemm--wwiissee ccoosstt eessttiimmaattee ffoorr eeaacchh MMaatteerriiaall RReeqquuiissiittiioonn aanndd

TTeennddeerr..

[[gg]] PPrreeppaarraattiioonn ooff ddrraawwiinnggss,, MMaatteerriiaall RReeqquuiissiittiioonnss aanndd PPrroojjeecctt DDooccuummeenntt

IInnddeexx..

[[hh]] PPllaannnniinngg && SScchheedduulliinngg..

[[ii]] IIddeennttiiffyy aallll tthhee iinntteerrffaaccee ppooiinnttss // bbaatttteerryy lliimmiittss aanndd iinnccoorrppoorraattee tthheemm oonn

rreelleevvaanntt ddrraawwiinnggss aanndd ddooccuummeennttss..

[[jj]] RReevviieeww aanndd aapppprroovvaall ooff ddeessiiggnn // ddrraawwiinnggss // ddooccuummeennttss ssuubbmmiitttteedd bbyy

vveennddoorrss // ccoonnttrraaccttoorrss // ssuupppplliieerrss..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 120 of 154

[[kk]] TThhee ccoonnssuullttaanntt sshhaallll pprroovviiddee aallll tteecchhnniiccaall ddooccuummeennttss ffoorr lliiaassiioonniinngg

aassssiissttaannccee wwiitthh ssttaattuuttoorryy aauutthhoorriittiieess lliikkee RR&&BB,, SSPPCCBB ((SSttaattee PPoolllluuttiioonn

CCoonnttrrooll BBooaarrdd)),, FFoorreesstt aauutthhoorriittiieess,,iirrrriiggaattiioonn,, CCCCOOEE ((CChhiieeff CCoonnttrroolllleerr ooff

EExxpplloossiivveess)) ffoorr oobbttaaiinniinngg vvaarriioouuss ssttaattuuttoorryy ppeerrmmiissssiioonnss..

[[ll]] PPrreeppaarraattiioonn ooff TTeennddeerr DDooccuummeennttss,, iinnvviittee bbiiddss,, eevvaalluuaattiioonn ooff uunn--pprriicceedd

aanndd pprriiccee bbiiddss,, rreeccoommmmeennddaattiioonn ffoorr aawwaarrdd ooff jjoobb aass ppeerr GGAAIILL''ss CC&&PP

PPrroocceedduurree,, aassssiissttaannccee dduurriinngg nneeggoottiiaattiioonnss iiff ssiittuuaattiioonn aarriisseess.. PPrreeppaarraattiioonn

ooff LLeetttteerrss ooff IInntteenntt,, WWoorrkk OOrrddeerrss // PPuurrcchhaassee OOrrddeerrss,, CCoonnttrraacctt DDooccuummeennttss

// AAggrreeeemmeennttss,, PPuurrcchhaassee RReeqquuiissiittiioonnss ((PPRR''ss))..

[[mm]] TTeennddeerriinngg && OOrrddeerriinngg,, iinncclluuddiinngg PPuurrcchhaassee ooff aallll eeqquuiippmmeennttss aanndd

mmaatteerriiaallss,, CCuussttoommss CClleeaarraannccee aanndd TTrraannssppoorrttaattiioonn ooff mmaatteerriiaallss //

eeqquuiippmmeennttss ttoo ssiittee,, eettcc..

[[nn]] IInnssppeeccttiioonn // EExxppeeddiittiinngg ooff eeqquuiippmmeennttss // mmaatteerriiaallss bbeeiinngg mmaannuuffaaccttuurreedd bbyy

vveennddoorrss iinncclluuddiinngg ccoonnttrraaccttoorr--ssuupppplliieedd iitteemmss..

[[oo]] MMaannaaggeemmeenntt ooff CCoonnssttrruuccttiioonn SSttoorreess aanndd SSttoorreess AAccccoouunnttiinngg..

[[pp]] CCoonnssttrruuccttiioonn MMaannaaggeemmeenntt && SSuuppeerrvviissiioonn

[[qq]] QQuuaalliittyy AAssssuurraannccee aanndd QQuuaalliittyy CCoonnttrrooll..

[[rr]] PPrroojjeecctt CCoommmmiissssiioonniinngg..

[[ss]] RReevviieeww aanndd aapppprroovvaall ooff ''AAss--BBuuiilltt DDooccuummeennttss // DDrraawwiinnggss''..

[[tt]] PPrroojjeecctt CCoosstt CCoonnttrrooll,, MMaannaaggeemmeenntt && MMoonniittoorriinngg..

[[uu]] CCoonnssttrruuccttiioonn ssuuppeerrvviissiioonn iinncclluuddiinngg cceerrttiiffiiccaattiioonn ooff ccoonnttrraaccttoorr’’ss bbiillllss..

[[vv]] RRiisskk MMaannaaggeemmeenntt ooff tthhee PPrroojjeecctt aalloonngg wwiitthh ddeettaaiilleedd RRiisskk AAnnaallyyssiiss.. TThhee

RRiisskk MMaannaaggeemmeenntt PPllaann ((RRMMPP)) && DDiissaasstteerr MMaannaaggeemmeenntt PPllaann ((DDMMPP)) aarree

aallssoo ttoo bbee pprreeppaarreedd bbyy tthhee CCoonnssuullttaanntt..

[[ww]] HHeeaalltthh && SSaaffeettyy MMaannaaggeemmeenntt..

[[xx]] PPrroojjeecctt CClloosseeoouutt..

33.. SSCCOOPPEE OOFF CCUURRRREENNTT PPRROOJJEECCTT

SSccooppee uunnddeerr tthhee ccuurrrreenntt pprroojjeecctt iiss aass ffoolllloowwss::

LLaayyiinngg ooff 1100"" ddiiaammeetteerr,, aapppprrooxx.. 44..66 kkmmss.. PPiippeelliinnee ffrroomm KKeessaannaappaallllii((WWeesstt)) ttoo

PPoonnnnaammaannddaa ((iinn tthhee ssaammee RRooUU ppaarraalllleell ttoo eexxiissttiinngg 1122”” ddiiaa ppiippeelliinnee 55 mmttrrss.. aappaarrtt))

aalloonnggwwiitthh hhooookk--uupp wwiitthh ccrreeaattiioonn ooff nneeww tteerrmmiinnaall ffaacciilliittiieess aatt KKeessaannaappaallllii((WW)) aanndd

uuppggrraaddaattiioonn ooff eexxiissttiinngg PPoonnnnaammaannddaa aanndd hhooookk--uupp wwiitthh eexxiissttiinngg ssttaattiioonn ppiippiinngg

nneettwwoorrkk aatt PPoonnnnaammaannddaa.. SScchheemmaattiicc iinnddiiccaattiinngg eexxiissttiinngg ppiippeelliinnee ffaacciilliittiieess && pprrooppoosseedd

nneeww ffaacciilliittiieess ffoorr ssuuppppllyyiinngg NNaattuurraall GGaass iiss aass uunnddeerr::

44.. CCOONNTTRRAACCTT PPEERRIIOODD

TThhee ccoonnttrraaccttuuaall sscchheedduulleedd ttiimmee ffoorr tthhee PPMMCC CCoonnttrraacctt sshhaallll bbee EEIIGGHHTT ((0088)) mmoonntthhss

ffrroomm tthhee ddaattee ooff ""FFaaxx ooff AAcccceeppttaannccee ((FFOOAA))"",, wwhhiicchh iiss iinncclluussiivvee ooff TTWWOO ((0022))

mmoonntthhss ffoorr PPrroojjeecctt cclloosseeoouutt..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 121 of 154

TThhee PPMMCC wwoouulldd pprreeppaarree ddeettaaiill sscchheedduullee iinn ccoonnssuullttaattiioonn wwiitthh GGAAIILL aatt tthhee bbeeggiinnnniinngg

// dduurriinngg kkiicckk--ooffff.. AAllll eeffffoorrttss sshhoouulldd bbee mmaaddee ttoo mmeeeett aallll tthhee iinntteerrmmeeddiiaattee sscchheedduullee

aanndd mmiilleessttoonneess.. PPMMCC iiss rreeqquuiirreedd ttoo ppllaann aanndd ppuutt mmaannppoowweerr aanndd rreessoouurrcceess

aaccccoorrddiinnggllyy.. PPMMCC iiss rreeqquuiirreedd ttoo wwoorrkk ssiimmuullttaanneeoouussllyy iinn vvaarriioouuss ppaacckkaaggeess aanndd wwoorrkkss

aanndd mmaakkee aallll--oouutt eeffffoorrttss ttoo ccoommpplleettee tthhee PPrroojjeecctt oonn oorr bbeeffoorree tthhee sscchheedduulleedd ddaattee..

HHoowweevveerr,, aass ppeerr eexxttaanntt pprraaccttiicceess tthhee pprroojjeecctt sshhaallll bbee mmoonniittoorreedd ww..rr..tt iinntteerrnnaall

sscchheedduullee aass wweellll tthhee sscchheedduulleedd ddeeaaddlliinnee..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 122 of 154

SSPPEECCIIAALLCCOONNDDIITTIIOONNSS OOFF TTHHEE CCOONNTTRRAACCTT

55.. GGEENNEERRAALL::

55..11 IInn aaddddiittiioonn ttoo mmeeaanniinngg aassccrriibbeedd ttoo cceerrttaaiinn ccaappiittaalliizzeedd tteerrmmss iinn ""GGeenneerraall CCoonnddiittiioonnss

ooff CCoonnttrraacctt ((GGCCCC))"",, ffoolllloowwiinngg iinniittiiaall ccaappiittaalliizzeedd tteerrmmss sshhaallll hhaavvee tthhee mmeeaanniinngg aass

aassccrriibbeedd ttoo ssuucchh tteerrmm hheerreeuunnddeerr.. IInn ccaassee aannyy tteerrmm ddeeffiinneedd hheerreeuunnddeerr iiss aallssoo ddeeffiinneedd

iinn GGCCCC,, tthhee mmeeaanniinngg aassccrriibbeedd ttoo ssuucchh tteerrmm hheerreeuunnddeerr sshhaallll pprreevvaaiill::

•• ""BBiidd // TTeennddeerr DDooccuummeennttss"" sshhaallll mmeeaann ddooccuummeennttss iissssuueedd ttoo tthhee bbiiddddeerr

ppuurrssuuaanntt ttoo IIFFBB aanndd lliisstteedd iinn IITTBB..

•• ""EEffffeeccttiivvee DDaattee"" sshhaallll mmeeaann tthhee ddaattee oonn wwhhiicchh CCoonnssuullttaanntt''ss oobblliiggaattiioonnss wwiillll

ccoommmmeennccee aanndd tthhaatt wwiillll bbee ddaattee ooff ""FFaaxx ooff IInntteenntt ((FFOOII))"" // ""FFaaxx ooff AAcccceeppttaannccee

((FFOOAA))""..

55..22 TThhee ""SSppeecciiaall CCoonnddiittiioonnss ooff CCoonnttrraacctt ((SSCCCC))"" sshhaallll bbee rreeaadd iinn ccoonnjjuunnccttiioonn wwiitthh tthhee

""GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt ((GGCCCC))"",, ""SSccooppee ooff CCoonnssuullttaannccyy SSeerrvviicceess"",, ""PPrriiccee

SScchheedduullee // SScchheedduullee ooff RRaatteess ((SSOORR))"",, ddrraawwiinnggss,, eettcc.. aanndd aannyy ootthheerr ddooccuummeenntt ffoorrmmiinngg

ppaarrtt ooff tthhiiss CCoonnttrraacctt wwhheerreevveerr tthhee ccoonntteexxtt ssoo rreeqquuiirreess..

55..33 WWhheerreevveerr aannyy ppoorrttiioonn ooff tthhee GGCCCC iiss rreeppuuggnnaanntt ttoo oorr aatt vvaarriiaannccee wwiitthh aannyy pprroovviissiioonnss

ooff tthhee SSCCCC,, tthheenn,, uunnlleessss aa ddiiffffeerreenntt iinntteennttiioonn aappppeeaarrss,, tthhee pprroovviissiioonnss ooff tthhee SSCCCC sshhaallll

bbee ddeeeemmeedd ttoo ggoovveerrnn tthhee pprroovviissiioonnss ooff tthhee GGCCCC,, aanndd SSCCCC sshhaallll pprreevvaaiill ttoo tthhee eexxtteenntt

ooff ssuucchh rreeppuuggnnaannccyy,, oorr vvaarriiaattiioonnss eexxiisstt..

55..44 IInn tthhee CCoonnttrraacctt ddooccuummeennttss,, uunnlleessss ootthheerrwwiissee ssttaatteedd ssppeecciiffiiccaallllyy,, tthhee ssiinngguullaarr sshhaallll

iinncclluuddee tthhee pplluurraall aanndd vviiccee vveerrssaa wwhheerreevveerr tthhee ccoonntteexxtt ssoo rreeqquuiirreess..

55..55 NNoottwwiitthhssttaannddiinngg tthhee ssuubb--ddiivviissiioonnss ooff tthhee CCoonnttrraacctt ddooccuummeennttss iinnttoo sseeppaarraattee sseeccttiioonnss

aanndd vvoolluummeess,, eevveerryy ppaarrtt ooff eeaacchh sshhaallll bbee ddeeeemmeedd ttoo bbee ssuupppplleemmeennttaarryy ttoo aanndd

ccoommpplleemmeennttaarryy ooff eevveerryy ootthheerr ppaarrtt aanndd sshhaallll bbee rreeaadd wwiitthh aanndd iinnttoo tthhee AAggrreeeemmeenntt ssoo

ffaarr aass iitt mmaayy bbee pprraaccttiiccaabbllee ttoo ddoo ssoo..

55..66 AAllll hheeaaddiinnggss,, ssuubbttiittlleess aanndd mmaarrggiinnaall nnootteess ttoo tthhee ccllaauusseess ooff tthhee GGCCCC,, SSCCCC oorr ttoo tthhee

ssppeecciiffiiccaattiioonnss oorr ttoo aannyy ootthheerr ppaarrtt ooff BBiidd DDooccuummeenntt aarree ssoolleellyy ffoorr tthhee ppuurrppoossee ooff

ggiivviinngg aa ccoonncciissee iinnddiiccaattiioonn aanndd nnoott aa ssuummmmaarryy ooff tthhee ccoonntteennttss tthheerreeooff,, aanndd tthheeyy sshhaallll

nneevveerr bbee ddeeeemmeedd ttoo bbee ppaarrtt tthheerreeooff oorr bbee uusseedd iinn iinntteerrpprreettaattiioonn tthheerreeooff..

55..77 ''CCoommpplleettiioonn CCeerrttiiffiiccaattee'' wwiillll bbee iissssuueedd bbyy tthhee EEnnggiinneeeerr--iinn--CChhaarrggee ((EEIICC)) ooff OOwwnneerr oonn

aacccceeppttaannccee ooff ''CClloosseeoouutt RReeppoorrtt'' ssuubbmmiitttteedd bbyy CCoonnssuullttaanntt..

55..88 TThhee qquuootteedd rraatteess sshhaallll bbee ddeeeemmeedd ttoo bbee iinncclluussiivvee ooff aallll aapppplliiccaabbllee ttaaxxeess,, dduuttiieess,, ooccttrrooii,,

lleevviieess,, wwoorrkk ccoonnttrraacctt ttaaxx iiff aannyy.. SSeerrvviiccee ttaaxx aass ppeerr sseerrvviiccee ttaaxx aacctt,, sshhaallll bbee qquuootteedd

sseeppaarraatteellyy iinn tthhee lliinnee iitteemm pprroovviiddeedd.. BBiiddddeerr sshhaallll nnoott bbee eelliiggiibbllee ffoorr aannyy ootthheerr

rreevviissiioonn iinn rraatteess ttiillll tthhee ccoommpplleettiioonn ooff tthhee ccoonnttrraacctt aanndd ccoonnttrraaccttoorr sshhaallll nnoott bbee eelliiggiibbllee

ffoorr aannyy ccoommppeennssaattiioonn oonn tthhiiss aaccccoouunntt dduurriinngg eennttiirree ccoonnttrraacctt ppeerriioodd.. TThhee ccoonnttrraaccttoorr

hhaass ttoo rraaiissee CCeennvvaattaabbllee iinnvvooiiccee sshhoowwiinngg cclleeaarrllyy tthhee sseerrvviiccee ttaaxx aalloonngg wwiitthh cceessss

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 123 of 154

ccoommppoonneenntt sseeppaarraatteellyy iinn tthhee iinnvvooiiccee.. FFuurrtthheerr tthhee bbiiddddeerr aatt tthhee ttiimmee ooff bbiiddddiinngg mmuusstt

iinnddiiccaattee tthhee sseerrvviiccee ttaaxx ccoommppoonneenntt ii..ee.. %% sseerrvviiccee ttaaxx aapppplliiccaabbllee..

55..99 WWhheerreevveerr iitt iiss mmeennttiioonneedd iinn tthhee ssccooppee ooff wwoorrkk // ssppeecciiffiiccaattiioonnss tthhaatt tthhee CCoonnssuullttaanntt

sshhaallll ppeerrffoorrmm cceerrttaaiinn wwoorrkk oorr pprroovviiddee cceerrttaaiinn ffaacciilliittiieess,, iitt iiss uunnddeerrssttoooodd tthhaatt tthhee

CCoonnssuullttaanntt sshhaallll ddoo ssoo aatt hhiiss ccoosstt aanndd tthhee vvaalluuee ooff CCoonnttrraacctt sshhaallll bbee ddeeeemmeedd ttoo hhaavvee

iinncclluuddeedd ccoosstt ooff ssuucchh ppeerrffoorrmmaannccee aanndd pprroovviissiioonnss ssoo mmeennttiioonneedd..

55..1100 IInn ccaassee ooff aann iirrrreeccoonncciillaabbllee ccoonnfflliicctt aammoonnggsstt ""GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt"",,

""SSppeecciiaall CCoonnddiittiioonnss ooff CCoonnttrraacctt"",, ""SSccooppee ooff CCoonnssuullttaannccyy SSeerrvviicceess"",, ""PPrriiccee SScchheedduullee //

SScchheedduullee ooff RRaatteess ((SSOORR))"",, eettcc..,, tthhee ffoolllloowwiinngg sshhaallll pprreevvaaiill ttoo tthhee eexxtteenntt ooff ssuucchh

iirrrreeccoonncciillaabbllee ccoonnfflliicctt iinn oorrddeerr ooff pprreecceeddeennccee::

((ii)) LLeetttteerr ooff AAcccceeppttaannccee ((aalloonnggwwiitthh PPrriiccee SScchheedduullee // SSOORR)) // CCoonnttrraacctt AAggrreeeemmeenntt..

((iiii)) FFaaxx ooff IInntteenntt // LLeetttteerr ooff IInntteenntt // FFaaxx ooff AAcccceeppttaannccee..

((iiiiii)) SSccooppee ooff CCoonnssuullttaannccyy SSeerrvviicceess..

((iivv)) IInnssttrruuccttiioonnss ttoo BBiiddddeerrss..

((vv)) SSppeecciiaall CCoonnddiittiioonnss ooff CCoonnttrraacctt..

((vvii)) GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt..

((vviiii)) IInnddiiaann SSttaannddaarrddss..

((vviiiiii)) OOtthheerr AApppplliiccaabbllee SSttaannddaarrddss..

55..1111 IItt wwiillll bbee CCoonnssuullttaanntt''ss rreessppoonnssiibbiilliittyy ttoo bbrriinngg ttoo tthhee nnoottiiccee ooff EEIICC aannyy iirrrreeccoonncciillaabbllee

ccoonnfflliicctt iinn tthhee CCoonnttrraacctt DDooccuummeennttss bbeeffoorree ssttaarrttiinngg tthhee wwoorrkk((ss)) oorr mmaakkiinngg tthhee ssuuppppllyy

wwiitthh rreeffeerreennccee ttoo wwhhiicchh tthhee ccoonnfflliicctt eexxiissttss..

66.. PPEERRFFOORRMMAANNCCEE EEVVAALLUUAATTIIOONN::

66..11 TThhee ppeerrffoorrmmaannccee ooff CCoonnssuullttaanntt ttoo wwhhoomm tthhee aawwaarrdd iiss ppllaacceedd sshhaallll bbee eevvaalluuaatteedd rriigghhtt

ffrroomm ssuubbmmiissssiioonn ooff bbiidd ttiillll tthhee ffiinnaall ccoommpplleettiioonn..

77.. PPAAYYMMEENNTT TTEERRMMSS AANNDD MMOODDEE OOFF PPAAYYMMEENNTT::

77..11 TTeerrmmss ooff PPaayymmeenntt::

((ii)) AAllll tthhee rreelleevvaanntt ccllaauusseess ooff ""GGeenneerraall CCoonnddiittiioonnss ooff CCoonnttrraacctt"",, ""IInnssttrruuccttiioonnss ttoo

BBiiddddeerrss"" aanndd ""SSppeecciiaall CCoonnddiittiioonnss ooff CCoonnttrraacctt"" sshhaallll bbee aapppplliiccaabbllee..

((iiii)) PPaayymmeenntt sshhaallll ssttaarrtt oonnllyy aafftteerr ssiiggnniinngg ooff CCoonnttaacctt AAggrreeeemmeenntt aass ppeerr BBiidd

DDooccuummeenntt..

((iiiiii)) PPaayymmeennttss wwiillll bbee bbaasseedd oonn ssuucccceessssffuull ccoommpplleettiioonn ooff mmiilleessttoonnee aaccttiivviittiieess,, aass

ppeerr tthhee %% aammoouunntt ooff lluummppssuumm vvaalluuee qquuootteedd bbyy tthhee PPMMCC.. PPaayymmeenntt sshhaallll bbee

mmaaddee tthhrroouugghh ee--bbaannkkiinngg.. TThhee ccoonnssuullttaanntt sshhaallll rraaiissee mmoonntthhllyy iinnvvooiicceess ffoorr tthhee

mmiilleessttoonneess aattttaaiinneedd dduurriinngg tthhee bbiilllliinngg ppeerriioodd wwiitthh rreeqquuiirreedd ddooccuummeennttaattiioonn..

TThhee ccoonnssuullttaanntt sshhaallll ssuubbmmiitt cceennvvaattaabbllee iinnvvooiiccee ttoo eennaabbllee GGAAIILL ttoo aavvaaiill

CCeennvvaatt CCrreeddiitt.. TThhee ddeettaaiillss ooff tthhee mmiilleessttoonneess aarree aass eenncclloosseedd aatt nneexxtt

ffoorrtthhccoommiinngg ppaaggeess..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 124 of 154

((iivv)) IInn ccaassee aannyy mmiilleessttoonnee iiss nnoott aapppplliiccaabbllee,, oorr nnoott eexxeeccuuttaabbllee,, oorr mmiilleessttoonneess aarree

cclluubbbbeedd,, ppaayymmeenntt wwoouulldd bbee rreelleeaasseedd wwiitthh ssuuiittaabbllee cclluubbbbiinngg // ssuubbssttiittuuttiioonn

wwiitthh tthhee aapppprroovvaall ooff GGAAIILL''ss EEIICC..

((vv)) IInn ccaassee aannyy mmiilleessttoonnee iiss nnoott aacchhiieevveedd,, ppaayymmeenntt ffoorr tthhee ssaammee sshhaallll nnoott bbee

mmaaddee.. HHoowweevveerr,, oonn ccoommpplleettiioonn ooff PPrroojjeecctt,, aallll tthhee mmiilleessttoonneess wwiillll bbee ddeeeemmeedd

ccoommpplleetteedd aanndd ppaayymmeennttss aaggaaiinnsstt tthhee mmiilleessttoonneess wwiillll bbee rreelleeaasseedd..

((vvii)) TThhee PPMMCC sshhaallll bbee rreessppoonnssiibbllee ttoo ssuubbmmiitt tthhee iinnvvooiicceess tthhrroouugghh GGAAIILL''ss BBiillll

WWaattcchh SSyysstteemm ((BBWWSS)) aanndd rreettaaiinn aann eelleeccttrroonniicc rreecceeiipptt oonn ssuubbmmiissssiioonn.. GGAAIILL

wwiillll nnoott eenntteerrttaaiinn aannyy bbiillll nnoott ssuubbmmiitttteedd tthhrroouugghh BBWWSS.. OOwwnneerr sshhaallll eennddeeaavvoorr

ttoo rreelleeaassee ppaayymmeennttss wwiitthhiinn ffiifftteeeenn ((1155)) ddaayyss,, ffoorr tthhee bbiillllss rraaiisseedd bbyy tthhee PPMMCC,,

tthhrroouugghh ee--bbaannkkiinngg..

((vviiii)) PPaayymmeenntt sshhaallll bbee mmaaddee ttoo tthhee bbaannkk aaccccoouunntt bbeeaarriinngg tthhee nnaammee ooff PPMMCC ttoo

wwhhoomm WWoorrkk OOrrddeerr hhaass bbeeeenn rreelleeaasseedd bbyy GGAAIILL.. TThhee PPMMCC sshhoouulldd ooppeenn aa bbaannkk

aaccccoouunntt iinn IInnddiiaa..

((vviiiiii)) ""CClloosseeoouutt ooff PPrroojjeecctt"" iinn MMiilleessttoonnee aabboovvee rreeffeerrss ttoo:: MMeecchhaanniiccaall ccoommpplleettiioonn ooff

tthhee PPrroojjeecctt,, ssuubbsseeqquueenntt ccoommmmiissssiioonniinngg ooff aallll ffaacciilliittiieess iinnssttaalllleedd,, cclloossuurree ooff aallll

ppuurrcchhaassee oorrddeerrss,, wwoorrkk oorrddeerrss,, ccoonnttrraaccttss,, ssuubbmmiissssiioonn ooff aallll aass--bbuuiilltt ddrraawwiinnggss,,

ooppeerraattiinngg mmaannuuaallss,, ddooccuummeennttss,, eettcc.. ffrroomm vveennddoorrss // ccoonnttrraaccttoorrss ttoo OOwwnneerr aanndd

rreecceeiipptt ooff aallll uunnuusseedd mmaatteerriiaall ffrroomm ccoonnttrraaccttoorrss aanndd rreettuurrnn ttoo OOwwnneerr aafftteerr dduuee

mmaatteerriiaall rreeccoonncciilliiaattiioonn,, rreeccoommmmeennddiinngg ppeennaallttiieess,, rreeccoovveerriieess ((iiff aannyy)) ffoorr

sshhoorrttaaggee,, ddaammaaggeess iinn ggooooddss,, ssuubbmmiissssiioonn ooff vveennddoorr((ss))'' // ccoonnttrraaccttoorr((ss))''

ppeerrffoorrmmaannccee eevvaalluuaattiioonn aanndd ssuubbmmiissssiioonn ooff PPrroojjeecctt CClloosseeoouutt RReeppoorrtt,, eettcc..

((iixx)) VVEERRYY IIMMPPOORRTTAANNTT::

EEaacchh mmiilleessttoonnee ppaayymmeenntt sshhaallll bbee aass ppeerr bbeellooww ccrriitteerriiaa::

--

OOnn ccoommpplleettiioonn ooff MMiilleessttoonneess aaggaaiinnsstt eeaacchh aaccttiivviittyy ooff PPrroojjeecctt aass

iiddeennttiiffiieedd iinn tthhee ssccooppee ooff wwoorrkk pprrooggrreessssiivveellyy bbaasseedd oonn

FFoorrttnniigghhttllyy iinnvvooiicceess

9955%%

-- AAfftteerr cclloossee oouutt ooff PPrroojjeecctt oonn ccoommpplleettiioonn ooff jjoobb iinn aallll rreessppeeccttss 55%%

DDeedduuccttiioonn aatt SSoouurrccee::

•• OOwwnneerr wwiillll rreelleeaassee tthhee ppaayymmeenntt ttoo tthhee CCoonnssuullttaanntt aafftteerr eeffffeeccttiinngg ddeedduuccttiioonnss aass ppeerr

aapppplliiccaabbllee llaaww iinn ffoorrccee..

•• OOwwnneerr wwiillll rreelleeaassee ppaayymmeennttss ttoo tthhee CCoonnssuullttaanntt aafftteerr ooffffsseettttiinngg aallll dduueess ttoo tthhee

OOwwnneerr ppaayyaabbllee bbyy tthhee CCoonnssuullttaanntt uunnddeerr tthhee CCoonnttrraacctt..

•• SSeerrvviiccee ttaaxx wwoouulldd bbee ppaaiidd eexxttrraa aatt aaccttuuaallss oonn rreecceeiipptt ooff cceennvvaattaabbllee iinnvvooiiccee..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 125 of 154

77..22 LLiisstt ooff MMiilleessttoonneess ffoorr rreelleeaassee ooff PPaayymmeenntt::

ss..nn DDeessccrriippttiioonn %%

ppaayymmeenntt

%% ccuummuullaattiivvee

ppaayymmeenntt

[[AA]] EEnnggiinneeeerriinngg 1100..0000

11.. CCeerrttiiffiiccaattiioonn aanndd iinnssppeeccttiioonn ooff DDeessiiggnn BBaassiiss

DDooccuummeenntt aanndd RReevviieeww

11..5500 11..5500

22.. FFiinnaalliizzaattiioonn ooff PPrroocceessss PP&&IIDD''ss aalloonngg wwiitthh SSuubbmmiissssiioonn

ooff FFiinnaall DDooccuummeenntt

22..0000 33..5500

33.. CCoommpplleettiioonn ooff HHAAZZOOPP SSttuuddyy aalloonngg wwiitthh SSuubbmmiissssiioonn

ooff FFiinnaall PP&&IIDD''ss aanndd HHAAZZOOPP CClloossuurree RReeppoorrtt,, EEIIAA,,

EEMMPP

00..5500 44..0000

44.. FFiinnaalliizzaattiioonn ooff TTeennddeerr DDooccuummeenntt ffoorr MMaaiinnlliinnee VVaallvveess 00..5500 44..5500

55.. FFiinnaalliizzaattiioonn ooff TTeennddeerr DDooccuummeenntt ffoorr SSccrraappppeerr TTrraappss,,

FFllooww TTeeeess && IInnssuullaattiinnggJJooiinnttss

00..5500 55..0000

66.. FFiinnaalliizzaattiioonn ooff TTeennddeerr DDooccuummeenntt ffoorr PPiippee LLaayyiinngg &&

CCoommppoossiittee WWoorrkkss

33..5500 88..5500

77.. FFiinnaalliizzaattiioonn ooff TTeennddeerr DDooccuummeenntt ffoorr PPoowweerr SSoouurrccee,,

SSCCAADDAA SSyysstteemm aanndd tteelleeccoomm ssyysstteemm

11..0000 99..5500

88.. FFiinnaalliizzaattiioonn ooff MMaatteerriiaall TTaakkee--ooffff ((MMTTOO)) ffoorr AAssssoorrtteedd

PPiippeess ,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess

00..5500 1100..0000

ss..nn DDeessccrriippttiioonn %%

ppaayymmeenntt

%% ccuummuullaattiivvee

ppaayymmeenntt

[[BB]] PPllaannnniinngg aanndd SScchheedduulliinngg 11..0000

11.. FFiinnaalliizzaattiioonn ooff LLeevveell --33 IInntteerrnnaall SScchheedduullee 00..1155 1100..1155

22.. FFiinnaalliizzaattiioonn aanndd SSuubbmmiissssiioonn ooff LLiisstt ooff MMiilleessttoonneess ffoorr

IInntteerrnnaall MMoonniittoorriinngg

00..1155 1100..3300

33.. FFiinnaalliizzaattiioonn ooff PPrroojjeecctt EExxeeccuuttiioonn PPllaann // MMeetthhooddoollooggyy 00..2200 1100..5500

44.. SSuubbmmiissssiioonn ooff OOrrggaannooggrraamm ffoorr PPrroojjeecctt OOffffiiccee &&

ccoonnssttrruuccttiioonn SSiittee aalloonngg wwiitthh DDeeppllooyymmeenntt ooff

MMaannppoowweerr

00..5500 1111..0000

ss..nn DDeessccrriippttiioonn %%

ppaayymmeenntt

%% ccuummuullaattiivvee

ppaayymmeenntt

[[CC]] TTeennddeerriinngg 77..0000

11.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPiippee LLaayyiinngg &&

CCoommppoossiittee WWoorrkkss

11..5500 1122..5500

22.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPrrooccuurreemmeenntt ooff

MMaaiinnlliinnee VVaallvveess

00..5500 1133..0000

33.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPrrooccuurreemmeenntt ooff

SSccrraappppeerr TTrraappss,, FFllooww TTeeeess && IInnssuullaattiinngg JJooiinnttss

00..5500 1133..5500

44.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPrrooccuurreemmeenntt ooff PPoowweerr

SSoouurrccee,, SSCCAADDAA aanndd tteelleeccoomm ssyysstteemmss

00..5500 1144..0000

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 126 of 154

55.. IIssssuuee && PPuubblliiccaattiioonn ooff NNIITT ffoorr PPrrooccuurreemmeenntt ooff

AAssssoorrtteedd PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess

00..5500 1144..5500

66.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall

ffoorr PPiippee LLaayyiinngg && CCoommppoossiittee WWoorrkkss

11..5500 1166..0000

77.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall

ffoorr PPrrooccuurreemmeenntt ooff MMaaiinnlliinnee VVaallvveess

00..5500 1166..5500

88.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall

ffoorr SSccrraappppeerr TTrraappss,, FFllooww TTeeeess && IInnssuullaattiinngg JJooiinnttss

00..5500 1177..0000

99.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall

ffoorr PPrrooccuurreemmeenntt ooff PPoowweerr SSoouurrccee,, SSCCAADDAA aanndd

tteelleeccoomm ssyysstteemmss

00..5500 1177..5500

1100.. SSuubbmmiissssiioonn ooff PPBBOO RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall

ffoorr AAssssoorrtteedd PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess eettcc

00..5500 1188..0000

ss..nn DDeessccrriippttiioonn %%

ppaayymmeenntt

%% ccuummuullaattiivvee

ppaayymmeenntt

[[DD]] OOrrddeerriinngg 1100..0000

11.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt

rreeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr PPiippee LLaayyiinngg &&

CCoommppoossiittee WWoorrkkss

22..0000 2200..0000

22.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt

rreeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr PPrrooccuurreemmeenntt ooff

MMaaiinnlliinnee VVaallvveess

00..7755 2200..7755

33.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt

RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr PPrrooccuurreemmeenntt ooff

SSccrraappppeerr TTrraappss,, FFllooww TTeeeess aanndd IInnssuullaattiinngg JJooiinnttss

00..7755 2211..5500

44.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt

RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr PPoowweerr ssoouurrccee,,

SSCCAADDAA aanndd tteelleeccoomm ssyysstteemmss

00..7755 2222..2255

55.. SSuubbmmiissssiioonn ooff AAwwaarrdd // OOrrddeerr PPllaacceemmeenntt

RReeccoommmmeennddaattiioonnss aanndd AApppprroovvaall ffoorr AAssssoorrtteedd PPiippeess,,

FFiittttiinnggss,, FFllaannggeess,, VVaallvveess

00..7755 2233..0000

66.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr PPiippee

LLaayyiinngg && CCoommppoossiittee WWoorrkkss

22..0000 2255..0000

77.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr

PPrrooccuurreemmeenntt ooff MMaaiinnlliinnee VVaallvveess

00..7755 2255..7755

88.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr

PPrrooccuurreemmeenntt ooff SSccrraappppeerr TTrraappss,, FFllooww TTeeeess aanndd

IInnssuullaattiinngg JJooiinnttss

00..7755 2266..5500

99.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr PPoowweerr

ssoouurrccee,, SSCCAADDAA aanndd tteelleeccoomm ssyysstteemmss

00..7755 2277..2255

1100.. AAssssiissttiinngg GGAAIILL bbyy ssuubbmmiittttiinngg ddrraafftt LLOOAA ffoorr AAssssoorrtteedd

PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess

00..7755 2288..0000

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 127 of 154

ss..nn DDeessccrriippttiioonn %%

ppaayymmeenntt

%% ccuummuullaattiivvee

ppaayymmeenntt

[[EE]] IInnssppeeccttiioonn,, EExxppeeddiittiinngg,, MMaannuuffaaccttuurriinngg &&

ddeelliivveerryy

1177..0000

11.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr PPiippee LLaayyiinngg

&& CCoommppoossiittee WWoorrkkss

22..0000 3300..0000

22.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr

ccoommmmeenncceemmeenntt ooff MMaannuuffaaccttuurriinngg ffoorr MMaaiinnlliinnee

VVaallvveess

11..0000 3311..0000

33.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr

ccoommmmeenncceemmeenntt ooff MMaannuuffaaccttuurriinngg ffoorr SSccrraappppeerr TTrraappss,,

FFllooww TTeeeess && IInnssuullaattiinngg JJooiinnttss

22..0000 3333..0000

44.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr

ccoommmmeenncceemmeenntt ooff MMaannuuffaaccttuurriinngg ffoorr PPoowweerr ssoouurrccee,,

SSCCAADDAA aanndd tteelleeccoomm ssyysstteemmss

22..0000 3355..0000

55.. AApppprroovvaall ooff DDrraawwiinnggss // DDooccuummeennttss ffoorr

ccoommmmeenncceemmeenntt ooff MMaannuuffaaccttuurriinngg ffoorr AAssssoorrtteedd PPiippeess,,

FFiittttiinnggss,, FFllaannggeess,, VVaallvveess

22..0000 3377..0000

66.. DDeelliivveerryy ccoommpplleettee aatt ddeessiiggnnaatteedd DDuummppssiittee // SSttoorree ffoorr

MMaaiinnlliinnee VVaallvveess

22..0000 3399..0000

77.. DDeelliivveerryy ccoommpplleettee aatt ddeessiiggnnaatteedd DDuummppssiittee //

CCoonnssttrruuccttiioonn SSiittee SSttoorree SSccrraappppeerr TTrraappss,, FFllooww TTeeeess &&

IInnssuullaattiinngg JJooiinnttss

22..0000 4411..0000

88.. DDeelliivveerryy,, IInnssttaallllaattiioonn && CCoommmmiissssiioonniinngg ccoommpplleettee ffoorr

PPoowweerr SSoouurrccee,, SSCCAADDAA aanndd TTeelleeccoomm ssyysstteemm

22..0000 4433..0000

99.. DDeelliivveerryy ccoommpplleettee aatt DDeessiiggnnaatteedd CCoonnssttrruuccttiioonn SSiittee ffoorr

AAssssoorrtteedd PPiippeess,, FFiittttiinnggss,, FFllaannggeess,, VVaallvveess

22..0000 4455..0000

ss..nn DDeessccrriippttiioonn %%

ppaayymmeenntt

%% ccuummuullaattiivvee

ppaayymmeenntt

[[FF]] CCoonnssttrruuccttiioonn && CCoommmmiissssiioonniinngg 5500..0000

11.. CCoommpplleettee MMoobbiilliizzaattiioonn ooff CCoonnssuullttaanntt MMaannppoowweerr aatt

SSiittee aass ppeerr rreeqquuiirreemmeenntt aanndd SSuubbmmiissssiioonn ooff

OOrrggaannooggrraamm

22..5500 4477..5500

22.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 1100%% 22..5500 5500..0000

33.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 2255%% 22..5500 5522..5500

44.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 4400%% 22..5500 5555..0000

55.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 5500%% 22..5500 5577..5500

66.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 7755%% 22..5500 6600..0000

77.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 8855%% 33..0000 6633..0000

88.. CCuummuullaattiivvee CCoonnssttrruuccttiioonn PPrrooggrreessss -- 110000%% 44..0000 6677..0000

99.. SSuubbmmiissssiioonn ooff MMeecchhaanniiccaall CCoommpplleettiioonn CCeerrttiiffiiccaattee 44..0000 7711..0000

1100.. CCoommmmiissssiioonniinngg && GGaass--IInn ffoorr PPiippeelliinnee SSyysstteemm aanndd 44..0000 7755..0000

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 128 of 154

SSuubbmmiissssiioonn ooff CCoommmmiissssiioonniinngg CCeerrttiiffiiccaattee

1111.. CCoommmmiissssiioonniinngg && GGaass--IInn ffoorr aallll SSttaattiioonnss && TTeerrmmiinnaallss 44..0000 7799..0000

1122.. AAccccuurraattee CCoosstt EEssttiimmaattee ffoorr aallll PPuurrcchhaassee OOrrddeerrss aanndd

WWoorrkk OOrrddeerrss

22..0000 8811..0000

1133.. SSuubbmmiissssiioonn ooff aallll PPOO CClloossuurree SSttaatteemmeennttss 22..0000 8833..0000

1144.. SSuubbmmiissssiioonn ooff aallll WWOO CClloossuurree SSttaatteemmeennttss 22..0000 8855..0000

1155.. AAcccceeppttaannccee ooff aallll PPOO CClloossuurree SSttaatteemmeennttss pprreeppaarreedd bbyy

CCoonnssuullttaanntt

22..0000 8877..0000

1166.. AAcccceeppttaannccee ooff aallll WWOO CClloossuurree SSttaatteemmeennttss pprreeppaarreedd

bbyy CCoonnssuullttaanntt

22..0000 8899..0000

1177.. SSuubbmmiissssiioonn ooff PPeerrffoorrmmaannccee CCaarrddss ooff aallll VVeennddoorrss 11..0000 9900..0000

1188.. SSuubbmmiissssiioonn ooff PPeerrffoorrmmaannccee CCaarrddss ooff aallll CCoonnttrraaccttoorrss 11..0000 9911..0000

1199.. HHaannddoovveerr ooff LLiisstt ooff SSuurrpplluuss aanndd NNoonn--ggeenneerraattiioonn ooff

SSuurrpplluuss MMaatteerriiaall bbeeyyoonndd

22..0000 9933..0000

2200.. HHaannddoovveerr ooff ccoommpplleettee MMaatteerriiaall RReeccoonncciilliiaattiioonn 22..0000 9955..0000

ss..nn DDeessccrriippttiioonn %%

ppaayymmeenntt

%% ccuummuullaattiivvee

ppaayymmeenntt

[[GG]] PPrroojjeecctt CClloosseeoouutt 55..0000

11.. PPrroojjeecctt CClloosseeoouutt aanndd SSuubbmmiissssiioonn ooff PPrroojjeecctt CClloossuurree

RReeppoorrtt

55..0000 110000..0000

TTOOTTAALL 110000..0000

NNoottee::

((ii)) IInn ccaassee aannyy ppaacckkaaggee iiss iinncclluuddeedd iinn tthhee ccoommppoossiittee ccoonnssttrruuccttiioonn tteennddeerr,, tthheenn

mmiilleessttoonnee ((uuppttoo ssuuppppllyy ooff mmaatteerriiaall)) ffoorr tthhaatt ppaacckkaaggee sshhaallll bbee rreelleeaasseedd oonnllyy

aafftteerr rreecceeiipptt ooff mmaatteerriiaall aatt ssiittee..

((iiii)) AAss ""PPrroojjeecctt CClloosseeoouutt"" hhaass bbeeeenn mmaaddee sseeppaarraattee mmiilleessttoonnee,, AArrttiiccllee--33..55..33..33 ooff

GGCCCC iiss mmooddiiffiieedd aass bbeellooww:: OOnn ccoommpplleettiioonn ooff mmiilleessttoonneess lliisstteedd aabboovvee :: 110000%%

ooff ppaayymmeenntt dduuee aaggaaiinnsstt tthhee mmiilleessttoonnee

VVEERRYY IIMMPPOORRTTAANNTT::

EEaacchh mmiilleessttoonnee ppaayymmeenntt sshhaallll bbee aass ppeerr bbeellooww ccrriitteerriiaa::

-- OOnn ccoommpplleettiioonn ooff MMiilleessttoonneess aaggaaiinnsstt eeaacchh aaccttiivviittyy ooff PPrroojjeecctt aass iiddeennttiiffiieedd iinn tthhee

ssccooppee ooff wwoorrkk pprrooggrreessssiivveellyy bbaasseedd oonn FFoorrttnniigghhttllyy iinnvvooiicceess 9955%%

-- AAfftteerr cclloossee oouutt ooff PPrroojjeecctt oonn ccoommpplleettiioonn ooff jjoobb iinn aallll rreessppeeccttss 55%%

88.. PPRRIICCEE RREEDDUUCCTTIIOONN SSCCHHEEDDUULLEE [[PPRRSS]]:: aass ppeerr GGCCCC..

99.. TTAAXXEESS AANNDD DDUUTTIIEESS CCLLAAUUSSEE:: aass ppeerr GGCCCC..

1100.. TTEERRMMIINNAATTIIOONN CCLLAASSUUEE:: aass ppeerr GGCCCC..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 129 of 154

1111.. CCOOMMPPEENNSSAATTIIOONN OONN SSUUSSPPEENNSSIIOONN OOFF TTHHEE PPEERRFFOORRMMAANNCCEE OOFF

DDUUTTIIEESS && SSEERRVVIICCEESS::

1111..11 IInn ccaassee GGAAIILL ssuussppeennddss tthhee wwoorrkk iinn tteerrmmss ooff aarrttiiccllee NNoo.. 33..1111 ooff GGCCCC,, tthhee ccoonnssuullttaanntt

sshhaallll bbee ccoommppeennssaatteedd iinn oorrddeerr ttoo mmaaiinnttaaiinn tthhee mmiinniimmuumm eexxppeennddiittuurree oonn wweeeekkllyy

bbaassiiss.. SSuucchh ccoommppeennssaattiioonn sshhaallll nnoott bbee ppaayyaabbllee ffoorr ffiirrsstt 33 mmoonntthhss.. IIff ssuussppeennssiioonn

ccoonnttiinnuueess bbeeyyoonndd tthhrreeee mmoonntthhss,, tthhee ccoommppeennssaattiioonn sshhaallll bbee ppaaiidd bbaasseedd oonn tthhee qquuootteedd

ppeerr wweeeekk ((ccoommpplleetteedd)) rraattee.. TThhee ccoonnssuullttaanntt sshhaallll mmeennttiioonn tthhee rraattee ffoorr ssuucchh

ccoommppeennssaattiioonn ppeerr ccoommpplleetteedd wweeeekk iinn tthhee ““PPrriicceedd PPaarrtt”” wwhhiicchh wwiillll bbee ccoonnssiiddeerreedd ffoorr

eevvaalluuaattiioonn.. TThhee ppeerriioodd ccoonnssiiddeerreedd ffoorr tthhee ppuurrppoossee ooff eevvaalluuaattiioonn sshhaallll bbee 1122

ccoommpplleetteedd wweeeekkss..

1111..22 IInn ccaassee ooff ssuussppeennssiioonn bbeeyyoonndd ssiixx mmoonntthhss,, eeiitthheerr ppaarrttyy hhaass tthhee ooppttiioonn ttoo ttaakkee aaccttiioonn aass

ppeerr AArrttiiccllee NNoo.. 33..1111..66 ooff GGCCCC..

1111..33 IInn ccaassee tthhee bbiiddddeerr ddooeess nnoott iinnddiiccaattee tthhee rraattee ffoorr ccoommppeennssaattiioonn aass ppeerr tthhee pprrooffoorrmmaa iinn

tthhee PPrriicceedd PPaarrtt,, iitt wwiillll bbee ccoonnssiiddeerreedd tthhaatt nnoo ccoommppeennssaattiioonn iiss rreeqquuiirreedd ttoo bbee ppaaiidd ttoo

tthhee ccoonnssuullttaanntt aanndd pprroovviissiioonnss ooff CCllaauussee NNoo....55..00 wwiillll nnoott bbee aapppplliiccaabbllee ffoorr tthheemm..

12.0 FORMAT OF BIO DATA

Bio-Data of the Key personnel viz: Project Manager, Engineering Manager,

Construction Manager, Planning Manager, Inspection Manager, Contracts

Manager as per format enclosed in next page

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 130 of 154

FORMAT FOR BIO DATA

Paste

Photograph

Here

1. Name

2. DOB

3. Place of Birth

4. Nationality

5. Contact Details, Phone No.,

Email

6. Languages Know (Read, Write,

Speak)

7. Educational Qualifications

8. Professional Qualifications

9. Affiliations to Professional

Bodies

10.

Professional Experience

Organization From To Years Position Responsibilities

11.

Computer & Software’s

Proficiency

12.

Contact details

Tel No.

Mobile No.

Email.

12.

Any Other Information:

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 131 of 154

SECTION – VI

PRICE SCHEDULE

SCHEDULE OF RATE (SOR)

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 132 of 154

SSCCHHEEDDUULLEE OOFF RRAATTEESS [[SSOORR]] HHIIRRIINNGG OOFF PPMMCC FFOORR KKSSPP((WWeesstt)) ttoo PPOONNNNAAMMAANNDDAA

11..00 PPRREEAAMMBBLLEE TTOO PPRRIICCEE SSCCHHEEDDUULLEE

11..11 PPrriiccee SScchheedduullee sshhaallll bbee rreeaadd iinn ccoonnjjuunnccttiioonn wwiitthh GGCCCC,, SSCCCC,, IITTBB aanndd SSccooppee ooff wwoorrkk ooff

tthhiiss tteennddeerr ddooccuummeenntt..

11..22 TThhee qquuootteedd pprriiccee ooff tthhee bbiiddddeerr sshhaallll iinncclluuddee,, bbuutt nnoott lliimmiitteedd ttoo tthhee ffoolllloowwiinngg::

►► OOffffiiccee iinnffrraassttrruuccttuurree,, ccoommppuutteerr ffaacciilliittiieess,, aallll pprriinnttiinngg,, rreepprroodduuccttiioonn,,

ccoommmmuunniiccaattiioonn aanndd ccoouurriieerr rreeccoorrddss..

►► PPMMCC ooffffiiccee sshhaallll bbee mmaaiinnttaaiinneedd aatt RRaajjaahhmmuunnddrryy,, aatt vveerryy cclloossee pprrooxxiimmiittyy ttoo

GGAAIILL BBhhaavvaann,, AAVVAA RRooaadd,, RRaajjaahhmmuunnddrryy..

►► PPMMCC’’ss ppeerrssoonnnneell iinncciiddeennttaall eexxppeennsseess..

►► FFeeeess ppaaiidd ttoo aannyy ootthheerr aaggeennccyy,, ccoommppaannyy,, oorrggaanniizzaattiioonn aanndd ssppeecciiaalliisstt eettcc..

►► IInnccoommee ttaaxx oorr aannyy ootthheerr aaggeennccyy,, ccoommppaannyy,, oorrggaanniizzaattiioonn aanndd ssppeecciiaalliisstt..

►► IInnssuurraannccee ttaakkeenn bbyy tthhee PPMMCC ffoorr iittss iinnssppeeccttoorrss // ccoo--oorrddiinnaattoorrss ttoo bbee ddeeppuutteedd

ffoorr tthhee jjoobb..

►► AAllll ccoonnvveeyyaannccee // llooccaall ttrraavveell ffrroomm RRaajjaahhmmuunnddrryy ttoo ssiittee ii..ee.. KKeessaannaappaallllii((WW))

aanndd PPoonnnnaammaannddaa.. IItt iiss aapppprrooxx.. 110000 kkmm aawwaayy ffrroomm RRaajjaahhmmuunnddrryy..

22..00 BBAASSIISS OOFF PPRRIICCEESS AANNDD OOTTHHEERR RRAATTEESS

22..11 TThhee mmoonntthhllyy rraattee sshhaallll bbee iinncclluussiivvee ooff

►► aallll ccoosstt,, rriisskk aanndd eexxppeennssee,, oovveerrhheeaadd,, pprrooffiitt aanndd//oorr ffeeee rreellaatteedd ttoo tthhee

ssaattiissffaaccttoorryy ppeerrffoorrmmaannccee aanndd ccoommpplleettiioonn ooff tthhee wwoorrkk wwiitthh rreeggaarrdd ttoo

ccoonnssuullttaattiioonn..

►► AAllll eexxppeennsseess ttoowwaarrddss bbooaarrddiinngg && llooddggiinngg ffoorr iinnssppeeccttoorrss..

►► AAllll eexxppeennsseess ttoowwaarrddss llooccaall ttrraavveell ttoo aanndd ffrroo ffrroomm ssiittee..

►► CCaammpp ooffffiiccee ffaacciilliittiieess..

22..22 EErrrroorrss aanndd OOmmmmiissssiioonnss:: BBiiddddeerrss sshhaallll eennssuurree tthhaatt tthheerree aarree nnoo eerrrroorrss oorr oommiissssiioonnss iinn

tthhee PPrriiccee BBiidd.. AAllll ccoolluummnnss ooff tthhee pprriiccee bbiidd aarree mmaannddaattoorryy ttoo bbee ffiilllleedd--uupp.. IInn ccaassee

tthheerree iiss nnoo aammoouunntt,, ““00”” ((zzeerroo)) nneeeeddss ttoo bbee mmeennttiioonneedd.. IInn ccaassee aannyy oommiissssiioonnss aarree

nnoottiicceedd iinn tthhee PPrriicceedd BBiidd,, tthhee bbiidd iiss lliiaabbllee ttoo bbee rreejjeecctteedd.. PPrriicceess sshhaallll bbee wwrriitttteenn iinn

bbootthh wwoorrddss aanndd ffiigguurreess.. IInn ccaassee ooff aannyy ddiissccrreeppaannccyy bbeettwweeeenn pprriicceess iinn wwoorrddss aanndd

pprriicceess iinn ffiigguurreess,, tthhee pprriicceess iinn wwoorrddss sshhaallll bbee vvaalliidd aanndd bbiinnddiinngg.. IInn ccaassee ooff aannyy eerrrroorr

iinn ttoottaall iinnddiiccaatteedd bbyy tthhee bbiiddddeerr,, tthhee uunniitt pprriiccee aalloonnee sshhaallll bbee ccoonnssiiddeerreedd vvaalliidd aanndd

bbiinnddiinngg oonn tthhee bbiiddddeerr..

33..00 RRAATTEESS FFOORR PPMMCC PPEERRSSOONNNNEELL

33..11 TThhee PPMMCC iiss rreeqquuiirreedd ttoo qquuoottee tthhee mmoonntthhllyy rraattee iinn tthhee ffoorrmmaatt iinnddiiccaatteedd iinn SScchheedduullee ooff

RRaatteess ((SSOORR)) –– mmoonntthhllyy cchhaarrggeess ttoowwaarrddss ccoonnssuullaattaannccyy ++ bbooaarrddiinngg ++ llooddggiinngg ++ llooccaall

ccoonnvveeyyaannccee aallll ccoosstt iinncclluussiivvee..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 133 of 154

33..22 TThhee PPMMCC ooffffiiccee sshhaallll bbee aatt RRaajjaahhmmuunnddrryy..

33..33 GGAAIILL sshhaallll nnoott pprroovviiddee eeiitthheerr llooccaall ttrraavveell aassssiissttaannccee ffrroomm RRaajjaahhmmuunnddrryy ttoo rreessppeeccttiivvee

ssiittee oorr hhootteell aaccccoommmmooddaattiioonn..

44..00 MMOONNTTHHLLYY RRAATTEESS

44..11 MMoonntthhllyy rraattee == oonnee ccaalleennddaarr mmoonntthh

44..22 TThhee mmoonntthhllyy rraattee iiss ccoonnssiiddeerreedd aallll iinncclluussiivvee ii..ee..

PPMMCC CCoonnssuullttaattiioonn cchhaarrggeess ++ bbooaarrddiinngg && llooddggiinngg cchhaarrggeess ++ ccaammpp

ffaacciilliittiieess ++ ooffffiiccee ffaacciilliittiieess ++ ccoommmmuunniiccaattiioonn ffaacciilliittiieess..

44..33 PPMMCC iiss rreeqquuiirreedd ttoo ddeeppllooyy ppeerrssoonnnneell oonn ccoonnttiinnuuoouuss bbaassiiss..

44..44 AAnnyy aaddddiittiioonnaall ccoossttss wwhhaatt--ssoo--eevveerr ttoowwaarrddss bbaacckk--uupp mmaannaaggeemmeenntt,,

pprrooffeessssiioonnaall,, IITT ffaacciilliittiieess,, eelleeccttrroonniicc ggaaddggeettss,, ttrraannssmmiittttaall,, wwaasshhiinngg

aalllloowwaanncceess,, bbooaarrddiinngg eexxttrraass,, ccoonnvveeyyaannccee eettcc.. sshhaallll nnoott bbee ppaayyaabbllee.. TThhee

PPMMCC oorrggaanniizzaattiioonn sshhaallll mmaaiinnttaaiinn aa llooccaall ooffffiiccee aatt RRaajjaahhmmuunnddrryy,, vveerryy

cclloossee ttoo GGAAIILL BBhhaavvaann,, AAVVAA RRooaadd,, RRaajjaahhmmuunnddrryy -- 553333110033

44..55 NNoo eexxttrraa aammoouunntt iiss ppaayyaabbllee ffoorr eexxttrraa wwoorrkkiinngg hhoouurrss.. IItt iiss aallll iinncclluussiivvee iinn

tthhee mmoonntthhllyy rraattee..

55..00 MMOOBBIILLIIZZAATTIIOONN // DDEEMMOOBBIILLIIZZAATTIIOONN // TTRRAAVVEELL CCHHAARRGGEESS::

NNoott--aapppplliiccaabbllee

66..00 PPEERRFFOORRMMAANNCCEE MMOONNIITTOORRIINNGG::

TThhee ppeerrffoorrmmaannccee ooff TTPPIIAA sshhaallll bbee mmoonniittoorreedd aass ppeerr tthhee GGAAIILL’’ss PPeerrffoorrmmaannccee

EEvvaalluuaattiioonn PPrroocceedduurree.. AAss mmaajjoorriittyy ooff tthhee wwoorrkk iiss bbeeiinngg ccoonndduucctteedd aatt tthhee ccoonnssttrruuccttiioonn

ssiittee,, ppeerriiooddiicc ppeerrffoorrmmaannccee eevvaalluuaattiioonn aanndd tthhee ffiinnaall eevvaalluuaattiioonn wwiillll bbee ddoonnee bbyy

rreessppeeccttiivvee GGAAIILL ccoonnssttrruuccttiioonn ssiittee iinncchhaarrggeess..

77..00 EEVVAALLUUAATTIIOONN OOFF TTHHEE BBIIDDSS::

77..11 FFoorr eevvaalluuaattiioonn ooff tthhiiss bbiidd ddooccuummeenntt ffoorr aawwaarrdd ooff wwoorrkk,, oovveerraallll LL--11 wwiillll bbee

ccoonnssiiddeerreedd

77..22 BBiiddddeerr hhaass ttoo qquuoottee tthhee sseerrvviiccee ttaaxx %% aanndd tthhee aammoouunntt aapppplliiccaabbllee..

88..00 SScchheedduullee ooff rraatteess ffoorrmmaatt aattttaacchheedd..

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 134 of 154

SSCCHHEEDDUULLEE OOFF RRAATTEESS

SS..NN JJOOBB DDEESSCCRRIIPPTTIIOONN UUOOMM QQTTYY UUNNIITT RRAATTEE

((iinn RRss..))

AAMMOOUUNNTT

((iinn RRss..))

[[11]] PPRROOJJEECCTT MMAANNAAGGEEMMEENNTT CCOONNSSUULLTTAANNCCYY

[[PPMMCC]] FFOORR KKSSPP((WW)) ttoo PPoonnnnaammaannddaa PP//LL MMoonntthhss 88

[[22]] SSeerrvviiccee ttaaxx @@

____________________ %%

GGRRAANNDD TTOOTTAALL

NNOOTTEE::

► PPMMCC UUNNIITT RRAATTEE FFOORR EEAACCHH MMOONNTTHH SSHHAALLLL BBEE IINNCCLLUUSSIIVVEE OOFF

CCOONNSSUULLTTAANNCCYY ++ BBOOAARRDDIINNGG ++ LLOODDGGIINNGG ++ LLOOCCAALL CCOONNVVEEYYAANNCCEE ++

IINNCCIIDDEENNTTAALL EEXXPPEENNSSEESS ++ CCAAMMPP FFAACCIILLIITTIIEESS ++ CCOO--OORRDDIINNAATTOORR

PPEERRSSOONNNNEELL ++ OOFFFFIICCEE FFAACCIILLIITTIIEESS EETTCC.. GGAAIILL SSHHAALLLL NNOOTT PPRROOVVIIDDEE

AANNYYTTHHIINNGG .. ► UUNNIITT RRAATTEE SSHHOOUULLDD BBEE IINNCCLLUUSSIIVVEE OOFF AALLLL TTAAXXEESS,, DDUUTTIIEESS EETTCC..

((CCSSTT,, LLSSTT,, WWCCTT EETTCC..)) EEXXCCEEPPTT SSEERRVVIICCEE TTAAXX ► BBIIDDDDEERR TTOO QQUUOOTTEE TTHHEE PPEERRCCEENNTTAAGGEE OOFF SSEERRVVIICCEE TTAAXX

AAPPPPLLIICCAABBLLEE AANNDD TTHHEE AAMMOOUUNNTT..

______________________________________________________________

SSIIGGNNAATTUURREE OOFF TTHHEE BBIIDDDDEERR

________________________________________________________________

NNAAMMEE OOFF TTHHEE PPMMCC AAGGEENNCCYY

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 135 of 154

SECTION-VII

ATTACHMENTS

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 136 of 154

ATTACHMENT - I

CONTRACT PROFORMA

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 137 of 154

CONTRACT AGREEMENT FORM AGREEMENT for “_________” (hereinafter called the "Job") made on ______ day of _________, 2009 between M/s _________, hereinafter called the “CONSULTANT” (which term shall unless excluded by or repugnant to the subject or context include its successors and permitted assignees) of the one part and the GAIL (India) Limited hereinafter called “GAIL” (which term shall unless excluded by or repugnant to the subject or context include its successors and assignees) of the other part. WHEREAS GAIL being desirous of having provided for execution of certain work mentioned, enumerated or referred to in the LOA including Completion Schedule of job has called for proposal. A. The CONSULTANT has examined the Job specified in Bid Document of GAIL and has satisfied himself

by careful examination before submitting his proposal as to the nature of the Job and local conditions, the nature and magnitude of the Job, the availability of manpower and materials necessary for the execution of Job and has made local and independent enquiries and obtained complete information as to the matters and thing referred to, or implied in LOA or having any connection therewith and has considered the nature and extent of all probable and possible situations, delays, hindrances or interference’s to or with the execution and completion of the Job to be carried out under the Agreement, and has examined and considered all other matters, conditions and things and probable and possible contingencies, and generally all matters incidental thereto and auxiliary thereof affecting the completion of the Job and which might have included him in making his proposal.

B. The LOA including Completion Schedule of Job and Letter of Acceptance of proposal form part of this Agreement though separately set out herein and are included in the expression Agreement wherever herein used.

AND WHEREAS GAIL accepted the bid of the CONSULTANT for the provision and the execution of the said Job at the values stated in bid and finally approved by GAIL upon the terms and subject to the conditions of Agreement. NOW THIS AGREEMENT WITNESSETH AND IT IS HEREBY AGREED AND DECLARED AS FOLLOWS: 1. In consideration of the payment to be made to the CONSULTANT for the Job to be executed by him

the CONTRACTOR hereby covenants with GAIL that the CONSULTANT shall and will duly provide, execute and complete the said Job and shall do and perform all other acts and things in the Agreement mentioned or described or which are to be implied there from or may be reasonably necessary for the completion of the said Job and at the said times and in the manner and subject to the terms and conditions or stipulations mentioned in the Agreement.

2. In consideration of the due provision execution and completion of the said Job, GAIL does hereby

agree with the Agreement that GAIL will pay to the CONSULTANT the respective amounts for the Job actually done by him and approved by GAIL at the amount specified in this LOA, such payment to be made at such time in such manner as provided for in the Agreement and LOA.

In witness whereof the parties have executed these presents in the day and the year first above written. Signed and Delivered for and on behalf of Signed and Delivered for and on behalf of M/s GAIL (India) Limited M/s _________________ Date: ________________ Date: _________________ Place: ________________ Place: _________________ IN PRESENCE OF TWO WITNESSES 1.__________________________ 1. _____________________ 2.__________________________ 2. _____________________

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 138 of 154

ATTACHMENT II

PERFORMANCE EVALUATION

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 139 of 154

PURPOSE OF ATTACHMENT –II

PERFORMANCE EVALUATION 1.1 GAIL follows a system of Performance Evaluation of vendors and contractors to

monitor and ensure the timely and smooth completion of supplies, execution of contracts, and maintenance of quality standards. The basic objective is to recognize and develop reliable vendors and contractors who consistently meet or exceed expectations and requirements of GAIL with respect to timely receipt of supplies, completion of work and services and the quality specifications, standards. Vendors and contractors whose performance is not found satisfactory will be debarred from future business with GAIL.

1.2 All the suppliers and contractors working with GAIL will be evaluated based on the

parameters defined in the performance Rating Data Sheet as per enclosed Annexure –I of attachment –II.

1.3 The evaluated rating may be falling in any of the following category depending upon

the scoring of points in various parameters. Very good Good Fair Poor 1.4 In case, a vendor/contractor is not able to achieve a minimum scoring of 60% points

in the given parameters individually and collectively for all parameters i.e. with poor rating shall be put on “HOLIDAY” for a period of 1 to 3 years depending upon the nature of failure on their part in performance and such venders and contractors will not be allowed to participate in business with GAIL for the Holiday period.

1.5 The vendors and contractors will be blacklisted for submitting forged documents in

respect of experience, turnover and any other requirements forming the basis for pre qualifying / eligibility criteria irrespective of their rating in the past. Such vendors & Contractors will be debarred from having business with GAIL in future.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 140 of 154

GAIL (India) Limited Annexure - 1

PERFORMANCE RATING DATA SHEET (FOR PROJECTS/CONSULTANCY JOBS)

(i) Project/Work Centre

:

(ii) Order/Contract No. & Date

:

(iii) Brief description of Items Works/Assignment

:

(iv) Order/Contract value (Rs.)

:

(v) Name of Vendor/Contractor/Consultant

:

(vi) Contracted delivery/Completion Schedule

:

(vii) Actual delivery/Completion date

:

Performance Parameter

Delivery/Completion Performance

Quality Performance

Reliability Performance

Total

Maximum Marks 40 40 20 100 Marks Allocated (*)

Remarks (if any) PERFORMANCE RATING (**): Note: (*) Allocation of marks would be as per enclosed instructions (**) performance rating shall be classified as under :

Sl. No. Range (Marks) Rating 1. 60 & below POOR 2. 61-75 FAIR 3. 76-90 GOOD 4. MORE THAN 90 VERY GOOD

Signature of Authorised signatory with name & designation

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 141 of 154

INSTRUCTIONS FOR ALLOCATION OF MARKS

Marks are to be allocated as under: 1.1 DELIVERY/COMPLETION PERFORMANCE : 40 MARKS Delivery Period/completion Schedule Delay in weeks Marks a) Up to 3 months Before CDD 40 Delay upto 4 weeks 35 Delay upto 8 weeks 30 Delay upto 10 weeks 25 Delay upto 12 weeks 20 Delay upto 16 weeks 15 More than 16 weeks 0 b) Above 3 months Before CDD 40 Delay upto 4 weeks 35 Delay upto 8 weeks 30 Delay upto 10 weeks 25 Delay upto 16 weeks 20 Delay upto 20 weeks 15 Delay upto 24 weeks 10 More than 24 weeks 0 1.2 QUALITY PERFORMANCE: 40 MARKS

For Normal Cases: No Defects/No Deviation/No failure: 40 marks i) Rejection/Defects Marks to be allocated on

pro-rata basis for acceptable quantity as compared to total quantity for normal cases

10 Marks

ii) When quality failure endangers the system integration and safety of the system.

Failure of severe nature - Moderate nature - low severe nature

0 marks 5 marks 10-25 marks

iii) Number of deviations 1. No. deviation 2. No. of deviations

<=2 3. No. of deviations

>2

5 Marks 2 marks 0 marks

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 142 of 154

1.3 RELIABILITY PERFORMANCE: 20 MARKS

A. FOR WORKS / CONTRACTS

i) Submission of order acceptance, agreement, PBG, Drawings and other documents within time

4 marks

ii) Mobilization of resources as per Contact and in time 4 marks iii) Liquidation of Check-list points 4 marks iv) Compliance to statutory and HS & E requirements

Or Reliability of Estimates/Design/Drawing etc. in case of Consultancy jobs

4 marks

v) Timely submission of estimates and other documents for Extra, Substituted & AHR items

4 marks

B. FOR SUPPLIES

i) Submission of order acceptance, PBG , Drawing and other documents within time

5 marks

ii) Attending complaints and requests for after Sales service/warranty repairs and/or query/advice (upto the evaluation period)

5 marks

iii) Response to various correspondence and conformance to standards like ISO

5 marks

iv) Submission of all required documents including Test Certificates at the time of supply

5 marks

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 143 of 154

ATTACHMENT III

AGREED TERMS & CONDITIONS

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 144 of 154

ATTACHMENT III BRIEF SUMMARY OF AGREED TERMS AND CONDITIONS

Bidder’s Name M/s............................. Bid Document No. : GAIL/RJY/C&P/SR20036987/RAO Offer Ref................................ This Questionnaire duly filled in should be returned along with each copy of Un-priced Bid failing which Offer/Bid will not be considered for evaluation. Clauses confirmed hereunder should not be repeated in the Bid. S. No. Description Bidder's Confirmation

1 It is noted that deviations to Terms & Conditions shall lead to rejection of offer, as specified in the Bid Document.

2 Ensure and confirm that prices quoted in ‘Price Schedules / Schedule of Rates’ are for complete scope of work as defined in the Bid document.

2.1 Confirm Price Schedule / Schedule of Rates – 1 to 3 are submitted duly filled in & signed in Priced Bid.

2.2 Confirm Un-priced (i.e. with prices blanked out) submitted in un-priced bid.

3 Confirm that the offer shall remain valid for acceptance up to 4 months from Final Bid Due Date/Date of Opening of Bids

4 Confirm that quoted prices shall remain firm, Fixed and valid until completion of the contract Performance.

5 Please confirm the quoted prices are in Indian Rupees / US $ / Home Currency of the bidder.

5.1 Currency of Quote is:

6 Confirm acceptance of Completion period as per requirement Specified in Bid Document (to be reckoned from date of Fax of Acceptance)

7 Confirm complete technical literatures/ catalogues and Users reference list submitted along with offer.

8 Confirm acceptance of Price Reduction Schedule (PRS) for delay in completion beyond contractually agreed completion schedule as specified in the Bid Document.

9 Confirm that in case of delay in completion beyond contractual completion date the invoice shall be submitted for the amount duly reduced to the extent of PRS.

10 Confirm in case of delay in completion beyond contractual completion date, any new or additional taxes and duties imposed shall be to Consultant’s account.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 145 of 154

11 Confirm acceptance of relevant Terms of Payment as specified in the Bid Document.

12 Confirm that Contract Performance Bank Guarantee (CPBG) for 5% of order/contract value shall be furnished within 15 days of Fax of Intent, valid for period as per Bid Document.

13 Confirm acceptance in Toto of the Terms & Conditions contained in-

a) i) Instructions to Bidders ii) General Conditions of Contract & Special

Conditions of Contract iii) Scope of work & Schedule of Rates iv) All other commercial documents/ attachments of

Bid Document.

b) All the terms & conditions have been indicated in this format (including annexure, if any) and have not been repeated in the bid elsewhere. It is noted that Terms & Conditions indicated elsewhere including any printed Terms & Conditions, shall not be considered by Owner.

14 The bidder is required to state whether any of the Directors of bidder is a relative of any Director of Owner or the Bidder is a firm in which any Director of Owner or his relative is a partner or the Bidder is a private company in which any Director of Owner is a member or Director.

15 All correspondence must be in English Language only.

16 Indicate Name & Contact No. (Telephone/Fax No.) of person(s) to whom queries, if any, are to be addressed against your bid.

17 Owner reserves the right to make any change in the terms & conditions of the Bid Document and to reject any or all bids including those received late or incomplete.

18 Confirm that all Bank charges associated with Bidder’s Bank shall be borne by Bidder.

Signature ________________________ Name ________________________ Designation ________________________ Office Stamp ________________________ Tel No. ________________________ Fax No. ________________________ e-mail ________________________

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 146 of 154

ATTACHMENT- IV

INTEGRITY PACT

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 147 of 154

INTEGRITY PACT Bidder is required to sign the Integrity Pact with GAIL as per format & terms conditions enclosed with tender. In case a bidder does not sign the integrity Pact, his bid shall be liable for rejection.

COMMITMENTS AND OBLIGATIONS OF THE “COUNTERPARTY” a) The Counterparty, directly or indirectly (through agent, consultant, advisor, etc.), shall

not pay any bribe / influence or give undue / unlawful benefit to anyone to gain undue advantage in dealing with GAIL.

b) The Counterparty will not engage in collusion of any kind including price fixation etc. with other Counterparts.

c) The counterparty will not pass GAIL’s confidential information to any third party unless specifically authorized by GAIL in writing.

d) The Counterparties shall promote and observe best ethical practices within their respective organizations.

e) The Counterparty shall inform the Independent External Monitor. f) If it received any demand, directly or indirectly, for a bribe/ favour or any illegal

gratification / payment / benefit; g) If it comes to know of any unethical or illegal payment/benefit; h) If it makes any payment to any GAIL associate. i) The Counterparty shall not make any false or misleading allegations against GAIL or

its associates.

VIOLATIONS & CONSEQUENCES: a) If a Counterparty commits a violation of its Commitments and Obligations under the

Integrity Pact Programme during bidding process, their entire Earnest Money Deposit / Bid Security, would be forfeited and in addition, they may be blacklisted from the GAIL business in future.

b) In case of violation of the Integrity pact by Counterparty after award of the Contract, GAIL shall be entitled to terminate the Contract. GAIL would forfeit the security deposits, encash the bank guarantee(s) and other payments payable to Counterparty in such cases.

c) Subject to satisfaction of the Independent External Monitor, GAIL may ban / blacklist / put on holiday and exclude the Counterparty from future dealings until GAIL is satisfied that the Counterparty shall not commit any such violation in future.

d) In addition to above, GAIL reserves its right to initiate criminal proceedings against the violating Counterparty, if the allegations by Counterparty are found frivolous, untrue and misleading and may also impose exemplary cost for the same.

e) The Counterparty will be entitled to claim as determined by the Independent External Monitor, if the above (d) is found incorrect.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 148 of 154

INDEPENDENT EXTERNAL MONITORS (IEMS)

The following three Independent External Monitors (IEMs) have been appointed by GAIL, in terms of Integrity Pact (IP) which forms part of GAIL Tenders/ Contract.

(i) Dr A K Kundra [email protected] (ii) Shri S C Tripathi [email protected] (iii) Shri Mukesh Rohtagi [email protected]

This panel is authorized to examine / consider all references made to it under this tender. The bidder (s), in case of any dispute (s) / complaint (s) pertaining to this tender may raise the issue either with designated Tender Issuing Officer in GAIL or directly, with the IEMs on the panel c/o Chief Vigilance Officer, GAIL (India) Limited, GAIL Bhawan, 16, Bhikaiji Cama Place, R.K. Puram, New Delhi – 110066.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 149 of 154

INTEGRITY PACT

(To be executed on plain paper and applicable to all tenders of the value of Rs. one crore and above)

Between GAIL (India) Limited, a Government of India Public Sector, (here-in-after referred to as "Principal ").

AND

……………………….............. …… (Here-in-after referred to as "The Bidder/Contractor"). (Principal and the Bidder/Contractor are here-in-after are referred to individually as "Party" or collectively as "Parties").

PREAMBLE

The Principal intends to award under laid down organizational procedures, contract/s for ………………………………………………….. The Principal values full compliance with all relevant laws and regulations, and the principles of economic use of resources, and of fairness and transparency in its relations with its Bidder/s and Contractor/s. In order to achieve these goals, the Principal co-operates with the renowned International Non-Governmental Organization 'Transparency International' (TI). Following TI's national and international experience, the Principal will appoint an Independent External Monitor who will monitor the tender process, the execution of the contract etc. for compliance with the principles mentioned above.

Section 1 - Commitments of the Principal 1. The Principal commits itself to take all measures necessary to prevent corruption and

to observe the following Principles in this regard:-

i) No employee of the Principal, either in person or through family members, including relatives, will in connection with the tender for or the execution of a contract, demand or accept a promise for or accept for him/herself or for a third person, any material or immaterial benefit to which he/she is not legally entitled.

ii) The Principal shall, during the tender process treat all Bidders with equity. The

Principal undertakes and ensures that before and during the tender process shall provide and share 'the same information to all Bidders and will not provide to any Bidder confidential/additional information through which one particular Bidder could take an advantage in relation to the tender process or the contract execution.

iii) The Principal will exclude from the process all known prejudiced persons.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 150 of 154

2. If the Principal obtains information on the conduct of any of its employees which is a

criminal offence under the Anti-Corruption Laws of India, or if there be a substantive suspicion in this regard, the Principal will inform its Vigilance Office and in addition can initiate disciplinary actions.

Section 2 - Commitments and Undertakings by the Bidder/Contractor 1. The Bidder / Contractor commit and undertakes to take all measures necessary to

prevent malpractices & corruption. He commits himself to observe the following principles during his participation in the tender process and during the contract execution:

i) The Bidder / Contractor undertakes not to, directly or through any other

person or firm offer, promise or give or influence to any employee of the Principal associated with the tender process or the execution of the contract or to any other person on their behalf any material or immaterial benefit to which he / she is not legally entitled in order to obtain in exchange any advantage of any kind whatsoever during the tender process or during the execution of the contract.

ii) The Bidder / Contractor undertakes not to enter into any undisclosed

agreement or understanding, whether formal or informal with other Bidders. This applies in particular to prices, specifications, certifications, subsidiary contracts, submission or non-submission of bids or any other action to restrict competitiveness or to introduce cartelisation in the bidding process.

iii) The Bidder / Contractor undertakes not to commit any offence under the

relevant Anti-corruption Laws of India. Further, the Bidder / Contractor will not use improperly any information or document provided by the Principal as part of the business relationship regarding plans, technical proposals and business details, including information contained or transmitted electronically for the purposes of competition or personal gain and will not pass the information so acquired on to others.

iv) The Bidder / Contractor will, when presenting his bid undertakes to disclose

any and all payments made, is committed to or intends to make to agents, brokers or any other intermediaries in connection with the award of the contract.

2. The Bidder / Contractor will not instigate and allure third persons / parties to commit

offences outlined above or be an accessory to such offences.

Section 3 - Disqualification from tender process and exclusion from future contracts

If the Bidder, before the award of contract, has committed a transgression through a violation of any provisions of Section 2 or in any other form so as to put his reliability or credibility as Bidder into question, the Principal shall be entitled to disqualify, put on holiday or blacklist the Bidder including from the future tender process or to terminate the contract, if already signed, on that ground.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 151 of 154

1. If the Bidder/Contractor has committed a transgression through a violation of any

provisions of Section 2 so as to put his reliability or credibility into question, the Principal shall be entitled to exclude including blacklist and put on holiday the Bidder/Contractor from entering into any GAIL future contract tender processes. The imposition and duration of the exclusion will be determined by the severity of the transgression. The severity will be determined by the Principal taking into consideration the full facts and circumstances of each case particularly taking into account the number of transgressions, the position of the transgressors within the company hierarchy of the Bidder and the amount of the damage. The exclusion may be imposed for a minimum period of 6 months and maximum of three years.

2. A transgression is considered to have occurred if the Principal after due consideration

of the available evidence, concludes that no reasonable doubt is possible. 3. The Bidder with its free consent and without any influence agrees and undertakes to

respect and uphold the Principal's absolute rights to resort to and impose such exclusion and further accepts and undertakes not to challenge or question such exclusion on any ground, including the lack of any hearing before the decision to resort to such exclusion is taken. This undertaking is given freely and after obtaining independent legal advice.

4. Subject to the full satisfaction of the Principal, the exclusion of the Bidder /

Contractor could be revoked - by Principal prematurely if the bidder / contractor can prove that he has restored / recouped the damage caused by him and has installed a suitable corruption prevention system in his organization.

Section 4 - Forfeiture of EMD / Security Deposits

1. If the Principal has disqualified the Bidder from the tender process prior to the award

in terms of Section 3, and during the execution of the contract, the Principal shall forfeit earnest money deposit / bid security money, encash the bank guarantee including due payments in addition to blacklisting or putting on holiday the bidder and terminating the contract.

2. If the Principal has terminated the contract according to Section 3, or if the Principal

is entitled to terminate the contract according to Section 3, the Principal shall be entitled to demand and recover from the Contractor liquidated damages equivalent to Earnest Money Deposit / Security Deposit / Performance Bank Guarantee.

3. The bidder agrees and undertakes to pay the said amounts without protest or demur

subject only to condition that if the Bidder / Contractor can prove and establish that the exclusion of the Bidder from the tender process or the termination of the contract after the contract award has caused no damage or less damage than the amount of the liquidated damages, the Bidder / Contractor shall compensate the Principal only to the extent of the damage in the amount proved.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 152 of 154

Section 5 - Previous transgression

1. The Bidder swears on oath that no previous transgression has occurred during the last

three years with any other Company in any country conforming to the TI approach or including with any other Public Sector Enterprise / Undertaking in India that could justify his exclusion from the tender process.

2. If the Bidder makes incorrect statement on this subject, he shall be disqualified from

the tender process or the contract, if already awarded, could be liable to be terminated on this ground.

Section 6 - Equal treatment to all Bidders / Contractors / Subcontractors

1. The Bidder / Contractor undertakes to demand from all its sub-contractors, if any, an

undertaking and commitment in conformity with this Integrity Pact, and to submit it to the Principal before signing of the contract.

2. The Principal will enter into agreements with similar conditions, as stipulated herein,

with all Bidders, Contractors and Subcontractors. 3. The Principal shall disqualify from the tender process all Bidders who do not sign this

Pact or violate any of its provisions. Section 7 - Criminal charges against violating Bidders / Contractors / Sub-contractors

If the Principal obtains knowledge of conduct of a Bidder, Contractor or

Subcontractor, or of an employee or a representative or an associate of a Bidder, Contractor or Subcontractor which constitutes corruption, or if the Principal has substantive suspicion in this regard, the Principal will inform the Vigilance Office / Department for initiating appropriate action for above.

Section 8 -Independent External Monitor / Monitors

(Three in number depending on the size of the contract)

(To be decided by the Chairperson of the Principal)

1. The Principal appoints competent and credible external independent Monitor for this Pact. The task of the Monitor is to review independently and objectively, whether and to what extent the parties comply with the obligations under this agreement.

2. The Monitor is not subject to any instructions by the representatives of the parties and

performs his functions neutrally and independently. He reports to the Chairperson of the Board of the Principal.

3. The Contractor accepts that the Monitor has the right to access without restriction to

all Project documentation of the Principal including that provided by the Contractor. The Contractor will also grant the Monitor, upon his request and demonstration of a valid interest, unrestricted and unconditional access to his project documentation. The

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 153 of 154

same is applicable to Sub-contractors. The Monitor is under contractual obligation to treat the information and documents of the Bidder / Contractor / Sub-contractor with confidentiality.

4. The Principal will provide to the Monitor sufficient information about all meetings

among the parties related to the Project provided such meetings could have an impact on the contractual relations between the Principal and the Contractor. The parties offer to the Monitor the option to participate in such meetings.

5. As soon as the Monitor notices, or believes to notice, a violation of this agreement he

will so inform the Management of the Principal and request the Management to discontinue or heal the violation or to take other relevant action. The monitor can in this regard submit non-binding recommendations. Beyond this, the Monitor has no right to demand from the parties that they act in a specific manner, refrain from action or tolerate action. However, the Independent External Monitor shall give an opportunity to the bidder/contractor to present its case before making its recommendations to the Principal.

6. The Monitor will submit a written report to the Chairperson of the Board of the

Principal within 8 to 10 weeks from the date of reference or intimation to him by the 'Principal' and should the occasion arise, submit proposals for taking corrective measures.

7. Monitor shall be entitled to compensation by the Principal on the same terms &

conditions as being extended to/provided to Outside Expert Committee Members of ONGC.

8. If the Monitor has reported to the Chairperson of the Board a substantiated suspicion

of an offence under relevant Anti-Corruption laws of India, and the Chairperson has not, within reasonable time, taken visible action to proceed against such offence or reported it to the Vigilance Office, the Monitor may also transmit this information directly to the Central Vigilance Commissioner, Government of India.

9. The word 'Monitor' would include both singular and plural. 10. Independent External Monitor shall be required to maintain confidentiality of the

information acquired and gathered during their tenure / role as Independent Monitor. Any breach in this regard would be subject to the legal judicial system of India.

11. The Independent External Monitors - shall be responsible to oversee the

implementation of Integrity Pact Program to prevent corruption, bribes or any other unethical practices in the GAIL. However, Monitor(s) shall be personally and severally be liable for any action or suit brought by Bidder / Contractor / against the Monitor, in case the findings of Independent Monitor is / are found incorrect or biased or prejudiced.

12. Independent External Monitor(s) shall be required to furnish an Undertaking and shall

disclose before taking any assignment that he / she has no interest in the matter or connected with the party (bidder / contractor) in any manner.

GAIL (INDIA) LIMITED

Bid Document No. GAIL/RJY/C&P/SR20036987/RAO Page 154 of 154

Section 9 - Pact Duration

The provisions of this Pact shall come into effect from the date of signing of this Pact by the both parties. It expires for the Contractor 12 months after the last payment under the respective contract, and for all other Bidders 6 months after the contract has been awarded.

If any claim is made / lodged by either party during this time, the same shall be binding and continue to be valid despite the lapse of this pact as specified above, unless it is discharged/determined by the Chairperson of the Principal.

Section 10 - Miscellaneous Provisions

1. This agreement is subject to Indian Law. Place of performance and jurisdiction is the

Registered Office of the Principal, i.e. New Delhi. The Arbitration clause provided in main tender document / contract shall not be applicable for any issue / dispute arising under Integrity Pact.

2. Changes and supplements as well as termination notices, if any, need to be made in

writing. Side Agreements have not been made. 3. If the Contractor / Bidder is a partnership concern or a consortium, this agreement

must be signed by all partners or consortium members. 4. In case any or several of the provisions of this agreement turn out to be void, the

remainder of this pact shall remain valid. The parties to this pact however, shall strive to come to an agreement to their original intentions in such a case.

______________________ _________________________ (Name & Designation) (Name & Designation) For the Principal For the Bidder/Contractor Place:__________________ Witness-1 : ________________________ Date:___________________ Witness-2 : ________________________