Download - Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Transcript
Page 1: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

stm.sciencemag.org/cgi/content/full/12/537/eaax1798/DC1

Supplementary Materials for

PBX1 expression in uterine natural killer cells drives fetal growth

Yonggang Zhou, Binqing Fu*, Xiuxiu Xu, Jinghe Zhang, Xianhong Tong, Yanshi Wang, Zhongjun Dong, Xiaoren Zhang,

Nan Shen, Yiwen Zhai, Xiangdong Kong, Rui Sun, Zhigang Tian*, Haiming Wei*

*Corresponding author. Email: [email protected] (H.W.); [email protected] (Z.T.); [email protected] (B.F.)

Published 1 April 2020, Sci. Transl. Med. 12, eaax1798 (2020)

DOI: 10.1126/scitranslmed.aax1798

The PDF file includes:

Materials and methods Fig. S1. Validation of rat anti-human/mouse PBX1 monoclonal antibody. Fig. S2. The transcription factor PBX1 is more conserved than other related NK cell transcription factors. Fig. S3. Expression of the GPFs, PTN and OGN, is up-regulated after overexpression of PBX1 in dNK-like cells. Fig. S4. PBX1G21S retains DNA binding activity. Fig. S5. dNK cells are the dominant subset expressing growth factors in early pregnancy. Fig. S6. PBX1 is highly expressed in uterine NK cells from pregnant Pbx1HA-tag knock-in mice. Fig. S7. Knockout of Pbx1 alters the gene expression profile in uterine NK cells, and the bone development of embryos is limited in pregnant Pbx1f/f;Ncr1Cre mice. Fig. S8. Fetal growth is normal in pregnant EomesNK-KO mice. Fig. S9. Working model of PBX1+ NK cells promoting early fetal development. Table S1. Clinical data for patients with RSA and healthy controls. Table S2. Commercial kits for cell preparation used in this study. Table S3. Recombinant proteins used in this study. Table S4. Antibodies used in this study. Table S5. Human-specific primer sequences. Table S6. Construction of siRNAs of the target gene. Table S7. Primer sequences for the ChIP assay. Table S8. Construction of oligonucleotides of Pbx1HA tag knock-in mice.

Other Supplementary Material for this manuscript includes the following: (available at stm.sciencemag.org/cgi/content/full/12/537/eaax1798/DC1)

Data file S1 (Microsoft Excel format). Original data.

Page 2: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Materials and methods

Preparation of rat anti-human/mouse PBX1 monoclonal antibody

The intact human PBX1 homolog, PBX1b, expressed in and purified from prokaryotic cells,

was used to immunize rats to prepare antibodies. Immunization of rats and preparation of

monoclonal antibody hybridoma cells were entrusted to Absea Biotechnology Ltd (Beijing,

China). Resulting monoclonal antibodies from different clones were used as primary antibodies

in flow cytometry to screen for those suitable for use in flow cytometry detection, and clone

2D11 was selected. Antibody specificity was verified by flow cytometry and western blotting to

detect PBX1b protein in cells where it was knocked down (siRNA-PBX1) or knocked down and

recovered by overexpression from a eukaryotic vector. The anti-PBX1 (2D11) monoclonal

antibody was labeled using an Alexa Fluor 488 Antibody Labeling Kit (Invitrogen, Cat. No.

A10235). After collection of the labeled eluate, the antibody concentration (M) and labeling

efficiency (C) were calculated by measuring absorbance values at 280 and 494 nm (A280 and

A494); M = 1 mg/ml, C = 5.8 moles of Alexa Fluor 488 dye per mole of antibody.

Analysis of the conservation of NK cell-associated genes

Phylogenetic homology analysis of NK cell-associated genes, including transcription

factors, functional factors, and characteristic surface molecules, was conducted by querying

protein sequences using the NCBI HomoloGene system

(https://www.ncbi.nlm.nih.gov/homolo-gene) to analyze the distinguishing features of human

NK cells compared with those from other species. The results of cluster analysis are presented as

heat maps. Gene orthologs of NK cell-associated transcription factors in different species were

queried using the HCOP database, supported by the National Human Genome Research Institute

(https://www.genenames.org/cgi-bin/hcop) and the OrthoDB database, which was developed by

Zdobnov’s Computational Evolutionary Genomics group (http://cegg.unige.ch/).

Generation of Pbx1HA-tag knock-in mice

For PBX1 monitoring and for ChIP assays of murine NK cells, HA-tagged knock-in Pbx1

mice were constructed by CRISPR-Cas9-mediated homology-directed repair technology, as

previously reported (33). Briefly, annealed sgRNA oligos targeting the start codon of the Pbx1

gene were inserted into an expression plasmid (pUC57-sgRNA, Addgene plasmid #51132).

Linearized expression plasmid was used as a template to transcribe sgRNA in vitro with T7 RNA

polymerase. Human codon-optimized SpCas9 linearized vector (Addgene plasmid #44758) was

used as a template to transcribe Cas9 mRNA in vitro with a T7 ULTRA Transcription Kit

(Ambion, AM1345), according to the manufacturer’s instructions. Single-stranded

oligodeoxynucleotides were synthesized for homology-driven repair (Integrated DNA

Technologies). Purified sgRNA, Cas9 mRNA, and ssODNs were diluted to 15 ng/μl, 20 ng/μl,

and 40 ng/μl, respectively, with DEPC-treated water in a final volume of 50 μl. The mixture was

injected into the cytoplasm and male pronucleus of mouse zygotes using standardized

microinjection and embryo transfer procedures. The genotype of genetically ablated mice was

assessed by sequence analysis of the Pbx1 gene (fig. S6A). Oligonucleotide sequences are listed

in table S8.

Page 3: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Immunofluorescence

Purified human dNK and pNK cells were fixed with 4% paraformaldehyde for 15 min and

incubated in blocking solution (5% normal goat serum, 0.5% Triton-X in PBS) for 1 h at room

temperature. Cells were then incubated in primary antibody overnight at 4 ℃ and then with

fluorescent secondary antibody at room temperature for 1 h in the dark, followed by staining

with DAPI. Antibodies were diluted as follows: anti-CD45 (1:200), anti-CD56 (1:200),

anti-PBX1 (1:400), and fluorescent secondary antibodies (1:200). A LSM880+ Airyscan system

(Zeiss) was used to capture images, and ZEN software (ZEN 2012, Carl Zeiss Microimaging)

was applied to process the data.

Multiplex immunohistochemistry

Decidual and villus tissues from healthy controls and patients with URSA were fixed in

neutral formalin, and then embedded in paraffin for sectioning. Paraffin sections were dewaxed

in xylene solution and rehydrated with ultrapure water. Antigen was retrieved using Tris-EDTA

antigen retrieval solution (pH 9.0) in a boiling water bath for 20 min, then naturally cooled to

room temperature. Multiplex immunohistochemistry of paraffin sections was conducted using

Tyramide SuperBoost Kits with Alexa Fluor Tyramides (Thermo Fisher, cat# B40922 and

B40913), according to the kit instructions. Sections were incubated with primary antibody

overnight at 4 ℃; antibodies were diluted as follows: anti-CD56 (1:200), anti-EpCAM (1:200),

anti-PTN (1:50), and anti-OGN (1:50). Fluorescent dye staining was conducted at room

temperature for 3 min and terminated using a stop solution for 20 min at room temperature.

Nuclei were stained with DAPI. Antifade Mounting Medium (Thermo Fisher, cat# P36934) was

added to tissue sections dropwise, followed by a sealing treatment, and an LSM880+ Airyscan

system (Zeiss) was used to capture images.

Immunohistochemistry

Paraffin sections of villus tissue from healthy controls and patients with URSA were

prepared. After dewaxing and rehydration, sections were boiled in 1x citrate unmasking solution

in a water bath for 20 min for antigen retrieval, and naturally cooled to room temperature.

Staining of Ki67 and PCNA was then conducted at 4 ℃ overnight. Antibody dilutions were as

follows: anti-Ki67 (1:400) and anti-PCNA (1:4000). After staining with secondary antibody for

30 min at room temperature, samples were developed using DBA substrate for 30 sec, followed

by counterstaining with hematoxylin.

Page 4: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Fig. S1. Validation of rat anti-human/mouse PBX1 monoclonal antibody.

(A) Schematic representation of vector for prokaryotic expression of PBX1. (B) Schematic

representation of the vector for eukaryotic overexpression of PBX1. (C) Coomassie blue staining

of rat anti-human/mouse PBX1 antibody. (D) Western blot analysis of PBX1 in 293T cells

transfected with siRNA-PBX1, or a mixture of siRNA-PBX1 and eukaryotic PBX1 overexpression

vector with rat anti-human/mouse PBX1 antibody. Lamin B was used as an internal reference.

NC, negative control. (E) Flow cytometry analysis of PBX1 in 293T cells with transfected with

siRNA-PBX1, or a mixture of siRNA-PBX1 and eukaryotic PBX1 overexpression vector, with rat

anti-human/mouse PBX1 antibody and secondary AF647-anti-rat IgG antibody. NC, negative

control.

Experiments (D and E) were independently performed twice with similar results.

Page 5: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable
Page 6: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Fig. S2. The transcription factor PBX1 is more conserved than other related NK cell

transcription factors.

(A) Strategy for gating dNK and pNK cells from mononuclear cells. Numbers are the percentage

in each indicated subset. (B) Confocal microscopy of the expression of PBX1 in purified dNK

and pNK cells. Scale bar, 5 μm. (C) Phylogenic homology analysis of transcription factors,

functional factors, and characteristic surface molecules associated with NK cells. Protein

sequences were identified using the NCBI HomoloGene system to analyze the distinguishing

features between proteins in human NK cells and those from other species. The results of

homology cluster analysis are presented as a heat map. Numbers and colors indicate the degree

of homology of ortholog sequences from other species with human sequences. (D) Phylogeny of

orthologous signature NK cell transcription factor genes from different species identified by

querying the HCOP and OrthoDB databases. Numbers and colors in the plot indicate the

probability of the existence of an orthologous gene in other species.

Page 7: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable
Page 8: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Fig. S3. Expression of the GPFs, PTN and OGN, is up-regulated after overexpression of

PBX1 in dNK-like cells.

(A) Schematic representation of the in vitro cell system for induction of dNK-like cells using

cytokine cocktail stimulation of human umbilical cord blood stem cells. (B) Gating strategy for

dNK-like cells during the process of cell induction. (C) Quantitative RT-PCR of PBX1, TBX21,

EOMES, PTN, and OGN in cells during different weeks of the process of inducing dNK-like

cells from hematopoietic stem cells (n = 8), normalized to their expression in week 2 cells (ns >

0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 by ANOVA). w, week. (D-I) Intracellular flow

cytometry analysis (D, F, and H) and statistical analysis of the MFI (E, G, and I) of expression of

PBX1 (D and E), PTN (F and G), OGN (F and G), and other transcription factors (H and I) in

week 4 dNK-like cells overexpressing PBX1 from a lentiviral vector (ns > 0.05, **P < 0.01,

****P < 0.0001 by ANOVA). iNK-PBX1, dNK-like cells transfected with PBX1-overexpressing

lentiviral vector. iNK-Mock, dNK-like cells transfected with control lentiviral vector. Data from

three independent experiments. (J) Western blot for PBX1 to assess the effects of siRNA-PBX1

vectors transfected into 293T cells. GAPDH was used as an internal control. (K) Quantitative

RT-PCR analysis of PBX1, PTN, and OGN expression in purified human dNK cells transfected

with siRNA-PBX1 or siRNA-NC (negative control) vectors and co-cultured with EVT cells (n =

6); expression was normalized to that in cells transfected with a combination of siPBX1-1 and

siPBX1-2(siPBX1-1 &2) (****P < 0.0001 by ANOVA). (L and M) CD3-CD45+CD56+ NK cells

were purified from fresh decidual tissues from two first trimester pregnancies. Differential

analysis of enriched gene promoter region sequences by scatter plot (L) and heat map (M) of data

from a ChIP assay from decidual NK cells using anti-PBX1 antibody. No. 1 and No. 2 indicate

data of two experimental replicates generated using anti-PBX1 antibodies. IgG antibody,

negative control. The numbers in (B) are the percentage in each indicated subset. The numbers in

(D, F, and H) represent the MFI for the indicated molecules.

Page 9: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Fig. S4. PBX1G21S retains DNA binding activity.

(A) Representative flow cytometry showing the percentages of CD3-CD45+CD56+ dNK cells in

samples purified from first trimester pregnancies of patients with URSA (representative images

from n = 5) and healthy controls (representative images from n = 3). Numbers show the

percentage of each indicated subset. (B) Representative chromatograms generated by Sanger

sequencing of PBX1 exon 1 PCR products amplified from decidual tissue from patients with

Page 10: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

URSA (upper panel). Amino acid sequence, functional domains, and mutation site in PBX1

(lower panel). (C) Exome sequencing results for dNK cells from healthy controls and five

patients with URSA. SNP counts per site (left). Overview of dNK cell mutation status for

transcription factors and functional molecule-related genes (right). (D) Western blot analysis to

detect the presence of PBX1 in samples obtained by DNA pull-down assay using PTN or

OGN-binding site probes in 293T cells with knockdown of PBX1WT (wild-type) and

overexpressing PBX1G21S. PBX1G31S is a natural variant of PBX1. 293T cells with PBX1WT

knocked down served as negative controls. BS, binding site.

Page 11: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable
Page 12: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Fig. S5. dNK cells are the dominant subset expressing growth factors in early pregnancy.

(A) Gating strategy for the cell subset expressing growth factors PTN and OGN from human

decidual tissue in the first trimester of pregnancy. Red, CD3-CD45+CD56+ NK cells. Blue,

CD45+ immune cells. Black, CD45- non-immune cells. (B) Statistical analysis of the MFI for

PTN and OGN in CD3-CD45+CD56+ NK cells, CD45+ immune cells, and CD45- non-immune

cells from decidual tissue of pregnant women about 40 days (n = 4) and 60 days (n = 3) of

pregnancy (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 by ANOVA). (C) Western

blot for PTN and OGN in human dNK cells of healthy controls (n = 3) and URSA patients with

PBX1G21S mutant (n=5). β-actin was used as an internal control. (D and E) Confocal microscopy

of the expression of PTN (top, red) and OGN (bottom, red) in CD56+ dNK cells (green) in

human decidual tissue of healthy controls (D) and URSA patients with PBX1G21S mutant (E) in

the first trimester of pregnancy. Scale bar, 50 μm. (F and G) Confocal microscopy of the

expression of PTN (top, red) and OGN (bottom, red) in extravillous trophoblast (EVT) cells in

human villous tissue of healthy controls (F) and URSA patients with PBX1G21S mutant (G) in the

first trimester of pregnancy. EpCAM+ villous cytotrophoblast (green) proliferation that give rise

to EVT cells. Scale bar, 50 μm. (H and I) Immunohistochemical staining of Ki67 (H) and PCNA

(I) in human villous tissue of healthy controls and URSA patients with PBX1G21S mutant in the

first trimester of pregnancy. Scale bar, 50 μm. (J) Statistical analysis of the volume of gestation

sac from the color B-ultrasound of healthy pregnant women (n = 18) and women with URSA and

impaired PBX1 at 7 weeks ± 5 days of gestation (n = 13) (**P < 0.01 by two-tailed t test).

Page 13: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable
Page 14: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Fig. S6. PBX1 is highly expressed in uterine NK cells from pregnant Pbx1HA-tag knock-in

mice.

(A) Schematic of the process of construction of Pbx1HA-tag knock-in mice using CRISPR-Cas9

technology. (B) Gating strategy and intracellular flow cytometric analysis of PBX1 in NK cells

from spleen of Pbx1HA-tag knock-in mice at gestational day (gd) 11.5 (n = 4) and virgin mice (n =

4) as controls. (C) Statistical analysis of the MFI of PBX1 in (B) (ns > 0.05 by two-tailed t test).

(D) Gating strategy and intracellular flow cytometric analysis of PBX1 in NK cells from uterine

tissue of Pbx1HA-tag knock-in mice at gestational day (gd) 11.5 (n = 4) and virgin mice (n = 4) as

controls. (E) Statistical analysis of the MFI of PBX1 in (D) (****P < 0.0001 by two-tailed t

test). (F) Flow cytometry and frequencies of eGFP+ cells in Rosa26f-stop-f-eGFP;Vav1Cre and

Rosa26f-stop-f-eGFP;Ncr1Cre mice to assess the efficiency of Cre expression in Cre-transgenic mice.

(G) Intracellular flow cytometric analysis of PBX1 in uterine NK cells from Pbx1f/f;Vav1Cre and

Pbx1f/f;Ncr1Cre mice to assess the effect of the Pbx1 gene knockout. The numbers in (B, D, F,

and G) represent the percentages of indicated subsets or the MFI of indicated molecules.

Page 15: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable
Page 16: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Fig. S7. Knockout of Pbx1 alters the gene expression profile in uterine NK cells, and the

bone development of embryos is limited in pregnant Pbx1f/f;Ncr1Cre mice.

(A, B, and C) RNA sequencing analysis of uterine NK cells from Pbx1f/f and Pbx1f/f;Ncr1Cre

mice at gestational day (gd) 11.5. KEGG pathway analysis of differentially expressed genes (A).

Heat map of differentially expressed cytokine genes (B) and receptor and chemokine genes (C)

in uterine NK cells. (D) Von Kossa staining of skulls of embryos from Pbx1f/f and Pbx1f/f;Ncr1Cre

pregnant female mice mated with B6 male mice at gd16.5. Scale bar: 1 mm. (E) SafraninO-fast

green staining of skulls of embryos from Pbx1f/f and Pbx1f/f;Ncr1Cre pregnant female mice mated

with B6 male mice at gd16.5. Scale bar, 1 mm. Experiments (D and E) were independently

performed three times.

Page 17: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Fig. S8. Fetal growth is normal in pregnant EomesNK-KO mice.

(A) Representative picture of fetuses from Eomesf/f and Eomesf/f;Ncr1Cre mice at gd16.5 and

gd19.5. Scale bar, 5 mm. (B) Statistical analysis of the number of live fetuses from Eomesf/f and

Eomesf/f;Ncr1Cre pregnant female mice (n = 6) mated with B6 male mice. (C and D) Statistical

analyses of the weight (C) and body length (D) of fetuses from Eomesf/f and Eomesf/f;Ncr1Cre

mice (n = 6) mated with B6 male mice at gd16.5 and gd19.5. (E) Statistical analysis of the

relative MFI for PTN and OGN in uterine NK cells from Eomesf/f and Eomesf/f;Ncr1Cre mice (n =

6) at gd11.5, normalized to MFI in IgG antibody negative control. Statistical analyses (B, C, D,

and E) were conducted by two-tailed t test (ns > 0.05, *P < 0.05).

Page 18: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Fig. S9. Working model of PBX1+ NK cells promoting early fetal development. The embryo-derived HLA-G signal activates the AKT signal of NK cells in the decidual tissue,

drives the expression of the transcription factor PBX1, and enhances the transcriptional expression

of growth-promoting factors, ultimately promoting early fetal development.

Page 19: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Table S1. Clinical data for patients with RSA and healthy controls.

Age (year)

(Mean ± SD)

Number of

pregnancies

(Mean ± SD)

Number of

spontaneous

abortions

(Mean ± SD)

Pregnancy

(weeks)

(Mean ± SD)

Control

(Fresh, n= 45) 26.76 ± 4.72 1.47 ± 0.50 0.0 ± 0.0 8.24 ± 1.25

URSA

(Fresh, n= 20) 30.25 ± 4.25 2.70 ± 0.80 2.45 ± 0.60 8.98 ± 1.36

URSA

(Cryopreserved,

n= 45)

30.15 ± 4.67 2.65 ± 0.74 2.42 ± 0.61 9.11 ± 1.65

RSA-ECA

(Cryopreserved,

n= 30)

27.97 ± 4.60 2.34 ± 0.61 2.24 ± 0.51 9.72 ± 1.40

Page 20: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Table S2. Commercial kits for cell preparation used in this study.

Recombinant Proteins Sources Identifier

Anti-PE Microbeads Miltenyi Biotec Cat# 130-048-801,RRID:AB_244373

NK cell Isolation Kit, human Miltenyi Biotec Cat# 130-092-657

CD34 MicroBead Kit, human Miltenyi Biotec Cat# 130-046-702

Lineage Cell Depletion Kit, mouse Miltenyi Biotec Cat# 130-090-858

Nucleofector Kits for Human

Natural Killer Cells Lonza Cat# VPA-1005

Page 21: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Table S3. Recombinant proteins used in this study.

Recombinant Proteins Sources Identifier

Recombinant Human SCF PeproTech Cat# 300-07

Recombinant Human Flt3L PeproTech Cat# 300-19

Recombinant Human IL-15 PeproTech Cat# 200-15

Recombinant Murine SCF PeproTech Cat# 250-03

Recombinant Murine Flt3L PeproTech Cat# 250-31L

Recombinant Murine IL-2 PeproTech Cat# 212-12

Recombinant Murine IL-3 PeproTech Cat# 213-13

Recombinant Murine IL-6 PeproTech Cat# 216-16

Recombinant Murine IL-7 PeproTech Cat# 217-17

Recombinant Murine IL-15 PeproTech Cat# 210-15

Page 22: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Table S4. Antibodies used in this study.

Reagent or Resource Sources Identifier

Human

Anti-human CD11b PE-CY7 BD Cat# 557743, RRID:AB_396849

Anti-human CD103 BV 605 BioLegend Cat# 350217, RRID:AB_2564282

Anti-human CD27 PE BD Cat# 555441, RRID:AB_395834

Anti-human CD3 PerCP-Cy5.5 BioLegend Cat# 300328, RRID:AB_1575008

Anti-human CD3 APC-Cy7 BD Cat# 557832, RRID:AB_396890

Anti-human CD34 FITC BD Cat# 555821, RRID:AB_396150

Anti-human CD39 PE-CY7 BioLegend Cat# 328211, RRID:AB_2293623

Anti-human CD45 BV 510 BD Cat# 555483, RRID:AB_395875

Anti-human CD45 Purified CST Cat# 13917, RRID:AB_2750898

Anti-human CD49a Alexa Fluor 647 BioLegend Cat# 328310, RRID:AB_2129242

Anti-human CD56 BV 421 BioLegend Cat# 362552, RRID:AB_2566061

Anti-human CD56 Alexa Fluor 647 BD Cat# 557711, RRID:AB_396820

Anti-human CD56 BV 510 BioLegend Cat# 318340, RRID:AB_2561944

Anti-human CD56 Purified CST Cat# 3576, RRID:AB_2149540

Anti-human CD9 PE BioLegend Cat# 312105, RRID:AB_2075893

Anti-human ITGB2 BV 421 BD Cat# 743370

Anti-human EOMES PerCP-eFluor 710 Thermo Cat# 46-4877-41, RRID:AB_2573758

Anti-human EOMES Purified Biolegend Cat# 662001, RRID:AB_2564181

Anti-human T-bet PE Thermo Cat# 12-5825-82, RRID:AB_925761

Anti-human T-bet Purified Thermo Cat# 14-5825-80, RRID:AB_763635

Anti-Human/Mouse phospho-S6 Ribosomal

(S235/S236) PE

Thermo Cat# 12-9007-41, RRID:AB_2572666

Anti-human phospho-S6 Ribosomal Purified Thermo Cat# 14-9007-80, RRID:AB_2572910

Rat-Anti-human/mouse PBX1 Alexa Fluor 488 This paper N/A

Anti-human PBX1 Purified CST Cat# 4342S, RRID:AB_2160295

Anti-human PTN Purified LifeSpan Cat# LS-C162291

Anti-human OGN Purified LifeSpan Cat# LS-B10948

Anti-human PDK1 Purified CST Cat# 13037; RRID: AB_2798095

Anti-human PDK2 Purified Abcam Cat# ab68164, RRID:AB_11156499

Anti-human AKT1 Purified CST Cat# 2938, RRID:AB_915788

Anti-human Phospho-Akt1 (Ser473) Purified CST Cat# 9018, RRID:AB_2629283

Anti-human Phospho-Akt (Thr308) Purified CST Cat# 13038, RRID:AB_2629447

Anti-human HLA-G Purified Biolegend Cat# 335904; RRID: AB_10641840

Anti-human ILT2 Purified Biolegend Cat# 333704; RRID: AB_1089088

Anti-human EpCAM Purified Abcam Cat# ab7504, RRID:AB_ 305949

Anti-human Ki-67 Purified CST Cat# 9449, RRID:AB_ 2797703

Anti-human PCNA Purified CST Cat# 2586, RRID:AB_ 2160343

Anti-human GAPDH Purified CST Cat# 5174, RRID: AB_10622025

Anti-human ACTIN Purified CST Cat# 3700, RRID:AB_2242334

Anti-human Lamin B Purified BOSTER Cat# PB9611

Mouse

Anti-mouse CD3ε PerCP-Cy5.5 BioLegend Cat# 100328, RRID:AB_893318

Anti-mouse CD3 BV 605 BD Cat# 563004, RRID:AB_2737945

Anti-mouse CD45.2 APC-Cy7 BioLegend Cat# 109824, RRID:AB_830789

Anti-mouse CD49a BV 786 BD Cat# 740919, RRID:AB_2740560

Anti-mouse CD49b BV 421 BD Cat# 563063, RRID:AB_2737983

Page 23: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Anti-mouse NK-1.1 PE-Cy7 BioLegend Cat# 108714, RRID:AB_389364

Anti-mouse NK-1.1 BV 605 BioLegend Cat# 108740, RRID:AB_2562274

Anti-mouse Eomes eFluor 660 Thermo Cat# 50-4875-82, RRID:AB_2574227

Anti-mouse T-bet PE BioLegend Cat# 644810, RRID:AB_2200542

Anti-mouse PTN Purified LifeSpan Cat# LS-C295980

Anti-mouse OGN Purified LifeSpan Cat# LS-C387062

Anti-Ki67 BV 510 BD Cat# 563462, RRID:AB_2738221

Anti-HA Purified Transgen Cat# HT301-01

Isotype Control

Mouse IgG1, κ FITC BD Cat# 555909, RRID:AB_396216

Mouse IgG1, κ Alexa Fluor 488 BD Cat# 557702, RRID:AB_396811

Mouse IgG1, κ PE BD Cat# 555749, RRID:AB_396091

Mouse IgG1, κ PerCP-Cy5.5 BD Cat# 552834, RRID:AB_394484

Mouse IgG1, κ PerCP-eFluor 710 Thermo Cat# 46-4714, RRID:AB_1834453

Mouse IgG1, κ PE-Cy7 BD Cat# 557872, RRID:AB_396914

Mouse IgG1, κ Alexa Fluor 647 BD Cat# 557714, RRID:AB_396823

Mouse IgG1, κ APC-Cy7 BD Cat# 557873, RRID:AB_396915

Mouse IgG1, κ BV 421 BD Cat# 562438, RRID:AB_11207319

Mouse IgG1, κ BV 510 BioLegend Cat# 400172, RRID:AB_2714004

Mouse IgG1, κ BV 605 BioLegend Cat# 400161, RRID:AB_11125373

Hamster IgG PerCP/Cy5.5 BioLegend Cat# 400931

Hamster IgG1,λ BV 605 BioLegend Cat# 400943

Hamster IgG2,λ1 BV 786 BD Cat# 565864

Mouse IgG2a, κ PE-Cy7 BD Cat# 552868, RRID:AB_394501

Mouse IgG2a, κ APC-Cy7 BD Cat# 557751,

Mouse IgG2a, κ BV 605 BD Cat# 563144

Rat IgG2a, κ Alexa Fluor 660 Thermo Cat# 50-4321, RRID:AB_10598640

Rat IgM, κ BV421 BD Cat# 562595

Rabbit IgG Purified CST Cat# 2729S, RRID:AB_1031062

Rat IgG Purified Thermo Cat# 02-9602, RRID:AB_2532969

Secondary antibody

Goat Anti-Rabbit IgG FITC BD Cat# 554020, RRID:AB_395212

Goat Anti-Rat IgG Alexa Fluor 647 BioLegend Cat# 405416, RRID:AB_2562967

Goat Anti-Mouse IgG APC BioLegend Cat# 405308, RRID:AB_315011

Goat Anti-Rat IgG BV421 BioLegend Cat# 405414, RRID:AB_10900808

Goat anti-Rabbit IgG Alexa Fluor 488 Thermo Cat# A-11008, RRID:AB_143165

Goat anti-Rabbit IgG Alexa Fluor 647 Thermo Cat# A-32733, RRID:AB_2633282

Goat anti-Mouse IgG Alexa Fluor 546 Thermo Cat# A-11030, RRID:AB_144695

Goat anti-Rat IgG Alexa Fluor 647 Thermo Cat# A-21247, RRID:AB_141778

Goat Anti-Rabbit IgG HRP BOSTER Cat# BA1054

Goat Anti-Mouse IgG HRP BOSTER Cat# BA1050

Rabbit Anti-Rat IgG HRP BOSTER Cat# BA1058

Page 24: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Table S5. Human-specific primer sequences.

Genes Oligonucleotides

Primers for human ACTB

(NM_001101.3)

Forward: TGACGTGGACATCCGCAAAGACC

Reverse : CTCAGGAGGAGCAATGATCTTGA

Primers for human PBX1

(NM_002585)

Forward: CCATCTCAGCAACCCTTACCC

Reverse: GAACCAGCCGAGTTGGGAGT

Primers for human TBX21

(NM_013351.2)

Forward: CACGTCCACAAACATCCTGT

Reverse: GATCATCACCAAGCAGGGAC

Primers for human EOMES

(NM_005442.3)

Forward: CTGGCTTCCGTGCCCACGTC

Reverse: CATGCGCCTGCCCTGTTTCG

Primers for human PTN

(NM_002825)

Forward: CCTCCCTGTCAGGGCGTAAT

Reverse: GACGGATGACTCACTGGTCTCTTT

Primers for human OGN

(NM_024416.4)

Forward: GAGGATAAATACCTGGATGGA

Reverse: GTGCGTAAAGATAGGCTGATT

Page 25: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Table S6. Construction of siRNAs of the target gene.

Oligonucleotides Sources Identifier

siRNA targeting sequence: Negative Control

UUCUCCGAACGUGUCACGUTT GenePharma Cat# A06001

siRNA targeting sequence: siPBX1-1,

GCUUUAAACUGCCACAGAATT GenePharma Lot# 20160808662

siRNA targeting sequence: siPBX1-2,

CCAUCCAGAUGCAGCUCAATT GenePharma Lot# 201608081092

siRNA targeting sequence: siPBX1-3,

CCAAAGAGGAGUUAGCCAATT GenePharma Lot# 201608081257

shRNA targeting sequence: pLKO.1-shPbx1

CAGAAATTCTGAATGAATAT Sangon Lot# 9401112278

siRNA targeting sequence: siAKT1-1,

GCACCUUCAUUGGCUACAATT GenePharma Lot# 20190725463

siRNA targeting sequence: siAKT1-2,

GGAGACUGACACCAGGUAUTT GenePharma Lot# 20190725465

siRNA targeting sequence: siPDK2-1,

CCAAGUACAUAGAGCACUUTT GenePharma Lot# 20190725466

siRNA targeting sequence: siPDK2-2,

GCUGUCCAUGAAGCAGUUUTT GenePharma Lot# 20190725467

Page 26: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Table S7. Primer sequences for the ChIP assay.

Target sequences Oligonucleotides

Primers for ChIP human PTN

(-1000/700)

Forward: GCCTTAGCGTCTTTCCTGTA

Reverse: GTGCCTTTAGCAACCTATTTAGT

Primers for ChIP human PTN

(-650/350)

Forward: AAGGCACCAAGGAAACCAAA

Reverse: CAATTGATGGCATTTTAGGTTACA

Primers for ChIP human OGN

(-2100/1800)

Forward: TGGACTATGTTGTCATTTGGTG

Reverse: ATCTTTGCCAGCATTCTTTC

Primers for ChIP human OGN

(-1350/1050)

Forward: CATTCAGCAAACAAAAGTATC

Reverse: TGAAATAGGACACCAAATGA

Primers for ChIP human OGN

(-950/650)

Forward: TGCCTAGCACAATAGTGAGT

Reverse: CAATGTTCTTTCTCCCTTAT

Primers for ChIP human OGN

(-350/50)

Forward: CAGTTATCTCCCCATTTGTC

Reverse: AGTGAGGTTTAAGTCAGGGA

Primers for ChIP mouse Ptn

(-1500/1201)

Forward: CAGCAATGGGAAGGGAGGC

Reverse: CTTTGCTCTTCCTAATGCTGGAT

Primers for ChIP mouse Ptn

(-1200/901)

Forward: AGGAAGAGCAAAGCTACCAGTAC

Reverse: TTTCCAAGACTGGCAATAGACT

Primers for ChIP mouse Ptn

(-900/601)

Forward: AACTAGTCTATTGCCAGTCTTGG

Reverse: AGACCCATTAATTCTCCAGATC

Primers for ChIP mouse Ptn

(-600/301)

Forward: AATGGGTCTTGATTAAAGTCAGTT

Reverse: TCTTGTTGTTTGCATCACTTGGT

Primers for ChIP mouse Ptn

(-300/1)

Forward: ACAACAAGATTGGGTTTGGGCT

Reverse: CTGGAGTAAAGAGAAAGGGGGAA

Primers for ChIP mouse Ogn

(-2100/1800)

Forward: TACTACAAAATTTTGGAATCAAAC

Reverse: GTTGTTGTTGTTGTTGTTATTGTTA

Primers for ChIP mouse Ogn

(-1300/1000)

Forward: ATATCCTCAGCACATTCTCTCTT

Reverse: GAATCATACTTTCACACACAGTAT

Primers for ChIP mouse Ogn

(-900/600)

Forward: CAGATGTAGGTTAGAACTAGAAG

Reverse: TCACTAGTTAGCTAGTAATGTTGC

Primers for ChIP mouse Ogn

(-750/450)

Forward: CCTGTATTCAGCAGTTAAAATTC

Reverse: TGTAAAAGAAGCAGTTCTGAGAA

Primers for ChIP mouse Ogn

(-350/50)

Forward: ATTTATACTGCAGGTACCCCGAG

Reverse: TGATGACTGTGGAACGAAACTCT

Page 27: Supplementary Materials for...2020/04/01  · China). Resulting monoclonal antibodies from different clones were used as primary antibodies in flow cytometry to screen for those suitable

Table S8. Construction of oligonucleotides of Pbx1HA tag knock-in mice.

Oligonucleotides Sources

sgRNA targeting sequence: sgPBX1-ATG,

GCTGCCGGAGCCTTCAGAGA

Sangon

PAGE Ultramer DNA Oligo: Pbx1 Donor

GGATTTGAAGACAGCTTGAAGGATAAAAAGCCTCGGTGCTTCC

CAGGCGCCGATCCGAGGAGCCGAAGAGGAAGAGCCGGGGCTG

CCGGAGCCTTCAGAGATGTACCCATACGATGTTCCAGATTACG

CTGACGAGCAGCCGAGGCTGATGCATTCCCACGCTGGGGTCGG

GATGGCCGGACACCCCGGCCTGTCCCAG

IDT