i
SEROLOGICAL AND MOLECULAR STUDIES OF MYCOPLASMA MYCOIDES
MYCOIDES SMALL COLONY IN NORTHERN NIGERIA
By
DR. NWANKPA NICK DOUGLAS PG/PHD/03/34614
DEPARTMENT OF VETERINARY PATHOLOGY AND MICROBIOLOGY
UNIVERSITY OF NIGERIA, NSUKKA
FEBRUARY, 2008
ii
SEROLOGICAL AND MOLECULAR STUDIES OF MYCOPLASMA MYCOIDES
MYCOIDES SMALL COLONY IN NORTHERN NIGERIA
By
DR. NWANKPA NICK DOUGLAS PG/PHD/03/34614
A THESIS SUBMITTED TO THE DEPARTMENT OF VETERINARY PATHOLOGY AND MICROBIOLOGY, FACULTY OF VETERINARY MEDICINE IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE AWARD OF THE DEGREE OF DOCTOR OF PHILOSOPHY IN VETERINARY MICROBIOLOGY UNIVERSITY OF NIGERIA, NSUKKA
FEBRUARY, 2008
iii
CCEERRTTIIFFIICCAATTIIOONN
We certify that Dr. Nwankpa, Nick Douglas carried out this research work in the
Department of Veterinary Pathology and Microbiology at the University of Nigeria
Nsukka.
The work presented herein is original and has not been previously reported anywhere
else.
__________________________
Professor, S. I. Oboegbulem
(Supervisor)
__________________________
DATE
__________________________ ____________________________
Dr. J. I. Ihedioha Prof. G. O. Egwu
(Head of Department) (External Examiner)
__________________________ ____________________________
DATE DATE
iv
DDEEDDIICCAATTIIOONN
To the very few who live a life of service to mankind and derive pleasure in touching
positively the lives of people and bringing sunshine into their lives.
v
AACCKKNNOOWWLLEEDDGGEEMMEENNTTSS
I would like to thank the National Veterinary Research Institute Vom for financing my
PhD program, and Centre International Recherché Agronomic pour Development
(CIRAD) Montpellier, France for financing the bench work carried out in their
laboratory. I am most grateful to Dr. (Mrs.) L. H. Lombin, Chief Executive of NVRI
Vom. She was truly the driving force behind this work. Her resilience and motivation
were a great source of encouragement and inspiration to me. She is a mother, a lady and
a leader. I am grateful and truly honoured to be associated with her.
I wish to thank my supervisors Prof. S. I. Oboegbulem for accepting me as his student
and for the constant support, advice, and providing directions during the research and
writing of this thesis. Sincere thanks also go to Dr. K. F. Chah for the dedication,
constructive criticisms, and encouragement during the work.
I wish also to thank my supervisor at CIRAD Dr. Francois Thiaucourt, the head of
Bacteriology and World Reference Laboratory for Contagious Bovine Pleuropneumonia
(CBPP) and Dr. Manso-silvan Lucia. Their technical skills, ideas, determination, and
commitment made this work worthwhile. I also thank all the other members who have
also contributed (Lorenzon Sophie, Armelle Peyraud, Woubit Sallah, Marie Caroline,
and Yaya Abubakar).
I wish to express my appreciation to my superiors and colleagues in NVRI, Dr. A.A.
Makinde, Dr. J. U. Molokwu, Dr. David Shamaki, Dr. P. A. Okewole, Dr. Atanda
Olabode and others too numerous to mention.
vi
I also thank all the staff, Faculty of Veterinary Medicine, University of Nigeria, Nsukka,
Dr. S.V.O. Shoyinka, Dr. J.I. Ihedioha, and Dr. J.I. Onunkwo. I appreciate all my
friends too numerous to mention especially Dr. C. O. Nwaigwe and his Lolo for their
very wonderful hospitality at Nsukka, and Mr. Sunday Makinde, Bacterial Vaccine
Production, always there to lend a helping hand, you are truly a friend and a brother.
I truly wish to appreciate my darling wife, Veronica Rume Nwankpa for her love,
understanding, and support. I thank her particularly for accepting the PhD as a genuine
excuse for me to leave my home, sometimes at very odd periods and for the beautiful
bouncing baby girl Michelle Fatima Nenpin whose delivery coincided with the end of
the work.
Finally, I thank our heavenly father for giving me the grace to contribute to the benefit
of mankind.
vii
________________________________________________TABLE OF CONTENTS
TITLE PAGE _________________________________________________________ i
CERTIFICATION ____________________________________________________ iii
DEDICATION _______________________________________________________ iv
ACKNOWLEDGEMENTS _____________________________________________ v
TABLE OF CONTENTS _____________________ Error! Bookmark not defined.
LIST OF FIGURES _________________________ Error! Bookmark not defined.
LIST OF PLATES __________________________ Error! Bookmark not defined.
LIST OF TABLES ______________________________________________ xiii
ABSTRACT___________________________________________________xiv
CHAPTER ONE ___________________________ Error! Bookmark not defined.
INTRODUCTION ______________________________________________________ 1
1.1 Background of the Study _________________________________________ 1
1.2 Statement of the Problem _________________________________________ 2
1.3 Aims and Objectives ____________________________________________ 3
1.4 Relevance and Justification ______________________________________ 4
CHAPTER TWO _______________________________________________________ 5
LITERATURE REVIEW ________________________________________________ 5
2.1. The Mycoplasmas ______________________________________________ 5
2.1.1 Phylogeny and Genome characteristics ___________________________________ 8
2.2 Contagious Bovine Pleuropneumonia (CBPP) ______________________ 13
2.2.1 Historical Perspective ___________________________________________________ 13
2.2.1.1. CBPP in Africa _____________________________________________________ 15
CBPP in Tanzania _______________________________________________ 18
CBPP in Botswana _______________________________________________ 18
CBPP in Nigeria _________________________________________________ 19
2.2.2 Transmission and spread of CBPP ______________________________________ 21
viii
2.2.4 Clinical Signs __________________________________________________________ 24
2.2.4 Pathology ______________________________________________________________ 28
2.2.5 Serology _______________________________________________________________ 28
2.2.6 Molecular diagnosis ____________________________________________________ 31
2.2.7 Economic importance ___________________________________________________ 33
2.2.8 Vaccines ________________________________________________________________ 34
2.3 Mycoplasma mycoides cluster ____________________________________ 37
2.3.1 Taxonomy and Phylogeny of the Mycoides cluster ________________________ 38
2.3.2 Pathogenicity of members of the M. mycoides cluster _____________________ 40
2.3.2.1 Capsular polysaccharide ______________________________________________ 40
2.3.2.2 Hydrogen peroxide ___________________________________________________ 41
2.3.2.3 Variable surface protein _______________________________________________ 41
2.4 Molecular methods for the identification and characterization of
Mycoplasmas ________________________________________________ 42
CHAPTER THREE ___________________________________________________ 50
SEROLOGICAL STUDIES _____________________________________________ 50
3.1 Experiment 1: Identification of MmmSC in twelve States of Northern Nigeria
by competitive Enzyme Linked Immuno-Sorbent Assay (c-ELISA). ____ 50
3.1.1 Introduction ___________________________________________________________ 50
3.1.2 Materials and Methods _______________________________________________ 51
3.1.2.1 Competitive Enzyme Linked Immuno-Sorbent Assay (c-ELISA) ____ 54
3.1.3 Results _________________________________________________________________ 54
3.1.4 Discussions ____________________________________________________________ 56
CHAPTER FOUR _____________________________________________________ 60
ISOLATION AND IDENTIFICATION OF MMSC in _______________________ 61
northern nigeria ______________________________________________________ 61
4.1 Experiment 2 : Isolation of Mycoplasma mycoides mycoides ______Small
Colony _____________________________________________________ 61
4.1.1 Introduction ___________________________________________________________ 61
ix
4.1.2 Materials and Methods ________________________________________________ 61
3.2 .1 Culture and isolation _________________________________________________ 62
4. 1.3 Results ________________________________________________________________ 62
4 .1.4 Discussions ___________________________________________________________ 64
4.2 Experiment 3: Identification and confirmation of Mycoplasma mycoides
mycoides Small Colony isolates by specific Polymerase Chain Reaction
(PCR). _____________________________________________________ 67
4.2.1 Introduction ___________________________________________________________ 67
4.2 .2 Materials and Methods ________________________________________________ 68
Extraction of DNA ___________________________________________________ 68
Diagnostic PCR for the detection of MmmSC ________________________ 68
Agarose (2%) gel electrophoresis _____________________________________ 69
4.2.3 Results _________________________________________________________________ 69
4.2.4 Discussions _____________________________________________________________ 75
4.3 Experiment 4: Identification of isolates by MmmSC Specific QPCR ____ 75
4.3.1 Introduction ___________________________________________________________ 75
4.3.2 Materials and Methods ________________________________________________ 76
4.3.3 Results _________________________________________________________________ 78
4.3.4 Discussions _____________________________________________________________ 81
CHAPTER FIVE_____________________________________________________82
5.0 MOLECULAR CHARACTERIZATION OF MMSC ISOLATES ____________ 82
5.1 Experiment 5: Multi-Locus Variable Analysis (MLVA) Variable Number
Tandem Repeats (VNTR) MmmSC TR-34 PCR ____________________ 82
5.1.1 Introduction ___________________________________________________________ 82
Agarose (4%) Gel preparation and migration _________________________ 83
Polyacrylamide (10% ) Gel Electrophoresis __________________________ 84
5.1.3 Results ________________________________________________________________ 85
10% Polyacrylamide Gel electrophoresis ____________________________ 89
5.1.4 Discussions ____________________________________________________________ 92
x
5.2 Experiment 6: Multi-Locus Sequence Analysis (MLSA) on Loc-PG1-0001
and Loc-PG-0103 ____________________________________________ 92
5.2.1 Introduction ___________________________________________________________ 92
5.2.2 Materials and Methods ________________________________________________ 95
PCR for Loc-PG1-0001and Loc-PG1-0103 ___________________________ 96
5.2.3 Results ________________________________________________________________ 97
Allelic profile analysis _______________________________________________ 97
Alleles defined in non-coding sequences Loc-PG1-0001 _______________ 98
Alleles defined in genes of unknown function: Lipoproteins (Lpp) and
Conserved hypothetical proteins (Chp) Loc-PG1-0103 ________________ 98
CHAPTER SIX ______________________________________________________ 109
GENERAL DISCUSSIONS ___________________________________________ 111
6.1 Competitive Enzyme Linked Immuno-sorbent Assay for the estimation of
CBPP prevalence ___________________________________________ 111
6.2 Isolation and Identification of Mycoplasma mycoides mycoides Small
Colony from Northern Nigeria. _________________________________ 113
6.3 Multi-Locus Variable Analysis (MLVA) of Variable Number Tandem Repeats
(VNTR) 34 and Multilocus Sequence Analysis MLSA ______________ 114
6.4 Multi-locus Sequence Analysis (MLSA) on Loc-PG1-0001 and Loc-PG1-0103
115
CONCLUSIONS _____________________________________________________ 123
MAJOR CONSTRAINTS OF THE STUDY_______________________________125 RECOMMENDATIONS______________________________________________126 REFERENCES______________________________________________________128 APPENDIX
I. Preparation of broth and agar medium base for Mycoplasma cultures _________ 156
II. Preparation of supplement for mycoplasma culture medium ________________ 158
III. Preparation of supplement for mycoplasma culture medium _______________ 158
IV. Preparation of broth and agar medium base for Mycoplasma cultures ________ 158
xi
V. Preparation of supplement for mycoplasma culture medium ________________ 158
xii
LIST OF FIGURES
Figure 1: Phylogenic tree of Mollicutes constructed based on the 16SrDNA sequence 11
Figure 2: Map of Nigeria showing the 12 States . _____________________________ 53
Figure 3: Rate of CBPP infection in Bulls and Cows based on the total number sampled
____________________________________________________________________ 57
Figure 4: Graph showing average PI, average OD and infection rates for samples
collected from the various states. _________________________________________ 59
Figure 5: Specific QPCR for the identification of MmmSC _____________________ 79
Figure 6: Temperature dissociation curve for the isolates ______________________ 80
Figure 7: Geographical distribution of the different MmmSC TR 34 types _________ 91
Figure 8: Distribution of alleles of Loc-PG1-0001 in Northern Nigeria __________ 103
Figure 9: Distribution of strains based on the number of repeats for Loc-PG1-0103 in
Northern Nigeria _____________________________________________________ 105
Figure 10: Overall distribution of alleles for combined MLVN TR, MLSA on loc-PG-
0001 and 0103 in Northern Nigeria. ______________________________________ 108
Figure 11: Overall distribution of alleles for combined MLVN TR, MLSA on loc-PG-
0001, and 0103 in Northern Nigeria ________________ Error! Bookmark not defined.
xiii
LIST OF PLATES
PLATE 1 : Electron Micrograph of thin sectioned Mycoplasma. __________________ 7
PLATE 2: Colonies of Mycoplasma mycoides mycoides SC isolated from the specimens
____________________________________________________________________ 66
PLATE 3: MmmSC diagnostic PCR MSC1: 275 bp product from all clones of the
samples ______________________________________________________________ 70
PLATE 4: M. mycoides mycoides Small Colony (048 Bovine, Birnin Kebbi) Isolate __ 73
PLATE 5: (044 Ovine, Fadan kaje) Nasal swab collected from ovine adult in contact
with a CBPP infected herd in Fadan Kaje, Kaduna State _______________________ 74
PLATE 6: MLVA VNTR MmmSC TR-34 PCR: 4% Agarose gel electrophoresis ___ 87
PLATE 7: MLVA VNTR MmmSC TR-34 PCR: 4% Agarose gel electrophoresis ___ 88
PLATE 8: MLVA VNTR MmmSC TR-34 PCR: 10% Poly Acrylamide Gel
Electrophoresis _______________________________________________________ 89
PLATE 9: MLVA VNTR MmmSC TR-34 PCR: 10% Poly Acrylamide Gel
Electrophoresis _______________________________________________________ 90
PLATE 10: Analysis of PCR products on 1 % agarose gel electrophoresis prior to
sequencing __________________________________________________________ 100
PLATE 11: Alignment of sequences on locus Loc-PG1-0001 ___________________ 101
PLATE 12: Alignment of sequences on locus Loc-PG1-0001 ___________________ 102
PLATE 13: alignment of the sequences on locus PG1-0103.There is 4 alleles on this
locus _______________________________________________________________ 104
LLIISSTT OOFF TTAABBLLEESS
xiv
Table 1: Estimated prevalence of CBPP by c-ELISA in 12 Northern States of Nigeria 55
Table 2: Culture and identification of isolates from specimens __________________ 63
Table 3: Isolates identified by Specific PCR for the diagnosis of MmmSC. _________ 71
Table 4: TR 34 Differentiates the Mycoplasma isolates into 5 alleles _____________ 86
Table 5: Overall distribution of alleles for combined MLVN TR, MLSA on loc-PG- 0001
and 0103 in Northern Nigeria.MmmSC strains. _____________________________ 107
Table 6: Polymorphisms between the allelic profiles of Vaccine strains and isolates
from Northern Nigeria. __________________________ Error! Bookmark not defined.
xv
ABSTRACT
Serological and Molecular studies of Mycoplasma mycoides mycoides Small Colony
(MmmSC) was undertaken in Northern Nigeria. The study was aimed at ascertaining
the presence of MmmSC in Northern Nigeria by serological and cultural techniques
including characterization of isolates using current Molecular tools. This study
established links between isolates and the distribution of Contagious Bovine
Pleuropneumonia (CBPP), a disease, caused by this organism in some Northern parts of
Nigeria. A total of 2026 bovine sera samples from twelve states of Northern Nigeria
were screened by c-ELISA technique and 213 tested positive for CBPP. The prevalence
of infection ranged from 2.1 % to 32.5 %, with an overall prevalence of 10.8 %. A total
of 287 tissue samples were also collected from CBPP outbreaks in 5 Northern States
and processed for isolation and identification of Mycoplasma organisms. Among these
is a pleural fluid sample which was collected from a two week old lamb. Thirteen
MmmSC isolates were recovered from the outbreaks with an isolate representing one
outbreak. The isolates were confirmed by conventional and Real Time PCRs and then
characterized by Multilocus Variable-Number Tandem Repeat Analysis (MLVA) and
Multilocus Sequence Analysis (MLSA). All Polymerase Chain Reaction (PCR)
amplifications were performed according to specific protocols. PCR products were
controlled by electrophoretic separation in 1 % agarose gels. Tandem Repeat (TR) 34
PCR products were analyzed on 4 % agarose and 10% polyacrylamide gels. The
relevant loci were sequenced with the corresponding primers. The sequences were
assembled and aligned with the software Vector NTI SuiteTM (InfoMax, 2001). Seven
profiles were defined for the thirteen isolates giving more precision in the definition of
the origin of the strains. The variations observed within the M. mycoides subsp.
mycoides isolates characterized indicates that the problems of differentiation associated
with homogeneity of the Mycoides cluster group can be avoided and the variations also
cast some doubts over the protective ability of a single strain for CBPP. A new allele
was described in this work and assigned a no. 7. Presently, the isolates in this study are
the only MmmSC isolates in Nigeria to be identified and characterized to molecular
level. The study also indicated that the isolates recovered from sheep are identical to
those of bovine, making sheep a potential source of infection for bovine. The tools used
in this study may be useful in the characterization of other isolates of MmmSC from
other parts of Nigeria.
1
CCHHAAPPTTEERR OONNEE
IINNTTRROODDUUCCTTIIOONN
1.1 Background of the Study
Contagious Bovine Pleuropneumonia (CBPP) is a highly contagious disease primarily
of cattle caused by Mycoplasma mycoides subsp. mycoides Small Colony (MmmSC)
bovine biotype (Osiyemi, 1981; Provost et al., 1987; Terlaak, 1992; Taylor et al.,
1992a). On account of its transmissibility and economic impacts, CBPP is now
recognized as a priority trans-boundary disease and has thus been categorized as the
only bacterial disease in the OIE list A diseases (Litamoi et al., 2004). The disease is
considered to be the most economically important cattle disease in Africa causing
greater losses in cattle than any other disease including Rinderpest (OIE, 2003).
Presently the disease is wide spread in Nigeria and the recent wave of civil and religious
unrest which swept most parts of the country only helped to spread the disease by the
unrestricted movement of nomads across state boundaries which made accurate
monitoring difficult (Nwankpa et al., 2003). Several authors have documented the
outbreaks, prevalence, and the economic importance of the disease in Nigeria (Egwu et
al., 1996, Osiyemi, 1981, Nwanta and Umoh 1992). The disease was present in most
sub-Saharan countries and had not only reinfected countries like Uganda and Kenya but
has also infected countries like Tanzania (1990) , Botswana (1995) and Rwanda (1995)
which had been CBPP free (Nicholas and Bashiruddin 1995).
Control of CBPP in Nigeria was probably achieved by 1965 following 10years of mass
vaccination, well organized disease reporting, efficient laboratory diagnosis, effective
quarantine, and strict control of cattle movement. This did not last long as the disease
re-emerged a few years later perhaps from chronic carriers (Lungers) through one or all
2
of the neighbouring countries of Niger, Chad and Cameroon (Nwanta and Umoh, 1992).
In spite of an eradication campaign launched in 1970, outbreaks rose rapidly from 1986
onwards to a peak in 1989 where over 10,000 cattle were affected (Nwanta and Umoh,
1992). Alarmed by the situation, the meeting of the FAO/OIE/OUA IBAR Consultative
Group on Contagious Bovine Pleuropneumonia was convened for the first time in over
25years in June 1998, to discuss the deteriorating situation of the disease in Africa
(FAO, 2000). The meeting focused on the wealth of new data accumulating on the
causative organism of CBPP, Mycoplasma mycoides subspecies mycoides small-colony
type (MmmSC). Disease status, current knowledge, surveillance and control strategies,
as well as research directions were extensively discussed (FAO, 2001). The meeting
concluded that, “CBPP was the most important threat to the cattle industry in Africa.”
Although deterioration of Veterinary services could not be demonstrated, it was further
observed that the inadequacy of veterinary services, epidemiological knowledge, the
inadequacy of control systems and regional coordination, coupled with civil unrest
contributed to the endemicity of CBPP in the African continent.
1.2 Statement of the Problem
Contagious Bovine Pleuropneumonia (CBPP) is a contagious disease primarily of cattle.
The disease is prevalent in Africa where it is responsible for high economic losses and
is a limiting factor in cattle production. While relatively accurate data can be gathered
on which areas are infected, what is less clear is the prevalence of infection, as reported
cases are usually inaccurate and subjective (Nicholas et al., 2000). The establishment of
the true prevalence rates of CBPP in infected countries is a crucial prerequisite to
mounting a successful disease control programme, and a precursor to national efforts
(FAO, 2004). The increasing importance of the disease emphasizes the need for an
3
accurate data on the prevalence of the infection if prompt and effective control measures
are to be instituted. Presently, in Nigeria, the extent and pattern of CBPP prevalence is
largely unknown (Aliyu, et al., 2000).
Although M. mycoides SC has been isolated from goats and sheep (Brandão, 1995;
Srivastava et al., 2000; Kusiluka et al., 2000), the role of small ruminants in the
epidemiology of CBPP has not been demonstrated and no reservoir either in wild
animals has been established (Bell et al., 1990; Masiga et al., 1996). There is therefore,
the need to determine if small ruminants are involved in any way in the epidemiology of
the disease in Nigeria. There is also a need to determine the type of strains of MmmSC
involved in the various out breaks in Nigeria. It has been shown that cattle affected with
CBPP in Europe since 1980 have shown less severe clinical signs and lower mortality
than affected animals in Africa (Nicholas et al., 1996). Studies of experimental
infections in cattle, with a representative strain isolated from European outbreaks of
CBPP have indicated that the strain was less pathogenic than a typical African strain of
M. mycoides subsp. Mycoides SC (Abdo et al., 1998). It thus raises the question of the
source of current outbreaks in Africa. Are the current outbreaks due to a resurgence of
dormant African strains from the eradication campaigns of the early 60’s, or is it
possible that Africa is witnessing an import of the European strains causing the current
wave of outbreaks.
1.3 Aims and Objectives
The aims and objectives of this research are to:
1. Determine the prevalence of Mycoplasma mycoides mycoides Small Colony in
Northern Nigeria by serological and cultural methods.
4
2. Confirm the presence of the aetiological agent of CBPP (Mycoplasma mycoides
mycoides Small Colony) using conventional and Real-Time PCR
3. Molecularly characterize the isolates of Mycoplasma mycoides mycoides Small
Colony, the agent of CBPP in Nigeria, using Variable Number Tandem Repeat 34
(VNTR 34) and Multi-locus sequence Analysis (MLSA).
4. Determine the role if any of small ruminants in the epidemiology of Contagious
Bovine Pleuropneumonia in Nigeria.
1.4 Relevance and Justification
1. Various reports have indicated that the disease is endemic in Nigeria hence the
need for better concerted efforts in control strategies.
2. Field experiences have shown that the current vaccines are not protective enough
and vaccinations campaigns not very efficient.
3. Outbreaks of CBPP have indicated differences in the pathogenicity of the agents
involved thereby indicating a likelihood of several circulating strains of MmmSC
in the field.
4. Presently, current tools for the diagnosis of CBPP have a lot of limitations and
drawback, hence the need for better and efficient ones.
5
CHAPTER TWO
LLIITTEERRAATTUURREE RREEVVIIEEWW
2.1. The Mycoplasmas
Mycoplasma is a trivial name for a group of microorganisms which belong to the class
Mollicutes (Maniloff 1992). Mollicutes evolved from AT-rich, gram-positive bacteria
to become the smallest self replicating organisms known to date. During their
degenerative evolution, their genomes considerably reduced in size and many genes,
common to most bacteria, were lost. Most characteristically, mollicutes (mollis= soft,
cutis= skin) lost the genes involved in the synthesis of a cell wall. The presence of a cell
membrane as the only boundary implies an intrinsic resistance to antimicrobial agents
that inhibit cell wall synthesis, sensitivity to osmotic shock and an ability to pass filters
typically used to sterilise solutions (Stakenborg et al., 2005). Moreover, because of their
small genomes, mollicutes have limited biosynthetic capabilities and occur as obligate
parasites in a wide diversity of plant and animal hosts. Thus far, tremendous efforts
have led to the description of more than 200 species, and still, this number likely
represents only a minor fraction of the mollicutes present in nature (Stakenborg et al.,
2005). Of the eight genera currently described within the class of Mollicutes, the genus
Mycoplasma is by far the most studied (Stakenborg et al.,, 2005).
Incidentally, the first mollicute to be isolated and described was Mycoplasma mycoides
subsp. mycoides small colony (SC) in 1898, but it took another few decades before
other animal Mycoplasmas were found (Bové, 1999). For instance, the porcine pathogen
M. hyopneumoniae was only demonstrated in 1965 (Mare and Switzer, 1965). The first
human Mycoplasma, M. pneumoniae, was described in 1937 (Asai et al., 1993).
6
Mycoplasmas are wide spread in nature as parasites of humans, mammals, reptiles, fish,
arthropods, and plants. It has been indicated that the extanct Mycoplasmas are the
surviving descendants of exceedingly primitive bacteria that existed before the
development of a peptidoglycan based cell wall (Razin, 1992). The class mollicutes
consists of nine genera, Ureaplasma, Entomoplasma, Mesoplasma, Spiroplasma,
Acholeplasma, Anaeroplasmas, Asteroleplasma, and Phytoplasma. In general,
Mollicutes are the smallest and simplest self-replicating organisms, being made of a
plasma membrane, ribosomes, and a circular double-stranded DNA molecule (Razin
1997b). They are characterized by their small genome size and are thought to have
undergone reductive evolution, losing many genes possessed by more complex bacteria
in the process (Plate. 1). They lack many genes, including those for cell wall synthesis
and for the production of all 20 amino acids, as well as genes encoding enzymes of the
citric acid cycle and the majority of all other biosynthetic genes (Razin et al., 1998).
They can survive with a reduced genome since they are able to acquire these products
from their host in vivo and as such they are considered the model organisms for the
study of essential functions in living cells. It could be argued that Mycoplasmas are
close to the concept of "ideal parasites," usually living in harmony with their host.
(Nicholas, 2004). Despite their small genome size, Mycoplasmas cause a wide range of
disease in both humans and animals. The primary habitats of human and animal
Mycoplasmas are the mucous surfaces of the respiratory and urinogenital tracts, the
eyes, alimentary canal, mammary glands and joints. They are associated with
pneumonia, arthritis and reproductive disorders. Infections with pathogenic
Mycoplasmas are rarely of the fulminant type but, rather, follow a chronic course.
7
0.5 µm
PLATE 1 : Electron Micrograph of thin sectioned Mycoplasma.Cells are bounded by a single membrane showing in section the characteristic trilaminar shape. The cytoplasm contains thin threads representing sectioned chromosome and dark granules representing ribosomes (Adapted from Shmuel Razin, 1996 Courtesy of RM Cole, Bethesda, Maryland).
However, very little is known about their pathogenicity factors or mechanisms of
persistence in the host. There are only a few characterized virulence factors of
Mycoplasmas; these include, in certain
hydrogen peroxide (Miles
scavenge arginine from host cells (Sasaki
to explain how Mycoplasmas
their paucity of virulence factors and lack of cell wall. Presently, about 190
Mycoplasma species have been described under the class
2.1.1 Phylogeny and Genome characteristics
Early attempts to classify the mollicutes by immunological and molecular approaches
provided useful taxonomic data but
studies on the phylogenetic relationships of the mollicutes have concentrated on the
highly conserved Mycoplasma
constraints, has changed much less than the bulk of the genome (
widely agreed that the mollicutes that have already been characterized and
taxonomically defined constitute only a part, apparently a minor one, of the mollicutes
living in nature. Therefore,
hosts is the willingness of a
isolate and taxonomically characterize
al., 1998). There is a consensus among bacterial taxonomists
sequences of bacterial genomes will form the basis for phylogeny and, ultimately,
taxonomy. However, as long as complete genomic sequences are available for a few
bacteria only, current bacterial taxonomy, including that of mollicutes (
Committee on Systematic Bacteriology
8
However, very little is known about their pathogenicity factors or mechanisms of
persistence in the host. There are only a few characterized virulence factors of
; these include, in certain Mycoplasma species, the production of
e (Miles and Taylor,, 1991), the carbohydrate capsule, the ability to
scavenge arginine from host cells (Sasaki et al., 2002) and T-cell mitogens. It is difficult
Mycoplasmas manage to cause such severe and chronic infection given
ity of virulence factors and lack of cell wall. Presently, about 190
have been described under the class mollicutes (Rottem 2003)
Phylogeny and Genome characteristics
Early attempts to classify the mollicutes by immunological and molecular approaches
provided useful taxonomic data but with little information on the trends. More recently,
studies on the phylogenetic relationships of the mollicutes have concentrated on the
Mycoplasma ribosomal ®RNA which, because of very tight structural
constraints, has changed much less than the bulk of the genome (Nicholas, 200
widely agreed that the mollicutes that have already been characterized and
taxonomically defined constitute only a part, apparently a minor one, of the mollicutes
Therefore, the main factor for adding an animal or plant to the list of
hosts is the willingness of a Mycoplasmologist to invest the effort and funds required to
isolate and taxonomically characterize new Mycoplasmas from different host (
). There is a consensus among bacterial taxonomists that the complete
sequences of bacterial genomes will form the basis for phylogeny and, ultimately,
taxonomy. However, as long as complete genomic sequences are available for a few
bacteria only, current bacterial taxonomy, including that of mollicutes (
Committee on Systematic Bacteriology Subcommittee on the Taxonomy of
However, very little is known about their pathogenicity factors or mechanisms of
persistence in the host. There are only a few characterized virulence factors of
species, the production of
1991), the carbohydrate capsule, the ability to
cell mitogens. It is difficult
manage to cause such severe and chronic infection given
ity of virulence factors and lack of cell wall. Presently, about 190
(Rottem 2003).
Early attempts to classify the mollicutes by immunological and molecular approaches,
trends. More recently,
studies on the phylogenetic relationships of the mollicutes have concentrated on the
because of very tight structural
Nicholas, 2004). It is
widely agreed that the mollicutes that have already been characterized and
taxonomically defined constitute only a part, apparently a minor one, of the mollicutes
plant to the list of
to invest the effort and funds required to
host (Razin et
that the complete
sequences of bacterial genomes will form the basis for phylogeny and, ultimately,
taxonomy. However, as long as complete genomic sequences are available for a few
bacteria only, current bacterial taxonomy, including that of mollicutes (International
Subcommittee on the Taxonomy of
9
Mollicutes, 1995), relies on the combination of phenotypic characteristics and
phylogenetic data based on partial genomic sequences, particularly those from the
conserved rRNA genes (Razin et al., 1998). According to 16S rRNA sequences
(Weisburg et al., 1989) the mollicutes are divided into five phylogenetic units (clades).
At the moment, the genus Mycoplasma encompasses a pneumoniae group, while other
groups are spiroplasma, or mycoides group, hominis and an anaeroplasma with only one
species. The haemobartonella and Eperythrozoon species were recently and correctly
placed within the genus Mycoplasma (Neimark et al., 2001), but also currently enlisted
Mycoplasma species should be reclassified to other genera. The current problems are
probably best exemplified by the taxonomic position of the M. mycoides cluster.
Unequivocal evidence places this cluster more closely to spiroplasmas than to
Mycoplasmas (Gasparich et al., 2004). However, owing to practical and legislative
complications, taxonomic changes have not been realized and one species of the M.
mycoides cluster, referred to as Mycoplasma Bovine Group 7 (MBG 7) and closely
related to M.capricolum sp., but still has no official name. Some species of veterinary
medical importance are found within the phylogenetic spiroplasma group in the so-
called Mycoplasma mycoides cluster, encircled in blue (Figure 1). An important feature
of mollicute phylogeny proposed by Woese (Woese, 1987) is the rapid pace of their
evolution, in line with the marked genotypic and phenotypic variability characterizing
the mollicutes as a group. The great weight given to 16S rDNA sequences in
Mycoplasma phylogeny, taxonomy, and species identification (Patterson et al., 1996;
Razin, S. 1992) led the Mollicutes Taxonomy Committee (International Committee on
Systematic Bacteriology, 1997) to recommend the inclusion of the 16S rDNA sequence
in any description of a new Mycoplasma species (Fig. 1). Although the 16S rRNA
sequence has proved to be very effective tools in the phylogeny and taxonomy of
10
mollicutes, it was thought that additional phylogenetic markers are desirable to support
the conclusions based on the 16S rRNA data.
11
Figure 1: Phylogenic tree of Mollicutes constructed based on the 16SrDNA sequence The six species of the M. mycoides cluster are encircled in blue. Among which M. mycoides subsp
mycoides LC spotted in red is the species of interest in the present study (Adapted from MolliGen Web site http://cbi.labri.fr/outils/molligen/).
100
100
100
100
100
100
100 100
100
100
100
100
100
100
100
70
90
83
52
87
43
99
86
98 50
51
50
0.05
Sp
irop
lasm
a
Pn
eum
on
iae
Ho
min
is
Ph
yto
pla
sma
M. haemofelis
M. sp bovine group 7 M. capricolum subsp. capripneumoniae
M. capricolum subsp. capricolum
M. mycoides subsp. mycoids SC
M. mycoides subsp. mycoides LC
Mesoplasma florum Spiroplasma citri
M. mycoides subsp. capri
Spiroplasma kunkelii
U. urealyticum/parvum
M. penetrans
M. gallisepticum M. pneumoniae
M. genitalium
M. mobile
M. arthritidis
M. hominis
M. orale
M. hyopneumoniae
M. pulmonis
M. synoviae
M. fermentans
M. bovis
M. agalactiae
Acholeplasma laidlawii
Aster Yellow phytoplasma
Onion Yellow phytoplasma
Stolbur phytoplasma Western X phytoplasma
Flavescence Dorée phytoplasma
12
In fact, such markers have already been applied, including the conserved ribosomal
protein genes (Gundersen et al., 1996), the elongation factor EF-Tu (tuf) gene (Kamla et
al., 1996), the heat shock protein gene hsp70 (Falah and Gupta, 1997), and the
16S/23SrRNA intergenic sequences (Smart et al., 1996). Use of these markers has
supplemented and complemented the 16S rRNA comparative data. A priori, wobble in
the genetic code permits more variations in protein gene sequences, even of highly
conserved genes, than is possible in rRNA sequences. Thus, even though these
ribosomal protein-encoding genes are quite conserved, they vary considerably in size
and primary sequence more than the 16S rRNA genes do (Razin et al., 1998). The
reassignment, in most mollicutes of Uridine-Guanine-Adenine (UGA) from a stop
codon to a tryptophan codon, a feature found in mitochondria is the apparent outcome
of codon reassignment under strong A+T pressure. Not all mollicutes do share this
property, the phylogenetically early acholeplasmas and phytoplasma use conventional
Uridine-Guanine-Guanine (UGG) codon for tryptophan retaining UGA as a stop codon
(Razin et al., 1998).
There is now solid genetic support for the hypothesis that Mycoplasmas have evolved as
a branch of gram-positive bacteria by a process of reductive evolution (Woubit et al.,
2007). During this process, the Mycoplasmas lost considerable portions of their
ancestral chromosomes but retained the genes essential for life. Thus, the Mycoplasma l
genomes carry a high percentage of conserved genes, greatly facilitating gene
annotation. The significant genome compaction that occurred in Mycoplasmas was
made possible by adopting a parasitic mode of life (Razin, 1989). The recent sequencing
of several Mycoplasma genomes (Bork, et al., 1995; Fraser et al., 1995; Himmelreich et
al., 1996) has provided some information on Mycoplasma l genes homologous to cell
13
division genes of walled-covered bacteria. The comparative genomics data reveal the
lack in Mycoplasmas of a significant number of genes belonging to this category,
findings which may be relevant in the consideration of the relative importance of the
different genes in the prokaryotic cell division process.
Considerable advances were also made toward a better understanding of Mycoplasma
pathogenesis. Most impressive are the findings concerning the interaction of
Mycoplasmas with the immune system, macrophage activation, cytokine induction,
Mycoplasma cell components acting as super antigens, and autoimmune manifestations.
Evasion of the host immune system by antigenic variation of Mycoplasma l surface
components, as well as molecular definition of Mycoplasma l adhesins, has also gained
much attention recently (Razin et al., 1998). The most important finding, perhaps, is
that of the ftsZ gene in Mycoplasmas which indicates that ftsZ gene is a highly
conserved and ubiquitous gene (found also in archeons and chloroplasts), fulfilling a
key role in prokaryote cell division. In eubacteria, the ftsZ protein is a polymer-forming,
GTP-hydrolyzing protein with tubulin-like elements; it is localized to the site of
septation and forms a constricting ring (the Z ring) between the dividing cells (Bork et
al., 1995; Fraser et al., 1995; Himmelreich et al., 1996).
2.2 Contagious Bovine Pleuropneumonia (CBPP)
2.2.1 Historical Perspective
Contagious Bovine Pleuropneumonia (CBPP) is thought to have existed in Europe
many centuries ago and it is note worthy that eradication was achieved in most
European countries before anything was known concerning the etiological agent as it
was first identified in 1898 by Nocard and Roux (Thiaucourt, 2000b). The disease was
14
believed to have spread throughout Europe in the 18th century through uncontrolled
movements of cattle that were caused by wars, transhumance and trade (Provost et al.,
1987; Turner, 1959; Blancou, 1996). Early descriptions of the disease were found in
writings from Gallo in Italy (1550) and also from C. Testienne in France (1554).
However, it was only during the 18th century that the disease was clearly described, in
Switzerland in 1732 by J. Scheuchzer and in France in the monts d’Auvergne and
Vosges, in Italy the Piemont and in Germanic States in Bavaria and Wurtemberg
(Thiaucourt, 2000b). “The spread of CBPP throughout Europe started at the end of the
18th century and culminated in the middle of the 19th century. All European countries
became infected: Northern France 1922, Belgium 1828, Holland and Prussia 1830,
Schleswig Holstein 1841, Sweden 1847, Norway (then Swedish territory 1860), the first
cases seen in Spain in 1846 in Barcelona region and later on in 1864 in central Spain”
(Thiaucourt, 2000b) CBPP was introduced into the United States of America, Asia,
Australia and Japan in the 19th and 20th century by importation of cattle from Europe.
South Africa was infected in 1854 through importation of cattle from the Netherlands;
thereafter, the disease spread to other countries in southern Africa. In Namibia, the
disease was first recorded in 1856 and is reported to have caused large scale cattle
losses for the next 40 years. The disease spread rapidly aided by people trying to flee
with their animals from the disease, wars and the use of trekking cattle for freight. Laws
aimed at controlling the disease were promulgated in 1885 and CBPP became a
notifiable disease and has remained so since 1887 (Masiga et al., 1996). Vaccination,
adequate movement control, and good extension services greatly reduced the prevalence
of the disease and by 1904 only minor outbreaks were reported. The disease was
completely eradicated by 1944; however, reintroduction of the disease from neighboring
Angola saw a resurgence of the disease in 1983. Presently the disease is considered
15
endemic in some parts of Namibia. It is believed that East Africa was infected in the
19th century by cattle imported from India (Masiga et al., 1996). Through vigorous
control efforts involving slaughter of the affected animals, quarantine and strict control
of animal movements, CBPP was eradicated from most of Western Europe, U.S.A. and
Japan by the beginning of the 20th century (Provost et al., 1987). Some foci of the
disease remained in south-western Europe (TerLaak, 1992; Regalla et al., 1996) where a
resurgence of CBPP occurred in the early 1980s with reports in southern France on a
few occasions, between 1980 and 1984. In Italy the disease reappeared in 1990,
however vigorous eradication efforts again were successful (Nicholas et al., 2000). The
Peoples Republic of China eradicated CBPP in the 1980s while Australia eradicated
CBPP in 1973 through animal-movement control, vaccination and slaughter of affected
and in-contact animals, combined with an efficient disease-surveillance system
(Newton, 1992). Zimbabwe eradicated CBPP in 1904, South Africa in 1924 (FAO/OIE,
1995). Most countries in southern Africa eradicated CBPP by the end of 1939 but the
disease remained in war-torn Angola and Namibia, from which it spread to Botswana in
1995 (Trichard et al., 1989; Masiga et al., 1996; Amanfu et al., 1998). The current
status of CBPP in Eastern Europe and the Mediterranean region, the Middle East and
Asia is not well known and this poses a threat to Western Europe (Thiaucourt, 1999).
Sporadic outbreaks have been recognized in the Middle East most likely from
importations of African cattle (FAO, 2001).
2.2.1.1. CBPP in Africa
CBPP is presently considered to be the most economically important cattle disease in
Africa, causing greater losses in cattle than any other disease including Rinderpest. The
growing sense of impatience and frustration connected with this disease is the fact that
16
the stunning successes achieved in other parts of the world in terms of eradication,
simply have not been repeated. On the contrary CBPP has increased the size of its
territory, and threatens to increase further, in a continent with growing human
population but dwindling meat supply (FAO, 2001). Presently, CBPP is found in an
area south of the Sahara, from the Tropic of Cancer to the Tropic of Capricorn and from
the Atlantic to the Indian Ocean. Endemic infection extends throughout the pastoral
herds of much of western, central and eastern Africa, with Angola and Northern
Namibia in southern Africa. Malawi, Mozambique, South Africa, Swaziland, and
Zimbabwe are currently free (Masiga et al., 1996).
By the end of 1999, CBPP was present in at least 27 countries in equatorial, central and
southern Africa although it is difficult to be certain due to the discrepancy between
official and non-official reports (Nicholas et.al. 2000). The two main CBPP infection
foci in west and central Africa are the Inner Delta area of Niger and the Lake Chad area.
With the exception of countries like Senegal and Gambia in West Africa and Gabon and
Congo Brazzaville in central Africa whose CBPP status remains unknown, all other
countries are currently infected (FAO, 2000).
In Africa, Contagious Bovine Pleuropneumonia (CBPP) is present in at least 29
countries and the disease was said to have made its initial entry into Africa in 1854,
when an infected bull was introduced to Mossel Bay, South Africa, from the
Netherlands. Nearly one hundred and fifty years later, the disease is still enzootic in
large areas of sub-Saharan Africa (Nicholas, 2004). In the 1960s and 1970s, sustained
research on CBPP in Nigeria, Kenya, Chad and other African countries, coupled with a
massive international campaign code-named Joint Project 16 (JP 16) resulted in the
17
disappearance of clinical disease from most parts of Africa. However, because of
economic decline and poorly financed veterinary services, the disease made a
spectacular comeback in the late 1980s and early 1990s. Today, more countries are
affected by CBPP than was the case 20 years ago (FAO, 2001). Endemic infection
extends throughout the pastoral herds of much of western, central and eastern Africa,
with Angola and Northern Namibia in South Africa. CBPP continues to be a
constraining factor in African livestock production and a deterrent to investment in the
livestock sector. The disease is currently endemic in much of West Africa and in the
greater horn of Africa and Angola; it has in recent years spread into Tanzania, is
established in Northern Namibia, has made repeated incursions into Zambia; and after a
brief epidemic was eradicated from Northern Botswana (Paskin, 2000). Seasonal cattle
movements by pastoralists resulted in the spread of the disease in 1990 from Kenya,
where the disease has been endemic for some time, into the Ngorogoro crater in
Tanzania, which had been free of CBPP for 30 years. As a result of drought, failure to
report outbreaks of the disease and continued, unrestricted movement of livestock,
CBPP spread further south in 1995 causing over 14,000 cattle deaths in just six months.
Most of Central and Eastern Africa, from Uganda down to Zambia, now have cattle
infected with CBPP. Most countries in Central and Eastern Africa are infected. Angola
is still infected and the prevalence of the disease in the country is not known because of
civil conflict. Newly-infected areas in the 1990s include much of Uganda, parts of
Kenya, the Ituri Region of the Democratic Republic of Congo and most of Tanzania,
where recently the disease has spread alarmingly; Rwanda (1994), Botswana (1995,
now free), Burundi (1997) and Zambia (1997). Currently, the disease is absent in some
southern African countries, i.e. Botswana, Lesotho, South Africa, Swaziland and
Zimbabwe, and parts of Namibia and Zambia (http://www.vm.iaState.edu).
18
2.2.1.1.1 CBPP in Tanzania
CBPP was introduced into Tanzania from southern Kenya in 1916 (Hammond and
Branagan, 1965). The disease spread to Northern regions of Tanzania encompassing
Arusha, Mara, Kilimanjaro and Tanga, achieving its maximum spread in 1941.
Restriction and control of animal movements, quarantine and vaccination resulted in
eradication of CBPP from Tanzania in 1964 and the country was declared free from the
disease in 1966 (Lwebandiza, 1969). In the late 1980s, a new episode of CBPP emerged
in East Africa. Movements of animals spread the disease from Northern and eastern
Uganda to the south-western part of that country (Rweyemamu and Benkirane, 1996).
From Northern Kenya, the disease spread southward and crossed into the Ngorongoro
district of the Arusha region in Northern Tanzania in June 1990 and since then it has
spread widely, threatening the entire national cattle herd. Because of lack of a clear
disease-control policy, uncontrolled cattle movements, lack of public awareness and
commitment, ineffective legislation, attempts to control and eradicate the disease for the
last 10 years have failed (Bölske et al., 1995; Anon., 2000).
2.2.1.1.2 CBPP in Botswana
In Botswana, the disease re-emerged in early 1995 after an absence of 50 years. Border
controls which were relaxed after the end of the Namibian War of Independence
allowed the uncontrolled movement and smuggling of livestock, resulting in the
outbreak of CBPP. Despite rapid control efforts, including restriction of cattle
movement, the erection of fences & the slaughter of infected herds, the disease
continued to spread and, in 1996, 300,000 cattle in the infected region had to be
19
slaughtered. This proved effective and, in January 1997, Botswana was declared
'provisionally free' from CBPP ([email protected]).
2.2.1.1.3 CBPP in Nigeria
CBPP is currently endemic in Nigeria with pockets of outbreaks occurring in the North
of the country, where most of the cattle population is located (Osiyemi, 1981; Fayomi
and Aliyu, 1992; Ameh et al., 1998). Most cattle in Nigeria are owned by nomadic
Fulanis who move for long distances (thereby enhancing the spread of the disease).
In Nigeria, CBPP was regarded as extinct in 1965 and this was brought about by ten
years of mass vaccination, well organised disease reporting, laboratory diagnosis,
quarantine, slaughter policy, and strict control of cattle movements (Knowles, 1955 and
1960, Griffin and laing, 1966). Although achieved by 1965, control of CBPP did not
last long as the disease re-emerged a few years later perhaps from bordering countries
of Niger, Chad, and Cameroon. In spite of an eradication campaign launched in 1970,
outbreaks rose rapidly from 1986 onwards to a peak in 1989 when over 10,000 cattle
were affected (Nwanta and Umoh, 1992).
In 1998, under the Technical Co-operation Project (TCP), the FAO/IAEA introduced
the competitive ELISA for the measurement of CBPP antibodies to laboratories in
Africa. This new technique is considered to be more sensitive than Complement
Fixation Test (CFT) and almost as specific for the organism as the CFT (Le Goff and
Thiaucourt, 1998; Nicholas et al., 1996). The National Veterinary Research Institute,
Vom was one of the centers chosen for the project. Prior to this, diagnosis of the disease
was mostly based on clinical signs, isolation of the organism and serology. The
20
serological techniques like the simple Plate Agglutination Test and Complement
Fixation Test which at that time was the prescribed test by the OIE (Campbell and
Turner, 1953) were then in use. In 2002 there was a meeting of Ten Research Contract
holders from 10 African Countries (Botswana, Cote d’Ivoire, Ethiopia, Ghana, Kenya,
Mali, Namibia, Tanzania, Uganda and Nigeria), and three Research Agreement Holders
(CIRAD/EMVT), France, National Veterinary Institute, Sweden, Scottish Agricultural
College, UK) and representatives of FAO and IAEA. During the meeting presentations
on the situation and diagnosis of CBPP and the diagnostic and surveillance capabilities
in these countries were given and discussed. The meeting recognized the need for an
improved diagnosis of CBPP in Africa and the need for the establishment of better
CBPP surveillance systems and recommended the confirmation under field conditions
of the performance of the monoclonal antibody based competitive ELISA for the
detection of antibodies to Mycoplasma mycoides mycoides SC in the 10 laboratories
participating in the programme (FAO/OIE, 1995).
The Pan- African Programme for the Control of Epizootics (PACE) which covers 32
countries including Nigeria came into limelight after the conclusion of the Project on
Sero-monitoring by the IAEA/FAO. In order to support the CBPP control efforts at the
national and regional levels, PACE adopted several strategies which included the
reinforcement of animal epidemiology services and control of the major diseases. The
objectives were to enhance national capacities, improve the distribution of veterinary
services and medicines within the country and eliminate the last reservoirs of
Rinderpest. Others were to verify freedom from the disease, and control major
epizootics (FAO, 2001). Under this programme, PACE was to improve abattoir services
and commission specific surveys. These were aimed at improving surveillance of
21
clinical cases, improving the national disease reporting and surveillance systems and
introduce a compatible system of data management for all the countries involved. It was
also to introduce a Data Management System at OAU/IBAR to assist strategic decision
making at the sub-regional and continental levels in Africa. Unfortunately, none of
these were effectively achieved before the programme wound up in 2002.
2.2.2 Transmission and spread of CBPP
2.2.2.1 Transmission of CBPP
The epidemiology of CBPP is influenced by many factors including the virulence of the
M. mycoides SC strains, host susceptibility and management systems (Provost et al.,
1987, TerLaak, 1992, Nicholas and Palmer, 1994, Masiga et al., 1996). Spread and
Transmission of the disease occurs through inhalation of infective droplets from
clinically sick or carrier animals. Infection can also be acquired from fodder and
fomites contaminated with infected urine and fetal fluids (Masiga and Domenech, 1995;
Windsor and Masiga, 1977b). Close proximity between infected and healthy animals
facilitates the rapid transmission of the disease within and between herds. In Africa,
cattle movements through transhumance, nomadism and trekking of trade cattle are
responsible for the maintenance and spread of the disease within and across country
borders (Provost et al., 1987; Masiga et al., 1996).
CBPP affects cattle and buffalo but reports of isolation of the causative agent in small
ruminants especially sheep and goats have been made (Brandão, 1995; Srivastava et al.,
2000; Kusiluka et al., 2000). However, the role of small ruminants in the epidemiology
of CBPP has not been demonstrated and no reservoir in wild animals has been
established, either (Bell et al., 1990; Masiga et al., 1996). Any severe pneumonia with
22
pleurisy in cattle may be indistinguishable from the early stages of CBPP.
Consequently, inability to isolate Mycoplasma mycoides mycoides Small Colony
organism from cases with typical lesions should be expected since other infectious
agents may mimic the presenting features (Regalla et al., 1996).
2.2.2.2 Spread of CBPP
Contagion occurs through direct and repeated contacts between infected and susceptible
cattle essentially through expectorations of coughing (Provost et al., 1987; Nicholas and
Bashidurin, 1995). Excretion of organisms from the respiratory tract has been shown to
occur before the onset of detectable serological responses in experimentally infected
animals. (Bashiruddin et al., 1994; Miserez et al., 1997; Frey et al., 1998). The positive
findings from the swab samples taken in Portugal show the presence of MmmSC in
nasal secretions of infected cattle in the field and thus confirm the respiratory shedding
of organisms as a mode of contagion dispersion. Involvement of chronic carriers in the
perpetuation of the infection has been suggested by several authors (Mahoney, 1954;
Martel et al., 1985; Provost et al., 1987; Egwu et al., 1996) but is still debated (Windsor
and Masiga, 1977). Risk factors for its spread include high-density confinement in night
housings and use of common grasslands and watering places (Provost et al., 1987). In
Africa, between-zone or country spread essentially is related to cattle movements
caused by trade, transhumance and social troubles (Roeder and Rweyemamu, 1995). In
this continent, up to a third of cases that recover from acute disease become potential
carriers. This figure was probably higher in Europe where there is a far more
widespread use of antimicrobials (Nicholas, 2004). The risk of infection of CBPP-
uninfected herds by carriers can also be enhanced by animal exchanges (e.g. by loaning
contracts) between farmers which are quite frequent in mixed crop–livestock systems.
23
Chronic carriers are difficult to detect and their importation in the herds might be a
major risk or between-herd spread of the disease (Laval, 2002; Lesnoff et al., 2002).
Unfortunately, longitudinal data on the within-herd spread of CBPP are rare in general
(Bygrave et al., 1968) and absent for mixed crop–livestock systems. These systems are
common in Africa (especially in the East African highlands) and characterized by small
herds managed by individual farmers (Gryseels and Anderson, 1983). MmmSC chronic
carriers might present time-delimitated infectious phases during re-activations of lesions
or break-downs of sequestra. Therefore, inapparently infected animals may freely
transmit infection to susceptible animals (Hammond and Branagan, 1965). Chronic
carriers often were suspected to generate field outbreaks and endemic situations in cattle
populations (Curasson, 1942; Mahoney, 1954; Martel et al., 1985; Provost et al., 1987;
Dedieu et al., 1996; Egwu et al., 1996), although this hypothesis remains unproven. For
example, in experimental conditions, Windsor and Masiga (1977) did not observe any
disease transmission after challenging healthy animals with chronic carriers. Those
authors concluded that carriers (if infectious) play only an occasional role in the
epidemiology of CBPP.
The virulence of the African strain of the organism has been determined to be much
more than that of its European counterparts as such the disease in Europe has low
morbidity and mortality and appears to be less severe than in Africa with a high
percentage of infected animals with chronic lesions. The lower virulence of strains of
the recent European isolates if compared to African field strains seems to be due to an
attenuation most probably caused by a distinct deletion of 8.84 kb involving disruption
of the operon gtsABC for glycerol uptake, resulting to reduced production of hydrogen
peroxide (Houshaymi et al., 1997; Vilei and Frey, 2001). This operon was shown to
24
differentiate the strains of the recent European isolates from all other M. mycoides
subsp. Mycoides SC strains (Vilei and Frey, 2001). Other suggested explanations for the
milder disease in Europe include better animal husbandry and more frequent use of
antibiotics and anti-inflammatory drugs which may favour the formation of chronic
lesions in carrier animals (Provost et al., 1987).
2.2.3 Incubation Period
The incubation period in naturally infected animals ranges from 3 to 8 weeks and may
even be longer (Masiga et al., 1996; Baker, 1998; Radostitis et al., 1999). When control
cattle were placed in contact with naturally affected cattle from a recent outbreak in
Namibia, seroconversion was seen after 6 weeks, rose rapidly in the next two weeks by
which time 40% of contacts had died (Nicholas, 2004). In a fully susceptible cattle
population, the morbidity may reach 100% and mortality 50% (Masiga et al., 1996;
Baker, 1998). In experimental or natural outbreaks, most of the CBPP seroconversions
seem to continue until 6–7 months after the initial introduction of CBPP (Hudson and
Turner, 1963; Bygrave et al., 1968; Provost et al., 1987). However, in the field survey,
seroconversions continued more than 8 months after the disease onset (Lesnoff et al.,
2004).
2.2.4 Clinical Signs
The disease is characterized clinically by severe coughing, weakness, emaciation and
sometimes by elevated temperature (Provost et al., 1987; Egwu et al., 1996). The
severity of symptoms range from hyper acute, through acute, sub acute and chronic
forms of pleuropneumonia, while calves up to six months normally develop arthritis and
show lameness from swollen, hot and painful limb joints (Persson, 2002; Egwu, et. al.,
25
1996). Animals show dullness, anorexia, irregular rumination with moderate fever and
may show signs of respiratory disease. Coughing is usually persistent and is slight or
dry. Sometimes fever goes up to 40 – 42 0C, and the animal prostrates with difficulty of
movement. As the lung lesions develop, the signs become more pronounced with
increased frequency of coughing and the animal becomes prostrate or stands with the
back arched, head extended and elbows abducted (Nicholas, 2004). Cattle of all ages
can be affected by CBPP. The clinical picture of CBPP is more suggestive of damage
due to host immune and inflammatory responses rather than to direct toxic effects by
the Mycoplasma l cell components (Razin et al., 1998). The specific reactions elicited
by invading Mycoplasmas, essential for resistance and protection against Mycoplasma
infections, have also been shown to play a role in the development of lesions and
exacerbation of Mycoplasma induced diseases, as described and reviewed previously
(Biberfeld, 1985; Cassell et al., 1985; Cole et al., 1985; Howard and Taylor, 1985). In
addition to eliciting anti-Mycoplasma l immune responses, Mycoplasmas exert a wide
range of nonspecific immuno-modulatory effects upon cells making up the immune
system. Several documentations have been made on the clinical and pathological
features of CBPP (Provost et al., 1987; Masiga et al., 1996; Regalla et al., 1996). The
major signs being associated with respiratory stress (Scundamore, 1995), especially
after exercise where a soft dry cough is evident. All ages of animals are susceptible but
young animals develop joint swelling rather than lung infection. Calves are more
resistant to CBPP than adults (Curasson, 1942; Provost et al., 1987) and are generally
kept away from the main herd which greatly limits contact between the young ones and
the adults. Typically when first introduced into a herd, CBPP is severe and mortality
relatively high. However a small proportion of cattle may die rapidly without showing
any signs other than fever (FAO, 2002). Some animals appear to be naturally resistant
26
and subclinical forms are frequent. Severe respiratory signs are the most prominent
features observed in the clinical cases, and are associated with typical lesions of
pleurisy and pneumonia (Lesnoff, 2004).
2.2.4.1 Acute infection
The acute form involves cessation of rumination, nasal discharge, a dry cough and
difficulty in breathing (Scundamore, 1995; Ross, 1993, Curasson, 1942; Martel et al.,
1985; Provost et al., 1987); a marbled pneumonia and an exudative pleurisy are the
most-obvious lesions. Recovered cattle often have necrotic lung tissue, encapsulated in
sequestra where Mycoplasmas can survive (Lesnoff, 2004). The clinical signs observed
in the acute form are much accelerated. The pathological signs are usually characteristic
with marked pleural adhesion accompanied by exudative pericarditis (Regalla et al.,
1996). Affected animals may die within a week exhibiting classical respiratory signs.
2.2.4.2 Sub acute infection
Signs in the sub acute form, may be limited to a slight cough only noticeable when the
animal is exercised. CBPP in Europe, unlike that caused in Africa where mortality rates
are typically 10-70% in epizootics, is characterized by low morbidity and low or non-
existent mortality with the majority of infected cattle showing chronic lesions; this is
characteristic of endemic disease; the sub-acute form is most common in Africa
(Regalla et al., 1996).
27
2.2.4.3 Chronic infection
However, chronic lung lesions with viable MmmSC can persist in sick and/or recovered
cattle—in particular, when they develop ‘sequestra’ (i.e. necrotic tissues surrounded by
a fibrous capsule) and these animals could persist as carriers (Curasson, 1942; Provost
et al., 1987). There is no consensus on carrier parameters. According to Bygrave et al.,
(1968), most sequestra resorb into sterile fibrotic scars within 4 months. Nevertheless,
some examples of MmmSC isolations 1 or 2 years after the infection has been reported
from such lesions (Turner, 1954; Windsor and Masiga, 1977a).
2.2.5 Diagnosis of CBPP
Diagnosis of CBPP is achieved by the demonstration of typical pathology and/or the
presence of MmmSC after postmortem examination and isolation of the causative agent.
Although MmmSC is not difficult to cultivate, primary isolation of the pathogen from
lung lesions is made difficult by the use of therapeutic agents and cultures are often
negative from sequestered lesion material (Bashiruddin, 1998; Aliyu et al., 2000).
However, confirmation of the disease is usually done in two ways: detection of the
causal organism in affected tissue, and detection of serum antibodies to the organism
(FAO, 2002). The inability of CFT to discriminate between natural and vaccinal
exposures in animals has led to a greater reliance on Post Mortem examination of lung
lesions for monitoring and surveillance of CBPP in Nigeria. Moreover, some diagnostic
correlation exists between lung lesions of affected animals and serological techniques
such as CFT and enzyme-linked immunosorbent assay (ELISA) (Nicholas et al., 1996).
28
2.2.5.1 Pathology
Lesions are confined to the lungs and thoracic cavity which includes distension of
pulmonary lobules, consolidation, and marbling with varying colours of yellow, grey
and red hepatisation, bronchopneumonia and pleurisy, typified by adhesion of parietal
and visceral surfaces (Provost et al., 1987; Scundamore, 1995), and are mostly
unilateral. In a study in Nigeria, 95% of lesions were restricted to a single lung (Egwu et
al., 1996) with the diaphragmatic lobes being more commonly affected than cranial
lobes. Adhesions to the chest with roughened pleural membranes are common.
Significant quantities of straw coloured pleural fluid can be found in acute cases which
in most cases yields pure growth of the causative organism. The interlobular septa are
often distended and lungs show the typical marbled appearance with lung lobules
showing great variations in colour from red, grey to yellow depending on the stage of
inflammation. Associated lymph nodes undergo hypertrophy. In chronic cases the
sequestra is the main lesion type and consists of necrotic material surrounded by a
fibrotic capsule ranging from 10 to 100 mm in diameter. Necrotic foci have been
reported in the kidneys of affected cattle.
2.2.5.2 Serology
Serodiagnosis plays a key role in survey and control programs to combat Contagious
Bovine Pleuropneumonia (CBPP) caused by Mycoplasma mycoides subsp. mycoides
SC. At the species level, serologic relatedness has until recently overshadowed all other
features used in routine mollicute identification, but the weight given to the
determination of molecular properties in mollicute classification and identification is
steadily increasing (Razin, 1992). The function of antigenic variation in several
Mycoplasmas like M. hyorhinis, M. gallisepticum (Yogev et al., 1994), M. bovis
29
(Rosengarten et al., 1994), has been attributed to either immune evasion or, for
structural proteins, microorganism/host interactions essential for pathogenesis.
Antigenic variation, an important mechanism of infection, is due to membrane surface
proteins (Vsps) mainly lipoproteins (Wise et al., 1993). The high rate of surface
antigenic variation characterizing mollicutes may impose some limitations on the use of
monoclonal antibodies to surface antigens as tools in Mycoplasma identification
(Rosengarten, 1996); though these difficulties are usually not encountered when
polyclonal antibodies are used (International Committee on Systematic Bacteriology,
1997). Antigenic variation of M. mycoides SC of bovine origin has been demonstrated
(Costas et al., 1987; Poumarat and Solsona, 1995) with isolates from different animal
species and geographic locations (Gonc,alves et al., 1994, 1996). These studies showed
differences among strains isolated from cattle, small ruminants and water buffalo
originating from European countries, in particular Italy. In a study, European strains
form a genetic clonal lineage (Cheng et al., 1995), and antigenic differences within the
Portuguese (with one exception), Spanish and French strains which together formed one
group with nearly identical immunoprofiles were seen which are distinct from the
Italian strains (Goncalves et al., 1998). Differences in protein profiles between M.
mycoides SC strains usually reflected variations in the concentrations of individual
proteins. In a study, protein profiles of PG1 and the Australian strain V5 were found to
be similar, both lacking the 30 kDa band but, the absence of specific proteins was noted
in some cases (Goncalves et al., 1998). Previous studies by Gonc,alves et al., (1994),
indicated that the type strain PG1 of unknown origin was characterized by the absence
of 54 kDa protein. In a related study, a strong IgA reaction to the membrane lipoprotein
P72 of M. mycoides SC, in bronchial lavage samples of cattle experimentally infected,
confirmed the induction of a specific local immune response (Abdo et al., 1997).
30
Furthermore, these studies showed that other reacting antigens with IgA, such as 110,
95 and 48 kDa, are lipoproteins. Proteins partitioning into TX-114 phase has been
demonstrated to be important immunogenic surface components recognized by host
antibodies during infection (Riethman et al., 1987; Rosengarten and Wise, 1991).
The serological techniques mostly in use today are those developed in the 1950s: the
serum agglutination slide test SAST (Turner and Etheridge, 1963), the complement
fixation test CFT (Campbell and Turner, 1953; Gambles, 1956) and the detection of
circulating antigen by Agar Gel Immunodiffusion AGID (Griffin, 1965; White, 1958;
Shifrin, 1967). These serological methods have been proven useful for the detection of
outbreaks and they have had an important role in the successful CBPP eradication
campaign in Australia (Newton, 1992). These tests though quite useful have some
limitations which has made them sometimes unreliable in the field. In a CBPP-free
region, the use of classical serological techniques might be disappointing as the
percentage of false positives will be quite high and consequently, the predictive value of
a positive result will be very low (Stark et al., 1995 ). The Slide-Agglutination Blood
Test, Agar Gel Diffusion and Complement-Fixation Tests were highly sensitive for
detection of acute cases but less so for chronic cases (Campbell and Turner, 1953;
Turner, 1962; Shifrine and Gourlay, 1967). The Slide Agglutination Test on its own is
not very sensitive and it may give some false positive reactions but easy to perform in
the field, but will detect positive cases in acute outbreaks (Adler and Etheridge, 1964) .
It can be recommended for the diagnosis of acute outbreaks when immediate actions are
to be taken (Aliyu et al., 2000). Though the Complement-Fixation Test (CFT) is
commonly used as a diagnostic method in most CBPP endemic countries of Africa, its
sensitivity in detecting chronically affected animals is low (Provost et al., 1987;
31
Nicholas et al., 1996). It also has the disadvantage of being quite difficult to standardize
because of the use of antigens or fresh red blood cells of various qualities, and it
requires skilled technicians to perform the test. In the case of an acute outbreak, the
sensitivity is quite good as it detects up to 70% of positives and the rapid waning of
antibodies might be an advantage since vaccination elicits very low titers that usually
return CFT results to negativity after 3 months. Once again, this test can be used to
detect acutely infected herds. Performing mass screening is relatively rapid and easy by
testing a single dilution, thus, allowing the determination with CFT of incidence of the
disease in a country, i.e., by detecting the herds that have suffered from an outbreak
during the 3 months before the sampling. It will not permit the detection of all infected
animals and therefore, cannot be recommended as an individual testing method for
import restrictions. (Le Goff and Thiaucourt, 1998).
2.2.5.3 Molecular diagnosis
In general, species within the M. mycoides cluster share many immunological,
biochemical and genetic properties, which result in major problems for diagnostic
laboratories in the identification of field strains because of the use of classical
techniques, such as the Growth Inhibition Test, that have some limitations (Persson,
2002, Cottew et al., 1987). The Classical technique was considered for a long time as a
gold standard but, in practice, gives varying degrees of cross-reactions (Thiaucourt, et
al., 2000a). Though some degree of success has been achieved in immunological
experiments carried out to differentiate the various strains (Vilei and Abdo, 2000),
these tests and most others were found not to be as reliable as molecular based tests
such as the Polymerase Chain Reaction (PCR) (Bashiruddin et al., 1994). The advent of
molecular biology has greatly enhanced the capability to detect and identify species, to
32
classify and characterise strains and to assess the genetic diversity of populations
(Stakenborg et al., 2005). Diagnostic tests based on DNA amplification by polymerase
chain reaction (PCR) promise high sensitivity and specificity and are suited to large-
scale performance in 96-well format thermal cyclers. The traditional method for the
analysis of PCR products has been agarose gel electrophoresis which will continue to be
useful for the optimization and analysis of PCR tests with small sample numbers. Gel
electrophoresis is not suitable for large-scale routine use (Bashiruddin et al., 1998). The
use of PCR has overcome most of the problems encountered with immunological tests
and it has permitted major advances both in phylogenetic studies and in diagnostic
methods (Thiaucourt et al., 2000a). The specific identification of MmmSC strains can
now be obtained by various PCR methods but these techniques are universal and
recognize pathogenic as well as vaccine strains (Dedieu et al., 1994). The PCR
techniques for the diagnosis of MmmSC have the advantage of being fast, specific, very
sensitive and easy to perform (Bashiruddin et al., 1994; Dedieu et al., 1994; Hotzel et
al., 1996; Miserez et al., 1997). Primers specific for the M. mycoides cluster
(Knudtson and Minion, 1993) and for MmmSC (Rovid and Roth, 1997) have been
developed, and various types of PCR assays have been developed (Rovid and Roth,
1997, Thiaucourt, et al., 2000a). Numerous detection methods able to handle moderate
to large sample numbers in the 96-well format have been described (Lazar, 1995).
These methods are based on the hybridization of oligonucleotides to either capture or
detect PCR product. (Rasmussen et al., 1994). Other methods use labeled primers to
incorporate biotin into the PCR product which is then used to either capture the product
or detect the amplicon immunoenzymatically (Bashiruddin et al., 1994). Methods which
use RNA probes followed by anti-RNA: DNA to detect captured hybrids have also been
used. A method for the specific capture and enzymatic detection of PCR product and its
33
application to the detection of Mycoplasma mycoides from a variety of clinical samples
like washed lungs with hot water or impregnated filter strips have been described
(Bashiruddin et al., 1994).
PCR can also be applied directly after denaturation in boiling water, using samples such
as lung exudates, without any DNA extraction. It can even be applied to dry samples on
filter paper. The PCR can also be performed with urine or blood. The main advantage of
the PCR technique is that it can be applied on poorly conserved samples (contaminated
or without any viable Mycoplasmas as may occur following antibiotic treatment).
Molecular epidemiological studies on genomic fragments of M. mycoides subsp.
Mycoides SC have been able to differentiate phylogenetic lineages of this organism.
(Lorenzon et al., 2003). This has made it possible to trace sources of outbreaks based on
their phylogenetic lineages. There are several assays systems developed for this
purpose. In the case of CBPP, for example, specific amplifications can be obtained
(Dedieu et al., 1994) and additional sensitivity can also be achieved by nested PCR
schemes (Miserez et al., 1997). Up till now phylogenetic studies have focused on the
16S rRNA genes (Olsen and Woese, 1993).
2.2.6 Economic importance
Contagious Bovine Pleuropneumonia (CBPP), a highly contagious disease of cattle
caused by Mycoplasma mycoides mycoides (SC) type, is still considered to be the most
economically important cattle disease in Africa, causing greater losses in cattle than any
other disease after Rinderpest (OIE, 1997). Losses per annum due to this disease are
estimated to be in the region of US$ 2 billion (Masiga et al., 1999). The Joint Project 28
(JP28) eradication programme for CBPP which was carried out in the early 70s though
34
not very successful greatly reduced the incidence of CBPP in Nigeria. Even then, the
economic losses due to CBPP in Nigeria were estimated to be in excess of 3.6 million
dollars annually nearly 20 years ago (Osiyemi, 1981). CBPP spread from Kenya to the
Ngorongoro carater in Tanzania caused over 14,000 cattle deaths in just six months (nr-
2.2.7 Vaccines
In the last decade there has been a substantial re-emergence of CBPP, despite
vaccination campaigns using freeze-dried broth cultures of live attenuated Mycoplasma
mycoides subsp. mycoides small colony biotype (MmmSC) (strain T144 or T1SR).
Information from the field and studies (Masiga, et al., 1999a and 1996, Thiaucourt et
al., 2000a, Yaya et al., 1999) have indicated that the current vaccines do not effectively
protect cattle from outbreaks of disease. The frequent failure of antibiotics and other
therapeutic approaches to eradicate Mycoplasmas and abort the infectious disease
process has led to the conclusion that development of effective vaccines is the most
promising approach to control Mycoplasma infections in humans and animals (FAO,
2002). CBPP control is achieved by eliminating the whole cattle herd population, i.e.
stamping out, wherever the disease is detected. However, this may not prove realistic,
and quarantine coupled with vaccination is the most frequently used CBPP control
measure (FAO, 2002).
The history of CBPP vaccine could be traced back to 1852, when Willems established
the ways to “inoculate” infectious material in cattle in order to protect them. This
process was recommended by the fifth international veterinary congress in 1889 as an
35
auxiliary measure to reduce significantly the number of CBPP outbreaks before
stamping out policies can be put into force and achieve complete eradication
(Thiaucourt, 2000b). This knowledge was the basis for the establishment of efficient
control strategies and eventually led to the eradication of the disease from many
countries: 1888 Holland, 1895 Switzerland, 1896 Great Britain, 1900 Belgium, 1902
France, 1919 Austria, 1924 Baltic States and 1934 Poland and Soviet Union.
In Africa, where the application of the stamping out policy of eradication is not feasible
the control of CBPP has relied on preventive immunoprophylaxis using live attenuated
cultures of the causative agent. CBPP vaccination is the method that is currently in use
in most African countries employing the vaccine strains T1/44 or its streptomycin
resistant derivative T1-SR (Litamoi et al., 2004). These CBPP vaccines do not confer
long-term immunity (Rweyemamu et al., 1995). The CBPP T1-44/2 vaccine that is
currently recommended for use in endemic areas of Africa confers immunity for ≤1 year
(Tulasne et al., 1996). The low potency of the T1/SR vaccine that was used during the
initial outbreaks of CBPP in 1990s frustrated both the farmers and livestock experts
(Masiga et al., 1996; Tulsane et al., 1996). These vaccines though have been used quite
successfully in the past for the control of CBPP in Australia, Nigeria and East Africa
(Brown et al., 1965, Hudson 1968). The T144 is noted for post vaccinal reactions while
the T1 SR induces a shorter period of immunity than the T144 (Heubschle et al., 2002).
A major factor behind poor vaccine efficacy is likely to be sub-optimum bacterial titres.
Many vaccine production laboratories do not reach the O.I.E. recommendation of
delivering a vaccine at 108 viable Mycoplasmas per animal dose (which allows for
losses during lyophilisation, storage and transport (Rweyemamu et al., 1995, Litamoi
and Seck, 1999). The pH of the growth medium is an important factor which affects
36
Mycoplasma viability (Gourlay and MacLeod 1966, Miles 1983) Current vaccine
media e.g. Gourlay’s (Gourlay, 1964) and F66 (Waite and March 2001) are poorly
buffered, containing only a dibasic (Na2HPO4) phosphate salt, and exhibit a sharp drop
in pH during MmmSC growth. This is mirrored by a rapid reduction in culture viability
once the pH begins to fall. A buffer system based upon N-[2-hydroxyethyl]piperazine-
NP-[2-ethanesulfonic acid] (HEPES) has been described (Provost et al., 1970), which
exhibits a 10-fold increase in titre and markedly increased culture survival compared to
contemporary media due to maintenance of a neutral pH during the growth cycle.
Current vaccines are freeze-dried to allow for longer term storage at 320C and to reduce
the requirement for cold-chain transport in the field. Another disadvantage is that
Mycoplasmas are extremely heat labile and as a result, current freeze dried vaccines for
the prevention of CBPP must be maintained under cold storage until used in order to
preserve the viability and potency of the immunizing organisms (Litamoi et al., 2004,
Hudson, 1968). Apart from the alleged low potency, the effectiveness of the CBPP
vaccines might have been reduced by inefficient cold chain. During the vaccination
campaigns of the past, the vaccines were stored in paraffin-fuelled refrigerators (which
were unreliable because they often failed to attain optimal cooling temperature). The
low potency of the vaccine could have resulted also from the use of harmful diluents
such as chlorinated or tap water or mishandling of the reconstituted vaccine by exposing
it to light and high temperatures for a long time (Karst, 1972).
The difficulty with the use of CBPP vaccines is that two divergent issues are sometimes
confused with each other: the efficacy of the vaccine itself, and the efficient conduct of
a vaccination campaign (Thiaucourt, 2004). The first issue can be assessed in controlled
experiments provided that all the parameters are clearly identified and analyzed. The
37
second is far more difficult, and therefore also more controversial, because the
efficiency of a vaccination campaign depends not only on the intrinsic quality of the
vaccine itself but also on the strategy and logistics for implementation of the
vaccinations (Thiaucourt, 2004). With reported cases of CBPP vaccine failures in past
vaccination campaigns (Amanfu et al., 1998), the capacity of current vaccines to control
the disease with eventual eradication of the disease has often been an issue of debate.
Even though Uncontrolled cattle movement, insufficient vaccination cover, acquired
immunity and the poor health status of vaccinated cattle were identified as some of the
major reasons attributable to CBPP vaccination campaigns failures (Thiaucourt et al.,
1998) many experts believe that “clearly, the ideal CBPP vaccine has not yet been
developed” (Thiaucourt, 2004).
2.3 Mycoplasma mycoides cluster
The Mycoplasma mycoides cluster consists of six pathogenic Mycoplasma species,
subspecies or strains causing mild to severe disease in ruminant hosts, either bovine or
caprine. These are Mycoplasma mycoides subsp. mycoides Large Colony (MmmLC),
M. mycoides subsp. Mycoides small colony type (MmmSC), M. mycoides subsp. capri
(Mmc), M. capricolum subsp. capricolum (Mcc), M. capricolum subsp.
capripneumoniae (Mccp), and Mycoplasma species bovine serogroup seven (MBG 7)
(Cottew et al., 1987). Even though the causative organism for Contagious Bovine
Pleuropneumonia (CBPP) was isolated for the first time over a century ago by Nocard
and Roux in 1898, it took another 58 years before organism was definitely identified as
a Mycoplasma and called by Edward and Freundt (1956) as Mycoplasma mycoides
subspecies mycoides (M. M. mycoides) by which time it had undergone nine name
changes (Nicholas and Bashiruddin, 1995). Two variants M. M. mycoides have been
38
recognized, the small colony (SC) type which causes CBPP in cattle, and the large
colony (LC) type which produces arthritis and mastitis in goats (Cottew and Yeats,
1978). The members of the Mycoplasma mycoides cluster are closely related both
genetically and phenotypically. When using conventional serological methods for
Mycoplasma typing, cross reactive antibodies impede the identification of pathogenic
agents of the M. mycoides cluster thereby complicating interpretation (Cottew and
Yeats, 1978; Rurangirwa and Shompole, 2000). This phenomenon was observed
between MBG 7 and Mccp (Thiaucourt, 2002) and between MBG 7 and Mcc (Bolske
1988). Analysis of the 16S rRNA categorized MBG 7 with Mcc and Mccp, and the two
species MmmLC and Mmc as a single entity (Pettersson, et al., 1996). Parsimony
analysis on an alignment of 49 DNA sequences show a subdivision of the M. mycoides
cluster into two subgroups that is in accordance with results obtained by phenotypic
methods. Two lineages exist within the capricolum subgroup, one of them clustering
strains identified as M. capricolum subsp. capricolum, M. capricolum subsp.
capripneumoniae and M. sp Bovine Group 7. However M. capricolum subsp.
capripneumoniae strains can readily be identified by three specific nucleotide positions
or by sequencing the 1298 bp long fragment (Thiaucourt et al., 2000a). There is no
clear subdivision within the mycoides subgroup, supporting the idea that M. mycoides
subsp. Mycoides LC and M. mycoides subsp. capri should not be separated into two
subspecies (Thiaucourt et al., 2000a).
2.3.1 Taxonomy and Phylogeny of the Mycoides cluster
The basis for the M. mycoides cluster taxonomy was established in 1987 (Cottew et al.,
1987) with a comprehensive review of the results on the reference strains by
conventional methods such as biochemical tests, immunological reactions (Al-Aubaidi
39
et al., 1972), isoenzyme patterns (Salih et al., 1983) one and two dimensional Poly
Acrylamide Gel Electrophoresis (PAGE) patterns (Rodwell, 1982) and DNA
hybridization. However, various techniques such as growth inhibition tests had already
shown that some species exhibited a high degree of intraspecies heterogeneity.
Therefore, Cottew et al., 1987 advocated that numerous strains of each group of strains
should be investigated in order to confirm the preliminary results (Cottew et al., 1987).
Subsequent studies with larger panels of strains, by whole cell PAGE patterns (Costas et
al., 1987; Leach et al., 1989), methylation of DNA (Bergemann et al., 1990), dot
blotting with monoclonal antibodies (Thiaucourt et al., 1994) or substrate utilization
patterns (Abu-groun et al., 1994) confirmed that this intraspecies heterogeneity was
mainly confined within the mycoides and capricolum species. By contrast, MmmSC and
Mccp seemed rather homogeneous, although Restriction Fragment Length
Polymorphism (Cheng et al., 1995; Poumarat and Solsona, 1995) as well as differences
in substrate utilization patterns (Houshaymi et al., 1997) was observed within MmmSC.
Based on the classification of the 16S rRNA, M. putrefaciencs was classified within the
M. mycoides cluster (Weisburg, et al., 1989). However, sequencing of the 16S rRNA of
M. cottewi and M. yeatsii, revealed a close similarity of M. putrefaciens with these
species, with similarity of 99.7% with M. cotttewii and 98% with M. yeatsii (Pettersson
et al., 1998). But these species, should not be regarded as members of the M. mycoides
cluster on the basis of serological, biochemical features (Pettersson et al., 1996) and
based on the phylogenetic tree derived from distance analysis of five protein coding
sequences (Figure 1) (Manso-silvan et al., 2007).
Some authors have proposed a revision of the actual classification of the M. mycoides
cluster to five subspecies (Thiaucourt et al., 2000a) Accorrding to them the new
40
calssification would have the advantage of retaining most former names (Thiaucourt et
al., 2000a). However, the proposal to reclassify this cluster accordingly has not been
adopted by the Mollicutes Taxonomy Committee (International Committee on
Systematic Bacteriology, 1997), which argues that such a reclassification would create
considerable problems in diagnostic veterinary medicine.
2.3.2 Pathogenicity of members of the M. mycoides cluster
Very little is known about the factors and mechanisms that affect the pathogenicity of
M. mycoides mycoides SC. No secreted toxins have been identified, neither receptor
molecules on the bacterial surface that mediate binding to host epithelium or induce
other cellular responses in the host tissues. However certain factors have been
associated with the pathogenesis, but the precise modes of action are still elusive
(Persson, 2002).
2.3.2.1 Capsular polysaccharide
An important pathogenicity factor in MmmSC is the capsular polysaccharide (CPS),
previously known as galactan (Woubit, 2008). It is made up of the carbohydrate
galactose (90%) and to a lesser extent glucose (2-4%) and lipid (Rodwell, 1982).
Injection of purified CPS to cattle produced severe respiratory collapse and even death
(Buttery, et al., 1976; Cottew, 1979). The CPS has been found to play a significant
role in the pathogenesis of infection, binding to the host tissue surfaces and inducing
resistance to phagocytosis. It has also been associated with the formation of autoreactive
antibodies and consequently autoimmune responses. Toxic effects of MmmSC have also
been associated with the capsule (Egwu et al., 1996, Nicholas et al., 2000, Nicholas and
Bashiruddin, 1995).
41
2.3.2.2 Hydrogen peroxide
In a recent investigation cited by Woubit (2008), there was indication that glycerol
metabolism in MmmSC strains release hydrogen peroxide (H2O2) as a byproduct,
resulting in disruption of host cell integrity. Hydrogen peroxide is produced by a
membrane located enzyme L-α-glycerophosphate oxidase (GlpO) that is involved in
glycerol metabolism (Pilo et al., 2005). The initial hypothesis was based on the fact
that virulent MmmSC African strains possessed an active ATP-binding cassette (ABC)
transport system for the utilization of glycerol, which is metabolized to
dihydroxyacetone-phosphate (DHAP) releasing H2O2, while European strains lacked
part of the glycerol uptake genes due to deletion and are less virulent (Vile and Abdo,
2000).
2.3.2.3 Variable surface protein
A report by Rosengarten and Wise (1991) indicated that Mycoplasmas express surface
proteins which can undergo reversible changes to alter the antigenic repertoire in a cell
population. The gene for these variable surface protein Vmm as they were termed
encodes a lipoprotein precursor of 59 amino acids, where the mature protein was
predicted to be 36 aa and was anchored to the membrane by only the lipid moiety, as no
transmembrane region could be identified (Woubit et al., 2007). The protein was found
to undergo reversible phase variation at a frequency of 9 x 10-4 to 5 x 10-5 per cell per
generation and this variation enables the Mycoplasma organisms to escape the host
immune defense mechanism of their host (Patersson, 2002). Vmm-like genes were also
found in the other three members of the M. mycoides cluster: Mcc, Mccp, MBG 77 and
in M. putrefaciens (Persson et al., 2002). The Vmm gene in MmmSC is an example of a
single gene encoded variable surface protein (Citti et al., 2005). A recent whole genome
sequence of Mcc type strain California kidT has revealed genes encoding a diverse
42
family of variable surface proteins termed the Vmc system. The Vmc genes of Mcc
present not only an alternative surface structure but also a system that permits high-
frequency phase variable expression as well as structural variation a feature crucial for
the survival of these wall-less microorganisms in the host (Wise et al., 2006). Variable
proteins are also involved in adhesion, hemadsorption, membrane transport and
immunomodulation (Le Grand et al., 2004).
2.4 Molecular methods for the identification and characterization of Mycoplasmas
Conventional methods for the detection and identification of Mycoplasmas
systematically involve enrichment steps in selective broth followed by morphological,
biochemical and serological tests. Although well established, these techniques have
some important drawbacks. The morphological and biochemical characteristics are in
general not discriminative, while serological cross-reactions have been frequently
reported as well. Moreover, these classical techniques are often labour intensive and
hardly ever useful to differentiate strains belonging to the same species (Stakenborg et
al., 2005).
During the past decades, the importance of molecular techniques in mycoplasmology
has greatly increased. Still, no single technique seems to be perfect. The discriminatory
power, applicability, reproducibility, ease of performance, and ease of interpretation,
may vary depending on the technique used and must be evaluated for each situation
(Olive and Bean, 1999).
The development of more accurate and faster techniques has become increasingly
important and although some generally applicable tests have been described (Melin et
al., 2004), molecular biology opened a path to shorten detection times and to improve
43
identification methods. In particular PCR methods appear very promising to replace
more and more conventional methods, although further improvements are necessary
(Vaneechoutte and Van Eldere, 1997). Currently, PCRs can be applied on purified
samples, but their effectiveness for detection and simultaneous identification may be
limited when applied to biological materials due to inhibitory effect from such
materials. The importance of sample pre-processing or DNA extraction methods, which
may need case-to case optimisation to yield compatible results (Radstrom et al., 2004),
are hard to standardise and selective enrichment steps are frequently preferred.
Moreover, PCR tests are mostly very specific and, as a consequence, only valuable to
detect and/or identify one or a few species. This is evident by the current lack of
commercially available quality-controlled, low-cost, PCR kits for the detection and
identification of Mycoplasmas. With the exception of very few commercial kits for
Mycoplasmas in cell-cultures (Razin et al., 1998), laboratories must rely on in-house
improvisions and such protocols are not often reliable. Nonetheless, molecular
techniques are likely to be an increasingly important tool for the detection and
identification of fastidious organisms like the Mycoplasmas.
While PCR can result in a direct identification of an organism by the amplification of
the species-specific product, sequence analysis can be used to discriminate between
strains. This technique does not require the cultivation of the organism and since all
molecular typing techniques are based on sequences comparisons, sequence analysis
seems the best approach. This technique also has an excellent interlaboratory
reproducibility and data can be stored online (Bashiruddin et al., 1994). But, sequence
analysis of single genomic fragments also has some important drawbacks notable
amongst which is the fact that the region under investigation is very small and is hardly,
if ever, representative of the entire genome. Besides, the region under investigation
44
must be conserved enough for amplification and at the same time variable enough to
differentiate between strains, which is not always easily attainable. In addition, the
stability of the gene must be verified over in vitro passages.
Sequence analyses of specific genomic fragments have been successfully used for the
typing of some Mycoplasma spp. In case of M. genitalium, the MG309 gene sequence
was proven stable in sequential urine samples obtained from single patients for at least
five weeks and may be valuable candidates for further typing studies (Ma and Martin,
2004). Also, sequence analysis was demonstrated for a genomic fragment of 2400 bp of
M. capricolum subp. Capripneumoniae (Lorenzon et al., 2002). Nucleotide variations in
this specific fragment were used to determine the geographical distribution of different
strains. Sequence variation of parts of the haemagglutinin encoding gene vlhA of M.
synoviae was used for strain differentiation (Hong et al., 2004) and could be linked to
the length of the expressed protein and to virulence (Hong et al., 2004)
Another technique, MLST which is even more expensive, was developed to cope with
some important drawbacks related to typing studies based on sequence analysis of
single genes (Olive and Bean, 1999). Instead of analyzing one single genomic fragment,
the partial sequences of multiple, selected genes are determined. Ideally, sequence
fragments about 500 bp in length of several, widely scattered genes should be included
to obtain a good representation of the genome, but the number may vary between
different studies. Housekeeping genes are mostly selected because they are less often
subjected to horizontal transfer events and are not liable to strong or unusual selective
pressures (Yaya et al., 2008). As a consequence, they are perfectly suited to represent
the accumulation of sequence variation in the genome. Generally in MLST analysis the
number of nucleotide differences found between alleles is disregarded and sequences
45
are given different allele numbers whether they differ at a single or at many nucleotide
positions (Yaya et al., 2008). The rationale for this is that a single genetic event
resulting in a new allele can occur by a point mutation, altering only a single nucleotide
site, or by a recombinational replacement that will often result in the modification of
multiple sites (Dingle et al., 2001). This approach has been applied successfully to a
wide variety of bacterial pathogens such as Campylobacter jejuni (Dingle et al., 2001),
Staphylococcus aureus (Enright et al., 2000), and Haemophilus influenzae (Meats et al.,
2003), and several other bacterial species of global importance (Urwin and Maiden.
2003.) for which, databases for international surveillance have been set up (Feil and
Enright, 2004). This approach has multiple applications such as phylogeny (Hanage et
al., 2005), molecular structure analysis (Tourasse et al., 2006) and molecular
epidemiology. In molecular epidemiology, MLST can be used to study the evolution of
antibiotic resistant strains (Gherardi et al., 2006), the temporal trends in strain
expansion or the distribution of strains of various lineages within a population (Lacher
et al., 2006).
However, some exceptions have been reported where a number of housekeeping genes
showed too few differences to be useful for typing (Dumke et al., 2003, Manning et al.,
2003, Nallapareddy et al., 2002). For these cases, carefully selected species specific
genes may be included instead. Only few investigators reported on the potential of the
technique for Mycoplasma spp. Even though sequence variations are known to occur
within MmmSC strains as evidenced by restriction fragment length polymorphism
(Poumarat and Solsona, 1995; Thiaucourt et al., 1998), comparative studies by SDS-
PAGE have already shown that strain variability within MmmSC is much more limited
than within other Mycoplasma mycoides mycoides cluster members (Costas et al.,
1987). So in the case of MmmSC this approach was not successful, as the variability
within housekeeping genes was too limited, if present at all. This was the case of the
genes fusA, lepA and rpoB
this may indicate that MmmSC
this Mycoplasma has adapted very recently to its bovine host. From a practical point of
view in this study, just as in the works
unknown function or non coding sequences had to be select instead in order to
differentiate MmmSC strains
multilocus sequence analysis (MLSA). This typing sc
analyses, as the gene targets used are selected for typing a biotype of a given subspecies
(MmmSC) and would not be suitable for typing strains of higher taxonomic ranks, given
their high variability (Yaya
of being a portable and very robust approach.
While the availability of complete genomic sequences is expected to provide a sound
basis for establishing phylogenetic relatedness among bacterial species and
consequently to enable the construction of taxonomic entities based on phylogeny, the
way to achieve this has not yet been worked out, since it presents several key problems.
Thus, the current, somewhat arbitrary definition of the basic taxonomic entity, that of a
bacterial species, includes all strains with approximately 70% or higher DNA homology
and with 5°C or lower
systems to generate phenotypic variations (Citti and Rosengarten, 1997) may give clues
for the understanding of pathogenesis but it also sheds light on the identification
problems encountered with reactions based on the recognition of potentially
variable membrane proteins. The sequences of a putative membrane protein gene and
partial flanking open reading frames have been obtained from various strains in this
cluster, including all reference strains. Sequence analysis showed this locus is present
46
within housekeeping genes was too limited, if present at all. This was the case of the
rpoB (Yaya et al., 2008). In terms of an evolutionary perspective
MmmSC genomes are extremely homogeneous, suggesting that
adapted very recently to its bovine host. From a practical point of
view in this study, just as in the works of Yaya et al., (2008), this meant that genes of
unknown function or non coding sequences had to be select instead in order to
strains. This is why the strategy has alternatively been named
multilocus sequence analysis (MLSA). This typing scheme is less universal than MLST
analyses, as the gene targets used are selected for typing a biotype of a given subspecies
) and would not be suitable for typing strains of higher taxonomic ranks, given
(Yaya et al., 2008). However, as MLST, MLSA has the advantage
of being a portable and very robust approach.
While the availability of complete genomic sequences is expected to provide a sound
basis for establishing phylogenetic relatedness among bacterial species and
tly to enable the construction of taxonomic entities based on phylogeny, the
way to achieve this has not yet been worked out, since it presents several key problems.
Thus, the current, somewhat arbitrary definition of the basic taxonomic entity, that of a
bacterial species, includes all strains with approximately 70% or higher DNA homology
Tm (Razin, 1992). The recent elucidation of Mycoplasma
systems to generate phenotypic variations (Citti and Rosengarten, 1997) may give clues
r the understanding of pathogenesis but it also sheds light on the identification
problems encountered with reactions based on the recognition of potentially
membrane proteins. The sequences of a putative membrane protein gene and
anking open reading frames have been obtained from various strains in this
cluster, including all reference strains. Sequence analysis showed this locus is present
within housekeeping genes was too limited, if present at all. This was the case of the
. In terms of an evolutionary perspective
genomes are extremely homogeneous, suggesting that
adapted very recently to its bovine host. From a practical point of
, this meant that genes of
unknown function or non coding sequences had to be select instead in order to
. This is why the strategy has alternatively been named
heme is less universal than MLST
analyses, as the gene targets used are selected for typing a biotype of a given subspecies
) and would not be suitable for typing strains of higher taxonomic ranks, given
However, as MLST, MLSA has the advantage
While the availability of complete genomic sequences is expected to provide a sound
basis for establishing phylogenetic relatedness among bacterial species and
tly to enable the construction of taxonomic entities based on phylogeny, the
way to achieve this has not yet been worked out, since it presents several key problems.
Thus, the current, somewhat arbitrary definition of the basic taxonomic entity, that of a
bacterial species, includes all strains with approximately 70% or higher DNA homology
Mycoplasma l
systems to generate phenotypic variations (Citti and Rosengarten, 1997) may give clues
r the understanding of pathogenesis but it also sheds light on the identification
problems encountered with reactions based on the recognition of potentially hyper
membrane proteins. The sequences of a putative membrane protein gene and
anking open reading frames have been obtained from various strains in this
cluster, including all reference strains. Sequence analysis showed this locus is present
47
and fully conserved in all strains of M. mycoides subsp. Mycoides SC isolated from
geographically most distant places worldwide (Thiaucourt, 2000b).
A DNA probe based on randomly chosen genomic fragments was developed for the
differentiation of members of the mycoides cluster into four groups (Taylor et al.,
1992). Genomic typing with two DNA insertion elements, IS1296 and IS1634, has
provided an efficacious tool for a preliminary differentiation of M. mycoides subsp.
Mycoides SC strains (Frey et al., 1995; Cheng et al., 1995; Vilei et al., 1999; Vilei and
Frey, 2004).
A new PCR based test has also been developed for the detection of MmmSC in animal
tissues (Bashiruddin et al., 1994) thus making it possible to identify the causative agent
without necessarily isolating them from the tissues.
The PCR–REA-based analysis of the bgl gene differentiates the African field strains of
M. mycoides subsp. Mycoides SC from the Australian strains, as well as from the type
strain PG1 whose origin is unknown. It also differentiates the T1-derived vaccine strains
from all other African strains. (Cheng et al., 1995; Vilei and Abdo,, 2000; Vilei and
Frey, 2001; Edy et al., 2004).
The use of HindIII allowed further differentiation and showed, notably, that the profiles
obtained from the vaccine strains T1/44 and KH3J were not identical (Thiaucourt et al.,
1998). The evidence of multiple copies of insertion elements present in the MmmSC
genome allowed the development of new typing tools based on Southern blot
hybridization (Cheng et al., 1995). The use of IS1296 as a probe allowed the clear
48
differentiation of recent European strains from those of African origin (Cheng et al.,
1995). The observed difference was explained later on by the identification of an 8.8
kbp deletion in the genome of most MmmSC strains of European origin (Vilei and
Abdo, 2000), resulting in a missing IS1296 band. The use of another insertion element,
IS1634, also led to different Southern blot profiles (March et al., 2000), although the
high copy number of this insertion sequence (N=60), as compared to that of IS1296
(N=28), gave rise to profiles that were difficult to analyze. In 2004 the whole genome
sequence of MmmSC reference strain PG1 was published (Vilei and Abdo,, 2000),
opening new opportunities for the development of typing tools. Analysis of the PG1
genome sequence showed that the loci and primer pairs previously selected for MLSA
were not the most adequate. Some of the primers hybridized on multiple sites, whilst
other targeted sequences that were duplicated in the PG1 genome, hampering result
interpretation.
The use of a technique based on sequencing multiple loci, designated “multilocus
sequence analysis” (MLSA), allowed shortly after the identification of 15 different
allelic profiles within a representative number of MmmSC strains (N=48) of various
origins (Lorenzon et al., 2003). Multilocus Sequence Analysis (MLSA) is very similar
to Multilocus Sequence Typing (MLST), an unambiguous procedure for characterizing
isolates of bacterial species (Enright and Spratt, 1999). MLST has been used with
various pathogenic species, such as Neisseria meningitidis, (Maiden et al., 1998; Feil et
al., 1999). For MLST, typing is based on house-keeping genes exhibiting sufficient
variations within the different strains, potentially allowing the differentiation of millions
of different strains. Previous studies have indicated that when this technique was
49
applied to MmmSC it was not successful because MmmSC strains were very closely
related and the variability within housekeeping genes was too limited, if present at all.
50
CCHHAAPPTTEERR TTHHRREEEE
SSEERROOLLOOGGIICCAALL SSTTUUDDIIEESS
3.1 Experiment 1: Identification of MmmSC in twelve States of Northern Nigeria
by competitive Enzyme Linked Immuno-Sorbent Assay (c-ELISA).
3.1.1 Introduction
Serodiagnosis plays a key role in survey and control programs to combat Contagious
Bovine Pleuropneumonia (CBPP) caused by Mycoplasma mycoides mycoides Small
Colony (Le Goff and Thiaucourt, 1998). Generally serological methods have been
proven useful for the detection of outbreaks of CBPP and they have had an important
role in successful CBPP eradication campaigns in several countries (Newton, 1992).
However, most of the serological techniques used today are still those developed in the
1950’s: the serum agglutination slide test (SAST) (Turner and Etheridge, 1963), the
Complement Fixation Test (CFT) (Campbell and Turner, 1953; Gambles, 1956), and
the detection of circulating antigen by Agar Gel Immuno-Diffusion (AGID) (Griffin,
1965; White, 1958; Shifrin, 1967). The Slide Agglutination Test is not very sensitive
and it might give some false positive reactions but it is nevertheless easy to perform
directly in the field, and it will always detect some positives in the case of acute
outbreaks (Adler and Etheridge, 1964). It can be recommended for the diagnosis of
acute outbreaks when immediate actions are to be taken. The CFT is quite difficult to
standardize because of the use of antigens or fresh red blood cells of various qualities
and it requires skilled technicians. The antibodies detected by CFT wane rapidly and the
number of positives declines dramatically when the outbreak has occurred more than 3
months before the sampling. As with SAST, a number of false positives might be found
in negative herds (Etheridge and Buttery, 1976).
51
An Indirect ELISA based on the systematic, genetic, biochemical and antigenic analysis
of surface exposed lipoproteins of M. mycoides subsp. Mycoides looked very promising
but was not specific enough (Le Goff and Lefevre, 1989). Recently, a competitive
ELISA was developed on the basis of a monoclonal antibody which specifically
recognized an uncharacterized 80 kDa antigen of M. mycoides subsp. Mycoides SC (Le
Goff and Thiaucourt, 1998). The OIE reference method for CBPP serology is the
Complement Fixation Test (CFT). This technique was used in the past for CBPP
eradication in many countries. However, it presents some disadvantages, mainly the
difficulties of antigen production, standardization and the existence of non-specific
positive results. For these reasons the CIRAD-EMVT (FAO World Reference
Laboratory for CBPP) has developed a second test, a competitive ELISA (c-ELISA)
based on a monoclonal anti-MmmSC antibody (named 117/5). This test is an alternative
to the CFT for the OIE and can be used for the official CBPP controls. For both ELISA
and CFT, it should be noted that the results obtained should be interpreted by taking
into account the results of the whole herd. The animals in the incubation stage cannot be
detected, as well as many animals in the chronic stage of the disease, since the
percentage of positive animals decreases as time progresses. So, the sampling protocol
should be adapted to this situation, and a significant number of animals to be tested
must be chosen in the suspicious herd (Institute Pourquier, c-ELISA protocol). In this
work, c-ELISA was used to estimate the prevalence of CBPP infection in the twelve
Northern States of Nigeria.
3.1.2 Materials and Methods
A total of 2026 sera samples were collected from 12 States of Northern Nigeria
indicated in Fig. 2 for analysis by c-ELISA. Sera were collected from sick or
52
apparently unhealthy animals either from suspected outbreaks in the field or through the
Pan-African programme for the Control of Epizootics (PACE) network in the Northern
parts of the country. Under the PACE programme, trained Community Animal Health
Workers (CAHW) were mandated to collect and send to Vom, sera from cattle herds
suspected to be habouring any of the transboundary diseases amongst which is CBPP.
The CAHW were trained on methods of sample collection and ensured that samples
were not collected from animals that have been vaccinated within last 3 months.
53
Figure 2: Map of Nigeria showing the 12 States .
54
3.1.2.1 Competitive Enzyme Linked Immuno-Sorbent Assay (c-ELISA)
The test was carried out according to (Le Goff and Thiaucourt, 1998). Microtitre plates
precoated with lysed Mycoplasma mycoides mycoides SC antigen were used for the test.
Non decomplemented sera (diluted 1/10) and Monoclonal Antibody (Mab) diluted in
PBS with 0.5% horse serum and 0.05% Tween 20 together with all the controls
(Positive, Negative, Monoclonal) were incubated in the plate for 1 hour at 37°C under
moderate agitation in a humid chamber. The plates were then washed twice following
which conjugate was added to all the wells (100 µl) and the plates incubated for
another1 hour at 37°C. After the incubation, the plates were washed three times and the
substrate added to all the wells (100 µl) and this time incubated for 30 minutes. The
reaction was then stopped with the addition of a Stop solution (Sulphuric acid). The
Optical Densities of the reaction was read using Multiskan EX (Labsystems) at 450 nm.
3.1.3 Results
3.1.3.1 c-ELISA
The results for the c-ELISA on isolates from Northern Nigeria are presented in Table 1.
Out of the twelve States surveyed, only two states were negative for CBPP by c-ELISA.
55
Table 1: Estimated prevalence of CBPP by c-ELISA in 12 Northern States of
Nigeria
S/N STATE NO. OF
SAMPLES
NO.
POSITIVE
*(%)
1 Adamawa 304 8 (2.63)
2 Bauchi 154 50 (32.47)
3 Borno 96 2 (2.08)
4 Gombe 18 9 (50.5)
5 Jigawa 135 18 (13.33)
6 Kaduna 313 39 (12.46)
7 Kano 215 11 (5.12)
8 Katsina 74 0 (0)
9 Plateau 591 72 (13.54)
10 Sokoto 108 4 (3.7)
11 Taraba 15 6 (40.0)
12 Kebbi 3 0 (0)
TOTAL 2026 219 (10.81)
* Figures in brackets are percentage positive.
56
3.1.3.2 Rate of CBPP infection in Bulls and Cows
This study also indicated that overall, 82 out of a total of 497 (16.5%) males were
positive for CBPP infection compared to 137 out of 1529 (9%) cows tested. There was
an association between sex and infection rate, i.e. males are more likely to be infected
by the disease (X2=21.63). Both fig.3 and Appendix II shows that although majority of
animals tested were cows, a higher proportion of positive was in the males (i.e.16.5%
positive in males; 9% in females).
57
Figure 3: Rate of CBPP infection in Bulls and Cows based on the total number sampled
0
10
20
30
40
50
60
AdamawaBauchi Borno Gombe Jigawa Kaduna Kano Katsina Plateau Sokoto Taraba Kebbi
Perc
en
tag
e p
osit
ive
States
Male
Female
58
3.1.3.3 Optical Density/Average Percentage Inhibition versus infection rate
The average Optical Density (OD) and the average Percentage Inhibition were plotted
against the infection rates in the various states. The curves for the PI and OD were quite
identical and overlapped (Fig. 4). This could be explained since the PI is the degree to
which the passage of light is inhibited and OD is the degree of resistance to the passage
of light. So it was not surprising to see that both graphs were identical. However, PI is
measured in Percentage while OD is in figures. It was also interesting to note that when
both the Average PI and OD of the the various states were compared with the infection
rates, (Fig. 4) the slopes of the graphs agree with each other indicating direct
correlation with the infection trend in those states. This means that the average PI and
OD for the various states can give an idea of the infection rate in those particular states
even if the actual percentage infection rate is not determined.
59
Figure 4: Graph showing average PI, average OD and infection rates for samples collected from the
various states.
0
20
40
60
80
100
120
Adamawa Bauchi Borno Gombe Jigawa Kaduna Kano Katsina Plateau Sokoto Taraba Kebbi
Perc
en
tag
e p
osit
ivit
y
States
AV. PI
AV. OD.
% POSITIVE
60
3.1.4 Discussions
This study indicates that CBPP is present in almost all the states sampled and confirms
the assertions by Nicholas et al., (2000) that CBPP is indeed widespread in Africa,
especially Nigeria. The fact that at least half the number of states sampled gave a
prevalence rate of over 10% indicates that this disease may be assuming endemic
proportions in Nigeria. This notion is further strengthened by the fact that even though
relatively fewer males were sampled, the rate of infection in them was quite high and it
is a known fact that most farmers keep only a few males in a herd.
The study indicated a significant difference between the rate of CBPP infection in
Males and Females (X2=21.63). The difference seen in the results was as a result of a
higher number of positives recorded in the males even though the actual number of
males sampled was much smaller compared to that of the famales where higher
number were sampled but with only few positives.
It was however interesting to note that when both the Average PI and OD of the the
various states were compared with the infection rates, the slopes of the graphs agree
with each other indicating direct correlation with the infection trend in those states. This
means that the average PI and OD for the various states can give an idea of the infection
rate in thoses particular states even if the actual percentage infection rate is not
determined. This would be particularly useful in sero-prevalence studies where the raw
data for Optical density can be used to calculate the infection rate without actually
performing the calculation for percentage inhibition and this will also eliminate the
problem associated with setting up a reliable cut-off for positive reactions.
61
CCHHAAPPTTEERR FFOOUURR
IISSOOLLAATTIIOONN AANNDD IIDDEENNTTIIFFIICCAATTIIOONN OOFF MMMMSSCC IINN
NNOORRTTHHEERRNN NNIIGGEERRIIAA
4.1 Experiment 2 : Isolation of Mycoplasma mycoides mycoides Small Colony
4.1.1 Introduction
Mycoplasmas, the smallest self-replicating life forms, are primarily characterized by
their lack of a cell wall and cholesterol containing membrane (Woubit et al., 2007).
Conventional methods for the detection and identification of Mycoplasmas
systematically involve enrichment steps in selective broth followed by morphological,
biochemical and serological tests. Although well established, these techniques have
some important drawbacks. The morphological and biochemical characteristics are in
general not discriminative, while serological cross-reaction have been frequently
reported as well (Woubit et al., 2007).
4.1.2 Materials and Methods
Outbreaks of CBPP in five States of Northern Nigeria were investigated. The States
were Plateau, Bauchi, Kano, Kaduna and Kebbi. A total of 287 specimens comprising
49 lung and 14 pleural fluid samples, 172 nasal and 52 ear swabs were collected from
animals suspected to be in the acute stage of CBPP infection. Pleural fluid and lung
tissues were collected in cases of mortalities, while nasal and ear swabs were collected
in live animals. Specimens were also collected from sheep in contact with suspected
bovine herds or showing respiratory distress. In all, 51 specimens were collected from
the sheep which comprised 13 lung and only one pleural fluid samples, 26 nasal and 11
ear swab samples. The only pleural fluid sample was collected from a two week old
lamb which was brought to the Veterinary Clinic in Vom and died of severe respiratory
62
illness. The mother of the lamb however did not show any signs of distress. One sample
(labeled ovine lung) from an unknown source and with an unknown year of collection
was recovered from the NVRI storage freezers and added to the samples for analysis.
Another lung sample collected from ovine species suspected of Contagious Caprine
Pleuropneumonia (CCPP), dated 1970 was also analyzed for MmmSC. The number of
samples collected was based on the number of clinically ill animals available and the
willingness of the owners to permit the collection of specimens. Details of age and sex
of the animals were not considered at the final analysis because the collection of such
data was not consistent. (See Appendix I for details of the samples collected).
3.2 .1 Culture and isolation
The lung tissues, nasal and ear swabs collected from suspected bovine and ovine species
were cultured in growth medium according to Provost et al., (1987) and Freundt,
(1983), see Appendix IV. The specimens were initially incubated in PPLO Broth for at
least 48 hours at 37 0C and 5% CO2 and subsequently subcultured on agar for 2 to 4
days.
4. 1.3 Results
4.1.3.1 Isolation of Mycoplasma mycoides mycoides SC
Eighteen out of the total number of samples cultured were considered to be positive for
Mycoplasma mycoides mycoides SC based on their colonial morphologies. In all, 12 out
of 236 bovine specimens were positive for MmmSC while 6 out of 51 ovine samples
were equally positive for MmmSC. Details of the breakdown for the various positive
specimens, the colony appearance and the animal species involved, are given inTtable
2. Pictures of some of the colonies of the isolates are presented in Plate 2.
63
Table 2: Culture and identification of isolates from specimens
Registr
ation
Numbe
r
Animal
species
Specimen
Screened Colony Appearance
Tentative
identificati
on
044 Ovine adult Nasal Swab Medium, small centre
MmmSC-
like colonies
045 Ovine lamb Pleural Fluid Medium, with or without centre ,,
046 Ovine adult Nasal Swab Round, medium, with or without centre ,,
047 Ovine adult Nasal Swab Medium, dark centre, presence of films ,,
048 Bovine adult Nasal Swab Large, dark centre ,,
049 Bovine adult Ear Swab
Clone 1: large, dark central area, darker
centre, / Clone 3: larger, clear, no centre. ,,
050 Bovine adult Nasal Swab
Clone 5: large bright with darker centre /
Clone 2: small, rough, with tiny centre ,,
051 Bovine adult Nasal Swab Medium, round, clear, dark, marked centre ,,
052 Bovine adult Lungs Round, medium, with or without centre ,,
053 Bovine adult Lungs Round, medium, with or without centre ,,
054 Bovine adult Pleural Fluid Round, medium, with or without centre ,,
055 Bovine adult Ear Swab
Medium, irregular shape, small centre
,,
056 Bovine adult Lungs Round, medium, with or without centre ,,
057 Bovine adult Pleural fluid Round, medium, with or without centre ,,
058 Ovine Lung? Much smaller, with or without centre ,,
059 Bovine1 year Lungs Round, medium, with or without centre ,,
060 Bovine adult Lungs Round, medium, with or without centre ,,
061 Ovine Lungs Round, medium, with or without centre ,,
64
4.1.3.2 Isolation of Mycoplasma mycoides mycoides SC from Ovine species.
The results indicated that among Mycoplasma mycoides mycoides SC isolated from 6
suspected ovine specimens is a positive case from the pleural fluid collected from a two
week old lamb. The dam did not show any signs of respiratory illness, and even though
the lamb was diagnosed with severe pneumonia, CBPP was not suspected because of
the age of the lamb. The confirmation of this disease in these animal species emphasises
the need to carry out pathogenicity studies to determine their effect on bovine.
The results also indicated that a specimen which was collected from a sheep suspected
to be suffering from Contagious Caprine Pleuropneumonia (CCPP) at the Jos abattoir
in 1970 was indeed MmmSC.
4 .1.4 Discussions
It was interesting to note that out of 287 specimens, only 18 were positive for MmmSC
giving a percentage of 6.27%. Even though the percentage positivity was apparently
higher for ovine (11.76%) than for bovine (5.08%), two major reasons could be
attributed to this. Firstly, the number of samples collected from sheep were fewer (51)
than that of cattle (236), and secondly, in cases of suspected outbreaks of CBPP,
owners usually institute treatment even though it is not recommended, which probably
is responsible for the very low number of isolates recorded in cattle. Sheep on the other
hand are usually considered as companion animals and since most owners do not
consider them to be in danger of contracting CBPP they are usually not screened or
treated, except where they show severe respiratory signs.
It was also interesting to note that there were variations in the appearance of the
colonies of Mycoplasma mycoides mycoides isolated from the different outbreaks. Even
65
though they had the characteristic small colony appearance, their appearance and size
were difficult to harmonize. There were very obvious differences between these
colonies which by their general appearance had been classified as MmmSC (See Figure
6). Some colonies were quite large with large dark centers while in others the centre
was thick and small. As a result of these variations it was not possible to make a
definitive diagnosis of Mycoplasma mycoides mycoides Small Colony for all the
isolates. These isolates had to be confirmed by a specific pcr for the diagnosis of
MmmSC and where it was negative; a sequencing of the 16SRNA was performed.
The isolation of MmmSC from the pleural fluid of a two week old lamb calls for a
reassessment of the incubation period of the disease caused by this isolate in both
bovine and ovine species. Since the lamb apparently came down with a respiratory
illness which could be attributed to the MmmSC, there is a need to determine the extent
of involvement of these species in the epidemiology of this disease.
The only plausible explanation for the isolation of MmmSC from the specimen of a
sheep suspected of CCPP could be that the MmmSC was present at the time of the
sample collection either as a contaminant or in combination with the CCPP organism,
but because of the fastidious nature of the organism, it was lost during storage.
PLATE 2: Colonies of Mycoplasma mycoides mycoides SC isolated from the specimens
66
: Colonies of Mycoplasma mycoides mycoides SC isolated from the specimens
: Colonies of Mycoplasma mycoides mycoides SC isolated from the specimens
67
4.2 Experiment 3: Identification and confirmation of Mycoplasma mycoides
mycoides Small Colony isolates by specific Polymerase Chain Reaction (PCR).
4.2.1 Introduction
In recent years, PCR has replaced traditional diagnostic tests for the identification of
members of the Mycoides cluster (Woubit, 2008). DNA amplification techniques offer a
promising identification system by avoiding variability that hinders serological methods
(Le Grand, et al., 2004). So far a number of PCR tests have been developed for the
rapid identification of species of the M. mycoides cluster. Most of the PCR systems
developed until recently and before the flourishing of genomic sequence of
Mycoplasmas were based on CAP-21 sequence fragment encoding notably for
ribosomal proteins rpsL and rpsG, and the design of specific primers for MmmSC
(Bashiruddin, et al., 1994), M. mycoides cluster and M. putrefaciens (Hotzel, et al.,
1996; Rodriguez, et al., 1997). The other most widely used target for specific PCR tests
is the 16S rRNA gene, this gene has been used for specific PCR for the identification of
Mccp (Buscanana, et al., 1999; Bolske et al., 1996) and MmmSC (Persson, et al.,
1999). In addition to these two gene that encodes for lipoprotein, p72 gene has been
used for the design of specific primers for MmmSC (Miserez et al., 1997) and MBG 7
(Frey, et al., 1998) detection. Finally gene lppA has been used for the detection of
Mccp, Mcc, MmmLC and Mmc (Monerate, et al., 1999). A non coding intergenic
sequence between MSC _0390 and MSC _ 0391 in the genome sequence of MmmSC
strain PG 1 has also been employed in the design of specific PCR primers for MmmSC
(Dedieu, et al., 1994). A recent evaluation of the above mentioned PCR tests have
revealed all PCR tests based on lipoprotein genes were not strictly specific (Le Grand,
et al., 2004) with respect to MmmSC identification. PCR tests by Dedieu et al., (1994)
68
and Bashiruddin et al., (1994) remain reliable tests as these two have been used
extensively in some CBPP diagnostic laboratories abroad (Woubit, 2008).
4.2 .2 Materials and Methods
In this experiment, all the 18 Mycoplasma isolates were subjected to Diagnostic PCR
test for the detection of MmmSC according to protocols by Dedieu et al., (1994).
4.2.2.1 Extraction of DNA
A 3 ml of MmmSC broth culture in medium was centrifuged for 10 min at 10,000g. The
pellet was washed once in 1.5 ml PBS, centrifuged again and re-suspended in 50 µl
sterile dH2O and to which 100 µl lysis buffer (100mM Tris–HCl pH 8.5, 0.05% Tween
20, 0.24 mg/ml proteinase K) was subsequently added. This was then incubated in a
water bath at 60°C for 1 hour and Proteinase K was then inactivated at 95°C for 5 min.
1 µl of the DNA extract was finally added to the reaction as the DNA template. This
template was used for all other pcr reactions carried out on the isolates.
4.2.2.2 Diagnostic PCR for the detection of MmmSC
This test was carried out according to the work of Dedieu et al., (1994). The DNA
reaction mix consisted of Sterile dH2O, 10x Qiagen Taq buffer, (15 mM MgCl2) Roche,
dNTP mix (30 mM AT / 15 mM GC), Qiagen Taq Polymerase (5 u/µl), Primer
MSC1_Forward 5’ ATACTTCTGTTCTAGTAATATG 3’ (20 µM) and Primer
MSC_Reverse 5’ CTGATTATGATGACAGTGGTCA 3’ (20 µM). To each 49 µl
PCR master mix was added 1 µl of the DNA extract from the isolates according to the
protocol. The DNA samples were amplified with the primers listed in Table 2.
Amplifications were performed using Gene Amp PCR Systems 2720 (Perkin Elmer).
Thermal cycling consisted of an initial denaturation step at 94°C for 2 minutes,
followed by 40 cycles of denaturation at 94°C for 30 seconds, annealing at 53°C for 30
69
seconds and extension at 72°C for 1 minute. The final extension step was maintained at
72°C for 5 minutes. The PCR products were then run on 2% agarose gel.
4.2.2.3 Agarose (2%) gel electrophoresis
A 2% Agarose gel was prepared for the separation of the PCR products according to
their sizes. Briefly, 2g agarose powder was mixed with 100ml of electrophoresis buffer,
Tris-acetate-EDTA (TAE). The gel was melted in a micro-wave oven, then poured into
a gel casting tray and allowed to set at room temperature. Individual pcr products were
then mixed with a loading dye (Bromophenol blue) at a ratio of 1 to 5 and placed in
their respective wells on the gel. The gel apparatus was then connected to electric power
source and the gel run at 130 volts for 30 minutes. Finally, the gel was removed from
the electrophoresis tank, stained in Ethidium bromide solution (0.5ug/ml) for 20
minutes and rinsed in water for 15 minutes. The DNA migration was viewed under the
transilluminator (UV light of wavelength 254 nm) and photographs of taken.
4.2.3 Results
Thirteen out of the eighteen Mycoplasma isolates recovered from the samples cultured
were confirmed to be MmmSC by a selective Polymerase Chain Reaction Assay for the
detection of Mycoplasma mycoides subsp. Mycoides S.C. (Dedieu, et al., 1994). The
production of a band equivalent to 275 bp and at the same distance with the PG1
positive control confirms MmmSC.
70
M 1 2 3 4 5 6 7 8 9 10 1112 13 14 - M
275bp
PLATE 3: MmmSC diagnostic PCR MSC1: 275 bp product from all clones of the samples
M: molecular weight marker, 1: 045-C1; 2: 048C1, 3: 050-C1; 4: 051-SC1; 5: 051-
C1; 6: 052-C1; 7: 053-C1; 8: 054-C1; 9: 056-C1; 10: 057-C1; 11: 058-C1; 12: 059-C1; 13: 060-C1;
14: 061-C1; +MmmSC PG1 positive control; -: water blank
71
Table 3: Isolates identified by Specific PCR for the diagnosis of MmmSC.
N° Animal Species Colony Appearance Results
048 Bovine adult Large, dark centre MmmSC
051 Bovine adult Medium, round, clear, dark, marked
centre
MmmSC
052 Bovine adult Round, medium, with or without
centre
MmmSC
053 Bovine adult Round, medium, with or without
centre
MmmSC
054 Bovine adult Round, medium, with or without
centre
MmmSC
056 Bovine adult Round, medium, with or without
centre
MmmSC
057 Bovine adult Round, medium, with or without
centre
MmmSC
059 Bovine 1 year Round, medium, with or without
centre
MmmSC
060 Bovine adult Round, medium, with or without
centre
MmmSC
050 Bovine adult Clone 5: large bright with darker
centre / Clone 2: small, rough, with
tiny centre
Clone 5: MmmSC /
Clone 2: M. arginini
061 Ovine Round, medium, with or without MmmSC
72
centre
045 Ovine lamb Medium, with or without centre MmmSC
058 Unknown Much smaller, with or without centre MmmSC
055 Bovine adult Medium, irregular shape, small centre Clone 1: M.
alkalescens
049 Bovine adult Clone 1: large, dark central area,
darker centre, / Clone 3: larger, clear,
no centre.
Clone 1: M. yeatsii,
Clone 3: MBG 7
047 Ovine adult Medium, dark centre, presence of
films
ND (weak
amplification by
PCR)
044 Ovine adult Medium, small centre Clone 1: M. arginini
046 Ovine adult NO GROWTH ND (no growth)
The other isolates, M. arginini, M. alkalescens, M. yeatsii, and MBG 7 were identified
by sequencing of the 16sRNA.
PLATE 4: M. mycoides mycoides Small Colony (048 Bovine, Birnin Kebbi) Isolate
from pleural fluid from a Bovine in a herd suspected of CBPP in Bogodo near Birnin Kebbi in
Kebbi State. Colonies were large with dark
73
: M. mycoides mycoides Small Colony (048 Bovine, Birnin Kebbi) Isolate was recovered
from pleural fluid from a Bovine in a herd suspected of CBPP in Bogodo near Birnin Kebbi in
Kebbi State. Colonies were large with dark centre.
was recovered
from pleural fluid from a Bovine in a herd suspected of CBPP in Bogodo near Birnin Kebbi in
PLATE 5: (044 Ovine, Fadan kaje) Nasal swab
infected herd in Fadan Kaje, Kaduna State.
1 of these confirmed to be M. arginini
74
: (044 Ovine, Fadan kaje) Nasal swab collected from ovine adult in contact with a CBPP
infected herd in Fadan Kaje, Kaduna State. Colonies were medium in size with small center. Clone
M. arginini.
collected from ovine adult in contact with a CBPP
Colonies were medium in size with small center. Clone
75
4.2.4 Discussions
The confirmation of thirteen isolates to be Mycoplasma mycoides mycoides Small
Colony out of the eighteen initially recovered is quite significant. Some mixed cultures
of MmmSC and M. arginini were also observed. This is not so surprising since M.
arginini is very often isolated from animal samples as a contaminant and has no
pathogenic significance. However culture 055 was identified as M. alkalescens and this
agent has a pathogenic potential. Other organisms isolated included M. yeatsii and
Mycoplasma Bovine group 7 (MBG 7). Biochemical analysis was not carried out on
these samples on account of the cross reactivity of the Mycoplasmas and unreliability of
these tests. However phenotypic identification also proved difficult as it was not easy to
differentiate some non MmmSC colonies from those of MmmSC. The situation was
made worse by situations where two clones of the same culture eventually yielded two
different organisms. The fact that several colonies of MmmSC showed different colonial
morphologies makes phenotypic method of identification unreliable. Three isolates
from sheep were among the isolates confirmed as MmmSC. This is quite significant
since these animals herd together with cattle. Further work needs to be done on these
isolates to determine if they are genetically similar to the isolates from bovine. The
confirmation of thirteen isolates out of the original eighteen also indicates that infection
is widespread in Northern Nigeria.
4.3 Experiment 4: Identification of isolates by MmmSC Specific QPCR
4.3.1 Introduction
Detection of MmmSC can be done by bacterial culture, which is relatively easy as this
Mycoplasma grows well in adequate medium (Lorenzon et al., 2008). Since 1994, the
use of specific PCR tests has made detection and identification of this organism much
76
more sensitive and reliable (Bashiruddin et al., 1994; Dedeiu et al., 1994). However,
classical PCR has a number of drawbacks, the major one being the risk of
contamination during post-PCR analysis. Additionally, classical PCR does not allow
quantification of the target DNA in the sample, and may lack sensitivity when
compared to newer methods. Real Time PCR (rtPCR) assays are less prone to
contamination risks and their use in the detection of notifiable pathogens must be
promoted. Real-time PCR assays have already been described for MmmSC (Gorton et
al., 2005; Fitzmaurice et al., 2008). In these previous studies, the targets were chosen in
conserved sequences and specificity was based on very few nucleotide differences. The
availability of commercial kits has made the technique easy to perform, efficient, and
reliable. QPCR methods are easily adapted to high throughput assays, allowing
researchers to process large numbers of samples in a short period of time. In addition,
data can be collected and analyzed using specialized software designed for the specific
instrument being used, and a personal computer. QPCR has been used for many diverse
applications, including the detection of pathogenic bacteria, identification and
quantification of microorganisms from water samples, studying gene expression levels,
and detection of single-nucleotide polymorphisms (SNP’s) in genomic sequences.
4.3.2 Materials and Methods
The confirmatory QPCR for the MmmSC isolates was carried out using the SYBR®
Green qPCR Master mix. The SYBR Green I dye has a high binding affinity to the
minor groove of double-stranded DNA (dsDNA). It has an excitation maximum at 497
nm and an emission maximum at 520 nm. In the unbound State the dye exhibits little
fluorescence; however, when bound to dsDNA, the fluorescence greatly increases,
making it useful for the detection of product accumulation during real-time PCR.
77
During denaturation, all DNA becomes single stranded. At this stage, SYBR Green is
free in solution and produces little fluorescence. During the annealing/extension step,
the primers hybridize to the target sequence and are extended, resulting in dsDNA to
which SYBR Green I can bind. The test was carried out according to protocols by
Lorenzon et al., (2008). The SYBR® Green QPCR Master mix is a ready-to-use
cocktail containing all components, except primers and template, for the amplification
and detection of DNA in qPCR. It is supplied in a 2X concentration and contains
sufficient reagents to perform 400, 25-µL reactions. The mix is optimized for SYBR
Green reactions and contains SYBR Green I Dye, AmpliTaq Gold® DNA polymerase,
and dNTPs with dUTP, Passive Reference, and optimized buffer components.
In this reaction, to each 23 µl QPCR master mix were added 1 µl of template DNA
extracted (from Experiment 3.3.1) and 1 µl of primers Q_MSC_0382_Forward 5’
ATGCAAGAAGTTATTAATGTTTATCATTC 3’ and Q_MSC_0382_Reverse 5’
CGTAATATATTTGTTTAACATATGGAATAA 3’. The SYBR Green master mix was
mixed gently by inversion without generating bubbles to avoid the creation of optical
errors during the sample read. Amplifications were performed using Strategen-
Mx3000P® Instruments. The default dissociation curve for SYBR Green experiments
was used. This default profile dissociation curve began with 1-minute incubation at
95°C to melt the DNA and then 30-second incubation at 55°C. This was followed by a
ramp up to 95°C with all points data collection performed during the ramp.The final
cycle consisted in an initial denaturation step at 95°C for 10 minutes, followed by 40
cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 1 minute and
extension at 72°C for 1 minute. This was followed by a ramp down at 95°C a rate of
0.2°C/sec for 1 minute and then a ramp up at 55°C a rate of 0.2°C/sec for 30 seconds.
78
The final step was maintained at 95 °C for 30 seconds. The progress of the reaction was
monitored on the computer in real time.
4.3.3 Results
All positive MmmSC cultures were also screened by Specific QPCR for the
identification of MmmSC. The production of similar curves by all the isolates and
another by the PG1 positive control confirms MmmSC .
79
Figure 5: Specific QPCR for the identification of MmmSC
80
Figure 6: Temperature dissociation curve for the isolates
81
4.3.4 Discussions
Diagnosis of MmmSC by QPCR offers lots of opportunities in Mycoplasma research
especially towards CBPP control efforts. The fact that this technique is very fast means
that several samples can be handled in unit time. Considering a vast country like
Nigeria where the number of samples from the field could be especially high, this will
be of significant advantage. The monitoring of the reaction in real time also means that
end point processes like staining with Ethidium bromide which is carcinogenic and a
possible source of contamination could be avoided. Even though the melting points of
the thirteen Nigerian Isolates of MmmSC tend to show very slight variations suggesting
the possibility of strain variation, it was not possible within the scope of this work to
differentiate the isolates using this technique. Although the equipment is expensive, it is
quite affordable considering the benefits to be derived. It is relatively easy to handle and
does not require special skills in interpretation. The reaction mix is also easy to use.
82
CCHHAAPPTTEERR FFIIVVEE
55..00 MMOOLLEECCUULLAARR CCHHAARRAACCTTEERRIIZZAATTIIOONN OOFF MMMMSSCC IISSOOLLAATTEESS
5.1 Experiment 5: Multi-Locus Variable Analysis (MLVA) Variable Number Tandem Repeats (VNTR) MmmSC TR-34 PCR
5.1.1 Introduction
In contrast to the popularity of DNA based identification methods, typing methods are
only gradually implemented in the field of Mycoplasmology (Stakenborg, 2005).
Firstly, for some species, the isolation is often merely too complex and laborious to
perform. Secondly, some species are ubiquitously present and not linked to true
outbreaks, making epidemiological episodes hard, if not impossible, to define (Hege et
al., 2002). Finally, some well documented, important species are very homogeneous
and difficult or impossible to type with techniques commonly used for other
Mycoplasmas (Cousin-Allery et al., 2000; Tenover et al., 1994). Since there are
currently numerous detailed reports about intraspecific variability, it has become
increasingly important to type strains or to define specific subgroups within a species.
This increasing interest in epidemiological data of Mycoplasmas will help to elucidate
the genomic plasticity, observed for some species, to reveal the geographical spread or
transmission patterns, or to interprete differences seen on the biological level.
Ultimately, the understanding of epidemiological behaviour may offer possibilities to
control or even to eradicate Mycoplasma related diseases.
Genetic loci or sequences containing variable numbers of tandem repeats (VNTR loci)
are frequently used for typing purposes and may prove especially valuable for
Mycoplasmas. Many medically important genes have been identified based on their
linkage to a mapped VNTR locus. Individual VNTR loci have been identified in
bacteria (Andersen et al., 1996; Frenay et al., 1994; Frothingham, 1995; Goyal et al.,
83
1994). The M. mycoides subsp. Mycoides SC genome contains an exceptionally high
fraction of repetitive sequences, the highest so far in currently sequenced bacteria
(Westberg et al., 2004). Generally, repeats are somewhat arbitrarily divided in tandem
repeated sequences (or satellites) and repeats that are dispersed around the genome.
These latter repeats are often linked to important surface antigens and owing to
occurring recombination events between the multiple copies present, they may
contribute to the similarity of known insertion sequences (IS) (Mahillon and Chandler,
1998).
5.1.2 Materials and Methods
The 13 isolates were characterized using Multilocus Variable-Number Tandem Repeat
Analysis (MLVA) on locus TR34 (within gene nat A). The PCR was conducted using
the primers indicated in Table.4. The conditions for the PCR were same as for
Experiment 3.3.2 and the primers Eh Ch TR34L 5’ ATTCAAATGTAACCAATCAGC
3’ Eh Ch TR34R 5’ GATTGCTTTGATTAACTTGTTG 3’ corresponding to sequences
on positions 451976 and 452235 on the PG 1 genome were used for the reaction. The
premers had melting temperatures of 56oC and 58oC respectively.
5.1.2.1 Agarose (4%) Gel preparation and migration
The preparation of the gel was same as for Experiment 3.3.3 except that in this case 4 g
(4%) of agarose was used instead. Individual pcr products were then mixed with a
loading dye (Bromophenol blue) at a ratio of 1 to 5 and placed in respective wells on the
gel. The gel apparatus was then connected to electric power source and the gel was run
at 18 volts overnight (14 hours). Finally, the gel was stained in Ethidium bromide
solution (0.5ug/ml) for 10 minutes and rinsed in water for 15 minutes. The DNA
migration was viewed under the transilluminator (UV light of wavelength 254 nm) and
84
photographs of taken. The number of repeats in the DNA isolate was estimated by
comparing the bands on the gel to those of other strains which have already been
sequenced and the number of repeats determined. These known strains were
incorporated into the test to serve as controls with number of repeats ranging from 4 to
16. These strains include; 9773 (4 repeats), 04003 (5 repeats), 83162 (6 repeats), 98029
(7 repeats), Afade (8 repeats), Rita (8 repeats), Vom (8 repeats), 9048 (9 repeats), 99042
(10 repeats), 91130 (13 repeats), and 00033 (16 repeats), all of which were got from the
World Reference laboratory for CBPP in France.
5.1.2.2 Polyacrylamide (10% ) Gel Electrophoresis
A 10% polyacrylamide gel was prepared by adding 600 µl of 10% ammonium
persulfate to 30 µl of Acrylamide/Bis, 12 µl 10X TBE, 78 µl Distilled water (Milli Q)
and finally 80 µl of Tetramethylethylenediamine (TEMED). About 10 µl of each pcr
product (50 µl product plus 5 µl blue sigma loading dye) was loaded into specific wells.
10 µl Marker VIII was used as the ladder while blanks were filled with loading dye
(1/10) diluted in water. The gel apparatus was then connected to electric power source
and the gel pre-run at 100V (30mA) for 15 minutes to stabilize the apparatus. After
loading the pcr products, there was an initial run at 100V (30 mA) for 15 minutes before
it was transferred to a cold room (40C) and set to 300V (77 mA). This was left
overnight (14 hours) before stopping the run. The gel was then stained in Ethidium
Bromide for 8 minutes and destained in distilled water for 30 minutes. The number of
repeats in the DNA isolate was also estimated by comparing the bands on the gel to
those of other strains which have already been sequenced and the number of repeats
determined.
85
5.1.3 Results
When the PCR products were migrated using 4% Agarose Gel Electrophoresis, it was
difficult to differentiate the isolates because the bands were poorly separated since they
were all between 200-500bp molecular weight (See Plate 6 and 7). However when the
products were migrated using 10% Poly-Acrylamide Gel Electrophoresis (PAGE), the
bands were clearly separated making it easy to differentiate the isolates into 5 different
alleles (See Plate 8 and 9). Thus, with the locus TR34, the 13 strains from Northern
Nigeria were differentiated into 5 alleles (See Table 4), the number of tandem repeats
varied from four to twelve. Two alleles gathered the majority of isolates with 5 strains
each (alleles with 8 and 12 repeats). The three other alleles had 1 strain each. The
results are summarized in Table 4 and Fig. 7.
86
Table 4: TR 34 Differentiates the Mycoplasma isolates into 5 alleles based on the number of repeats
ranging from 4 to 14
Serial no Source No of Repeats
059 c1 Kafanchan (Ovine) 4
052 c1 Kanam 8
053 c1 Barkin Ladi 8
056 c1 Vom/Jos 8
057 c2 Vom (Fadan kaje) 8
061 c1 Jos 8
051 c1 Bauchi 9
045 c1 Vom (Lamb) 12
048 c1 Birnin Kebbi 12
050 c1 Bauchi 12
054 c1 Sanga 12
060 c1 Kano 12
058 c1 Vom (Ovine) 14
87
1,517
500/517
1,000
200
100
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 MBase pair s
PLATE 6: MLVA VNTR MmmSC TR-34 PCR: 4% Agarose gel electrophoresis
M: 100 bp molecular weight marker, 1: 045-C1; 2: 048C1, 3: 050-C1; 4: 051-SC1; 5: 051-LC1; 6:
052-C2; 7: 053-C1; 8: 054-C1; 9: 056-C1; 10: 057-C2; 11: 058-C1; 12: 059-C1; 13: 060-C1; 14: 061-
C1; 15: M 100 bp molecular weight marker
88
M 1 2 3 4 5 6 7 8 9 10 M
1,5 17
1,0 00
500/517
200
100
Base pairs
PLATE 7: MLVA VNTR MmmSC TR-34 PCR: 4% Agarose gel electrophoresis
M: 100 bp molecular weight marker, 1: VOM; 2: 83162; 3: RITA; 4: 9048; 5: 91130 6: 9773 ; 7:
98029 ; 8: 99042 ; 9: 00033; 10: 04003; M 100 bp molecular weight marker
89
10% Polyacrylamide Gel electrophoresis
PLATE 8: MLVA VNTR MmmSC TR-34 PCR: 10% Poly Acrylamide Gel Electrophoresis
B: Blank; M: Molecular weight marker, 1: 9773; 2: 059C1, 3: 04003; 4: 83162; 5: 98029; 6: 061; 7:
Afade; 8: 053-C1; M: Molecular weight marker; 9: 056-C1; 10: 057-C2; 11:B17; 12: 052-C1; 13:
051-SC1; 14: 051-LC1; 15: Rita; 16: Vom; B: Blank
90
B M 17 18 19 20 21 22 23 M 24 25 26 B
PLATE 9: MLVA VNTR MmmSC TR-34 PCR: 10% Poly Acrylamide Gel Electrophoresis
B: Blank; M: Molecular weight marker 17: 9048; 18: 99042; 19: 045-C1; 20: 048-C1; 21:050; 22:
054-C1; 23: 060-; M: Molecular weight marker 24: 91130; 25: 058; 26: 00033; B: Blank
91
Figure 7: Geographical distribution of the different MmmSC TR 34 types
Types A (4 repeats), C (9 repeats) and E (14 repeats) are found only in one State each. While Type B (8
repeats) is found in Plateau and Kaduna States. The Type D (12 repeat) is more widely distributed as it is
found in all the five States screened
4
8
9
12
14
92
5.1.4 Discussions
This technique differentiated the isolates into five different alleles and also produced
three alleles that were unique to particular States. That means if there is an outbreak of
infection involving any of these strains, a relationship between the outbreak and the
origin of the infection could be determined. If this technique is extended to other parts
of the country, it would be possible to identify all the alleles in the different parts of the
country for the purpose of documentation and control efforts. It is also interesting to
note that the isolates were segregated into five strains even though all isolates were
circulating within the central region of the country. This means that different strains are
involved in CBPP outbreaks in those areas a feature to be noted especially in relation to
the use of a single MmmSC strain for vaccination and future vaccine development.
5.2 Experiment 6: Multi-Locus Sequence Analysis (MLSA) on Loc-PG1-0001 and Loc-PG-0103
5.2.1 Introduction
High throughput sequencing technologies and new bioinformatics tools have literarily
revolutionized modern microbiology. Phenotypic characterization of bacteria may now
seem as nineteen century tools. A technique such as iso-enzyme profiling has long ago
been replaced by multilocus sequencing of all genes. Coding sequences can then be
compared and the detection of synonymous mutations has further increased the
resolving power of the technique (Woubit et al., 2007). Molecular epidemiology tools
can aid in identifying strains of Mycoplasma mycoides mycoides Small Colony at a finer
level than simply the ‘SC biotype’ level, offering the possibility of understanding
certain trends in the spread of CBPP (Lorenzon et al., 2003). Up to 1995, MmmSC
strains were considered very homogeneous (Costas et al., 1987). Specific detection
93
methods were then developed which enabled the detection of all MmmSC strains
(Bashiruddin et al., 1994) and their differentiation from the closely related strains of the
mycoides cluster. Since that time, evidence has shown that MmmSC strains can be
differentiated at the molecular level. Restriction analysis of whole DNA makes it
possible to identify strain groups and to differentiate between any two vaccinal strains,
such as T1 and KH3J (Poumarat and Solsona, 1995; Thiaucourt et al., 1998). Southern
blotting, using insertion sequence IS1296 as a probe, enabled differentiation between
strains of European and African origin. Furthermore, different profiles were obtained in
strains of African origin (Cheng et al., 1995). A major genetic difference between
European and African strains was identified later, the genome of the European strains
lacking a segment of 8.84 kb including an IS1634, an ABC transporter and other genes
(Vilei et al., 2000). Ultimately, specific PCR reactions were designed to identify the T1
vaccinal strain taking advantage of sequence variation in IS1296 flanking regions
(Lorenzon et al., 2000). Phenotypic differences were also evidenced, such as the
presence of extra bands in SDS PAGE profiles (Goncalves et al., 1998), the inability of
European strains to oxidize glycerol (Abu-goun et al., 1994 ; Houshaymi et al., 1997) or
variability in growth rates and inhibition of growth by hyper immune sera (March et al.,
2000).
While amplification of the specie-specific PCR product can result in a direct
identification, sequence analysis can be used to discriminate between strains. The
technique does not need the cultivation of fastidious Mycoplasmas and since all
molecular typing techniques are ultimately based on differences in sequences, sequence
analysis seems the best approach. Moreover, the technique has an excellent inter-
94
laboratory reproducibility and data can be stored in online databases (Jolley et al.,
2004).
More expensive Sequenced-based methods (Olive and Bean, 1999), called MLST which
were developed to cope with some important drawbacks related to typing studies based
on sequence analysis of single genes, are becoming powerful sub typing tools in
molecular epidemiology. These methods have the advantage of being easily
standardized and automated. Instead of analyzing one single genomic fragment, the
partial sequences of multiple, selected genes are determined. Ideally, sequence
fragments about 500 bp in length of at least seven, widely scattered genes should be
included to obtain a good representation of the genome, but the number may vary
between different studies. Mostly, essential (housekeeping ) genes are chosen because
they are less often subjected to horizontal transfer events and are not liable to strong or
unusual selective pressures. As a consequence, they are perfectly suited to represent the
accumulation of sequence variation in the genome. However, some exceptions have
been reported where a number of housekeeping genes showed too few differences to be
useful for typing (Dumke et al., 2003; Manning et al., 2003, Nallapareddy et al., 2002).
For these cases, carefully selected species specific genes may be included instead. Once
the base r amino acid substitution rate of the selected genes is known, mathematical
models are available to perform profound phylogenetic analyses and to efficiently
determine the clonal structure of the population (Dingle et al., 2001; Iredell et al., 2003;
Lemee et al., 2004; Sarkar and Guttman, 2004). MLST turned out to be the method of
choice for the typing of several bacterial species of global importance (Urwin and
Maiden, 2003) and for those, databases for international surveillance have been set up
(Feil and Enright, 2004). This approach has multiple applications such as phylogeny
95
(Hanage et al., 2005), molecular structure analysis (Tourasse et al., 2006) and molecular
epidemiology. In molecular epidemiology, MLST can be used to study the evolution of
antibiotic resistant strains (Gherardi et al., 2006), or the distribution of strains of various
lineages within a population (Lacher et al., 2006).
MLST, while successful for the differentiation of other organisms (Feil, et al., 2000,
Kotetishvili, et al., 2002, Nicolas, et al., 2000, Zhou, et al., 2000), was unfortunately
not so with MmmSC because the techniques are quite difficult to standardize and in the
case of MmmSC the variability within housekeeping genes was too limited, if present at
all. This was the case of the genes fusA, lep A and rpoB. Therefore it was decided in
this work to use a technique based on PCR and sequencing. This technique was based
on the identification of MmmSC polymorphic DNA sequences in which polymorphisms
were amplified and sequenced and their occurrence compared in a representative subset
of strains to build a multilocus sequence analysis (MLSA) tool (Lorezon et al., 2003).
This typing scheme is less universal than MLST analysis, as the gene targets used are
selected for typing a biotype of a given subspecies (MmmSC) and would not be suitable
for typing strains of higher taxonomic ranks, given their high variability. However, as
MLST, MLSA has the advantage of being a portable and very robust approach (Yaya et
al., 2008).
5.2.2 Materials and Methods
A Multilocus sequence analysis (MLSA) was performed on two loci: Loc-PG1-
0001(non coding region) and Loc-PG1-0103 (coding for a hypothetical lipoprotein).
The major factor in the choice of locus of analysis was the ability of the locus to
96
differentiate strains from West Africa (Yaya et al., 2008). In that work, Loc-PG1-0001
had six alleles with the greatest variability found among strains originating from West
Africa as such it was considered as a candidate locus for the characterization of the
MmmSC isolates from Northern Nigeria. Likewise, five alleles which corresponded to a
variable number of 5 to 9 trinucleotide repeats (AAT) coding for asparagine (N) within
a putative lipoprotein coding gene were found in locus Loc-PG1-0103, and also chosen
for the analysis.
5.2.2.1 PCR for Loc-PG1-0001and Loc-PG1-0103
The PCR reactions were performed using Gene Amp PCR Systems 2720 (Perkin Elmer)
in 50 _l reaction mix. This mix contained 2.5U of Taq polymerase (Quiagen),
corresponding amplification buffer with a final concentration of 1.5mM MgCl2, 0.4 _M
of each primer, 150 _M of dGTP and dCTP and 300_M of dATP and dTTP, and the
template. Samples were amplified with the primers Loc-PG1-0001-F 5’
AACAAAAGAGATCTTAAATCACACTTTA 3’ and Loc-PG1-0001-R 5’
CCTCTTGTTTAACTTCTAGATCAGAAT 3, for Loc-PG1-0001 with Loc-PG1-
0103-D 5’ GATGGATATAATCTATACTAGCATTTA 3’ and Loc-PG1-0103-F 5’
CCTTATATAGATAAAACTCCTCCTTA 3’ for Loc-PG1-0103. Thermal cycling
consisted in an initial denaturation step at 94°C for 5 minutes, followed by 35 cycles of
denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds and extension at
72°C for 90 seconds. The final extension step was maintained at 72°C for 7 minutes.
The PCR amplification products were analyzed by electrophoresis through 1% agarose
gels (QA-Agarose, MP Biomedicas, IllKirch, France) at 100V and visualized after
staining with Ethidium bromide on a UV transilluminator. Samples with relevant
features were sent to Cogenics (Meylan, France) for sequencing with the corresponding
97
primers. Both forward and reverse strands were sequenced. Results from COGENICS
were received as electronic files. The electrophoregrammes were examined and the
sequences were assembled and aligned with the software Vector NTI SuiteTM . The
sequences were compared to those previously obtained on 50 strains of MmmSC (Yaya
et al., 2008). If the feature of a strain corresponded to one of the strains in the work of
Yaya et al., 2008, its allele number was assigned to the strain. Otherwise, a new allele
number was given.
5.2.3 Results
Prior to sequencing, all the PCR products of the isolates for the different loci were run
on 1% agarose gel to make sure they were of the required length and uncontaminated
(pure). A 538 bp product as indicated by the gel migration indicated the right amplicon
(See Plate 10).
5.2.3.1 Allelic profile analysis
The sequences obtained from each corresponding forward and reverse primers were
assembled using Vector NTI SuiteTM (InfoMax, 2001) and the extremities
corresponding to a single strand sequence or showing aberrant features were trimmed.
The sequences obtained from different strains for each locus were aligned using
ClustalW (Vector NTI). Polymorphic sites were recorded, carefully checking the
corresponding sequence chromatograms. An allele number was assigned to each change
in the nucleotide sequence in accordance with the results of Yaya et al., (2008). At the
end, each strain was characterized by an allelic profile, corresponding to the
combination of allele numbers for each of the two selected loci (See Plate 11 and 12).
98
5.2.3.1.1 Alleles defined in non-coding sequences Loc-PG1-0001
Three alleles were identified on the locus Loc-PG1-0001 (allele 1, 4 and 7) (Plates 11
and 12). Polymorphisms were at two positions: position 1523 and position 1635 on the
PG1 genome. At the first position, Isolates 051, 058 and 059 bore A instead of T for the
10 other strains. The second polymorphism was displayed at position 1635: the Isolates
048 and 054 from Kebbi and Kaduna States respectively, had A while the other 11
strains had G. This latter mutation is a new discovery as this was not observed on 51
strains previously analyzed by Yaya et al., (2008). As a result, a new allele number (n°
7) was assigned to these two isolates from Nigeria. All three alleles determined in these
loci were found circulating within the central states of Kaduna, Bauchi and Plateau
States. Alleles 1 and 4 were shared between Kaduna, Bauchi and Plateau States while
Kano State had only allele no. 4. The new allele no. 7 was shared between Kaduna and
Kebbi States with the latter state having it as the only allele (See Fig. 8).
5.2.3.1.2 Alleles defined in genes of unknown function: Lipoproteins (Lpp) and
Conserved hypothetical proteins (Chp) Loc-PG1-0103
Five alleles were defined in locus Loc-PG1-0103 (Plate 13). They corresponded to a
variable number of six to nine trinucleotide repeats (ATT) coding for asparagine (N)
within a gene coding for a putative lipoprotein from position 122-439. The 13 strains
bore 4 different alleles. There was geographic segregation of the various alleles (Fig.
9). Even though all the alleles were found circulating in the central part of the country
with the three states of Plateau, Kaduna, and Bauchi, it was interesting to note that no
single state bore all the four alleles determined in this locus. Kebbi State had a single
strain with 9 repeats which corresponds to allele 5 (Yaya et al., 2008). Kano State also
had a single allele (2) which had six repeats. Bauchi State had two alleles (6 and 7)
which had 2 and 3 repeats respectively. Kaduna and Plateau States each have three
99
different alleles (3, 4 and 5) and (2, 3 and 4) respectively which corresponds to (7, 8 and
9) and (6, 7 and 8) repeats also respectively.
100
538 bp
1321 bp
PLATE 10: Analysis of PCR products on 1 % agarose gel electrophoresis prior to sequencing
. A 538 bp amplicon is produced for loc-PG-0001 and 1321 bp amplicon for loc-PG-0103
representing the nucleotide sequence NC_005364 of reference strain PG1
PLATE 11: Alignment of sequences on locus Loc
Strains 59, 51 and 58 had a point
genome). The numbers following Loc
PG1-0001-60 is the sequence obtained on locus Loc
last five lines contain data from the sequ
101
: Alignment of sequences on locus Loc-PG1-0001 Strains 59, 51 and 58 had a point mutation (A instead of G at position 1523 of PG1
genome). The numbers following Loc-PG1-0001 refer to the strain number (e.g.: Loc
60 is the sequence obtained on locus Loc-PG1-0001 for strain n° 60). The
last five lines contain data from the sequence type defined for each allele (al1 to al5).
mutation (A instead of G at position 1523 of PG1
0001 refer to the strain number (e.g.: Loc-
0001 for strain n° 60). The
ence type defined for each allele (al1 to al5).
PLATE 12: Alignment of sequences on locus Loc
A point mutation is observed at position 1635 where A is found instead of G for two
strains (n° 054 and 048).
102
: Alignment of sequences on locus Loc-PG1-0001 A point mutation is observed at position 1635 where A is found instead of G for two
A point mutation is observed at position 1635 where A is found instead of G for two
103
Figure 8: Distribution of alleles of Loc-PG1-0001 in Northern Nigeria
1
4
7
104
PLATE 13: alignment of the sequences on locus PG1-0103.There is 4 alleles on this locus
The number of repeats varied from 6 (strains 58, 45, 50, 60), 7(strains 059, 056,
053), 8 (strains 052, 057,
061) to 9 (strains 48, 54, 51)
105
.
Figure 9: Distribution of strains based on the number of repeats for Loc-PG1-0103 in Northern
Nigeria
6
7
8
9
106
5.2.3.2 Combined MLSA and MLVNTR
Each of the 13 strains were characterised by an allelic profile and at the end, 7 different
allelic profiles were identified for the combined MLSA and MLVNTR techniques
(Table 5). The genetic events underlying the description of the various alleles for
MLSA are described in Table 6. Analysis allowed the identification of 7 main groups of
strains, ranging from one to three members per group. Six strains were included the
highest two groups, followed by two strains each in the next two groups and finally
three groups each containing a strain. The geographic positioning of the various groups
and allelic profiles is shown in Figures 10 and 11. The largest number of allelic profiles
per strain recorded in this work is 2 and this is found in all the groups except groups B
which has three members with one allelic profile each.
Also in this study, the allelic profiles of the vaccine strains determined by Yaya et
al.,(2008) was compared with that of the isolates from Northern Nigeria. Even though
five different vaccine strains were compared, only two of the vaccines have been widely
used in Africa and only one (T1SR, a T1-44 variant) is currently being used in Nigeria.
Polymorphisms were established between these vaccine strains and the field isolates
(See table 6).
107
Table 5: Overall distribution of alleles for combined MLVN TR, MLSA on loc-PG- 0001 and 0103
in Northern Nigeria.MmmSC strains.
The Profiles recorded will be entered into on-line Data Bank for future reference of all
Strains
Town
TR34:
number of
repeats
Loc-PG1-
0001
PG1-0103:
number of
(ATT)
repeats
Loc-PG1-
0103 -
Alleles Profiles
06045-C1 Vom 12 4 6 2 A
6050-C5 Bauchi 12 4 6 2 A
6060-C1 Kano 12 4 6 2 A
6052-C1 Kanam 8 4 8 4 B
6057-C2 Fadan Kaje 8 4 8 4 B
6061-C1 Jos 8 4 8 4 B
6058-C1 Vom 14 1 6 2 C
6059-C1 Kafanchan 4 1 7 3 D
6051-C1-LC1 Bauchi 9 1 9 5 E
6054C1 Sanga 12 7 9 5 F
6048-C1 Birnin Kebbi 12 7 9 5 F
6056-C1 Vom/Jos 8 4 7 3 G
6053-C1 B/Ladi 8 4 7 3 G
Global results
5 alleles 3 alleles
4 types 4 alleles
7
profiles
108
PLATE 14 : Geographical distribution of alleles for the combined MLVN
TR, MLSA on loc-PG- 0001 and 0103in Northern Nigeria
Figure 10: Overall distribution of alleles for combined MLVN TR, MLSA on loc-PG- 0001 and
0103 in Northern Nigeria.
A
B
C
D
E
F
G
109
Figure 11: Overall distribution of alleles for combined MLVN TR, MLSA on loc-PG-0001, and
0103 in Northern Nigeria
0
5
10
15
20
25
30
Po
lym
orp
his
m s
en
sit
ivit
y
Strains
PG1-0103: number of (ATT) repeats
Loc-PG1-0001
TR34: number of repeats
110
Table 6: Polymorphisms between the allelic profiles of Vaccine strains and isolates from Northern
Nigeria. Nucleotides identical to the consensus sequence are left blank. Deletions are indicated by] [. The bottom line represents the consensus sequence from the reference strain PG 1.
Polymorphisms of allelic profiles for vaccine strains were obtained from data by Yaya et al., 2008.
Loc-PG1-
Profiles Type strains Loc-PG1-0001 0103
1500 1518 1523 1524 1527 1528 1529 1530 1531 1635 122439
B05 V5 6ATT B06 Asmara 6ATT B07 T1SR 8ATT E E01 DK32 T G G01 Lederle T T ][ ][ ][ ][ ][ 4ATT I I01 KH3J 5ATT Vom 06045-C1 6ATT
Bauchi 6050-C5 6ATT
Kano 6060-C1 6ATT
Vom 6058-C1 A 6ATT
Kafanchan 6059-C1 A 7ATT
Vom/Jos 6056-C1 7ATT
B/Ladi 6053-C1 7ATT
Kanam 6052-C1 8ATT
Fadan Kaje 6057-C2 8ATT
Jos 6061-C1 8ATT
Bauchi 6051-C1-LC1 A 9ATT
Sanga 6054C1 A 9ATT
Birnin Kebbi 6048-C1 A 9ATT
PG1 Consensus C A G A T A G T A G 5ATT
111
CCHHAAPPTTEERR SSIIXX
GGEENNEERRAALL DDIISSCCUUSSSSIIOONNSS
6.1 Competitive Enzyme Linked Immuno-sorbent Assay for the estimation of
CBPP prevalence
The detection of outbreaks is a prerequisite for the success of CBPP control policies (Le
Goff and Thiaucourt, 1998). For effective control/or eradication of CBPP, its diagnosis
in live animals and identification of causal agent in tissues are necessary (Aliyu et al.,
2003). The establishment of the true prevalence rates of CBPP in infected countries is a
crucial prerequisite to mounting a successful disease control programme, and a
precursor to national efforts. CBPP is difficult to diagnose because many affected cattle
present no clinical signs as well as the inability of routinely available serological tests to
detect specific antibodies in most of the affected animals (Aliyu et al., 2003; Nicholas
and Bashirrudin, 1995; Regella et al., 1996). The virulence and immunological
mechanisms involved during M. mycoides mycoides SC infection, or following
vaccination against CBPP, are not fully elucidated. Consequently, there is no in vitro
test at present which can be used to assess accurately the immune status of bovines with
respect to CBPP (Tulsane et al., 1996). The inability of serological tests to discriminate
between natural and vaccinal exposures in animals has led to a greater reliance on Post
Mortem examination of lung lesions for monitoring and surveillance of CBPP (Aliyu et
al., 2000). However, in a comparison of c-ELISA with Complement Fixation Test
(CFT) on animals infected more than three months previously, c-ELISA able to detect
more positive cases than CFT (Le Goff and Thiaucourt, 1998) as such this test was
considered a more promising tool for the detection of CBPP. In this study, c-ELISA was
used to estimate the prevalence of CBPP in Twelve states of Northern Nigeria.
Commercial kits for ELISA have been described for the serological detection of CBPP
112
and are used today in favour of CFT because of its sensitivity and ease for large scale
testing (Nicholas, 2004). Ten out of the twelve States screened in this study, tested
positive for CBPP by c-ELISA which strongly suggests that the disease has attained
endemic proportions. This is quite contrary to the number of outbreaks reflected by
official figures for yearly outbreaks of CBPP in the country. An overall estimated
prevalence of 10.8% out of 2026 samples is quite alarming. Even though some States
like Gombe and Taraba recorded very high prevalence (50% and 40%) due to the very
low number of samples 18 and 15 respectively, States like Bauchi (154), Plateau (591)
and Jigawa (135) States with high number of samples also recorded fairly high
prevalence of infection (32.5%), (13.5%) and (13.3%) respectively. It must however be
Stated that only apparently unhealthy animals were targeted for sampling in this study,
and even then it should be noted that results obtained by c-ELISA should be interpreted
on a herd basis and not on the accuracy of individual samples. This is because c-ELISA
may not account for those animals in the incubation stage of the disease and results of
animals vaccinated less than three months prior to test may give a false outcome. In this
case however adequate vaccination history was collected and only herds not vaccinated
within three months prior to the test were considered. The two States which recorded
negative for CBPP could probably be due to the reasons given above or the fact that the
sample number for those areas was too small. In any case the positive results recorded
established the presence of CBPP in line with the objective for this work. This work
should also serve as a baseline for CBPP documentation and motivation for the
authorities to take the issue of disease outbreak documentation more seriously because
it is only by doing this that awareness about the impact of the disease in the country will
be created and international support for efforts at control will be enhanced.
113
6.2 Isolation and Identification of Mycoplasma mycoides mycoides Small Colony
from Northern Nigeria.
Thirteen (13) isolates out of the 18 recovered from this study were confirmed to be
MmmSC by conventional PCR. However phenotypic identification proved difficult as it
was almost impossible to differentiate some non MmmSC colonies from those of
MmmSC. The isolation of two different sub-species from an apparently pure
Mycoplasma culture only worsened the situation. Results from this study shows that
phenotypic method of identification for Mycoplasma should be applied only as a
preliminary step in the identification of MmmSC isolates.
The thirteen (13) isolates were also confirmed by Real Time or QPCR. Specific
identification of microorganisms by QPCR has been described for several organisms
(Lorenzon et al., 2002). However a Specific Real-Time PCR assays for the detection
and quantification of Mycoplasma mycoides subsp. mycoides SC and Mycoplasma
capricolum subsp. capripneumoniae has just be developed and accepted for publication
(Lorenzon et al., 2008). The confirmation of the 13 isolates was based on this protocol
and this is the first application of this technique for the diagnostic identification of
MmmSC isolates in Nigeria. The technique is superior to the conventional PCR because
it is more sensitive and avoids the processing of PCR products at the end of the reaction,
which is a major source of contamination and hazards for laboratories. The assay is easy
to perform, fast and robust. The equipment though expensive is affordable to most
laboratories in Nigeria.
114
6.3 Multi-Locus Variable Analysis (MLVA) of Variable Number Tandem Repeats
(VNTR) 34 and Multilocus Sequence Analysis MLSA
The causative organism of CBPP was isolated for the first time over a hundred years
ago by Nocard et al., (1898). It took another 58 years before the organism was
identified as a Mycoplasma by Edward and Freundt (1956), by which time it had
undergone nine name changes. Then 28 years ago (Nicholas and Bashiruddin, 1995),
two morphological variants of Mycoplasma mycoides mycoides were recognized.
Today, it does not only seem likely, but that further changes in nomenclature are
imminent because of new-found genetic relationships within the Small Colony variants.
The high degree of serological and DNA-relatedness between cluster members has
hitherto contributed to the difficulty of specific identification, although the recent
availability of molecular tests has helped considerably in this respect. The development
of new molecular and genetic tools has made it possible to show that there are genetic
differences between strains of MmmSC from Northern Nigeria. The ability to establish
these differences and to trace Mycoplasma mycoides subsp. mycoides SC
epidemiologically remains of great importance because of the importance of CBPP
(Litamoi et al., 2004). Not only can isolates be reliably identified today, but the
development of new techniques has aided considerably in the specific identification of
particular biotypes within a single species (March et al., 2000). The molecular
epidemiology of Mycoplasma mycoides mycoides Small Colony has advanced rapidly in
recent years, allowing an accurate characterization of strains at a molecular level,
involving both nucleic acid and protein-based approaches. In the present study, a high
level of discrimination was achieved when 13 MmmSC isolates from Northern Nigeria
were characterized into 5 alleles by the analysis of the VNTR 34 locus. MLVA was able
to discern genetic similarities and differences among these isolates. Typing by MLVA
115
can be achieved with basic equipment. The data obtained can easily be compared to
published genotypes, either at a local level or by querying data via a website created for
that purpose, http://bacterial-genotyping.igmors.u-psud.fr/. The potential Internet-based
querying tools will help make MLVA, like MLST, a good candidate for a robust and
geographically widespread control program.
Characterization of the isolates by the MLSA technique on locus Loc-PG1-0001
identified three alleles while that on locus Loc-PG1-0103 identified 4 alleles.
Combinations of MLVNTR and MLSA techniques was able to differentiate the isolates
from Northern Nigeria into 7 different profiles and amongst these were very unique
strains found only in specific locations. Presently four of the seven strains can be found
in one State each which makes it easy to relate the source of infection in case of an
outbreak involving these species. A comparison of the various molecular techniques
carried out indicated a positive correlation between them with the MLSA on Loc-PG1-
0103 being more segregative than the other two (Table 5). There was a positive
correlation between PG1-0103 and PG1-0001 using regression analysis at P<0.05.
However there was no significant correlation between Loc- PG1-0103 and TR 34.
MLSA on PG1-0103 therefore was determined to be more sensitive, followed by PG1-
0001 and then TR 34 was the least sensitive at 95% CI.
6.4 Multi-locus Sequence Analysis (MLSA) on Loc-PG1-0001 and Loc-PG1-0103
Multi-locus Sequence Analysis, a molecular approach for characterizing bacterial
species based on the principles of Multi-Locus Sequence Typing (MLST) was used in
characterizing the Isolates from Northern Nigeria. The MmmSC isolates were
characterized by MLSA based on whole genome sequence comparisons with the PG1
116
genome. Analysis of PG1 sequences indicated that primers designed on a previous
MLSA scheme (Lorenzon et al., 2003) hybridised at multiple sites or targeted
sequences that were duplicated in the PG1 genome. However the new MLSA scheme
designed by Yaya et al., (2008) seemed more robust than previous schemes and was
used for this work. In this study, three and four allelic profiles were determined for Loc-
PG1-0001 and Loc-PG1-0103 respectively for the thirteen isolates from Northern
Nigeria. Some strains share the same allelic profiles while others have profiles that were
unique. Similarly, some States have similar strains while others either have different
strains in addition or have entirely unique strains in their domain. The geographic
location of strains sharing the same allelic profile agreed with known epidemiological
data (Yaya et al., 2008). The presence of same allelic profiles in different strains from
different States of the country can be explained by a ‘clonal expansion’ of the initial
strain of the organism. Putting these two tests together, it is interesting to note the
cocktail of Mycoplasma mycoides mycoides Small Colony strains in the Northern part
of the country, which is in agreement with the transhumance and trade routes followed
by cattle herds that are raised in the north and sent to the meat markets in large cities in
the South, contrary to expectations that only a single strain is likely to be identified
since all the isolates were clustered mostly around the central part of the country.
The two major routes for cattle trade in Nigeria between the North and South are the
Lokoja and the Makurdi roads. These roads at one point go through Kaduna and Plateau
States respectively. With the Eastern axis of the road coming from Borno and the
surrounding States passing through Plateau to the South and equally, the Western axis
coming from Sokoto and the surrounding States passing through Kaduna State to the
South. Even though each road is located at least two hundred kilometres from the other,
117
these two states (Kaduna and Plateau) act as a funnel draining the livestock from the
North to the South. It is not surprising then to find these states with almost all the strains
determined for Northern Nigeria in this study.
However for these results to be meaningful, the study has to be extended to other parts
of the country so that data on the geographical distribution of all the strains would be
obtained. This would be useful in tracing future outbreaks of CBPP infection or
designing control strategies for such outbreaks. For example, an outbreak involving
profiles C, D and E would be traced easily since these strains are unique. The
information will also be useful in the selection of an appropriate candidate for future
vaccine development. Even though the results from this work may not be conclusive in
itself, it has laid the framework for relating the sources of particular outbreaks of CBPP
in Northern Nigeria.
Finally, the determination of a new allele which was not described in the previous work
of Yaya et al., (2008) is significant in this study. It would be necessary to extend this
study to other parts of the country in order to determine if there are other alleles of this
organism in other parts or if strains of this particular allele are distributed in other parts
of the country. It is necessary also to determine through gene expression models, the
possible roles of these polymorphisms in the pathogenicity or immunogenicity of these
strains.
118
6.5 MLSA allelic profile comparison of Vaccine strains and isolates from
Northern Nigeria.
Contagious Bovine Pleuropneumonia (CBPP) vaccines have often been the subject of
debate, possibly more so than any other bacterial vaccine. Observations from the field
(Masiga et al., 1999) and experimental studies (Thiaucourt et al., 2000a, Yaya et al.,
1999) have indicated that the current vaccines do not effectively protect cattle from
outbreaks of disease (March et al., 2002). These debates became more pronounced
when the T1SR strain of vaccine did not seem to induce sufficient protection after the
reintroduction of CBPP into Botswana (Amanfu et al., 1998) and East Africa (Masiga et
al., 1996). Presently, CBPP vaccines are used only in Africa and parts of Asia (Egwu et
al., 1996). These vaccines are live preparations produced from one of two strains, KH3J
or T144, each of which has a streptomycin resistant variant and are used in a lyophilized
form. The OIE recommended vaccine is the naturally mild T1-44 strain which has
been passaged in eggs 44 times and was isolated in Tanzania some 40 years ago (Egwu
et al., 1996). The KH3J strain which has been widely used in Western and Central
Africa (Rweyemamu et al., 1995) was isolated from the Juba region of Sudan and
passaged 88 times in embryonated eggs from which broth culture vaccines have been
prepared. The T1-44 freeze-dried vaccine is currently being used in Nigeria for CBPP
control but despite vaccination campaigns the disease continues to occur with increased
frequency (Aliyu et al., 2000).
In this study, the allelic profiles of the vaccine strains determined by Yaya et al.,(2008)
was compared with that of the isolates from Northern Nigeria. Even though five
different vaccine strains were compared, only two of the vaccines have been widely
used in Africa and only one (T1SR, a T1-44 variant) is currently being used in Nigeria.
Polymorphisms were established between these vaccines and the field isolates. The
119
genetic events underlying these polymorphisms are given in Table 6. Except for strain
058 (Vom), 059 (Kafanchan) and 051 (Bauchi) had an A instead of a G at the 1523
position of the consensus sequence while 054 (Sanga) and 048 (Birnin Kebbi) also had
an A instead of a G at position 1635. All other strains from Northern Nigeria were
identical to the vaccine strains at Loc-PG1-0001. However, greatest variability was seen
at Loc-PG1-0103 where only 052 (Kanam), 057 (Fadan Kaje) and 061 (Jos) showed
identical polymorphisms (8 repeats) with the T1SR vaccine. All other vaccine strains
had different numbers of ATT repeats (V5 and Asmara- 5 repeats and T1SR- 8 repeats).
The implications of these variations with respect to pathogenicity and immunogenicity
of the strains cannot be immediately ascertained. The fact that these isolates in some
respect appear to be different from the vaccine strains is a case for concern. This result
though, is not particularly surprising since recent finding from studies comparing T1-44
and KH3J indicated variations in immunogenicity and also experimental infections in
the past have shown virulence differences amongst African strains (Provost et al.,
1987). But what is not clear is whether these genetic differences are in themselves
responsible for serological variations witnessed in the immune responses to these
vaccines and also whether these classical vaccines can indeed protect against all these
different strains. Further work is required to determine the implications of these
variations with respect to immunogenicity and vaccine capability. It is worth
emphasizing that ‘Efficient control of CBPP in Africa, and indeed Nigeria, will require
both efficient vaccines as well as efficient diagnostic strategies’.
120
6.6 Isolation of Mycoplasma mycoides mycoides Small Colony from sheep
In this study, MmmSC was isolated in pure cultures from pleural fluid in a two week old
lamb which died of respiratory distress (045) and from two other ovine samples (058
and 061). Several reports of MmmSC isolation from small ruminants have been made
worldwide (Hudson et al., 1967; Brandao, 1995; Thiaucourt; 2000, Dujardin-Beaumetz,
1906; Yaya et al., 2000). Even though these reports tend to suggest that the role of these
ruminants in the transmission of the disease is insignificant (Mullins et al., 2000), some
authors believed that these reports should be investigated further (Egwu et al., 1996). In
Nigeria, Okoh and Ocholi isolated Mycoplasma mycoides mycoides Small Colony from
an outbreak of disease is sheep (Egwu et al., 1996). Though it was not clear from that
report whether the SC variant was confirmed or whether the isolates were pathogenic in
cattle. In the present study, some MmmSC isolates recovered from sheep were
characterized and compared with those isolated from cattle. Among these isolates was
one isolated from a two week old lamb which came to the Veterinary Clinic with a
history of respiratory distress. The farmer noticed the condition about a week after birth
and by the second week the situation had worsened with profuse mucus secretions from
the nostrils and mouth followed by difficulty in standing. The dam did not however
show any respiratory symptoms. The lamb died two weeks after birth and apart from
bilateral congestion of the lungs, there were no other visible lesions at post mortem.
MmmSC was isolated in pure culture from the pleural fluid. The isolate was confirmed
by both conventional and Real Time PCRs. Molecular characterization studies indicated
that this isolate is the same as other MmmSC isolates recovered from outbreaks of
Contagious Bovine Pleuropneumonia in cattle. Likewise results of sequence analysis for
the other strains isolated from sheep in this study indicated that only one of the strains
has a unique allelic profile (058 profile C) from those isolated from bovine (045 profile
121
A, and 061 profile B). This is particularly disturbing because it suggests that there is no
difference between isolates from sheep and those from bovine, indicating that the sheep
is a potential source of infection for bovine. This finding is significant as it implicates
sheep in the epidemiology of the disease. However, pathogenicity studies have not been
carried out in cattle to determine if the isolates are indeed pathogenic for cattle. There is
thus a need to carry out experimental infection of sheep using same isolates to
determine the risk factors associated with the transmission of infection to bovine and to
re-appraise the role of sheep in the transmission of this infection. The fact that small
ruminant species may serve as a reservoir, should be an incentive to widen the scope of
Mycoplasma isolation and identification from this host, which is known to harbour
Mycoplasma in the ear canal in the absence of pathological signs.
6.7 Mycoplasma mycoides mycoides Small Colony Isolate and serum bank
The isolates from this study are presently the only MmmSC isolates in Nigeria to be
identified and characterized to molecular level. These isolates presently form the
largest reserve of MmmSC isolates for any single country in the World Reference
Laboratory for CBPP in CIRAD, Montpellier, France and will also form the very first
batch of characterized MmmSC isolates at the Isolate bank of the Regional Reference
Laboratory for CBPP, National Veterinary Research Institute, Vom. Plateau State,
Nigeria. The sera screened in this study will also be grouped according to status and
kept in the Serum bank also of the Regional Laboratory. These would make these
isolates and sera available for future pathogenicity or immunological studies involving
this organism.
122
Finally, results from the current study would be included in a web tool dedicated to
molecular epidemiology within an EU-funded project called EPIZONE. This tool
should facilitate the dissemination of typing methods for pathogens, allow any
laboratory to compare in-house data with large databank sets and, in turn, generate
phylogenetic trees or actualized maps, provided that the geographic coordinates of all
isolates are known. Such a tool would naturally be linked to the websites of the OIE
(http://www.oie.int/wahid-prod/) and FAO.
123
CCOONNCCLLUUSSIIOONNSS
1. The presence of CBPP in Nigeria was further ascertained in this study by both
Serological and Molecular approaches.
2. A high level of discrimination was achieved using the MLVA on MmmSC
isolates. The 13 MmmSC isolates were characterized into 5 alleles using this
analysis. The Potential clinical applications of MLVNTR typing include
epidemiological investigations, identification of outbreak-associated strains and
recognition of laboratory cross-contamination. Even though the clinical
significance of M. mycoides mycoides Small Colony identified by MLVNTR
typing in this study is not yet known. VNTR typing by PCR has several
advantages. It is a rapid and reproducible method. It can be performed on
Mycoplasma killed by heat or alcohol, reducing biohazards. Results are usually
in electronic form thereby simplifying the comparison of large numbers of
strains.
3. The combination of MLVNTR and MLSA brought more precision to the
definition of the isolates in this study, with the other two loci, Loc-PG1-0001
and Loc-PG1-0103 having 3 and 4 alleles each respectively. Eventually, seven
profiles were defined for the thirteen isolates giving more precision in the
definition of the origin of the strains. This is at great variance with MmmSC
strains from southern Africa where all have the same profile, i.e. only one strain
(Yaya et al., 2008). But this is not surprising since unlike Nigeria, the region is
protected from other infected countries by a cordon of countries free of CBPP.
4. The number of strains recorded in this study (seven) in Northern Nigeria is so
far the largest for any single country in the world and the study also identified a
new allele which was not previously described.
124
5. The molecular tools used in this work if extended to other parts of Nigeria will
lead to faster and easier identification and characterization of Mycoplasma
mycoides mycoides Small and the epidemiological knowledge collected will help
to elucidate the prevalence and geographical spreading of this organism over
time or the extent and mode of its transmission during outbreaks.
6. The isolation of MmmSC in pure culture from a two week old lamb and other
adult ovine species is of major significance as it implicates ovine in the
epidemiology of CBPP in Nigeria. This agrees with the views of several authors
like Egwu et al., 1996 who suggested that small ruminants may be implicated in
the epidemiology of Contagious Bovine Pleuropneumonia.
7. As a result of this study, Nigeria now has the largest reserve of MmmSC isolates
(13) in the World Reference Laboratory for CBPP in CIRAD, France.
8. The extension of this study to other parts of the country and the determination of
the geographical distribution of the various profiles on the map will make it
possible to relate the origin of any CBPP outbreak within the country. It is even
possible to trace the source of infection especially for the unique profiles like C,
D, and E. This may be particularly useful for the country especially in
eradication programs requiring tools to trace the origin of remaining or re-
emerging CBPP foci and in control strategies especially the stamping out policy
where the source of infection is of prime importance.
9. The results obtained in this study, is the first its kind on livestock diseases in the
country to be included in a web tool dedicated to molecular epidemiology within
an EU-funded project called EPIZONE. This tool will facilitate the
dissemination of typing methods for pathogens, allowing laboratories to
compare in-house data with large databank sets and, in turn, generate
125
phylogenetic trees or actualized maps, provided that just as in this study, the
geographic coordinates of all isolates are known. Such a tool would naturally be
linked to the websites of the OIE (http://www.oie.int/wahid-prod/) and FAO
(http://www.fao.org/ag/againfo/programmes/en/empres/disease_cbpp.asp),
which provide updated information on new outbreaks for notifiable diseases.
10. Finally, over 100 years since the cause of CBPP was discovered, it is still not
possible to say with certainty how the M. mycoides mycoides Small Colony
causes disease. The use of serological tests with greater sensitivity may succeed
in identifying infected animals that are negative by c-ELISA and reduce the
burden of applying serological and abattoir survey in the determination of the
actual prevalence of CBPP. The use of Molecular tools in diagnosis is beginning
to elucidate the anatomy and behaviour of the CBPP agent even though very
little is known about the factors that play key role in the pathogenicity of the
organism and the implications of the genetic events underlying the
polymorphisms in the those strains. It is hoped that a better understanding of the
expression systems associated with these polymorphisms will enable the
formulation and production of improved vaccines to replace the semi-virulent
strains in use today. To re-echo the words of Egwu et al., 1996, ‘the persistence
of this disease in Nigeria is of great economic importance and the reports of
sporadic outbreaks in some areas in this country despite the various control
programmes in use emphasize the need…not only for control measures’ but also
for intensified commitment by all stake holders and research towards control.
126
MMAAJJOORR CCOONNSSTTRRAAIINNTTSS OOFF TTHHEE SSTTUUDDYY
a) Lack of Facilities and Reagents: Reagents and equipment were a major
requirement for this work. ELISA kits are very difficult to acquire. Presently, the
only vendor for this item is CIRAD, Montpellier, with difficulties in
administrative procedures, payments and shipment due to language barriers. As
a result of high cost of equipments, facilities like the Real Time PCR machines
are currently unavailable in the country.
b) Lack of capacity and skills in molecular biology: The various techniques applied
in this study requires capacity and skills in molecular biology especially
genomics and bioinformatics. The training I acquired from CIRAD on MLSA
was a major boost to this study.
c) Lack of reliable information from the field: Accurate information in the field
during investigation was a major problem. Most farmers would prefer to hide
outbreaks and treat their animals with antibiotics because of the lack of
compensation in the case of condemnation. Sometimes, information on the use
of vaccine before outbreak, antibiotics, and the exact period or duration of the
outbreak are very unreliable.
d) Insufficient finance: Lack of funds limited the scope of this work to Northern
Nigeria and to suspected outbreaks only. It would be interesting to find out the
situation of CBPP in apparently healthy animals, abattoir slaughter and animals
in other parts of the country.
127
RREECCOOMMMMEENNDDAATTIIOONNSS
I. There is a need to extend this study to other parts of the country to determine the
disease status in other areas and to compare isolates from such areas. The
average OD/PI of the different areas using c-ELISA may possibly give an idea
of the disease trend in such areas. Such extensions could also include abattoir
surveillance and the surveillance of apparently healthy animals. Serological
tools though not very reliable may serve as guides to instituting or supporting
control strategies.
II. This study has also indicated that the vaccines currently used for the control of
CBPP in Nigeria may not be genetically identical to the field isolates. The
significance of this finding should be investigated. In the future, the molecular
techniques used in this study may be applied to identify particular alleles with
potential to serve as possible candidates in the production of molecular vaccines
against CBPP. Though it must be pointed out that the various alleles defined in
this study are ‘strictly molecular epidemiological markers since no correlation
was established between the variations in sequences and pathogenicity.
III. The molecular tools used in this work if extended to other parts of Nigeria will
lead to faster and easier identification and characterization of Mycoplasma
mycoides mycoides Small Colony within the country and will help to determine
the geographical spread of this organism and possibly mode of CBPP
transmission during outbreaks.
IV. The isolation of MmmSC in pure culture from a two week old lamb and other
adult ovine species is of major significance as it implicates ovine in the
epidemiology of CBPP in Nigeria. Further work should be carried out to
determine the specific role played by these animals in the epidemiology of the
128
disease in Nigeria. Pathogenicity studies should be carried out in both Cattle
and Sheep to determine the virulence of this particular isolate to these species.
V. The combination of MLVNTR and MLSA increased the sensitivity of
characterization of the isolates in this study. Other loci, especially none coding
genes could be included in the MLSA. Likewise other Tandem Repeats in the
Small Colony genome should be investigated for polymorphisms.
VI. Finally, despite the use of vaccines and eradication campaigns in Nigeria, the
rate of CBPP is on the rise. It is obvious that the current vaccines are not the
magic bullet we anticipated. There is thus a need for the Government, to put
channel more efforts and resources, especially finance towards capacity building
in CBPP research and the development of next generation CBPP vaccines.
129
REFERENCES
Abdo, E.M., Nicolet, J., Miserez, R., Gonçalves, R., Regalla, J.,Griot, C., Bensaide, A.,
Krampe, M., and Frey, J., (1998). Humoral and bronchial immune responses in cattle experimentally infected with Mycoplasma mycoides subsp. mycoides
Small Colony type. Vet. Microbiol. 59, 109–122.
Abu-groun, E.A.M., Taylor, R.R., Varsani, H., Wadher, B.J., Leach, R.H., Miles, R.J., (1994). Biochemical diversity within the Mycoplasma mycoides cluster. Microbiology 140, 2033-2042.
Adler, H. E. (1964). A Comparison of Some Characteristics of Mycoplasma Var.
Mycoides and Mycoplasma gallisepticum. Am J. Vet. Res. 25, P. 243-5.
Adler, H.E., and Etheridge, J.R., (1964). Contagious Bovine Pleuropneumonia: a comparison of two slide agglutination blood tests with the complement fixation test. Aust. Vet. J. 40, 38–43.
Al- Aubaidi J. M. and Fabricant, J. (1971). Characterisation and classification of bovine
mycoplasma. Cornell Vet., 61, 490-518.
Aliyu, M. M, Obi, T. U, Oladosu, L. A., Egwu, G. O., and Ameh J.A. (2003). The use of competitive ELISA in combination with abattoir survey for CBPP surveillance in Nigeria. Trop. Vet. Med.; 21:35-40.
Aliyu, M. M., Obib, T.U. and Egwu, G.O. (2000). Prevalence of Contagious Bovine Pleuropneumonia (CBPP) in Northern Nigeria. Preventive Veterinary Medicine 47 263-269.
Amanfu, W., Masupu, K.V., Adom, K.V., Raborokwe, M.V., and Bashiruddin, J., (1998). An outbreak of Contagious Bovine Pleuropneumonia in Ngamiland district of north-west Botswana. Vet. Rec. 143, 46–48.
Ameh, J.A., Nawathe, D.R., and Fam, I.M., (1998). Retrospective, microbiological and serological studies of Contagious Bovine Pleuropneumonia (CBPP) in Nigeria. Trop. Vet. 16, 69-71.
Andersen, G. L., Simchock, J. M. and Wilson, K. H. (1996). Identification of a region of genetic variability among Bacillus anthracis strains and related species. J
Bacteriol 178, 377-384.
Anon., (2000). Programme for the control of Contagious Bovine Pleuropneumonia (CBPP) in the Sale and Loliondo divisions. Ngorongoro District Council, Arusha, Tanzania, 6 pp. Veterinary Microbiology 63 13-28.
Asai, T., Okada M., Ono, M., Irisawa, T., Mori, Y., Yokomizo, Y., and Sato, S. (1993). Increased levels of tumor necrosis factor and interleukin-1 in bronchoalveolar lavage fluids from pigs infected with Mycoplasma hyopneumoniae. Vet.
Immunol. Immunopathol. 38:253-260.
130
Baker, J.C., (1998). Respiratory diseases of cattle. In: Aiello, S.E. (Ed.), The Merck Veterinary Manual, 8th ed. Merck & Co., Inc., Whitehouse Station, NJ, pp. 1078–1079.
Bashiruddin, J. B., Nicholas, R. A. J., Santini, F. G., Woodward, M. J. and Taylor, T. K. (1994). Use of the polymerase chain reaction to detect mycoplasma DNA in cattle with contagious bovine pleuropneumonia. Vet Rec. 134. 10, p. 240-1.
Bashiruddin, J. B., De Santis, P., Vacciana, A. and Santini, F. G. (1998). Detection of Mycoplasma mycoides subspecies mycoides SC in clinical material by a rapid colorimetric PCR Molecular Biology, Istituto Zooprofilattico Sperimentale
dell’Abruzzo e del Molise “G. Caporale”, Via Campo Boario, 64100 Teramo, Italy (Received 8 June 1998, Accepted 2 September 1998)
Bashiruddin, J.B. (1998). PCR and RFLP methods for the specific detection and identification of Mycoplasma mycoides subsp. mycoides SC. In: Miles, R.J., Nicholas, R.A.J. (Eds.), Mycoplasma Protocols. Methods in Molecular
Biology, vol. 104. Humana Press Inc., Totowa, NJ, pp. 165–178.
Bashiruddin, J.B.; Taylor, T. K., and Gould, A. R. (1994). A PCR based test for the specific identification of Mycoplasma mycoides subspecies mycoides SC. J. Vet Diagn. Investig. 6: 428-434.
Bell, P., Poumarat, F., Perrin, M., Longchambon, D., and Martel, J.L., (1990). Experimental reproduction of contagious bovine pleuropneumonia in a herd of cattle and goats: clinical and pathological aspects. In: Regalla, J. (Ed.), Contagious Bovine Pleuropneumonia. A Seminar in the Community Programme for the Coordination of Agricultural Research, held in Lisbon on 7 and 8 December 1988. Commission of European Communities, Luxembourg, pp. 7–16.
Bergemann, A.D., Whitley, C., and Finch, L.R., (1990). Taxonomic signficance of differences in DNA methylation within the M. mycoides cluster detected with restriction endonucleases MbI and DpnI. Letts. Appl. Microbiol. 11, 48-51.
Biberfeld, G. (1985). Infection sequelae and autoimmune reactions in Mycoplasma
pneumoniae infection, p. 293-311. In S. Razin, and M. F. Barile (ed.), The mycoplasmas, vol. IV. Mycoplasma pathogenicity. Academic Press, Inc., Orlando, Fla.
Blancou J. (1996). Early methods of surveillance and control for contagious bovine Pleuropneumonia. Rev. Sci. Tech. Off. Int. Epiz. 15 (4) 1263-1282.
Bolske, G. (1988). "Survey of Mycoplasma infections in cell cultures and a comparison of detection methods." Zentralbl Bakteriol Mikrobiol Hyg [A] 269(3): 331-40.
Bolske, G., Msami, H.M., Gunnarsson, A., Kapaga, A.M. and Loomu, P.M., (1995). Contagious Bovine Pleuropneumonia in Northern Tanzania, culture confirmation and serological studies. Tropical Animal Health & Production 27, 193-201.
131
Bölske, G., Msami, H.M., Gunnarsson, A., Kapaga, A.M., and Loomu, P.M., (1995). Contagious Bovine Pleuropneumonia in Northern Tanzania,culture confirmation and serological studies. Trop. Anim. Health Prod. 27, 193–201.
Bolske, G.; Mattsson, J. G.; Bascunana, C. R.; Bergstrom, K.; Wesonga, H.; Johansson, K. E. (1996). Diagnosis of contagious caprine pleuropneumonia by detection and identification of Mycoplasma capricolum subsp. capripneumoniae by PCR and restriction enzyme analysis. J. Clin. Microbiol, 34, 4 Pages: 785-91
Bork, P., Ouzounis, C., Casari, G., Schneider, R., Sander, C., Dolan, M., Gilbert, W., and Gillevet, P. M. (1995). Exploring the Mycoplasma capricolum genome: a minimal cell reveals its physiology. Mol. Microbiol. 16:955-967.
Bove, J. M. (1999). The one-hundredth anniversary of the first culture of a mollicute, the contagious bovine peripneumonia microbe, by Nocard and Roux, with the collaboration of Borrel, Salimbeni, and Dujardin-Baumetz. Res Microbiol. V. 150 4 239-45.
Brandão, E., (1995). Isolation and identification of Mycoplasma mycoides subspecies
mycoides SC strains in sheep and goats. Vet. Rec. 136, 98–99.
Brown, R.D., Gourlay, R.N., and McLeod, A.K., (1965). The production of T1 broth culture contagious bovine pleuropneumonia vaccine. Bull. Epiz. Dis. Afr. 13, 149–155.
Buttery, S. H., Lloyd, L. C., et al.,. (1976). "Acute respiratory, circulatory and pathological changes in the calf after intravenous injections of the galactan from Mycoplasma mycoides subsp. mycoides." J Med Microbiol 9(4): 379-91.
Bygrave, A.C., Moulton, J.E., and Shifrine, M., (1968). Clinical, serological and pathological findings in an outbreak of Contagious Bovine Pleuropneumonia. Bull. Epiz. Dis. Afr. 16 (1), 21–46.
Campbell, A. D. and Turner, A. W., (1953). Studies of Contagious Bovine Pleuropneumonia of cattle. IV. An improved complement fixation test. Australian Veterinary Journal, 29, 154.
Cassell, G. H., Clyde, W. A. J., and Davis, J. K. (1985). Mycoplasmal respiratory infections, p. 69-106. In S. Razin, and M. F. Barile (ed.), The Mycoplasmas, vol. IV. Mycoplasma pathogenicity. Academic Press, Inc., Orlando, Fla.
Cheng, X., Nicolet, J., Poumarat, F., Regalla, J., Thiaucourt, F., and Frey J., (1995). Insertion element IS1296 in Mycoplasma mycoides subsp. mycoides small colony identifies a European clonal line distinct from African and Australian strains, Microbiology. 141 (Pt 12) 3221-3228.
Citti, C., Browning, G.F., and Rosengarten, R., (2005). Phenotypic diversity and cell invasion in host subversion by pathogenic Mycoplasmas, In: Blanchard, A., Browning, G. (Eds.) Mycoplasmas, Molecular biology pathogenicity and strategies for control. Horizon bioscience, Norfolk, UK, pp. 439-483.
132
Citti, C., and Rosengarten, R., (1997). Mycoplasma genetic variation and its implication for pathogenesis. Wien. Klin. Wschr. 109, 562-568.
Cole, B. C., Naot, Y., E. Stanbridge, J., and Wise, K. S. (1985). Interactions of Mycoplasmas and their products with lymphoid cells in vitro, p. 204-257. In S. Razin, and M. F. Barile (ed.), The Mycoplasmas, vol. IV. Mycoplasma
pathogenicity. Academic Press, Inc., Orlando, Fla.
Costas, M., Leach, R.H., and Mitchelmore, D.L., (1987). Numerical analysis of PAGE protein patterns and the taxonomic relationships within the `Mycoplasma
mycoides cluster'. J. Gen. Microbiol. 133, 3319-3329.
Cottew, G. S. and Yeats, F. R. (1978). Subdivision of Mycoplasma mycoides
subspecies mycoides from cattle and goats into two types. Australian
Veterinary Journal, 54, 293-296.
Cottew, G. S. (1979). "Pathogenicity of the subspecies mycoides of Mycoplasma
mycoides for cattle, sheep and goats." Zentralbl Bakteriol [Orig A] 245(1-2): 164-70.
Cottew, G. S., and F. R. Yeats, (1982). Mycoplasmas and mites in the ears of clinically normal goats, Aust. Vet. J. Vol. 59.
Cottew, G.S., Breard, A., Damassa, A.J., Erne, H., Leach, R.H., Lefevre, P.C., Rodwell, A.W., and Smith, G.R., (1987). Taxonomy of the Mycoplasma mycoides
cluster. Isr. J. Med. Sci. 23, 632-635.
Cousin-Allery, A.; Charron, A.; de Barbeyrac, B.; Fremy, G.; Skov Jensen, J.; Renaudin, H.; and Bebear, C. (2000). Typing of Mycoplasma pneumoniae
strains by PCR-based methods and pulsed-field gel electrophoresis. Application to French and Danish isolates Epidemiol Infect : 124 : 1 Pages: 103-11.
Curasson, G., (1942). Péripneumonie bovine. In: Traité de pathologie exotique vétérinaire et comparée. 2. Vigot-Frères, Paris VI, pp. 276–353.
Dannacher, G., Perrin, M., Martel, J.L., Perreau, P., and Le Goff, C. (1986). Report on evaluation of the European comparative trial concerning complement fixation test for diagnosis of contagious bovine pleuropneumonia. Ann. Rech. Vét 17 Pages: 107-114
Dedieu, L. A., Breard, C., Le Goff and Lefevre, P. C. (1994). Development of selective polymerase chain reaction assay for the detection of Mycoplasma mycoides
subspecies mycoides SC (Contagious Bovine Pleuropneumonia agent). Vet.
Microbiol. 42: 327-229.
Dedieu, L., Breárd, A., Le Goff, C., and Lefèvre, P.-C., (1996). Diagnostic de la péripneumonie contagieuse bovine: problèmes et nouveaux developpements. Rev. Sci. Tech. Off. Int. Epiz. 15 (4), 1331–1353.
133
Dingle K.E., Colles F.M., Wareing D.R., Ure R., Fox A.J., Bolton F.E., Bootsma H.J., Willems R.J., Urwin R., and Maiden M.C., (2001). Multilocus sequence typing system for Campylobacter jejuni, J. Clin. Microbiol. 39:14–23.
Dujardin-Beaumetz, E. (1906). Transmission de la péripneumonie des bovidés aus espèces ovine et caprine. Ann. Inst. Pasteur (Paris). Vol. 20. No. 2850
Dumke, R., Catrein, I., Pirkil, E., Herrmann, R., and Jacobs, E.. (2003). Subtyping of Mycoplasma pneumoniae isolates based on extended genome sequencing and on expression profiles. Int. J. Med. Microbiol. 292:513-525.
Edward, D.G., and Freundt, E.A. (1956). The classification and nomenclature of organisms of the pleuropneumonia groupJ. Gen. Microbiol: 14, 197-207.
Edy M. Vilei., and Joachim Frey (2004). Differential clustering of Mycoplasma
mycoides subsp. mycoides SC strains by PCR–REA of the bgl locus Veterinary Microbiology 100 (2004) 283–288.
Egwu, G.O., Nicholas, R.A.J., Ameh, J.A., and Bashiruddin, J.B., (1996). Contagious bovine pleuropneumonia. An update. Vet. Bull. 66, 875-888.
Enright, M. C., Day, N. P. J., Davies, C. E., Peacock, S. J., and Spratt, B. G., (2000). Multilocus Sequence Typing for Characterization of Methicillin-Resistant and Methicillin-Susceptible Clones of Staphylococcus aureus, J. Clin. Microbiol. 38 1008–1015.
Enright, M.C., and Spratt, B.G., (1999). Multilocus sequence typing. Trends Microbiol. 7, 482–487.
Etheridge, J. R., and Buttery, S. H. (1976). Improving the specificity and yield of the contagious bovine pleuropneumonia complement fixation test antigen Res Vet
Sci 20 : 2 Pages: 201-6
Falah, M., and Gupta, R., (1997). Phylogenetic analysis of Mycoplasmas based on Hsp70 sequences: cloning of the dnaK (hsp70) gene region of Mycoplasma
capricolum. Int. J. Syst. Bacteriol. 47, 38-45.
FAO, (2000). Extract from the report of the Second Meeting of the FAO/OIE/IAEA/OAU-IBAR Consultative group on Contagious Bovine Pleuropneumonia. Rome, Italy, 24-26 October 2000.
FAO, (2001). Contagious Bovine Pleuropneumonia – To Eradicate, Control or Live with the Disease. Summary and comments and discussions from the FAO Electronic Conference on Contagious Bovine Pleuropneumonia (CBPP). June – November, 2001
FAO, (2002). Recognizing Contagious Bovine Pleuropeumonia. Food and Agrculture Organization of the United Nations, Rome, 2002.
FAO, (2004). Summary of Recommendations. Report of the 3rd Meeting of the FAO-OIE-AU/IBARIAEA Consultative Group on Contagious Bovine
134
Pleuropneumonia (CBPP), 12–14 November 2003, Rome, Italy. FAO, Rome, pp. 5–6.
FAO/OIE, (1995). Animal Health Your Book (Livestock Statistics). pp. 173-178.
Fayomi, A., and Aliyu, I.D., (1992). A retrospective study of incidence of contagious bovine pleuropneumonia in Kano and Environs. In: Proceedings of the 29th
Annual General Meeting of the Nigerian Veterinary Medical Association, 27-30 October, 1992, Kaduna, pp. 124-130.
Feil, E. J., and Enright, M. C.. (2004). Analyses of clonality and the evolution of bacterial pathogens.Curr. Opin. Microbiol. 7:308-313.
Feil, E.J., Maiden, M.C.J., Achtman, M., and Spratt, B.G., (1999). The relative contributions of recombination and mutation to the divergence of clones of Neisseria meningitidis. Mol. Biol. Evol. 16, 1496–1502.
Feil, E. J., J. M. Smith, M. C. Enright, and B. G. Spratt. (2000). Estimating recombinational parameters in Streptococcus pneumoniae from multilocus sequence typing data. Genetics 154:1439–1450.
Fitzmaurice J, Sewell M, Manso-Silvan L, Thiaucourt F, McDonald WL, and O'Keefe JS.( 2008) Real-time polymerase chain reaction assays for the detection of members of the mycoides cluster. New Zealand veterinary journal;56:40-47.
Fox, G.E., Wisotzkey, J.D., and Jurtshuk, Jr., P., (1992). How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity. Int. J.
Syst. Bacteriol. 42, 166-170.
Fraser, C. M., J. D. Gocayne, O. White, M. D. Adams, R. A. Clayton, R. D. Fleischmann, C. J. Bult, A. R. Kerlavage, G. Sutton, J. M. Kelley, J. L. Fritchman, J. F. Weidman, K. V. Small, M. Sandusky, J. Fuhrmann, D. Nguyen, T. R. Utterback, D. M. Saudek, C. A. Phillips, J. M. Merrick, J-F. Tomb, B. A. Dougherty, K. F. Bott, P.-C. Hu, T. S. Lucier, S. N. Petterson, H. O. Smith, C. A. Hutchison III, and J. C. Venter. (1995). The minimal gene complement of Mycoplasma genitalium. Science 270:397-403.
Fre! nay, H. M. E., Theelen, J. P. G., Schouls, L. M., Vandenbroucke-Grauls, C. M. J. E., Verhoef, J., van Leeuwen, W. J. and Mooi, F. R. (1994). Discrimination of epidemic and non epidemic methicillinresistant Staphylococcus aureus strains on the basis of protein A gene polymorphism. J Clin Microbiol 32, 846-847.
Freundt, E. A. (1983). Culture media for classic Mycoplasmas. In: Methods in Mycoplasmology, vol. 1. [edited by Razin, S., Tully, J. G.]. Academic Press, New York. P. 127-135.
Freundt, E. A., and D. G. Edward. (1979). Classification and taxonomy, p. 1-41. In M. F. Barile and S. Razin (ed.), The Mycoplasmas. Academic Press, Inc., New York, N.Y.
135
Frey, J., Abdo, E., Miserez, R. (1998). Humoral and bronchial immune responses in cattle experimentally infected with Mycoplasma mycoides from Mycoplasma sp. strain F38 and development of an identification system based on PCR. J.
Bacteriol. 176, 2577-2586.
Frey, J., Cheng, X., Kuhnert, P., and Nicolet, J., (1995). Identification and characterization of IS1296 in Mycoplasma mycoides subsp. mycoides SC and presence in related Mycoplasmas. Gene 160, 95–100.
Frothingham, R. (1995). Differentiation of strains in Mycobacterium tuberculosis
complex by DNA sequence polymorphisms, including rapid identi®cation of M. bovis BCG. J Clin Microbiol 33, 840-844.
Gambles, M., (1956). Studies on Contagious Bovine Pleuropneumonia with special reference to the complement fixation test. Br. Vet. J. 156: 34–40, 78–86, 120–127, 162–169.
Gasparich, G. E., Whitcomb, R. F., Dodge, D., French, F. E., Glass, J., and Williamson, D. L. (2004). Genus Spiroplasma and its non-helical descendants: phylogenetic classification, correlation with phenotype and roots of the Mycoplasma
mycoides clade : Int J Syst Evol Microbiol : Pt 3 Pages: 893-918
Gherardi G., Fallico L., Del Grosso M., Bonanni F., D'Ambrosio F., Manganelli R., Palu G., Dicuonzo G., and Pantosti A., (2006). Antibiotic-resistant invasive pneumococcal clones in Italy, J. Clin. Microbiol. JCM.01229-06.
Gonc,alves, R., Regalla, J., Nicolet, J., Bashiruddin, J., DeSantis, P., Penha and Gonc,alves, A., (1996). A 98 kDa antigenic band as a possible epidemiological marker differentiating European isolates of Mycoplasma mycoides subsp.
mycoides SC, In: Frey, J., Sarris, K., (Eds.), COST 826. Mycoplasmas of Ruminants: Pathogenicity, Diagnostics, Epidemiology and Molecular Genetics, European Commission, EUR 16934 EN, Luxembourg, pp. 49-51.
Gonc,alves, R., Regalla, J., and Penha Gonc,alves, A., (1994). Intraspecies antigenic variation in Mycoplasma mycoides subsp. mycoides SC strains from different sources detected through immunoblots with naturally infected bovine sera, XX Reuniaƒo da Sociedade Portuguesa de Imunologia, Lisboa, 64 pp.
Goncalves, R., J. Regalla, et al., (1998). "Antigen heterogeneity among Mycoplasma
mycoides subsp. mycoides SC isolates: discrimination of major surface proteins." Vet Microbiol 63(1): 13-28.
Gorton T.S., Barnett M.M., Gull T., French R.A., Lu Z., Kutish G.F., Adams L.G., and Geary S.J. (2005). Development of real-time diagnostic assays specific for Mycoplasma mycoides subspecies mycoides Small Colony. Vet
Microbiol;111:51-58.
Gourlay, R.N. (1964). Antigenicity of Mycoplasma mycoides. I. Examination Examination of body fluids from cases of Contagious Bovine Pleuropneumonia. Res. Vet. Sci. 5, 473-482.
136
Gourlay, R.N. and MacLeod, A.K. (1966). Fermentation of glucose by Mycoplasma mycoides and its effect on viability. Bull. Epizoot. Dis. Afr. 14, 373-381.
Goyal, M., Young, D., Zhang, Y., Jenkins, P. A. and Shaw, R. J. (1994). PCR ampli®cation of variable sequence upstream of katG gene to subdivide strains of Mycobacterium tuberculosis complex. J Clin Microbiol 32, 3070-3071.
Griffin, R.M., (1965). A gel diffusion precipitin test for contagious bovine pleuropneumonia. J. Comp. Pathol. 75, 223–231.
Griffin, R. M.; and Laing, D. F. (1966). Contagious bovine pleuropneumonia in Northern Nigeria, 1924-64. I. Bull Epizoot Dis Afr. 14 iss. 3. Pg. 255-79
Gryseels, G., and Anderson, F.M., (1983). Research on farm and livestock productivity in the central Ethiopian highlands: initial results, 1977–1980. ILCA Research Report No. 4. International Livestock Center for Africa (ILCA), Addis Abeba, Ethiopia.
Gundersen, D. E., Lee, I.M., Schaff, D. A., Harrison, N. A., Chang, C. J., Davis, R. E., and Kingsbury, D. T. (1996). Genomic diversity and differentiation among phytoplasma strains in 16S rRNA groups I (aster yellows and related phytoplasmas) and III (X-disease and related phytoplasmas). Int. J. Syst.
Bacteriol. 46:64-75.
Hammond, J.A. and Branagan, D., (1965). Contagious Bovine Pleuropneumonia in Tanganyika. Bulletin of Epizootic Disease in Africa, 13, 121-147.
Hanage W. P., Kaijalainen T., Herva E., Saukkoriipi A., Syrjanen R., Spratt B. G., Using (2005). Multilocus Sequence Data to Define the Pneumococcus, J.
Bacteriol. 187 6223-6230.
Hazel, S.L., Greenwood, P.E., and Adams, B.S., (1986). Isolation of Mycoplasmas from the external car canal of a cow. Aust. Vet. J. 3, 129–130.
Hege, R., W. Zimmermann, R. Scheidegger, and K. D. Stärk. (2002). Incidence of reinfections with Mycoplasma hyopneumoniae and Actinobacillus
pleuropneumoniae in pig farms located in respiratorydisease- free regions of Switzerland--identification and quantification of risk factors. Acta Vet. Scand. 43:145-156.
Heubschle, O. J. B., C. Bamhare, and G. Tjipura-Zaire (2002). The situation of CBPP in Namibia in view of a new outbreak in the Caprivi region. Pace programme. in cattle with Contagious Bovine Pleuropneumonia. Veterinary Record 134, 240–1.
Himmelreich, R., Hilbert, H., Plagens, H., Pirkl, E., Li, B. C., and Herrmann, R. (1996). Complete sequence analysis of the genome of the bacterium Mycoplasma
pneumoniae. Nucleic Acids Res. 24:4420-4449.
Hong, Y., Garcia, M., Leiting, V., Bencina, D., Dufour
Kleven, S. H.. (2004). Specific detection and typing of strains in poultry with PCR and DNA sequence analysis targeting the hemagglutinin encoding gene
Hotzel, H., Sachse, K., and Pfutzner, H. (1996). A PCR Scheme for differentiation of organisms belonging to ther 49: 31-43.
Houshaymi, B.M., Miles, R.J., differentiates African from European isolates of mycoides SC. Vet. Rec
Howard, C. J., and Taylor, G. (1985). Immune responses to the respiratory tract
Hudson JR. ; Cottew, G. S.Mycoplasma : a review of the subject New York Academy of Sciences
Hudson JR. (1968). Contagious Bovine Pleuropneumonia: the keeping properties of the V5 vaccine used I nAustralia.
Hudson, R. and Turner, A. W. (1comparison of the efficacy of two types of vaccine.
International Committee on Systematic Bacteriologyof Mollicutes. (1997). Minutes of the interim meeting, JulUSA. Int. J. Syst. Bacteriol.
International Committee on Systematic Bacteriologyof Mollicutes. (1995). Minutes of the interim meeting, July 1994,France. Int. J. Syst. Bacteriol.
Iredell, J., D. Blanckenberg, M. Arvand, S. Grauling, E. J. Feil, and R. J. Birtles. (2003). Characterization of the natural population of sequence typing. J. Clin. Microbiol
Jolley, K. A., Chan, M. S., and Maiden, M. C.. (2004). mlstdbNet locus sequence typing (MLST) databases.
Kamla, V., Henrich, B., and Tu reflects the phenotypic features of 16S rRNA Gene : 171 : 1
Karst, O., (1972). Contagious Bovine Pleuropneumonia: lyophilized T1 vaccine. CBPP Special Issue. Bull. Epiz. Dis. Afri
Knowles, J.R. (1955). Some aspects of control of contagious bovine pleuropneumonia in Nigeria Bull. Epiz. Dis. Afr
137
Hong, Y., Garcia, M., Leiting, V., Bencina, D., Dufour-Zavala, L., Zavala, G., and 2004). Specific detection and typing of Mycoplasma synoviae
strains in poultry with PCR and DNA sequence analysis targeting the hemagglutinin encoding gene vlhA. Avian Dis. 48:606-616.
Hotzel, H., Sachse, K., and Pfutzner, H. (1996). A PCR Scheme for differentiation of organisms belonging to ther Mycoplasma mycoides cluster. Vet. Microbiol
Houshaymi, B.M., Miles, R.J., and Nicholas, R.A.J., (1997). Oxidation of glycerol differentiates African from European isolates of Mycoplasma mycoides
Vet. Rec. 140, 182±183.
Taylor, G. (1985). Immune responses to Mycoplasma
the respiratory tract. Vet Immunol Immunopathol 10 : 1 Pages: 3-32
; Cottew, G. S. ; and Adler, H. E. (1967). Diseases of goats caused by : a review of the subject with some new findings.
New York Academy of Sciences 143, 287-297.
Hudson JR. (1968). Contagious Bovine Pleuropneumonia: the keeping properties of the V5 vaccine used I nAustralia. Aust Vet J, 44(4): 123-9.
Hudson, R. and Turner, A. W. (1963). Contagious Bovine Pleuropneumonia: a comparison of the efficacy of two types of vaccine. Aust. vet. J. 39
International Committee on Systematic Bacteriology Subcommittee on the Taxonomy (1997). Minutes of the interim meeting, July 1996,
Syst. Bacteriol. 47:911-914.
International Committee on Systematic Bacteriology Subcommittee on the Taxonomy (1995). Minutes of the interim meeting, July 1994,
Syst. Bacteriol. 45:415-417.
Iredell, J., D. Blanckenberg, M. Arvand, S. Grauling, E. J. Feil, and R. J. Birtles. (2003). Characterization of the natural population of Bartonella henselae
J. Clin. Microbiol. 41:5071-5079.
Jolley, K. A., Chan, M. S., and Maiden, M. C.. (2004). mlstdbNet - distributed multilocus sequence typing (MLST) databases. BMC Bioinformatics. 5:86.
and Hadding, U. (1996). Phylogeny based on elongation factor Tu reflects the phenotypic features of Mycoplasmas better than that based on
: 171 : 1 Pages: 83-7.
Karst, O., (1972). Contagious Bovine Pleuropneumonia: lyophilized T1 vaccine. CBPP Bull. Epiz. Dis. Afri. 69–76.
Knowles, J.R. (1955). Some aspects of control of contagious bovine pleuropneumonia Bull. Epiz. Dis. Afr : 3. Pages: 381-386.
Zavala, L., Zavala, G., and Mycoplasma synoviae
strains in poultry with PCR and DNA sequence analysis targeting the
Hotzel, H., Sachse, K., and Pfutzner, H. (1996). A PCR Scheme for differentiation of Vet. Microbiol.
Nicholas, R.A.J., (1997). Oxidation of glycerol Mycoplasma mycoides subsp.
Mycoplasma infections of 32
Adler, H. E. (1967). Diseases of goats caused by with some new findings. Annals of the
Hudson JR. (1968). Contagious Bovine Pleuropneumonia: the keeping properties of the
963). Contagious Bovine Pleuropneumonia: a 39: 373.
Subcommittee on the Taxonomy y 1996, Orlando,
Subcommittee on the Taxonomy (1995). Minutes of the interim meeting, July 1994, Bordeaux,
Iredell, J., D. Blanckenberg, M. Arvand, S. Grauling, E. J. Feil, and R. J. Birtles. (2003). Bartonella henselae by multilocus
distributed multi-. 5:86.
Hadding, U. (1996). Phylogeny based on elongation factor better than that based on
Karst, O., (1972). Contagious Bovine Pleuropneumonia: lyophilized T1 vaccine. CBPP
Knowles, J.R. (1955). Some aspects of control of contagious bovine pleuropneumonia
138
Knowles, J.R. (1960). Methods of control of contagious bovine pleuropneumonia utilized in northern Nigeria with particular reference to Bornu province. Bull.
Epiz. Dis. Afr : 8 Pages: 225-231.
Knudtson, K.L., and Minion, F.C. (1993). Construction of Tn4001 lac derivatives to be used as promoter probe vectors in Mycoplasmas. Gene, 137:217-222.
Kotetishvili, M., O. C. Stine, A. Kreger, J. G. Morris, Jr., and A. Sulakvelidze. (2002). Multilocus sequence typing for characterization of clinical and environmental Salmonella strains. J. Clin. Microbiol. 40:1626–1635.
Kusiluka, L.J.M., (2000). Respiratory mycoplasmoses of cattle and goats with special emphasis on molecular epidemiology of Contagious Bovine Pleuropneumonia in Tanzania. Ph.D. Thesis. The Royal Veterinary and Agricultural University,Copenhagen, 113 pp.
Kusiluka, L.J.M., Semuguruka,W.D., Kazwala, R.R., Ojeniyi, B., and Friis, N.F., (2000). Demonstration of Mycoplasma capricolum subsp. Capripneumoniae and Mycoplasma mycoides subsp. mycoides, small colony type in outbreaks of caprine pleuropneumonia in eastern Tanzania. Acta
Vet. Scand. 41, 311–319.
Lacher D. W., Steinsland H., Blank T. E., Donnenberg M. S., and Whittam T. S., (2006). Molecular Evolution of Typical Enteropathogenic Escherichia coli: Clonal Analysis by Multilocus Sequence Typing and Virulence Gene Allelic Profiling, J. Bacteriol. JB.01472-06.
Laval, G., (2002). Analyse coˆut-bénéfice des méthodes de lutte contre la PPCB (péripneumonie contgieuse bovine)—Une application au niveau du troupeau dans le district de Boji, West Wellega (Ethiopie). PhD. Université de Lyon I, Lyon.
Lazar, J. G. (1995). Immunological detection of PCR products. In PCR Primer. A
Laboratory Mannual. (Dieffenbach, C.W. &Dveksler,G. S., eds) Pp. 177–92.
Le Goff, C. and Thiaucourt, F. (1998). A competitive ELISA for the specific diagnosis of Contagious Bovine Pleuropneumonia CBPP. Veterinary Microbiology 60 1998 179–191.
Le Goff, C., and Lefevre, P.C., (1989). Peripneumonie contagieuse bovine: test immuno enzymatique et cinetique d’apparition des anticorps au cours d’une infection experimentale: relation entre la fixation du complement, l’excretion et la recherche de l’antigene circulant. Rev. Elev. Med. Vet. Pays Trop. 42, 365–369. ´ Newing, C.R., Field, A.C., 1953. A preliminary report on a rapid field test for contagious bovine pleuropneumonia. Br. Vet. J. 109, 397–404.
Le Grand, D., Saras, E., Blond, D., Solsona, M., and Poumarat, F. (2004). Assessment of PCR for routine identification of species of the Mycoplasma mycoides
cluster in ruminants Vet Res : 35 : 6 Pages: 635-49.
139
Leach, R.H., Costas, M., and Mitchelmore, D.L., (1989). Relationship between Mycoplasma mycoides mycoides and M. mycoides capri as indicated by numerical analysis of one-dimensional SDS-PAGE protein patterns. J.
Gen. Microbiol. 135, 2993-3000.
Lemee, L., Dhalluin, A., Pestel-Caron, M., J. F. Lemeland, and J. L. Pons. (2004). Multilocus sequence typing analysis of human and animal Clostridium difficile
isolates of various toxigenic types. J. Clin. Microbiol. 42:2609-2617.
Lesnoff, M., Diedhiou, M.L., Laval, G., Bonnet, P., Workalemahu, A., Kifle, D., (2002). Demographic parameters of domestic cattle in a contagious-bovine-pleuropneumonia infected area of Ethiopian highlands. Rev. Elev. Méd. Vét.
Pays Trop. 55 (2), 139–147.
Lesnoff, M., Laval, G., Bonnet, P., Sintayehu, A., Workalemahu, A., Kifle, D., Peyraud, A., Lancelot, R., and Thiaucourt, F., (2004). Within-herd spread and clinical observations of Contagious Bovine Pleuropneumonia: a longitudinal survey in Ethiopian Highlands. Prev. Vet. Med., submitted for publication.
Litamoi, J. K. , Ayelet, G. and Rweyemamu, M. M. (2004). Evaluation of the xerovac process for the preparation of heat tolerant Contagious Bovine Pleuropneumonia (CBPP) vaccine. ELSEVIER. Article in Press (Received 23 April 2004, accepted 10 November 2004)
Litamoi, J.K., and Seck, B.M. (1999). Vaccines and vaccination. Vaccine quality issues in Africa including safety and e.cacy. In: Report of the first meeting of the FAO/OIE/OAU-IBAR consultative group on Contagious Bovine Pleuropneumonia (CBPP), Rome, Italy 5^7 October 1998, pp. 65^75. FAO
publication X3960-E, FAO, Rome.
Lorenzon, S., Manso-Silván, L., and Thiaucourt, F. (2008). Specific real-time PCR assays for the detection and quantification of Mycoplasma mycoides subsp.
mycoides SC and Mycoplasma capricolum subsp. capripneumoniae, Molecular
and Cellular Probes, doi: 10.1016/j.mcp.2008.07.003.
Lorenzon, S., Arzul, I., Peyraud, A., Hendrikx, F.and Thiaucourt, F., (2003). Molecular epidemiology of Contagious Bovine Pleuropneumonia by multilocus sequence analysis of Mycoplasma mycoides subspecies mycoides biotype SC strains. Veterinary Microbiology, 93, 319-333.
Lorenzon, S., Wesonga, H., Ygesu, L., Tekleghiorgis, T., Maikano, Y., Angaya, M., Hendrikx, P., and Thiaucourt, F. (2002). Genetic evolution of Mycoplasma
capricolum subsp. capripneumoniae strains and molecular epidemiology of contagious caprine pleuropneumonia by sequencing of locus H2. Vet
Microbiol. 85:111-123.
Lorenzon, S., David, A., Nadew, M., Wesonga, H., and Thiaucourt, F. (2000). Specific PCR identification of the T1 vaccine strains for contagious bovine pleuropneumonia. Mol Cell Probes : 14. : 4 Pages: 205-10.
140
Lowry, O.H., Rosebrough, N.J., Farr, A.L., and Randall, R.J., (1951). Protein measurement with the folin phenol reagent. J. Biol. Chem. 193, 265-275.
Lwebandiza, T.S., (1969). Contagious Bovine Pleuropneumonia in Tanzania. Bull. Off.
Int. Epiz. 72, 71–78.
Ma, L., and D. H. Martin. (2004). Single-Nucleotide polymorphisms in the rRNA operon and variable numbers of tandem repeats in the lipoprotein gene among Mycoplasma genitalium strains from clinical specimens. J. Clin. Microbiol. 42:4876-4888.
Mahillon, J., Leonard, C., and Chandler, M. (1999). IS elements as constituents of bacterial genomes, Research in Microbiology. 150 675-687.
Mahilon, J., and Chandler, M. (1998). Insertion sequences, Microbiol. Mol. Rev. 62 725-774.
Mahoney, D.F. (1954). Epidemiological considerations in relation to the control of Contagious Bovine Pleuropneumonia in northeast Queensland. Aust. Vet. J. 30, 318–320.
Maiden, M.C.J., Bygraves, J.A., Feil, E., Morelli, G., Russell, J.E., Urwin, R., Zhang, Q., Zhou, J., Zurth, K., Caugant, D.A., Feavers, I.M., Achtman, M., and Spratt, B.G., (1998). Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. U.S.A. 95, 3140–3145.
Maniloff, J. (1992). Phylogeny of Mycoplasmas. : molecular biology and pathogenesis. J. Maniloff. New York: 549-559.
Manning, G., Dowson, C. G., Bagnall, M. C., Ahmed, I. H., West, M., and Newell, D. G. (2003). Multilocus sequence typing for comparison of veterinary and human isolates of Campylobacter jejuni. Appl. Environ. Microbiol. 69:6370-6379.
Manso-Silván, L., Perrier, X., and Thiaucourt, F., (2007). Phylogeny of the Mycoplasma
mycoides cluster based on analysis of five conserved protein-coding sequences: consequences in taxonomy., Int J Syst Evol Microbiol. accepted for publication.
March, J.B., Clark, J. and Brodlie, M. (2000). Characterisation of strains of Mycoplasma mycoides subsp. mycoides small colony type isolated from recent outbreaks of Contagious Bovine Pleuropneumonia (CBPP) in Botswana and Tanzania: Evidence for a new biotype. Journal of Clinical Microbiology 38:1419-1425.
March John B. , Emma R. Waite , Joseph K. and Litamoi (2002). Re-suspension of T144 vaccine cultures of Mycoplasma mycoides subsp. mycoides SC in 1 molar MgSO4 causes a drop in pH and a rapid reduction in titre. FEMS
Immunology and Medical Microbiology 34 (2002) 97^103
141
Mare, C. J., and Switzer, W. P. (1965). New Species: Mycoplasma hyopneumoniae, a causative agent of virus pig pneumonia. Vet. Med. Small. Anim. Clin. 60:841-846.
Martel, J.L., Belli, P., Perrin, M., Dannacher, G., and Poumarat, F., (1985). La péripneumonie contagieuse bovine. Rec. Méd. Vét. 161 (2), 1105–1113.
Masiga, W. N., Domenech, J., and Windsor, R. S. (1996). Manifestation and epidemiology of Contagious Bovine Pleuropneumonia in Africa. Rev. Sci.
Tech. OIE 15: 12833 – 1308.
Masiga, W.N., Rossitor, P., and Bessin, R. (1999a). Contagious Bovine Pleuropneumonia. I. Epidemiology: the present situation in Africa and epidemiological trends. In: Report of the FAO/OIE/OAUIBAR CBPP Consulatative Group Meeting, Rome, Italy 5^7 October 1998, pp. 25^31, FAO publication X3960-E, FAO, Rome.
Masiga, W.N., Rossitor, P., and Bessin, R. (1999). Vaccines and vaccination: the impact of withdrawing rinderpest vaccination on CBPP control. In: Report of the FAO/OIE/OAU-IBAR CBPP Consulatative Group Meeting, Rome, Italy 5^7 October 1998, pp. 81^85, FAO publication X3960-E, FAO, Rome.
Masiga,W.N., (1972). Achievements of AOU/STRC CP 16 Project, CBPP Special Issue. Bull. Epiz. Dis. Afr. 5–11.
Masiga,W.N., and Domenech, J., (1995). Overview and epidemiology of contagious bovine pleuropneumonia in Africa. Rev. Sci. Tech. Off. Int. Epiz. 14, 611–620.
Meats, E., Feil, E. J., Stringer, S., Cody, A. J., Goldstein, R., Kroll, J. S., Popovic, T., and Spratt, B. G., (2003). Characterization of Encapsulated and Noncapsulated Haemophilus influenzae and Determination of Phylogenetic Relationships by Multilocus Sequence Typing, J. Clin. Microbiol. 41 1623-1636.
Melin, A. M., Allery, A., Perromat, A., Bebear, C., Deleris, G., and de Barbeyrac, B. (2004). Fourier transform infrared pectroscopy as a new tool for characterization of mollicutes. J. Microbiol. Methods. 56:73-82.
Miles, R. J., Beezer, A. E. and Lee, D. H. (1986). The growth of Mycoplasma mycoides
subspecies mycoides in a salt solution, an ampoule microcalorimetric study. Microbios, 45, 7-19.
Miles, R. J., and Taylor, R. R., (1991). "Oxygen uptake and H2O2 production by fermentative Mycoplasma spp." J Med Microbiol 34(4): 219-23.
Miles, R. J., Wadher, B. J., Henderson, C. L., and Mohan, K. (1988). Increased yields of Mycoplasma spp. In the presence of pyruvate. Letters in Applied
Microbiology, 149-151.
Miles, R.J. (1983). Effect of some cultural factors on T1 broth vaccine for contagious bovine pleuropneumonia. Trop. Anim. Health Prod. 15, 144-148.
142
Minion F.C., and Kapke P.A. (2003). Transformation of Mycoplasmas. In: Miles R, Nicholas R, editors. Methods in Molecular Biology. Totowa, NJ: Humana Press, Wschr. 109, 562±568.
Miserez, R., T. Pilloid, X. Cheng, J. Nicolet, C. Griot, and J. Frey (1997). Development of a sensitive nested PCR method for specific detection nof Mycoplasma
mycoides subspecies mycoides SC. Mol. Cell. Probes 11: 103-111.
Mullins G. R., Fidzani B., and Kolanyane M., (2000). At the end of the day. The socioeconomic impacts of eradicating Contagious Bovine Pleuropneumonia from Botswana, Ann N Y Acad Sci. 916 333-44.
Nallapareddy, S. R., Duh, R. W., Singh, K. V., and Murray, B. E. (2002). Molecular typing of selected Enterococcus faecalis isolates: pilot study using multilocus sequence typing and pulsed-field gel electrophoresis. J. Clin. Microbiol. 40:868-876.
Nawathe, D. R. (1992). Resurgence of Contagious Bovine Pleuropneumonia in Nigeria : Rev Sci Tech 11 3, Pages: 799-804
Newton, L.G., (1992). Contagious Bovine Pleuropneumonia in Australia: some historic highlights from entry to eradication. Aust. Vet. J. 69, 306–317.
Nicholas R. A. J. and Bashiruddin J. B. (1995). Mycoplasma mycoides subspecies mycoides (Small Colony Variant): the Agent of Contagious Bovine Pleuropneumonia and Member of the “Mycoplasma mycoides Cluster” J.
Comp. Path. Vol. 113, 1-27.
Nicholas, R. A. J. and Baker, and Baker, S. (1998). Recovery of Mycoplasmas from animals. In: Mycoplasma Protocols, Methods in Molecular Biology vol. 104. [edited by Miles, R.J., Nicholas, R.A.J.]. Totowa, New Jersey, Humana Press. Pp. 37-44.
Nicholas, R.A.J (2004). Recent developments in the diagnosis and control of Mycoplasma infections in cattle. Proceeding of the 23
rd World Biuatrics
congress, Quebec, Canada. July, 11 – 16.
Nicholas, R. A. J., Bashiruddin, J. B., Ayling, R. D., and Miles, R. J. (2000). Contagious Bovine Pleuropneumonia : a review of recent developments. Vet.
Rec. __ 70: 827-838.
Nicholas, R. A. J., Palmer, N.. (1994). Contagious Bovine Pleuropneumonia in Europe. State Veterinary Journal 4, 14-16.
Nicholas, R.A.J., Santini, F.G., Clark, K.M., Palmer, N.M.A.,DeSantis, P., and Bashiruddin, J.B., (1996). A comparison of serological tests and gross lung pathology for detecting Contagious Bovine Pleuropneumonia in two groups of Italian cattle. Vet. Rec. 139, 89–93.
Nicolas, P., G. Raphenon, M. Guibourdenche, L. Decousset, R. Stor, and A. B. Gaye (2000). The 1998 Senegal epidemic of meningitis was due to the clonal
143
expansion of A:4:P1.9, clone III-1, sequence type 5 Neisseria meningitides
strains. n. 38:198–200.
Neimark, H., K. E. Johansson, Y. Rikihisa, and J. G. Tully. (2001). Proposal to transfer some members of the genera Haemobartonella and Eperythrozoon to the genus Mycoplasma with descriptions of 'Candidatus Mycoplasma haemofelis', 'Candidatus Mycoplasma haemomuris', 'Candidatus Mycoplasma haemosuis' and 'Candidatus Mycoplasma wenyonii'. Int. J. Syst. Evol. Microbiol. 51:891-899.
Nocard, Roux, Borrel, Salimbeniet, and Dujardin-Beaumetz, (1898). Le microbe de la péripneumonie. Annales de I’nstitut Pasteur 12, 240–262.
Nwankpa, N. D., Molokwu, J. U., Abiayi, E., and Lombin, L. H. (2003). Contagious Bovine Pleuropneumonia : Current situation and the need to develop a control strategy for Nigeria. National Veterinary Research Institute Seminar
Series. No. 2. Pp. 15-19.
Nwanta, J. N. and Umoh, J. N. (1992). The epidemiology of Contagious Bovine Pleuropneumonia (CBPP) in Northern States of Nigeria: An update. Revue
d’Elevage de Medicine Veterinaire des Pays Tropicaux 45, 17-20.
OAU/IBAR, (2001). Participatory epidemiology: lessons learned and future directions. Nov 15-01 Nov 17. Nairobi:Community-based Animal Health and Participatory Epidemiology Unit,.
Office International des Epizooties, (OIE) (2000) Contagious Bovine Pleuropneumonia . In: Manual of Standards for Diagnostic Techniques and Vaccines (OIE, ed.) 4th edn., Chapter 2.1.6, pp 123-133. O.ce International des
Epizootes, Paris.
OIE, (1997) Revue Scientifique et Technique: Office International des Epizooties 16, 898-904.
OIE, (2003). Contagious Bovine Pleuropneumonia , Manual of Standards. Chapter 2.1.6.
Olive, D. M., and P. Bean. (1999). Principles and applications of methods for DNA-based typing of microbial organisms. J. Clin. Microbiol. 37:1661-1669.
Olsen, G.J., Woese, C.R., (1993). Ribosomal RNA: a key to phylogeny. FASEB J. 7, 113-123.
Osiyemi, T.I.O., (1981). The eradication of contagious pleuropneumonia in Nigeria: prospects and problems. Bull. Anim. Health Prod., Afr. 29, 95-97.
Paskin R. (2000). Economic and social welfare importance of transboundary animal diseases. In Report of a workshop of Chief Veterinary Officers/Directors of Veterinary Services of SADC Member Countries on Transboundary Animal Diseases with special reference to foot and mouth disease and Contagious
144
Bovine Pleuropneumonia in Southern Africa, Pretoria, 21-22 July, South Africa.
Persson Anja, (2002). Molecular characterization of Mycoplasma mycoides subsp.
mycoides SC. Doctors dissertation. ISSN: 1401-6257, ISBN 91-576-6364-5
Persson, A., B. Pettersson, G. Bolske, and K. E. Johansson. (1999). Diagnosis of Contagious Bovine Pleuropneumonia by PCR-laser- induced fluorescence and PCR-restriction endonuclease analysis based on the 16S rRNA genes of Mycoplasma mycoides subsp. mycoides SC. J. Clin. Microbiol. 37:3815- 3821.
Persson, A., K. Jacobsson, et al.,. (2002). "Variable surface protein Vmm of Mycoplasma mycoides subsp. mycoides small colony type." J Bacteriol 184(13): 3712-22.
Persson, Anja, Bertil Pettersson, goran Bolske, and Karl-erik Johansson (1999). Diagnosis of Contagious Bovien Pleuropneumonia by PCR-Laser induced Florescence and PCR-Restriction Endonuclease Analysis Based on the 16s RNA genes of Mycoplasma mycoides subsp. mycoides SC. J. Cl. Microb. Vol. 37. No. 12. p. 3815-3821.
Pettersson, B., Bolske, G., Thiaucourt, F., Uhlen, M., and Johansson, K.-E., (1998). Molecular evolution of Mycoplasma capricolum subsp. capripneumoniae strains based on polymorphisms in the 16S rRNA genes. J. Bacteriol. 180, 2350±2358.
Pettersson, B., Leitner, T., Ronaghi, M., Bolske, G., Uhlen, M., and Johansson, K. E. (1996). "Phylogeny of the Mycoplasma mycoides cluster as determined by sequence analysis of the 16S rRNA genes from the two rRNA operons." J
Bacteriol 178(14): 4131-42.
Pilo, P., Fleury, B., Marenda, M., Frey, J., E. and Vilei, M., (2003). Prevalence and distribution of the insertion element ISMag1 in Mycoplasma agalactiae, Veterinary Microbiology. 92 37-48.
Pilo, P., E. M. Vilei, et al.,. (2005). A metabolic enzyme as a primary virulence factor of Mycoplasma mycoides subsp. mycoides small colony. J Bacteriol 187(19): 6824-31.
Poumarat, F., and Solsona, M., (1995). Molecular epidemiology of Mycoplasma
mycoides subsp. mycoides biotype small colony, the agent of Contagious Bovine Pleuropneumonia . Vet. Microbiol. 47, 305-315.
Poumarat, F., Perrin, M., Belli, P., Longchambon, D., Le Goff, C., and Martel, J. L. (1989). Studies of the origin of false positive reactions in the serodiagnosis of Contagious Bovine Pleuropneumonia . Rev Elev Med Vet Pays Trop 42 Pages: 371-8.
Poumarat, F., Perrin, M., Belli, P., and Martel, J. L.(1989). Correlation of the excretion of Mycoplasma and kinetics of antibodies detected by complement fixation,
145
passive hemagglutination and rapid seroagglutination in Mycoplasma
mycoides subsp. mycoides SC experimental infection in cattle Rev Elev Med
Vet Pays Trop : 42 3 Pages: 357-64
Provost A, Borredon C, and Qurval R. (1970). Recherces immunologiques XI. Un vaccine vivant mixte antibovipestique-antiperipneumonique ocule en un seal temp: conception, production, controles. Reve Elev Med Cet Pays Trop, 23(2): 143-62.
Provost, A. (1996). Stratégies de prophylaxie et d’eradication de la peripneumonie contagieuse bovine avec ou sans vaccination. Rev. sci. tech. Off. Int. Epiz.,
15(4), 1355-1371.
Provost, A., (1974). Essai de traitement de la péripneumonie contagieuse des bovidés par la spyramicine. Cah. Méd. Vét. 43, 140–141.
Provost, A., Perreau, P., Beard Goff, L.E., and Cottew, G.S., (1987). Contagious Bovine Pleuropneumonia . Rev. Sci. Techn. Off. Int. Epiz. 6, 625±679.
Radostitis, O.M., Gay, C.C., Blood, D.C., and Hinchcliff, K.W. (1999). Veterinary Medicine: A Textbook of the Diseases of Cattle, Sheep, Pigs, Goats and Horses, 9th ed. Saunders, London, pp. 999–1004.
Radstrom, P., Knutsson, R., Wolffs, P., Lovenklev, M., and Lofstrom, C. (2004). Pre-PCR Processing : Strategies to generate PCR-compatible samples. Mol.
Biotechnol. 26:133-146.
Rasmussen, S. R., Rasmussen, H. B., Larsen, M. R. Hoff-Jørgensen, R. and Cano, R. J. (1994). Combined polymerase chain reaction-hybridisation microplate strains currently classified as M. capricolum (Tully, Barile, Edward, Theodore, and Ern¢ 1974) to an additional new subspecies M. capricolum subsp. capricolum subsp.nov. Int. J. Syst. Bacteriol. 43, 603-605.
Razin, S. (1992). Mycoplasma taxonomy and ecology, p. 3-22. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington, D.C.
Razin, S. (1997). Comparative genomics of Mycoplasmas. Wien Klin Wochenschr 109(14-15): 551-6.
Razin, S. (1997b). "The minimal cellular genome of Mycoplasma ." Indian J Biochem
Biophys 34(1-2): 124-30.
Razin, S., (1989). Molecular approach to Mycoplasma phylogeny. In: Whitcomb, R.F., Tully, J.G. (Eds.), The Mycoplasmas vol V Academic Press, San Diego, pp. 33±64.
Razin, S., Yogev, D. and Naot Y. (1998). Molecular Biology and Pathogenicity of Mycoplasmas. Microbiology and Molecular Biology Reviews, December 1998,
146
p. 1094-1156, Vol. 62, No. 4 reaction. Proceedings of the National
Academy of Sciences USA86, 2423–7.
Regalla, J., Caporale, V., Giovannini, A., Santini, F., Martel, J.L., and Gonçalves, A.P., (1996). Manifestation and epidemiology of Contagious Bovine Pleuropneumonia in Europe. Rev. Sci. Tech. Off. Int. Epiz. 15, 1309– 1329.
Riethman, H.C., Boyer, M.J., and Wise, K.S., (1987). Triton X-114 phase fractionation of an integral membrane surface protein mediating monoclonal antibody killing of Mycoplasma hyorhinis. Infect. Immun. 55, 1094-1100.
Rodwell, A.W., (1982). The protein Fingerprints of Mycoplasmas. Rev. Inf. Dis. 4, S8-S17.
Rodwell, A.W., and Mitchell, A. (1979). Nutrition, growth and reproduction. In: The Mycoplasmas.I. Cell Biology (Barile, M.F. and Razin, S., Eds.), pp. 103^139. Academic Press, New York.
Roeder, P.L., and Rweyemamu, M., (1995). Impact of refugees and changes in livestock movement pattern on epidemiology of epizootics in East Africa with special reference to CBPP. In: Contagious Bovine Pleuropneumonia Prevention and Control Strategies in Eastern and Southern Africa. FAO–EMPRES/OUAIBAR, Arusha, July 4–6, 1995.
Rosengarten, R., Behrens, A., Stetefeld, A., Heller, M., Ahrens, M., Sache, K., Yogev, D., and Kirchhoff, H., (1994). Antigen heterogeneity among isolates of Mycoplasma bovis is generated by high-frequency variation of diverse membrane surface proteins. Infect. Immun. 62, 5066±5074.
Rosengarten, R., and Wise, K. S. (1991). The Vlp system of Mycoplasma hyorhinis: combinatorial expression of distinct size variant lipoproteins generating high-frequency surface antigenic variation. J Bacteriol 173 15 Pages: 4782-93
Rosengarten, R., and Yogev, D. (1996). Variant colony surface antigenic phenotypes within Mycoplasma strain populations: implications for species identification and strain standardization J Clin Microbiol 34, 1 Pages: 149-58
Ross, R. F. (1993). Mycoplasma -animal pathogens, p. 69-109. In I. Kahane and A. Adoni (ed), Rapid diagnosis of Mycoplasmas.Plenum press, New York N. Y.
Rottem, S. (2003). Interaction of Mycoplasmas with host cells. Physiological Reviews 83: 417-432.
Rovid, A.H., and Roth, J.A. (1997). Enhancement of monocyte migration and phagocytosis by the bovine immunodeficiency-like virus gag proteins. J
Acquir Immune Defic Syndr Hum Retrovirol, 14:18-25.
Rurangirwa, F. R., and Shompole, P. S., (2000). Monoclonal antibody differentiation of Mycoplasma mycoides subsp. mycoides small-colony strains causing Contagious Bovine Pleuropneumonia from less important large-colony strains. Clin Diagn Lab Immunol 7(3): 519-21.
147
Rweyemamu, M., and Benkirane, A., (1996). Global impact of infections with organisms of the ‘Mycoplasma mycoides cluster’ in ruminants. In: Frey, J., Sarris, K. (Eds.), Mycoplasmas of ruminants: pathogenicity, diagnostics, epidemiology and molecular genetics.COST826. Report EUR16934. Commission of European Communities, Luxembourg, pp. 1–11.
Rweyemamu, M. M. (2001). Overview of the objectives of the consultation and expected outputs of CBPP vaccines. Report of the second meeting of the FAO/OIE/OAU-IBAR consultative group on Contagious Bovine Pleuropneumonia (CBPP), 24-26th Oct 2000, Rome, pp. 3-9. FAO, Rome.
Rweyemamu, M.M., Litamoi, J., Palya, V. and Sylla, D. (1995). Contagious Bovine Pleuropneumonia vaccines: the need for improvements. Rev. Sci. Tech. 14, 593-601.
Rwezaura, D.A., Mwinjaka, S.R., and Ponela, T., (2000). The CBPP Control Project in Tanzania. Livestock Division, Ministry of Agriculture, Dar es Salaam, 30 pp.
Salih, M.M., Erne, H., and Simonsen, V., (1983). Electrophoretic analysis of isoenzymes of Mycoplasma species. Acta Vet. Scand. 24, 14-33.
Sarkar, S. F., and Guttman, D. S.. (2004). Evolution of the core genome of Pseudomonas syringae, a highly clonal, endemic plant pathogen. Appl.
Environ. Microbiol. 70:1999-2012.
Sasaki, Y., Ishikawa, J., Yamashita, A., Oshima, K., Kenri, T., Furuya, K., Yoshino, C., Horino, A., Shiba, T., Sasaki, T., and Hattori, M.. (2002). The complete genomic sequence of Mycoplasma penetrans, an intracellular bacterial pathogen in humans. Nucleic Acids Res. 30:5293-5300.
Schneider, H.P., Van der Lugt, J.J. and Hübschle, O.J.B., (1994). Contagious bovine peuropneumonia. In: Infectious Diseases of Livestock. JAW Coetzer, GR Thomson & RC Tustin (eds), pp 1485-1494. Oxford University Press, Cape Town.
Scundamore, J. M. (1995). Contagious Bovine Pleuropneumonia . State Veterinary
Journal 5, 13-16.
Seck, B. M., Kané, M., and Amanfu, W. (2004). The status of CBPP in west and central Africa and strategies for sustainable control PACE PROGRAMME. Reports of the PACE workshops on CBPP held in Addis Ababa and Accra in 2001 and 2003 respectively and report on the technical workshop of CBPP experts of 8 May 2003.
Shifrin, M., (1967). A rapid gel diffusion precipitin test for bovine contagious pleuropneumonia. J. Wildl. Dis. Assoc. 3, 36.
Shifrine, M., Gourlay, R.N., (1967). Evaluation of diagnostic tests for Contagious Bovine Pleuropneumonia . Bull. Epiz. Dis. Afr. 15, 7–10.
148
Spratt B.G., Multilocus sequence typing: molecular typing of bacterial pathogens in an era of rapid DNA sequencing and the Internet, Curr. Opin. Microbiol. (1999) 2:312–316.
Smart, C. D., B. Schneider, C. L. Blomquist, L. J. Guerra, N. A. Harrison, U. Ahrens, K.-H. Lorenz, E. Seemuller, and B. C. Kirkpatrick. (1996). Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Appl. Environ. Microbiol. 62:2988-2993.
Srivastava, N.C., Thiaucourt, F., Singh, V.P., Sunder, J., Singh, V.P., (2000). Isolation of Mycoplasma mycoides small colony type from contagious caprine pleuropneumonia in India. Vet. Rec. 147, 520–521.
Stackebrand, E., and Goebel, B.M., (1994). Taxonomic note: a place for DNA±DNA reassociation and 16S Rrna sequence analysis in the present species definition in bacteriology. Int. J. Syst. Bacteriol. 44, 846±849.
Stakenborg, T., Vicca, J., Butaye, P., Maes, D., De Baere, T., Verhelst, R., Peeters, J., de Kruif, A., Haesebrouck, F., and Vaneechoutte, M. (2005). Evaluation of amplified rDNA restriction analysis (ARDRA) for the identification of Mycoplasma species BMC Infect Dis : 5 1 Pages: 46.
Stark, K.D.C., Vicari, A., Kihm, U., and Nicolet, J., (1995). Surveillance of Contagious Bovine Pleuropneumonia in Switzerland. Rev. Sci. Tech. Off. Int. Epiz. 14 3 , 621–629.
Tardy, F., Mercier, P., Solsona, M., Saras, E., and Poumarat, F., (2007). Mycoplasma
mycoides subsp. mycoides biotype large colony isolates from healthy and diseased goats: Prevalence and typing, Veterinary Microbiology. 121 268-277.
Taylor, T. K. Bashiruddin, J. B., and Gould A. R. (1992a). Relationships between members of the mycoides cluster as shown by DNA probes and sequence analysis. Int. J. Syst. Bacteriology 42 593-601.
Taylor, T.K., Bashiruddin, J.B., and Gould, A., (1992). Application of diagnostic DNA probe for the differentiation of two types of Mycoplasma mycoides subspecies mycoides. Res. Vet. Sci. 53, 154±159.
Tenover, F. C., Arbeit, R., Archer, G., Biddle, J., Byrne, S., Goering, R., Hancock, G., Hebert, G. A., Hill, B., and Hollis, R., (1994). Comparison of traditional and molecular methods of typing isolates of Staphylococcus aureus. J. Clin.
Microbiol. 32:407-415.
Terlaak, E.A., (1992). Contagious Bovine Pleuropneumonia . A review. Vet. Quart. 15, 104-110.
Thiacourt F., Van der Lugt J.J. and Provost, A., (2003). Contagious Bovine Pleuropneumonia . In: Infectious Diseases of Livestock, 2nd edn. JAW Coetzer & RC Tustin, eds. Oxford University Press, Cape Town.
149
Thiaucourt (2004). Within-herd spread of Contagious Bovine Pleuropneumonia in Ethiopian highlands Preventive Veterinary Medicine 64 27–40.
Thiaucourt , F., A., Wesonga, Huebschle, O. J., Tulasne, J. J. and Provost, A. (2000a).Contagious Bovine Pleuropneumonia . A reassessment of the efficacy of vaccines used in Africa. Ann. N. Y. Acad. Sci. 916, 71-80.
Thiaucourt F. (2000b). Contagious Bovine Pleuropneumonia and Contagious Caprine Pleuropneumonia: Historical Review and actual threat for European cattle. Cirad-Emvt BP 5035, 34032 Montpellier France.
Thiaucourt, F. (2002). "Contagious Bovine Pleuropneumonia and vaccine strain T1/44." Vet Rec 151(5): 156.
Thiaucourt, F. and Di Maria, A. (1992). A new microtitration method for the enumeration of Contagious Bovine Pleuropneumonia (CBPP) vaccines. Biologicals 20, 11^13.
Thiaucourt, F. and G. Bolske, (1996). Contagious caprine pleuropneumonia and other pulmonary mycoplasmoses of sheep and goats, Rev Sci Tech. 15 1397-1414.
Thiaucourt, F., (1999). Contagious Bovine Pleuropneumonia and contagious caprine pleuropneumonia: historical review and actual threat for European cattle. In: Stipkovits, L., Rosengarten, R., Frey, J. (Eds.), Mycoplasmas of Ruminants: Pathogenicity, Diagnostics, Epidemiology and Molecular Genetics, vol. 3, COST 826. Report EUR 18756. Commission of European Communities, Luxembourg, pp. 5–13.
Thiaucourt, F., Bolske, G., Libeau, G., Le Goff, C., and Lefevre, P.C., (1994). The use of monoclonal antibodies in the diagnosis of contagious caprine pleuropneumonia (CCPP). Vet. Microbiol. 41, 191±203.
Thiaucourt, F., C. Guerin, V. Mady, P. C. and Lefevre, (1992). Diagnosis of caprine contagious pleuropneumonia: recent improvements, Rev Sci Tech. 11 859-865.
Thiaucourt, F., Lorenzon, S., David, A., Tulasne, J.J., and Domenech, J., (1998). Vaccination against Contagious Bovine Pleuropneumonia and the use of molecular tools in epidemiology. Ann. N. Y. Acad. Sci. 849, 146–151.
Thiaucourt, F., Y. Aboubakar, et al.,. (2004). Contagious Bovine Pleuropneumonia vaccines and control strategies: recent data. Dev Biol (Basel) 119: 99-111.
Thiaucourt, F., Yaya, A., Wesonga, H., Huebschle, O.J., Tulasne, J.J. and Provost, A. (2000a). Contagious Bovine Pleuropneumonia . A reassessment of the efficacy of vaccines used in Africa. Ann. N.Y. Acad. Sci. 916, 71^80.
Thiaucourt, F., Lorenzon, S., David, A. and Breard, A. (2000b). Phylogeny of the Mycoplasma mycoides cluster as shown by sequencing of a putative membrane protein gene. Veterinary Microbiology 72 (2000) 251-268.
150
Thiaucourt, Francois (2002). Contagious Bovine Pleuropneumonia and Contagious Caprine Pleuropneumonia: Historical Review and Actual threat for European cattle. CIRAD-EMVT BP 5035, 34032 Montpellier, France.
Tourasse N.J., Helgason E., Okstad O.A., Hegna I.K., Kolstø A.B., (2006). The Bacillus
cereus group: novel aspects of population structure and genome dynamics, J.
Appl. Microbiol. 101:579–593.
Trichard, C.J.V., Basson, P.A., van der Lugt, J.J., and Jacobsz, E.P., (1989). An outbreak of Contagious Bovine Pleuropneumonia in the Owambo Mangetti area of South West Africa/Namibia: microbiological, immunofluorescent, pathological and serological findings. Onderstepoort J. Vet. Res. 56, 277–284.
Tulasne, J. J., Litamoi, J. K., Morein, B., Dedieu, L. ,Palya, V. J., Yami, M., Abusugra, I., Sylla, D. and Bensaid, A. (1996). Contagious Bovine Pleuropneumonia vaccines: the current situation and the need for improvement. Rev. sci. tech.
Off. Int. Epiz., 15 (4), 1373-1396.
Turner A. W. (1959). Pleuropneumonia group of diseases in : Infectious disease of animall. Disease due to bacteria. Vol 2, p:437-480 STABLEFORTH A W GALLOWAY I A eds Butterworths scientific publications, London.
Turner, A.W., (1954). Epidemiological characteristics of Contagious Bovine Pleuropneumonia . Aust. Vet. J. 30 (1), 312–317.
Turner, A.W., (1962). Detection of Mycoplasma mycoides antigens and antibody by means of precipitin tests as aids to diagnosis of Contagious Bovine Pleuropneumonia . Aust. Vet. J. 38, 335–337.
Turner, A.W., Campbell, A.D. and Dick, A.T. (1935). Recent work on pleuro-pneumonia contagiosa boum in North Queensland. Aust. Vet. J. 11, 63-71.
Turner, A.W., and Etheridge, J.R., (1963). Slide agglutination tests in the diagnosis of Contagious Bovine Pleuropneumonia . Aust. Vet. J. 39, 445–451.
Urwin, R., and M. Maiden, C.. (2003). Multi-locus sequence typing: a tool for global epidemiology. Trends Microbiol. 11:479-487.
Vaneechoutte, M., and Van Eldere, J. (1997). The possibilities and limitations of nucleic acid amplification technology in diagnostic microbiology. J. Med. Microbiol. 46:188-194.
Vilei, E. M. and Frey, J. (2001). Genetic and biochemical characterization of glycerol uptake in Mycoplasma mycoides subsp. mycoides SC: its impact on H(2)O(2) production and virulence." Clin Diagn Lab Immunol 8.
Vilei, E. M. and Frey, J. (2004). "Differential clustering of Mycoplasma mycoides
subsp. mycoides SC strains by PCR-REA of the bgl locus." Vet Microbiol 100 (3-4): 283-8.
151
Vilei, E. M., and Abdo E. M., (2000). Genomic and antigenic differences between the European and African/Australian clusters of Mycoplasma mycoides subsp.
mycoides SC. Microbiology 146 ( Pt 2): 477-86.
Vilei, E. M., J. Nicolet, and Frey, J., (1999). IS1634, a novel insertion element creating long, variable-length direct repeats which is specific for Mycoplasma
mycoides subsp. mycoides small-colony type, J Bacteriol. 181 1319-1323.
Waite, E.R. and March, J.B. (2001). Effect of HEPES buffer systems upon the pH, growth and survival of Mycoplasma mycoides subsp. mycoides small colony (MmmSC) vaccine cultures. FEMS Microbiol. Lett. 201, 291^294.
Weisburg, W. G., Tully, J. G., Rose, D. L., Petzel, J. P., Oyaizu, Yang, H., D., Mandelco, L., J. Sechrest, T. G. Lawrence, and J. Van Etten,, (1989). A phylogenetic analysis of the Mycoplasmas: basis for their classification, J
Bacteriol. 171 6455-6467.
Westberg, J. A. Persson, A. Holmberg, A. Goesmann, J. Lundeberg, K.-E. Johansson, B. Pettersson, and M. Uhlen, (2004). The Genome Sequence of Mycoplasma
mycoides subsp. mycoides SC Type Strain PG1T, the Causative Agent of Contagious Bovine Pleuropneumonia (CBPP), Genome Res. 14 221-227.
White, G., (1958). Agar double diffusion precipitation reaction applied to the study of Asterococcus mycoides. Nature 181, 278–279.
Windsor, R.S., Masiga, W.N., (1977b). Indirect infection of cattle with Contagious Bovine Pleuropneumonia . Res. Vet. Sci. 23, 230–236.
Windsor, R.S., Masiga,W.N., (1977). Investigation into the role of carrier animals in the spread of Contagious Bovine Pleuropneumonia . Res. vet. Sci. 23 (2), 224–229.
Windsor, R.S., and Masiga,W.N., (1977a). Investigations into the epidemiology of contagious bovine pleuropneumonia: the persistence of Mycoplasma
mycoides subsp. mycoides in placenta, urine and hay. Bull. Epiz. Dis. 25, 357
Windsor, R.S.,and Wood, A., (1998). Contagious Bovine Pleuropneumonia : the cost of control in central/southern Africa. Ann. N. Y. Acad. Sci. 849, 299–306.
Wise, K. S., and Foecking, M. F.(2006). Distinctive repertoire of contingency genes conferring mutation- based phase variation and combinatorial expression of surface lipoproteins in Mycoplasma capricolum subsp. capricolum of the Mycoplasma mycoides phylogenetic cluster." J Bacteriol 188(13): 4926-41.
Wise, K.S., Kim, M.F., Theiss, P.M., and Lo, S.C., (1993). A family of strain-variant surface lipoproteins of Mycoplasma fermentans. Infect. Immun. 61, 3327-3333.
Woese, C. R. (1987). Bacterial evolution. Microbiol. Rev. 51:221-271.
152
Woubit Salah (2008). Utilisation d’une séquence complète du génome d’une souche de Mycoplasma mycoides subsp. mycoides LC pour la mise au point de tests de diagnostic, application à l’expression de gènes hétérologues. Le titre de Doctoeur de L’Institut National Polytechnique de Toulouse PhD Ecole doctorale: Sevab Science Veterinaire
Woubit, S., Manso-Silvan, L., Lorenzon, S., Gaurivaud, P., Poumarat, F., Pellet, M.P., Singh, V.P., and Thiaucourt, F. (2007). A PCR for the detection of Mycoplasmas belonging to the Mycoplasma mycoides cluster: Application to the diagnosis of contagious agalactia. Mol Cell Probes 21, 391-399.
Yaya , A., Golsia, R., Hamadou, B., Amaro, A. and Thiaucourt, F. (1999). Comparative trial of two vaccinal strains for CBPP, T1/44 and T1sr, in Cameroon. Rev. Elev.
Med. Vet. Pays Trop. 52, 171-179.
Yaya A., Hamadou B., Yaya D., Abdoulkadiri S., and Thiaucourt F., (2000). Inoculation expérimentale de l'agent de la péripneumonie contagieuse bovine à des chèvres, Rev Elev Med Vet Pays Trop. 53 319-324.
Yaya, Aboubakar, Manso-Silv´an Lucía, Blanchard Alain, and Thiaucourt François (2008). Genotyping of Mycoplasma mycoides subsp. mycoides SC by multilocus sequence analysis allows molecular epidemiology of Contagious Bovine Pleuropneumonia . Vet. Res. (2008) 39:14.
Yogev, D., Menaker, D., Strutzberg, K., Levisohn, S., Kirchhoff, H., Hinz, K.-H., and Rosengarten, R., (1994). A surface epitope undergoing high-frequency phase variation is shared by Mycoplasma gallisepticum and Mycoplasma bovis. Infect. Immun., 62, 4962±4968.
Zhou, J., M. C. Enright, and B. G. Spratt (2000). Identification of the major Spanish clones of penicillin-resistant pneumococci via the Internet using multilocus sequence typing. J. Clin. Microbiol. 38:977–986.
153
AAPPPPEENNDDIIXX II
TISSUE SAMPLES COLLECTED FROM NORTHERN NIGERIA FOR MMSC ISOLATION
BOVINE SAMPLES
S/N STATES LUNGS PLEURAL FLUID
NASAL SWAB
EAR SWAB
1 PLATEAU 22 8 85 20 2 BAUCHI 7 5 23 4
3 KADUNA 9 - 28 15
4 KANO 5 - 19 5
5 KEBBI 6 1 17 8
TOTAL 49 14 172 52
OVINE SAMPLES
S/N STATES LUNGS PLEURAL FLUID
NASAL SWAB
EAR SWAB
1 PLATEAU 8 1 7 7
2 BAUCHI 1 - 2 2
3 KADUNA 2 - 11 2 4 KANO - - 4 -
5 KEBBI - - 2 -
TOTAL 13 1 26 11
154
AAPPPPEENNDDIIXX IIII
Estimated number of bulls and cows infected in outbreaks of CBPP in Northern
States of Nigeria
S/N STATE TOTAL
NO. OF
ANIMALS
NO. OF
MALES
TOTAL
NO.
POSITIVE
MALES
POSITIVE
FEMALES
POSITIVE
1 Adamawa *304/**257 68 8 2 6
2 Bauchi 154 61 50 24 26
3 Borno 96 17 2 0 2
4 Gombe 18 3 9 1 8
5 Jigawa 135 52 18 3 15
6 Kaduna 313 81 39 17 22
7 Kano 215 56 11 4 7
8 Katsina 74 N/A 0 N/A N/A
9 Plateau 591 117 72 27 50
10 Sokoto 108 38 4 0 4
11 Taraba 15 4 6 4 2
12 Kebbi 3 0 0
TOTAL 2026/1979 497 219 82 137
155
AAPPPPEENNDDIIXX IIIIII
Estimated infection rates of of CBPP bulls and cows in Northern States of Nigeria
NO STATE TOTAL %
INFECTION
BULLS %
INFECTION
COWS %
INFECTION
1 Adamawa 2.63 0.66 1.97
2 Bauchi 32.47 15.59 16.88
3 Borno 2.08 0 2.08
4 Gombe 50.5 5.61 44.89
5 Jigawa 13.33 2.22 11.11
6 Kaduna 12.46 5.43 7.03
7 Kano 5.12 1.86 3.26
8 Katsina 0 0 0
9 Plateau 13.54 4.75 8.79
10 Sokoto 3.7 0 3.7
11 Taraba 40.0 26.67 13.33
12 Kebbi 0 0 0
156
AAPPPPEENNDDIIXX IIVV
Preparation of broth and agar medium base for Mycoplasma cultures
Principle
The procedure consists in the preparation and sterilisation of a growth medium base, whether liquid (broth) or solid (agar), which will provide a complete culture medium after addition of the appropriate supplement.
This protocol is adapted from:
Provost, A. et al. (1987). Contagious bovine pleuropneumonia. Rev. Sci. Tech. Off int. Epiz. 6, (3), 625-679.
Freundt, E. A. (1983). Culture media for classic mycoplasmas. In Methods in
Mycoplasmology (I) 405-410. Edited by S. Razin and J. G. Tully: Academic Press.
III. Related documents
- Operating manuals for all materials used (Autoclave) - Operating procedure “Quality control of mycoplasma growth media” - Registration sheet
IV. Materials and methods
a) Materials
- Weighing scales - Glassware (a 3 L beaker, a 2 L bottle, twenty 100 ml bottles, graduated
cylinders) - Magnetic stirrer with heater - Autoclave
b) Reagents
- PPLO broth Difco (without crystal violet) - Milli-Q water - Agar noble Difco - Autoclaving control tape
c) Specific safety measures
- Risk of burning whilst manipulating hot products
d) Operating procedure
PPLO agar base (1.4 litres for 20 bottles)
1- Measure 1.4 litres of milli-Q water and transfer to a beaker with a capacity of 3 litres
2- Add a magnet and agitate on a magnetic stirrer, heating until it starts boiling
157
3- Weigh 20 g of agar noble Difco and add to the boiling water
4- Continue heating and agitation until the agar is completely molten (around 10-20 minutes)
5- Add 42 g of PPLO and let dissolve
6- When the mix acquires a translucent appearance, distribute 70 ml of the preparation (still liquid) into 100 ml bottles. Measure the volumes using a 100 ml cylinder and wear protective gloves to prevent skin burns.
7- Close the bottles, stick an autoclaving control tape on the lid and write on it the lot number with a permanent marker.
8- Fill in the registration sheet for production of growth media, indicating the reagents used for future reference.
9- Autoclave at 121°C for 20 minutes.
PPLO broth base (1.4 litres for 20 bottles)
1- Measure 1.4 litres of milli-Q water and transfer to a beaker with a capacity of 3 litres
2- Add 42 g of PPLO and let dissolve
3- Distribute 70 ml of the solution into 100 ml bottles
4- Close the bottles, stick an autoclaving control tape on the lid and write on it the lot number with a permanent marker
5- Fill in the registration sheet for production of growth media, indicating the reagents used for future reference
6- Autoclave at 121°C for 20 minutes
7- The quality of a lot of medium base must be tested at least once whenever a new lot of any of its ingredients is used
e) Storage
Media base may be conserved for up to 1 year at +4°C.
f) Comments - remarks
This protocol permits to obtain twenty bottles of base medium, which will provide, after supplementation, a final volume of 2 litres of ready-to-use culture medium.
Note that 30 ml of supplement are added to 70 ml of base, providing a final volume of 100 ml supplemented medium. For preparation of agar plates, melted base is cooled down to 60°C, supplemented as above and 25 ml doses are immediately added to 9 cm diameter Petri dishes.
158
AAPPPPEENNDDIIXX VVII
Preparation of supplement for mycoplasma culture medium
I. Aim and field of application
This protocol aims to describe the procedure for preparation of the supplement, which is a component of the growth medium used for the isolation of mycoplasmas.
II. Principle
The procedure consists in the preparation of a mixture of all the reagents that need to be added to the “medium base” in order to produce a complete culture medium.
This protocol is adapted from:
Provost, A. et al. (1987). Contagious bovine pleuropneumonia. Rev. Sci. Tech. Off int. Epiz. 6, (3), 625-679.
Freundt, E. A. (1983). Culture media for classic mycoplasmas. In Methods in
Mycoplasmology (I) 405-410. Edited by S. Razin and J. G. Tully: Academic Press.
III. Related documents
- Operating manuals for all materials used - Operating procedure “Preparation of fresh yeast extract” - Operating procedure “Quality control of mycoplasma growth media” - Registration sheet
V. Materials and methods
a) Materials
- Water bath - Weighing scales - Glassware (a 2 L bottle, graduated cylinders) - 0.22 µm filter units - Horizontal flux hood - Sterile 50 ml “Falcon” tubes
b) Reagents
- Horse serum tested for mycoplasma culture - Fresh yeast extract tested for mycoplasma culture - Milli-Q water - D-glucose - Sodium pyruvate - Ampicillin
159
c) Specific safety measures
- No identified risks
d) Operating procedure
1- The previous day, defrost two bottles of 500 ml horse serum and one bottle of 250 ml fresh yeast extract
2- De-complement the serum by incubating for 1 hour at 56°C
3- Prepare a solution of 250 ml milli-Q water, 10 g glucose, 20 g pyruvate and 2 g ampicillin.
4- Under a horizontal flux hood: Filter this solution through a 0.22 µm filter unit positioned over a 2 L bottle
5- Then filter the fresh yeast extract (250 ml) and finally the horse serum (1 L)
6- Mix well and distribute 30 ml doses into 50 ml “Falcon” tubes, annotating the lot number
7- Fill in the registration sheet for production of growth media, indicating the reagents used for future reference
9- Take one tube to test the sterility (compulsory) and the efficiency (whenever required)
10- The quality of a lot of supplement must be tested at least once whenever a new lot
of any of its ingredients is used
e) Storage
The supplement may be conserved for up to 1 year at -20°C.
f) Comments – remarks
This protocol permits to obtain fifty tubes of supplement, which will provide, after supplementation, a final volume of 5 litres of ready-to-use culture medium.
Note that each 30ml of supplement is added to 70ml medium base, producing a final volume of 100ml supplemented medium.
However, for isolation of fastidious species such as M. capricolum subsp. capripneumoniae, additional horse serum may be added (i. e.: 10 ml horse serum are added to the 100 ml supplemented medium).
Top Related