Download - Sect 6 Translation

Transcript
  • 8/11/2019 Sect 6 Translation

    1/21

    Gene Expression: Translation

  • 8/11/2019 Sect 6 Translation

    2/21

    Reminder

    Genes that encode proteins are transcribed and the transcript isprocessed to make mRNA.

    Next the base sequence in the mRNA must be translated into aminoacid sequences in a polypeptide.Once polypeptides are formed, they fold up and combine with othermolecules, but this is the realm of biochemistry, not genetics.

    Review structure of polypeptides; a protein consists of one or morepolypeptides.

  • 8/11/2019 Sect 6 Translation

    3/21

  • 8/11/2019 Sect 6 Translation

    4/21

    The 20 Amino AcidsImportantfeatures: Differ only inside chains Each has three-letter and one-letterabbreviations

    You shouldunderstand thatthe sequence ofamino acids in apolypeptide(protein) can be

    written twoways:Arg Thr Ser SerR T S S

    Polypeptideshave an N- and aC-terminal AA

    You dont have to memorize these but youdo have to know there are 20 and recognize

    amino acid sequences.

  • 8/11/2019 Sect 6 Translation

    5/21

    The Genetic CodeThe code is:

    Written in RNA becauseit is the mRNA sequencethat is read.

    Universal (almost)Exceptions (small):Vertebrate mitochondriaInvertebrate mitochondriaChloroplastsCiliate nuclear

    Mycoplasma nuclear

    Candida nuclearetc.

    Triplet Nonoverlapping Commaless Degenerate

  • 8/11/2019 Sect 6 Translation

    6/21

    The Genetic CodeThe code is:

    Universal (almost) Triplet Degenerate Nonoverlapping Commaless

    CACCAUGGUGCACCUGACUCCUGAGCACUAAGCU

    Quadruplet: AUGGUGCACCUGACUC

    Comma: AUGCCGUGCCCACCCUGG

    Overlaping: AUGGUGCACCUGACUC

  • 8/11/2019 Sect 6 Translation

    7/21

    The Genetic Code

    CACCAUGGUGCACCUGACUCCUGAGCACUAAGCU

    Met Val His Leu Thr Pro Glu . His StopStart

    UAA, UAG, and UGA arenonsense codons; they do notcode for any amino acid andhence are stop ortermination codons.

    All the rest are sense codons.

    AUG is the start codon andcodes for methionine (Met,M).(only one to memorize)

  • 8/11/2019 Sect 6 Translation

    8/21

    Open Reading Frames

    CACCAUGGUGCACCUGACUCCUGAGCACUAAGCU

    Met Val His Leu Thr Pro Glu . His StopStart

    An open reading frame (ORF ) is a string of sense codonsstarting with the start codon ATG and flanked at the 3 endby a stop codon.

    All genes that code for proteins must have an ORF.

  • 8/11/2019 Sect 6 Translation

    9/21

    Using Open ReadingFrames to Find Genes

    CACCAUGGUGCACCUGACUCCUGAGCACUAAGCU

    Met Val His Leu Thr Pro Glu . His StopStart

    A computer program can search a sequence of bases for open readingframes. These are candidates for genes encoding proteins.

    Problems:

  • 8/11/2019 Sect 6 Translation

    10/21

    Using Open Reading Frames to Find Genes

    A computer program can search a sequence of bases for open readingframes. These are candidates for genes encoding proteins.

    Problems:

    A gene can be on either strand, but the sequence is only written for one strand.Solution: search both complementary sequences.

    A random sequence of bases can have an ORF. Partial solutions: look for longORFs starting with ATG.

    Introns can interrupt ORFs. The introns are spliced out of the mRNA leavingonly the exons which form a continuous ORF; but DNA sequences will still havethe introns. Partial solution: look for sequences that often flank introns.

    Designing computer programs to seach complete genome sequences is a majorproblem in bioinformatics.

  • 8/11/2019 Sect 6 Translation

    11/21

    The Mechanics of Translation1. Translation requires:

    Small ribosomal subunit = SSUrRNA + ribosomal proteins Large ribosomal subunit = LSUrRNA + ribosomal proteins +5SrRNA (eukaryotes)

    (Small and large subunits also have S names: 16S, 18S, 23S, etc. Sis for Svedberg units describing how fast something moves in acentrifugal field.)

    Aminoacyl tRNAs = transfer RNAs + amino acids Accessory proteins that promote various steps2. mRNA is translated 5 to 33. Polypeptide is made N-terminal to C-terminal

  • 8/11/2019 Sect 6 Translation

    12/21

    Cellular Sites of Transcription Translation

    After eukaryotic nuclear genes aretranscribed and processed, themRNA must be moved to thecytoplasm for translation.

    Prokaryotic genes, and those in the

    chloroplasts and mitochondria, arenot separated from the sites ofprotein synthesis. Transcriptionand translation proceedsimultaneously.

    mitochondria

    genes

    mRNAprotein mRNA

    chloroplast

  • 8/11/2019 Sect 6 Translation

    13/21

    Making Aminoacyl tRNAs

    Each tRNA has a specific basesequence, including an anticodonthat can base pair with a codon.

  • 8/11/2019 Sect 6 Translation

    14/21

    A A A A A U

    U U U U U A

    AsnLys

    A A A A A U

    U U U U U A

    AsnLys

    A A A A A U

    U U U

    Asn

    Lys

    Asn

    U U A

    U U A An aminoacyl tRNA synthase recognizes atRNA and its corresponding amino acid and

    joins them.

    The anticodon on the aminoacyl tRNA base-pairs with its codon on the mRNA.

    A new peptide bond is formed to join theamino acids.

  • 8/11/2019 Sect 6 Translation

    15/21

    Wobble

    There are 61 sense codons.However, organisms may not have 61 different tRNAs.

    1st (5) base in anticodon can sometimes pair with 2 or 3 bases :

    pairs with 3 rd (3) base in codon5 anticodon base E. coli S. cerevisiae

    A U -C G GU A or G AG C or U C or U

    Inosine A, C, or U C or U

    Dont need to memorize these; just know basic principle .

  • 8/11/2019 Sect 6 Translation

    16/21

    Translation in More Detail than You Wanted or Need to Know(see text Figure 10.17 for a better diagram)

    $$

    ribosomesmallsubunit

  • 8/11/2019 Sect 6 Translation

    17/21

    Ribosome Binding, Translation Initiation, andTermination Signals on mRNAs

    Prokaryotes: a special sequence (the Shine-Delgarno sequence) isthe ribosome binding site.

    Eukaryotes: the 5 end of the mRNA is modified to form the 5 capthat initiates ribosome binding.

    Prokaryotes and eukaryotes: the AUG start codon is the signal toinitiate translation; the nonsense stop codon binds no tRNA and thisstops translation.

  • 8/11/2019 Sect 6 Translation

    18/21

    5 UTR 3 UTR

  • 8/11/2019 Sect 6 Translation

    19/21

    Unique Features of Translation in ProkaryotesOne mRNA can encode more than one polypeptide.

    ! 2

  • 8/11/2019 Sect 6 Translation

    20/21

    Unique Features of Translation in Prokaryotes

    Translation of an mRNA can begin before transcription iscomplete, because these processes are not separated by anuclear membrane.

  • 8/11/2019 Sect 6 Translation

    21/21