8/6/2019 Role of Rbm3 Gene in Cancer
1/41
1
CHAPTER 1
INTRODUCTION
8/6/2019 Role of Rbm3 Gene in Cancer
2/41
2
1. INTRODUCTION
Cancer is one of the most common causes of disease and death in the western world. In general,
incidence rates increase with age for most forms of cancer. As human populations continue to live
longer, due to an increase of the general health status, cancer may affect an increasing number of
individuals. The cause of most common cancer types is still largely unknown, although there is an
increasing body of knowledge providing a link between environmental factors (dietary, tobacco
smoke, UV radiation etc) as well as genetic factors (germ line mutations in "cancer genes" such as
p53, APC, BRCA1, XP etc) and the risk for development of cancer.
No definition of cancer is entirely satisfactory from a cell biological point of view, despite the fact
that cancer is essentially a cellular disease and defined as a transformed cell population with net cell
growth and anti-social behavior. Malignant transformation represents the transition to a malignant phenotype based on irreversible genetic alterations. Although this has not been formally proven,
malignant transformation is believed to take place in one cell, from which a subsequently developed
tumor originates (the "clonality of cancer" dogma). Carcinogenesis is the process by which cancer is
generated and is generally accepted to include multiple events that ultimately lead to growth of a
malignant tumor. This multi-step process includes several rate-limiting steps, such as addition of
mutations and possibly also epigenetic events, leading to formation of cancer following stages of
precancerous proliferation. The stepwise changes involve accumulation of errors (mutations) in vital
regulatory pathways that determine cell division, asocial behavior and cell death. Each of these
changes may provide a selective Darwinian growth advantage compared to surrounding cells,
resulting in a net growth of the tumor cell population. A malignant tumor does not only necessarily
consist of the transformed tumor cells themselves but also surrounding normal cells which act as a
supportive stroma. This recruited cancer stroma consists of connective tissue, blood vessels and
various other normal cells, e.g., inflammatory cells, which act in concert to supply the transformed
tumor cells with signals necessary for continued tumor growth.
The most common forms of cancer arise in somatic cells and are predominantly of epithelial origin,
e.g., prostate, breast, colon, urothelial and skin, followed by cancers originating from the
hematopoetic lineage, e.g., leukemia and lymphoma, neuroectoderm, e.g., malignant gliomas, and
soft tissue tumors, e.g., sarcomas.
8/6/2019 Role of Rbm3 Gene in Cancer
3/41
3
Breast cancer is the second most common form of cancer worldwide and by far the most frequent
cancer of women. Data from the GLOBOCAN 2002 database presented by Parkinrevealed 1.15
million new cases in 2002 and 0.41 million deaths during the same period (Parkin D M. et al. 2005).
If detected at an early stage, the prognosis is relatively good for a patient living in a developed
country, with a general five-year survival rate of 73%, compared to 57% in a developing country.The incidence is slowly increasing and about one in every nine women in the developed world is
believed to get breast cancer in her lifetime. Although lifestyle changes related to female steroid
hormones, including exposure to exogenous hormones, affect the risk of developing breast cancer,
these factors only make up for a small fraction of the etiology, and the benefit of preventive
manipulation is believed to be low. The decreased mortality is mainly due to earlier detection by
mammography screening and the use of modern adjuvant systemic treatment
The gene encoding RNA binding motif protein 3 (RBM3) was initially isolated from fetal brain
tissue (Derry J M et al. 1995). RBM3 is upregulated early in response to cold-shock (Danno S et
al.1997) and may protect against certain cell death pathways (Kita H et al. 2002). The RBM3 gene is
together with two other RNA binding proteins, RBMX and RBM10, all located on the X-
chromosome. A recent study revealed a significant association between expression of the X-
chromosome related RBM-genes and the proapoptoticBax gene in breast cancer tissue (Martinez-
Arribas F et al. 2006). Another protein identified with RBM domains is RBM5/LUCA15, which is
reported to play a role during cell proliferation and apoptosis and has been found down regulated in
both lung and breast cancer (Mourtada-Maarabouni M. et al. 2006).
Using cDNA selection with a YAC from the Xp11.2 region, scientists have identified a novel gene
(RBM3) thatencodes a polypeptide with high sequence similarityto a group of proteins that bind to
RNA. On a YACcontig map, RBM3 is located between OATL1 andGATA1/TFE3 in sub-band
Xp11.23, and gives rise toalternatively spliced transcripts in a variety of humantissues. The longest
open reading frame encodes a157 amino acid protein with a predicted molecularweight of 17 kDa.Its putative RNA-binding domainmost closely resembles that of two previously characterizedhuman
RNA-binding proteins, YRRM, the genefor which has been implicated in azoospermia, andhnRNP
G, a glycoprotein, also identified as an autoantigen.The homology of RBM3 in bothsequenceand size
to an RNA binding protein from maize, AAIP,suggests that it functions in a fundamental
pathwayconserved from plants to mammals(Derry JM. Kerns JA. et al)
8/6/2019 Role of Rbm3 Gene in Cancer
4/41
4
CHAPTER 2
Review of literature
8/6/2019 Role of Rbm3 Gene in Cancer
5/41
5
2.1. Location of RBM-3 gene
The Official Symbol of RBM3 is provided by HGNC (HUGO Gene Nomenclature Committee)& its
official Full NameRNA binding motif (RNP1, RRM) protein-3 is been provided by HGNCPrimary.
Its Gene type is protein coding.RBM-3 is also known as RNPL; IS1-RNPL. Molecular Weightof
gene is 17170 Da. It is found on Chromosome X at location of Xp11.2.This gene is a member of the
glycine-rich RNA-binding protein family and encodes a protein with one RNA recognition motif
(RRM) domain. Expression of this gene is induced by cold shock and low oxygen tension. A
pseudogene exists on chromosome 1. Multiple alternatively spliced transcript variants that are
predicted to encode different isoforms have been characterized although some of these variants fit
nonsense-mediated decay (NMD) criteria.
8/6/2019 Role of Rbm3 Gene in Cancer
6/41
6
Chromosome X - NC_000023.10
Homo sapiens chromosome X, GRCh37.p2 primary reference assembly
gi|224589822|ref|NC_000023.10|
8/6/2019 Role of Rbm3 Gene in Cancer
7/41
7
48,432,240 : 48,437,398 (5,159 bases shown, positive strand)
Protein Sequence 157AA NP_006734.1
MSSEEGKLFVGGLNFNTDEQ ALEDHFSSFG PISEVVVVKD
RETQRSRGFGFITFTNPEHA SVAMRAMNGE
SLDGRQIRVD HAGKSARGTRGGGFGAHGRG RSYSRGGGDQ
GYGSGRYYDS RPGGYGYGYG RSRDYNGRNQGGYDRYSGGN
YRDNYDN
8/6/2019 Role of Rbm3 Gene in Cancer
8/41
8
DNA Sequence Open Reading Frame: 140 to
613 NM_006743.3
GGGAACGTTC CGGGACGTTC TCGCTACGTA CTCTTTATCA
ATCGTCTTCCGGCGCAGCCC CGTCCCTGTT TTTTGTGCTC
CTCCGAGCTCGCTGTTCGTC CGGGTTTTTT ACGTTTTAATTTCCAGGACT TGAACTGCCA TGTCCTCTGA AGAAGGAAAG
CTCTTCGTGGGAGGGCTCAA CTTTAACACC GACGAGCAGG
CACTGGAAGA CCACTTCAGC AGTTTCGGAC CTATCTCTGA
GGTGGTCGTTGTCAAGGACC GGGAGACTCAGCGGTCCAGG
GGTTTTGGTT TCATCACCTT CACCAACCCAGAGCATGCTT
CAGTTGCCAT GAGAGCCATG AACGGAGAGT CTCTGGATGG
TCGTCAGATC CGTGTGGATC ATGCAGGCAAGTCTGCTCGG
GGAACCAGAGGAGGTGGCTT TGGGGCCCAT GGGCGTGGTC
GCAGCTACTC TAGAGGTGGT GGGGACCAGGGCTATGGGAG
TGGCAGGTAT TATGACAGTCGACCTGGAGGGTATGGATAT
GGATATGGACGTTCCAGAGA CTATAATGGC AGAAACCAGG
GTGGTTATGA CCGCTACTCAGGAGGAAATT ACAGAGACAA
TTATGACAAC TGAAATGAGA CATGCACATA ATATAGATAC
ACAAGGAATA ATTTCTGATC CAGGATCGTC CTTCCAAATG
GCTGTATTTA TAAAGGTTTT TGGAGCTGCA CCGAAGCATC
TTATTTTATAGTATATCAAC CTTTTGTTTT TAAATTGACC
TGCCAAGGTAGCTGAAGACC TTTTAGACAG TTCCATCTTT
TTTTTTAAAT TTTTTCTGCC TATTTAAAGA CAAATTATGG
GACGTTTGTAGAACCTGAGT ATTTTTCTTT TTACCAGTTT
TTTAGTTTGAGCTCTTAGGT TTATTGGAGC TAGCAATAAT
TGGTTCTGGC AAGTTTGGCC AGACTGACTT CAAAAAATTA
ATGTGTATCC AGGGACATTT TAAAAACCTG TACACAGTGT
TTATTGTGGT TAGGAAGCAA TTTCCCAATG TACCTATAAG
AAATGTGCAT CAAGCCAGCC TGACCAACAT GGTGAAACCC
CATCTGTACT AAACATAAAA AAATTAGCCTGGCATGGTGG
TGTACGCCTG TAATCCCAGT GACTTGGGAGGCTGAGGCAG
GAGAATCGCT TGAACCCGGG AGGCGGAGGT TGCAGTGAGC
TAAGATCGCG CCACTGTACT CCAGCCTGGG CAACAGCGAG
ACTCCATCTC AAAAAAAAAGGAAATGTGTA TCAAGAACAT
GATTATCCAG CGGTATTTTC TAATTCAGAT CATCAAACTG
ATTATATAGA AGAGTTGGCT TTAAAATGTT TGCAAATGTC
TTTTTTTTTT TAATACTGGA AGAAAAAATA TTCTGTTGTG
TCTCATACAG TGCTTAGGATGTCTTTCACAGAGCTTATTA
AAAAGATGAA ACCTGAGAAC AAACTGCTTT ATTCTTACTC
AGCCCATTTTGCAAATTAAA AGTGGGGGCAGAGGTGGGCG
GATCACCTGA GGTCAGGAGT TCGAGACCAG CCTGGCCAAC
8/6/2019 Role of Rbm3 Gene in Cancer
9/41
9
AGGGCAAAAC CCCATCTCTA CTAAAAAT
2.2. Gene profiling based on following case studies
y Promoter-sharing by different genes in human genome CPNE1and
RBM12 gene pair as an example.
8/6/2019 Role of Rbm3 Gene in Cancer
10/41
10
Regulation of gene expression plays important role in cellular functions. Coregulation of different
genes may indicate functional connection or even physical interaction between gene products. Thus
analysis on genomic structures that may affect gene expression regulation could shed light on the
functions of genes.
In a whole genome analysis of alternative splicing events, we found that two distinct genes,copine I
(CPNE1) and RNA binding motifprotein 12 (RBM12), share the most 5' exons and therefore the
promoter region in human. Further analysis identified many gene pairs in human genome that share
the same promoters and 5' exons but have totally different coding sequences. Analysis of genomic
and expressed sequences, either cDNAs or expressed sequence tags (ESTs) forCPNE1 andRBM12,
confirmed the conservation of this phenomenon during evolutionary courses. The coexpression of
the two genes initiated from the same promoter is confirmed by ReverseTranscription-Polymerase
Chain Reaction (RT-PCR) in different tissues in both human and mouse.High degrees of sequence
conservation among multiple species in the 5'UTR region common toCPNE1 andRBM12 were also
identified.
Promoter and 5'UTR sharing between CPNE1 and RBM12 is observed in human, mouse and
zebrafish. Conservation of this genomic structure in evolutionary courses indicatespotential
functional interaction between the two genes. More than 20 other gene pairs in humangenome were
found to have the similar genomic structure in a genome-wide analysis, and it mayrepresent a unique
pattern of genomic arrangement that may affect expression regulation of thecorresponding
genes.(Wanling Yang,et al.2008)
y Analysis of the retinal gene expression profile after hypoxic
preconditioning identifies candidate genes for neuroprotection.
Retinal degeneration is a main cause of blindness in humans. Neuroprotectivetherapies may be used
to rescue retinal cells and preserve vision. Hypoxic preconditioningstabilizes the transcription factor
HIF-1 in the retina and strongly protects photoreceptors in ananimal model of light-induced retinal
degeneration. To address the molecular mechanisms of theprotection, we analyzed the transcriptome
of the hypoxic retina using microarrays and real-timePCR.
8/6/2019 Role of Rbm3 Gene in Cancer
11/41
11
Hypoxic exposure induced a marked alteration in the retinal transcriptome withsignificantly different
expression levels of 431 genes immediately after hypoxic exposure. Thenormal expression profile
was restored within 16 hours of reoxygenation. Among the differentiallyregulated genes, several
candidates for neuroprotection were identified like metallothionein-1 and-2, the HIF-1 target gene
adrenomedullin and the gene encoding the antioxidative andcytoprotective enzyme paraoxonase 1which was previously not known to be a hypoxia responsivegene in the retina. The strongly
upregulatedcyclin dependent kinase inhibitor p21 was excludedfrom being essential for
neuroprotection.
Our data suggest that neuroprotection after hypoxic preconditioning is the result ofthe differential
expression of a multitude of genes which may act in concert to protect visual cellsagainst a toxic
insult(Markus Thierschet al.2008).
y Molecular processes during fat cell development revealed by gene
expression profiling and functional annotation.
Large-scale transcription profiling of cell models and model organisms can identifynovel molecular
components involved in fat cell development. Detailed characterization of thesequences of identified
gene products has not been done and global mechanisms have not beeninvestigated. We evaluated
the extent to which molecular processes can be revealed by expressionprofiling and functional
annotation of genes that are differentially expressed during fat celldevelopment.
Mouse microarrays with more than 27,000 elements were developed, and transcriptionalprofiles of
3T3-L1 cells (pre-adipocyte cells) were monitored during differentiation. In total, 780differentially
expressed expressed sequence tags (ESTs) were subjected to in-depth bioinformaticsanalyses. The
analysis of 3'-untranslated region sequences from 395 ESTs showed that 71% of thedifferentially
expressed genes could be regulated by microRNAs. A molecular atlas of fat celldevelopment was
then constructed by de novofunctional annotation on a sequence segment/domain-wise basis of 659
protein sequences, and subsequent mapping onto known pathways,possible cellular roles, and
subcellular localizations. Key enzymes in 27 out of 36 investigatedmetabolic pathways were
regulated at the transcriptional level, typically at the rate-limiting steps inthese pathways. Also,
coexpressed genes rarely shared consensus transcription-factor bindingsites, and were typically not
8/6/2019 Role of Rbm3 Gene in Cancer
12/41
12
clustered in adjacent chromosomal regions, but were instead widelydispersed throughout the
genome.
Large-scale transcription profiling in conjunction with sophisticated bioinformaticsanalyses can
provide not only a list of novel players in a particular setting but also a global view onbiological
processes and molecular networks (Hubert Hacklet al. 2005).
y Discovery and validation of colonic tumor-associated proteins via
metabolic labeling and stable isotopic dilution.
The unique biology of a neoplasm is reflected by its distinct molecular profile compared with normal
tissue. To understand tumor development better, we have undertaken a quantitative proteomic search
for abnormally expressed proteins in colonic tumors from ApcMin/ (Min) mice. By raising pairs of
Min and wild-type mice on diets derived from natural-abundance or 15Nlabeled algae, we used
metabolic labeling to compare protein levels in colonic tumor versus normal tissue. Because
metabolic labeling allows internal control throughout sample preparation and analysis, technical
error is minimized as compared with in vitro labeling. Several proteins displayed altered expression,
and a subset was validated via stable isotopic dilution using synthetic peptide standards. We also
compared gene and protein expression among tumor and nontumor tissue, revealing limited
correlation. This divergence was especially pronounced for species showing biological change,
highlighting the complementary perspectives provided by transcriptomics and proteomics. Our work
demonstrates the power of metabolic labeling combined with stable isotopic dilution as an integrated
strategy for the identification and validation of differentially expressed proteins using rodent models
of human disease (Edward L. Huttlin).
2.3. Functions
8/6/2019 Role of Rbm3 Gene in Cancer
13/41
13
y Nuclear expression of the RNA-binding protein RBM3 is associated with an improved
clinical outcome in breast cancer
Single-strand RNA-binding proteins (RBPs) are involved in many aspects of RNA metabolism and
in the regulation of gene transcription. The RBP RBM3 was recently suggested to be a proto-
oncogene in colorectal cancer; however, such a role has not been corroborated by previous studies in
the colon or other tumor types, and the prognostic implications of tumor-specific RBM3 expression
remain unclear. Mono-specific antibodies against RBM3 were generated. Antibody specificity was
confirmed using siRNA gene silencing, western blotting and immunohistochemistry on a panel of
breast cancer cell lines. Using tissue microarrays and IHC, RBM3 protein expression was examined
in 48 normal tissues and in 20 common cancers. Additional analysis in two independent breast
cancer cohorts (n=1016) with long-term follow-up was also carried out. RBM3 was upregulated in
cancer compared to normal tissues. The nuclear expression of RBM3 in breast cancer was associated
with low grade (P
8/6/2019 Role of Rbm3 Gene in Cancer
14/41
14
mediated down-regulation of the cold shock protein (CSP) encoding mRNAs dramatically attenuates
cell survival in the absence of any heat application. Furthermore, we also demonstrate that knocking
down the CSPs can enhance the therapeutic response of prostate cancer cells to chemotherapy. Our
findings suggest that down-regulating CSPs in cancer cells may "mimic" the stress response the cells
experience when exposed to heat treatment rendering them more susceptible to therapy. Thus, thepharmacological modulation of RBM3 and CIRBP may represent novel therapeutic approaches for
prostate cancer (Zeng Y, et al. 2009).
y Translation regulatory factor RBM3 is a proto-oncogene that prevents mitotic
catastrophe
RNA-binding proteins play a key role in post-transcriptional regulation of mRNA stability and
translation. We have identified that RBM3, a translation regulatory protein, is significantly
upregulated in human tumors, including a stage-dependent increase in colorectal tumors. Forced
RBM3 overexpression in NIH3T3 mouse fibroblasts and SW480 human colon epithelial cells
increases cell proliferation and development of compact multicellular spheroids in soft agar
suggesting the ability to induce anchorage-independent growth. In contrast, downregulating RBM3
in HCT116 colon cancer cells with specific siRNA decreases cell growth in culture, which was
partially overcome when treated with prostaglandin E(2), a product of cyclooxygenase (COX)-2
enzyme activity. Knockdown also resulted in the growth arrest of tumor xenografts. We have also
identified that RBM3 knockdown increases caspase-mediated apoptosis coupled with nuclear cyclin
B1, and phosphorylated Cdc25c, Chk1 and Chk2 kinases, implying that under conditions of RBM3
downregulation, cells undergo mitotic catastrophe. RBM3 enhances COX-2, IL-8 and VEGF mRNA
stability and translation. Conversely, RBM3 knockdown results in loss in the translation of these
transcripts. These data demonstrate that the RNA stabilizing and translation regulatory protein
RBM3 is a novel proto-oncogene that induces transformation when overexpressed and is essential
for cells to progress through mitosis (Sureban SM, et al. 2008).
8/6/2019 Role of Rbm3 Gene in Cancer
15/41
15
Fig - RBM3 and HuR are overexpressed in tumors. (a) RBM3 and HuR gene expression in tumor
and surrounding uninvolved tissues. Significant induction of RBM3 mRNA expression was observedin stages 24, whereas HuR was induced only in stage 1. * denote statistically significant differences
(*P
8/6/2019 Role of Rbm3 Gene in Cancer
16/41
16
8/6/2019 Role of Rbm3 Gene in Cancer
17/41
17
Fig - RBM3 overexpression induces oncogenic transformation. (a) Proliferation of three independent
NIH3T3-RBM3 clones were significantly higher than that observed with three independent NIH3T3-
vector clones. (b) NIH3T3-RBM3 cells develop large colonies in soft agar, which are bigger than
those formed by HT-29 cells. HuR overexpressing cells, on the other hand did not form any colonies
in the soft agar. (c) Quantitative estimation of number of colonies formed in soft agar (*P
8/6/2019 Role of Rbm3 Gene in Cancer
18/41
18
Fig - RBM3 is essential for tumor growth. (a) RBM3 specific siRNA (si-RBM3), but not a
scrambled siRNA (si-Scr) decreases RBM3 and COX-2 mRNA expression. * denote statistically
significant differences (**P
8/6/2019 Role of Rbm3 Gene in Cancer
19/41
19
Antitumor activity of si-RBM3 in mice carrying HCT116 cell tumor xenografts. HCT116 cells were
injected into the flanks of Ncr nude mice (five mice per group) and tumors were allowed to develop
for 15 days. siRNA was injected directly into the tumors starting on day 15 and every third day for a
total of five injections. Tumor sizes with standard error are shown from data collected at the time of
every injection. si-Scr treated tumors were larger than the control carrier injected tumors, whereas si-RBM3 treated tumors were smaller. A representative excised tumor at day 28 is shown to the right. *
denote statistically significant differences (*P
8/6/2019 Role of Rbm3 Gene in Cancer
20/41
20
Fig - RBM3 downregulation results in mitotic catastrophe. (a) siRNAdownregulation of RBM3
increased cells in the G2/M phase. HCT116 cells were transfected at the indicated dose of either
scrambled (si-Scr) or RBM3-specific (si-RBM3) siRNA for 72 h. Cell-cycle profiles were analysed
by flow cytometry following PI staining for DNA content. The percentage of cells in the G2/M
phase following si-RBM3 transfection was increased compared to control and si-Scr cells. Addition
of PGE2 partially suppressed the RBM3 siRNA-mediated effects. (b) Knockdown of RBM3 leads to
apoptosis. HCT116 cells following siRNA transfection were stained by the TUNEL method. Arrows
show the TUNEL-positive cells, which were higher in si-RBM3 transfected cells, but less in cells
also treated with 1 M PGE2. (c) Loss of RBM3 induces checkpoint proteins. Lysates from HCT116
cells treated with si-Scr (50 nM) or si-RBM3 (10 and 50 nM), and tumor xenografts from the various
treatments were subjected to western blot analyses using specific antibodies for phospho-Ser345
Chk-1, phospho-Thr68 Chk-2, Cdc25C, phospho-Ser15 p53 and cyclin B1. Actin was used as an
internal control for loading the gels. (d) Lack of RBM3 increases cyclin B1 translocation to nucleus.
Tumor xenografts were subjected to immunohistochemical staining for cyclin B1. The arrows in the
si-RBM3 treated tumors indicate cyclin B1-positive cells in the nucleus. Representative photographs
are a magnification of 400. (e) RBM3 depletion leads to mitotic catastrophe. Tumors treated with
8/6/2019 Role of Rbm3 Gene in Cancer
21/41
21
si-RBM3 were stained for TUNEL (green) and phosphorylated histone H3 (red). The cells positive
for both are shown in the merged image with yellow stain. DAPI is used to stain the nucleus. COX,
cyclooxygenase; PGE2, prostaglandin E2; RTPCR, reverse transcriptionpolymerase chain
reaction; siRNA, short interfering RNA; VEGF, vascular endothelial growth factor.
8/6/2019 Role of Rbm3 Gene in Cancer
22/41
22
Fig - RBM3 and HuR interact and enhance stability. (a) Yeast two-hybrid interaction of RBM3 with
HuR. RBM3 and HuR expressed as bait and test proteins interact in the yeast by the colonies formed
on quadruple dropout media. Breakdown of the X--gal results in a blue colony. Tumor suppressor
protein p53 and SV40 T antigen (RecT) were used as positive control for interaction, but negative
for interaction with either RBM3 or HuR. (b) GST pull-down assay. 35S-methionine labeled in vitro
translated HuR (35S-HuR) was incubated with either GST-RBM3 or GST-HuR. The GST-proteins
8/6/2019 Role of Rbm3 Gene in Cancer
23/41
23
were immobilized on to glutathione sepharose beads. The immobilized proteins were separated by
SDSPAGE and subjected to phosphorimager analyses. Pure GST served as negative control. (c).
Colocalization of HuR and RBM3. HeLa cells were transiently transfected with plasmids expressing
myc-epitope tagged HuR and FLAG-epitope tagged RBM3. Immunocytochemistry was performed
for the myc and FLAG epitopes. Images for the HuR and RBM3 were merged demonstratingcolocalization. Nucleus was stained by DAPI. (d) Nuclear-cytoplasmic shuttling of HuR and RBM3.
Plasmids encoding FLAG-epitope tagged HuR or RBM3 were transiently transfected into human
HeLa cells and subsequently fused with mouse NIH3T3 cells. The proteins were immunostained for
the FLAG tag, and the nuclei by Hoescht stain to differentiate human and mouse nuclei. Mouse
nuclei, seen as punctuate staining are denoted by an arrow. (e) RBM3 and HuR induce COX-2, IL-8
and VEGF mRNA expression. Ectopic expression of Flag epitope-tagged RBM3 and HuR resulted
in significant increase in endogenous COX-2, IL-8 and VEGF mRNA in HCT116 cells. There was a
trend for even higher levels when proteins were coexpressed (**P
8/6/2019 Role of Rbm3 Gene in Cancer
24/41
24
Fig - RBM3 overexpression increases COX-2 mRNA stability and translation. (a) RBM3 is an ARE-
binding protein. The first 60 nucleotides of COX-2 3UTR containing many ARE sequences was
transcribed in vitro in the presence of 32P-UTP. Purified recombinant GST-RBM3 was allowed to
interact with the radiolabeled RNA and subsequently separated by native PAGE. Presence of the
RBM3 bound RNA is shown by a mobility shift as indicated to the right. (b) Increased binding of
COX-2, IL-8 and VEGF mRNA to RBM3 following overexpression. Whole cell extracts (T) from
vector transfected or RBM3 overexpressing cells were prepared after cross-linking, and subjecting to
immunoprecipitation with anti-RBM3 antibody. RNA present in the immunoprecipitate (P) and
supernatant (S) were isolated after reversing the cross-link and subjected to RTPCR for COX-2, IL-
8/6/2019 Role of Rbm3 Gene in Cancer
25/41
25
8 and VEGF mRNA. Data demonstrates increased COX-2, IL-8 and VEGF mRNA in the pellet of
RBM3 overexpressing cells. (c) RBM3 and HuR increase COX-2, IL-8 and VEGF mRNA stability.
HCT116 cells were transfected with Flag epitope-tagged RBM3 and/or HuR and the stability of
endogenous transcripts was determined following addition of actinomycin D. Both RBM3 and HuR
increased COX-2 (left panel), IL-8 (middle panel) and VEGF (right panel) mRNA stability on theirown, which was further increased when the two were coexpressed. (d) Schematic representation of
control luciferase mRNA (Luc) and luciferase mRNA containing the full-length COX-2 3UTR
(Luc-COX) that is encoded in the plasmid under the control of the CMV promoter. (e) RBM3 and
HuR increase the translation of Luc mRNA containing COX-2 3UTR. HCT116 cells transiently
overexpressing RBM3, HuR or both were co-transfected with plasmids encoding either the Luc-
COX and luciferase activity was measured. Luciferase activity of Luc-COX is shown in black bars
and is relative to control cells. * denote statistically significant differences (**P
8/6/2019 Role of Rbm3 Gene in Cancer
26/41
26
siRNA-mediated RBM3 knockdown reduced cell viability and finally led to cell death, which
did not involve caspase-3-mediated apoptosis, cell cycle arrest, or COX-2 regulation. In
contrast, RBM3 over-expression rescued cells from death under serum starvation. This was
associated with increased translation rates, as measured by C serine and H phenylalanine
incorporation. Together, RBM3 is a critical factor providing cellular survival advantages in anadverse microenvironment presumably by restoring translation efficacy(Wellmann S, et al.2010)
2.4. DISEASE CAUSED BY RBM-3 GENE
Breast Cancer
Breast cancer is by far the most frequent cancer in women. Surgery is the primary curative treatmentfor breast cancer patients, often in combination with adjuvant therapy. However, adjuvant therapy is
associated with substantial costs and sometimes severe side effects, and physicians have identified
reduction of overtreatment as the major clinical need in breast cancer treatment today. Thus, the
stratification of patients into different prognostic categories is of great importance as it may aid
physicians in selecting the most appropriate treatment for a given patient. RBM3 was identified on
the Human Protein Atlas (proteinatlas.org) where it shows a weak expression pattern in normal
breast tissue, but a stratified pattern in tumor samples (see Figure A). In a recent publication,3
RBM3 protein expression was evaluated in 241 tumor samples from a cohort of 500 premenopausal
women with stage II invasivebreast cancer (see Figure B). RBM3 expressionwas associated with
small, low-grade, estrogenreceptor (ER)-positive tumors, and it is anindependent predictor of
recurrence freesurvival (RFS) in ER-positive patients. It couldbe concluded that RBM3 is a good
prognosismarker in breast cancer.
8/6/2019 Role of Rbm3 Gene in Cancer
27/41
27
Epithelial Ovarian Cancer
Epithelial ovarian cancer (EOC) is one of the most common forms of cancer worldwide, and a
leading cause of death from gynecological malignancy. Treatment with curative intent involves
surgery and postoperative platinum-based chemotherapy in combination with paclitaxel. However,
relapse is common, and side effects of platinum-based chemotherapy are severe. RBM3 protein
expression was evaluated in tumor samples from a cohort of 154 patients surgically treated for
primary invasive EOC.4 It was shown that RBM3 expression is weak in normal ovary tissue, butshows a stratified pattern in tumor samples (see Figure E). It could be concluded that RBM3 is a
prognostic marker that may aid physicians in determining which type of adjuvant treatment is
appropriate. This might mean a less intensive treatment for high-RBM3 patients with early-stage
cancer, and more intensive treatment for low-RBM3 patients (see Figure F).
8/6/2019 Role of Rbm3 Gene in Cancer
28/41
28
Colon Cancer
Colorectal cancer is one of the most common types of cancer, and it accounts for about 10% of
cancer deaths in Europe and the USA. Surgery is the only curative treatment today, but metastatic
disease is common and this hampers successful treatment. Currently, patients with advanced disease
are routinely given chemotherapy as adjuvant treatment. RBM3 protein expression was evaluated in
274 tumor samples from a cohort of 331 retrospectively identified cases from patients who
underwent curative resection for sigmoid colon cancer (see Figure G) (manuscript in preparation).
Immunohistochemical analysis of RBM3expression showed a differential expression in colon tumor
samples (see Figure H). It could be concluded that RBM3 is a prognostic marker that may aid in
determining if patients should receive adjuvant treatment, and also the treatmentintensity level.
8/6/2019 Role of Rbm3 Gene in Cancer
29/41
29
8/6/2019 Role of Rbm3 Gene in Cancer
30/41
30
2.5. CONSERVE SEQUENCE
Transcript: RBM3-009
This transcript is a product of RBM3 gene .There are 12 transcripts in this gene.
.Transcript summary
It contains 8 exons & its transcript length is 1,375 bps. It is a Known type processed transcript. It has
been predicted from manually annotated transcripts (determined on a case-by-case basis) from
the Havana project.
Transcript summary
StatisticsIt contains 6 exons & its transcript length is 1,130 bps& translation length is 157 residues. It
is a Known type processed transcript. This transcript is a member of the Human CCDS (consensus
coding sequence) set: CCDS14301. It has been predicted from manually annotated transcripts
(determined on a case-by-case basis) from the Havana project.
8/6/2019 Role of Rbm3 Gene in Cancer
31/41
31
Gene Tree (image)
Its a GeneTree of RBM3 gene. It contains 288 genes. Number of duplication nodes is 56& number
of ambiguous nodes15
8/6/2019 Role of Rbm3 Gene in Cancer
32/41
32
Variation Table
Summary of variations in ENSG00000102317 (RBM3) by consequence type
Number of variants Type Description
2 Synonymous coding In coding sequence, not
resulting in an amino acid
change
(silent mutation)
3 Upstream Within 5 kb upstream of the 5
prime end of a transcript3 5 prime UTR In 5 prime untranslated region
11 Non-synonymous coding In coding sequence and results
in an amino acid change in
the encoded peptide sequence
14 Downstream Within 5 kb downstream of the
3 prime end of a transcript
15 Essential splice site In the first 2 or the last 2
basepairs of an intron
25 Splice site 1-3 bps into an exon or 3-8 bps
into an intron
36 3 prime UTR In 3 prime untranslated region
98 Within non-coding gene Located within a gene that does
not code for a protein
107 Intronic In intron
214 All All variants
8/6/2019 Role of Rbm3 Gene in Cancer
33/41
33
2.6. HOMOLOGY OF RBM-3 GENE
Expression of RBM-3
On Northern blot analysis with a probe corresponding to nucleotides 200-794 (Sel 36) a major RNA
species of ~1.8 kb was observed in a wide variety of human adult and fetal tissues (fig.4). In
addition, a secondary transcript of ~3.0kb was also seen in all tissues along with weakly hybridizinglarger bands. Hybridization of this probe to a mouse tissue Northern blot identified a single band of
~1.6 kb indicating cross-species conservation of this RNP locus.
Fig4. expression of RBM3 in humans fetal tissues. The probe used was Sel36, a ~600bp cDNA.
The blot was stripped and re-probed with a beta-actin cDNA (bottom section). Positions of RNA size
standards in kb are indicated on the left.
Mapping & genomic of RBM3
As previously reported, STS content mapping of YACs from the Xp11.2 region has placed RBM3
b/w the OATL1 gene cluster & group of tightly linked genes defined by the GATA1 locus. Given
the complexity of cDNA isolated from the human fetal brain cDNA library however, we investigate
whether they were all derived from a single locus. Southern blot of YAC8 DNA & total human
genomic DNA, digested with HindIII&EcoRI&probd with Sel36, identified a single hybridizationband in YAC8 & an additional smaller band in total genomic DNA. Since the smaller band was not
seen in DNA from an X-only hybrid cell line, we located elsewhere in the genome. The structure of
the RBM3 gene contained within YAC8 was determined by PCR amplification & sequencing of
products from YAC8. The results indicate that RBM3 is split into at least nine exons that are
distributed over >4.5kb. when genomic seq. of individual exons amplified from YAC8 were
8/6/2019 Role of Rbm3 Gene in Cancer
34/41
34
compared with the seq. of RBM3 cDNAs, it became apparent that the RNP gene with YAC8
encodes the isolated cDNA& that the variable forms are generated by alternative splicing.
Fig3. Alignment of the RNA binding domain of RBM3 with those of the proteins YRRM, RNP G
& AAIP. The positions of the conserved RNP1 & RNP2 motifs are indicated below, & those of the
seq. blocks A, 1, 2, & 4 above, the seq. alignment. Amino acids that are conserved b/w RBM3 & at
least two of the three other proteins are highlighted. The protein structure is taken from Burd and
Dreyfuss (Burd C.G et al. 1994).
2.7. Mechanism of RBM-3 gene regarding breast cancer
Single-strand RNA-binding proteins (RBPs) are involved in many aspects of RNA metabolism and
in the regulation of gene transcription (Sutherland LCet al. 2005&Burd CGet al. 1994). Reversible
binding of RBPs to RNA is accomplished through specific sequences within the proteins, such as the
RNA-recognition motif (RRM), RNA-binding motif (RBM), ribonucleoprotein motif (RNP),
the arginine-rich motif (ARM), the cold-shock domain (CSD) and many others(Burd CG et al.
1994). RBM proteins have been recognized as a specific subgroup of RRM/RBM/RNP containing
RBPs. Each of the 10 proteins designated as RBM proteins contain between 1 and 4 copies of the
RRM consensus sequence(Sutherland LC et al. 2005). The functional importance of the RRM
domain is suggested by its evolutionary conservation across species and by its presence in virtually
every organelle of the cell in which RNA is present (Sutherland LC et al. 2005).
Initially identified in a human fetal brain tissue cDNA library(Derry JM,et al. 1995), theRBM3 gene
maps to Xp11.23, and is one of three X-chromosome-related RBM genes
8/6/2019 Role of Rbm3 Gene in Cancer
35/41
35
(RBMX,RBM3andRBM10). TheRBM3 gene encodes alternatively spliced transcripts, with the
longest reading frame encoding for a 157 amino-acid protein containing one RRM domain and a
glycine-rich region(Derry JM, et al. 1995). The RBM3 protein binds to both DNA and RNA(Wright
CFet al. 2001).
Although RBM proteins have been proposed to be a novel family of apoptosis regulators, the exact
function of RBM3 has yet to be fully elucidated.RBM3 transcripts have been found in various human
tissues (Derry JM, et al. 1995) and in vitro, RBM3 is one of the earliest proteins synthesized in
response to mild hypothermia(Danno Set al. 1997). A correlation between the X chromosome-
relatedRBMgenes (RBMX,RBM3 andRBM10) and the proapoptoticBax gene has been shown in
breast cancer(Martinez-Arribas Fet al. 2006).Downregulation ofRBM3 is associated with melanoma
progression(Baldi A et al. 2003); however, a recent report describedRBM3 as a proto-oncogene that
protects against mitotic catastrophe in colorectal cancer cell lines.Taken together, the role
ofRBM3 in the context of tumor initiation and progression in various cancer forms remains
unknown and, to date, no studies have addressed the role of tumor-specific RBM3 protein expression
in relation to disease outcome.
Using an antibody-based proteomics strategy, a comprehensive atlas of human protein expression
patterns has been generated through the Human Protein Atlas program
(http://www.proteinatlas.org)(Uhlen Met al. 2005 &Ponten Fet al. 2008). To date, more than 3000
antibodies (corresponding to more than 2600 different human proteins) have been screened in tissue
microarrays, representing 48 types of normal tissues, 216 human tumor samples representing the 20
most common forms of human cancer and 47 cell lines(Kampf Cet al. 2004 &Andersson ACet al.
2006), In addition to generating a map of protein expression patterns, this atlas can also be used as a
platform for the discovery of new diagnostic, prognostic and predictive cancer biomarkers. One such
candidate is RBM3, which, on the basis of its differential expression among the breast cancer
samples in the protein atlas was further evaluated in tissue microarrays constructed from two
independent breast cancer cohortsone consecutive cohort (n=512) and one cohort containingtumors from a randomized tamoxifen trial conducted in premenopausal women (n=500). The latter
cohort enabled assessment of the prognostic impact of RBM3 expression and also its potential value
as a predictor of response to tamoxifen treatment.
8/6/2019 Role of Rbm3 Gene in Cancer
36/41
36
Cell Culture and Gene Silencing
The human breast cancer cell lines, MCF-7, MDA-MB-231, T47D, and the human immortalized
breast epithelial cell line MCF-10A were maintained under standard conditions. Transfection with
siRNA againstRBM3 (Applied Biosystems, Carlsbad, CA, USA) or control siRNA (Applied
Biosystems), was performed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) with a finalconcentration of 50nMsiRNA. Cells were harvested for protein or RNA recovery 48 and 72h
post transfection initiation. IHC was performed on cells after fixation in paraformaldehyde (4%),
dehydration and paraffin embedding.
RNA-binding proteins play a key role in post-transcriptional regulation of mRNA stability and
translation. We have identified that RBM3, a translation regulatory protein, is significantly
upregulated in human tumors, including a stage-dependent increase in colorectal tumors. Forced
RBM3 overexpression in NIH3T3 mouse fibroblasts and SW480 human colon epithelial cells
increases cell proliferation and development of compact multicellular spheroids in soft agar
suggesting the ability to induce anchorage-independent growth. In contrast, downregulating RBM3
in HCT116 colon cancer cells with specific siRNA decreases cell growth in culture, which was
partially overcome when treated with prostaglandin E2, a product of cyclooxygenase (COX)-2
enzyme activity. Knockdown also resulted in the growth arrest of tumor xenografts. We have also
identified that RBM3 knockdown increases caspase-mediated apoptosis coupled with nuclear cyclin
B1, and phosphorylated Cdc25c, Chk1 and Chk2 kinases, implying that under conditions of RBM3
downregulation, cells undergo mitotic catastrophe. RBM3 enhances COX-2, IL-8 and VEGF mRNA
stability and translation. Conversely, RBM3 knockdown results in loss in the translation of these
transcripts. These data demonstrate that the RNA stabilizing and translation regulatory protein
RBM3 is a novel proto-oncogene that induces transformation when overexpressed and is essential
for cells to progress through mitosis.
8/6/2019 Role of Rbm3 Gene in Cancer
37/41
37
Chapter 3
Discussion & Conclusion
8/6/2019 Role of Rbm3 Gene in Cancer
38/41
38
3.0. Discussion & Conclusion
The gene and its protein, both called RBM3, are vital for normal cell division. RBM3, a ubiquitously
expressed serine- and glycine-rich protein, is a protooncogene that binds to COX-2 ARE and
regulates COX-2 mRNA stability and translation (Dannoet al., 1997). RBM3 level is upregulated in
human tumors, and expressing the protein in non-transformed cells induces the cells to grow in an
anchorage-independent manner.Moreover, there is an increase in apoptosis and activation of
checkpoint-related proteins that enhance cell cycle progression at the level of mitosis suggesting
mitotic catastrophe. Furthermore, downregulatingIn tumors, however, low oxygen levels causes the
amount if this protein to go up dramatically. This causes cancer cells to divide uncontrollably,
leading to increased tumor formation. Powerful new technology was used to genetically silence
the protein and reduce the level of RBM3 in cancer cells. The approach stopped the tumor from
growing and led to the cell death. This new technique has now been tested successful in severaltypes of cancer models such as breast, pancreas, colon, lung, ovarian and prostate. Most cancer are
thought to come from mutation in genes, but this discovery shows for the first time that too much of
the RBM3 protein can cause normal cells to turn into cancer cells. The RBM3 protein was found in
every stage of many cancers and the amount of protein increased as the cancer grew. The protein
helped the cancer grow faster, avoid cell death (apoptosis) and was also part of the process that
formed new blood vessels to feed the tumor, a process known as angiogenesis. Angiogenesis is
essential for tumor growth and its new data suggests that targeting RBM3 may be a useful tool
against cancer. Its one thing to
demonstrate success in lab though the
proof of the pudding is what happens in
real life. The next step is, therefore
designing suitable agents to inhibit the
activity of RBM3 and clinical trails may
begin within 5 years.
8/6/2019 Role of Rbm3 Gene in Cancer
39/41
39
References
8/6/2019 Role of Rbm3 Gene in Cancer
40/41
40
y Andersson AC, Stromberg S, Backvall H, et al. Analysis of protein expression in cellmicroarrays: a tool for antibody-based proteomics. J HistochemCytochem 2006;54:14131423.
y Baldi A, Battista T, De Luca A, et al. Identification of genes down-regulated during
melanoma progression: a cDNA array study.ExpDermatol2003;12:213218.
y Burd CG, Dreyfuss G. Conserved structures and diversity of functions of RNA-binding
proteins. Science 1994;265:615621.
y Chappell SA, Owens GC, Mauro VP. A 5 Leader of Rbm3, a Cold Stress-induced mRNA,
Mediates Internal Initiation of Translation with Increased Efficiency under Conditions of
Mild Hypothermia. The JournalofBiological Chemistry. 2001;276(40):36917-36922.
y Danno S, Nishiyama H, Higashitsuji H, et al. Increased transcript level of RBM3, a member
of the glycine-rich RNA-binding protein family, in human cells in response to cold stress.
Biochemical andBiophysical Research Communications. 1997;236(3):804-807.
y Derry JM, Kerns JA, Francke U. RBM3, a novel human gene in Xp11.23 with a putativeRNA-binding domain.Hum Mol Genet1995;4:23072311.
y Derry JM, Kerns JA, Francke U. RBM3, a novel human gene in Xp11.23 with a putative
RNA-binding domain.Human MolecularGenetics. 1995;4(12):2307-2311.
y Derry JM. Kerns JA. Francke U. Howard Hughes Medical Insitute, Stanford University
Medical Center, CA 94305, USA
y Dresios J, Aschrafi A, Owens GC, et al. Cold stress-induced protein Rbm3 binds 60S
ribosomal subunits, alters microRNA levels, and enhances global protein synthesis.
Proceedings of the National Academy of Sciences of the United States of America.
2005;102(6):1865-1870.
y Dupont-Versteegden EE, Nagarajan R, Beggs ML, et al. Identification of cold-shock protein
RBM3 as a possible regulator of skeletal muscle size through expression profiling. American
journal of physiolog y Regulatory integrative and comparative physiology.
2008;295(4):R1263-R1273.
y Ehln , Brennan DJ, Nodin B, et al. Expression of the RNA-binding protein RBM3 is
associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer.JournalofTranslational Medicine. 2010;8:78.
y Hubert Hackl et al. Genome Biology 2005, 6:R108. doi:10.1186/gb-2005-6-13-r108.
y Jgi A, Brennan DJ, Rydn L, et al. Nuclear expression of the RNA-binding protein RBM3
is associated with an improved clinical outcome in breast cancer. Modernpathology an
8/6/2019 Role of Rbm3 Gene in Cancer
41/41
official journal of the United States and Canadian Academy of Pathology Inc.
2009;22(12):1564-1574.
y Kampf C, Andersson AC, Wester K, et al. Antibody-based tissue profiling as a tool forclinical proteomics. Clinical Proteomics 2004;1:285299.
y Lleonart ME. A new generation of proto-oncogenes: cold-inducible RNA binding proteins.
BiochimicaetBiophysicaActa. 2010;1805(1):43-52.
y Martinez-Arribas F, Agudo D, Pollan M, et al. Positive correlation between the expression of
X-chromosome RBM genes (RBMX, RBM3, RBM10) and the proapoptoticBax gene in
human breast cancer.J Cell Biochem 2006;97:12751282.
y Markus Thiersch et al., BMC Genomics 2008, 9:73 doi:10.1186/1471-2164-9-73.
y Ponten F, Jirstrom K, Uhlen M. The Human Protein Atlasa tool for pathology. J Pathol
2008;216:387393.
y Stadler LJ. The gene. Society. 2010;134(874):1-37.
y Sureban SM, Ramalingam S, Natarajan G, et al. Translation regulatory factor RBM3 is a
proto-oncogene that prevents mitotic catastrophe. Oncogene. 2008;27(33):4544-4556.
y Sutherland LC, Rintala-Maki ND, White RD, et al. RNA binding motif (RBM) proteins: anovel family of apoptosis modulators? J Cell Biochem 2005;94:524.
y Uhlen M, Bjorling E, Agaton C, et al. A human protein atlas for normal and cancer tissuesbased on antibody proteomics.Mol Cell Proteomics 2005;4:19201932.
y Wanling Yang, et al. BMC Genomics 2008, 9:456 doi:10.1186/1471-2164-9-456.
y Wang H, Liu Y, Briesemann M, Yan J. Computational analysis of gene regulation in animal
sleep deprivation.Physiological Genomics. 2010;42(3):427-436.
y Wellmann S, Truss M, Bruder E, et al. The RNA-binding protein RBM3 is required for cell
proliferation and protects against serum deprivation-induced cell death. Pediatric Research.
2010;67(1):35-41.
y Wellmann S, Bhrer C, Moderegger E, et al. Oxygen-regulated expression of the RNA-
binding proteins RBM3 and CIRP by a HIF-1-independent mechanism. Journal ofCell
Science. 2004;117(Pt 9):1785-1794.
y Wright CF, Oswald BW, Dellis S. Vaccinia virus late transcription is activated invitro bycellular heterogeneous nuclear ribonucleoproteins.J BiolChem 2001;276:4068040686.
y Zeng Y, Kulkarni P, Inoue T, Getzenberg RH. Down-regulating cold shock protein genes
impairs cancer cell survival and enhances chemosensitivity. Journal of Cellular
Biochemistry. 2009;107(1):179-188.
Top Related