Download - October 21, 2018 - pathwayonline.com · 10/21/2018  · becbome Christianss become new persons. They ayre not the samem anymoree, forr thhe oldd lilif e iss s g one. A nenw life has

Transcript
Page 1: October 21, 2018 - pathwayonline.com · 10/21/2018  · becbome Christianss become new persons. They ayre not the samem anymoree, forr thhe oldd lilif e iss s g one. A nenw life has

October 21, 2018

Our purpose: KNOWLOVEGROWLOVESHOWLOVEPLEASE COMPLETE THE WELCOME CARD found in the chair in front of you and place it in the offering. You can also use the form on the

Pathway App or online at pathwayonline.com/welcome.PATHWAY KIDS provides a warm, nurturing, and well-supervised

experience. Preschool meets in Bldg C. 1st-5th grade meets in Bldg K.FREE WIFI available. The ID is “PathwayGuest.”

NEED PRAYER? visit pathwayonline.com/prayer. TODAY’S SERVICE is at pathwayonline.com/livestream.

ONLINE GIVING is at pathwayonline.com/giving.PATHWAY APP: See upcoming events, fi ll out a welcome card, and follow

along with the sermon notes. Find it on iTunes & Google Play.

1ST TIME AT PATHWAY? Bring your welcome card to Higher Grounds coffee house for a free drink

and gift from Pathway.

Page 2: October 21, 2018 - pathwayonline.com · 10/21/2018  · becbome Christianss become new persons. They ayre not the samem anymoree, forr thhe oldd lilif e iss s g one. A nenw life has

So if there is any encouragement in Christ, any comfort from love, any participation in the Spirit, any affection and sympathy, complete my joy by being of the same mind, having the same love, being in full accord and of one mind. Do nothing from selfish ambition or conceit, but in humility count others more significant than yourselves. Let each of you look not only to his own interests, but also to the interests of others. Have this mind among yourselves, which is yours in Christ Jesus, who, though he was in the form of God, did not count equality with God a thing to be grasped, but emptied himself, by taking the form of a servant, being born in the likeness of men. And being found in human form, he humbled himself by becoming obedient to the point of death, even death on a cross. Therefore God has highly exalted him and bestowed on him the name that is above every name, so that at the name of Jesus every knee should bow, in heaven and on earth and under the earth, and every tongue confess that Jesus Christ is Lord, to the glory of God the Father. Philippians 2:1-11 (ESV)

We will continue to explore this topic of the future in our Pathway Lights Daily Devotional posted Monday through Friday each week. Click the "Devotions" tab on the Pathway App, go to

pathwayonline.com/devotional, or sign up to get it in your inbox at pathwayonline.com/devotional_signup.

Up & Down, Down & Up Dr. Chris Morgan, CBU

Page 3: October 21, 2018 - pathwayonline.com · 10/21/2018  · becbome Christianss become new persons. They ayre not the samem anymoree, forr thhe oldd lilif e iss s g one. A nenw life has

Every Christian is either a missionary, or an imposter.

~Charles H. Spurgeon

Whahat this means is that those whobecb ome Christianss become new persons. TheThey ay re notnotnot the samem

anyanymormoree, forr thhe oe oldd lilife ie iss s goneone. A. A nen w w life has as beggun!un! All tthishis nenewness of liflife ie is

from GGod,od wwho brought us back c tohimhimsellff throughugh what at Christ did. And

Godd hhas giveiven us tthe h task of reconcilingpeoeopleple to hihimm. Forr God was in Christ,reconciling thethe world to himself, no

lonngerger counting people’s sins against thethem. ThiThis is is ts thehe wonwonderderful message ge hhe

hashas given us to tell othothersers. WWe arear Christ’s ambassaddorsors,

& God iss usiusisingngng us to speak to yoou.We urge ye youou, asa though Christ himseself

were heree plpleading with you, “Be“B reconncilcileded toto GodGod!” Foor God made

Chrhrist, wwho h nevver e sinnedd, to be the e offof eringng for our sinin, soso ththaat we couldd be

mmade e right with God td throhrough Chrisst.2 CCorinthians 5:17-211 (NNLT)LT)New series starts November 4.

DEC 2, 6PMpathwayonline.com/palooza

Winter TreatsOutdoor Party

Christmas ShowChildren’s Activities

and more!

FREE FUNFOR THE ENTIRE FAMILY!

Sign up to volunteer for the event by November 4 for a free Pathway t-shirt. You will also have the option to upgrade to a long sleeved shirt or hoodie for an additional cost.

Sign up at pathwayonline.com/palooza

COMING SOON: posters, fliers, yard signs, and more to spread the news.

WWAYS FFFFFFFOOOOORRR YYOOUU TTOOOO HHHEELP OUUTT:: - VoVolulullluntntnteeeer r fofofoorrrr oonono e ofof tthhhheeh variouss jjobobss aaatat tthe eveveeentntnn -- JoJoinin aandnd sharee ttttthehehh FFacacccceeebebook evvveeenenee tt - Share thhheeee event wwithh your commmmmununnnunititii yy ggroupsps oonn SoSoSocicicicialalalal MMMMeediaaa - BrBrininngggg aa aa ddededesss ert ththe morning ofof thehehe eeveveeentnt - Prraya fffororo ttheehe eeevvent and for those you arre invitinngg - InInInInI vivitetett ppeoe lple e yoyouu knknknnowoo who need to hear ababououtt ththee goodddod nnneewews ooffff ChChhChCChC ristmmas

Page 4: October 21, 2018 - pathwayonline.com · 10/21/2018  · becbome Christianss become new persons. They ayre not the samem anymoree, forr thhe oldd lilif e iss s g one. A nenw life has

Sunday November 4, 10:45am

in the church office.

Learn more about Pathway andhow to join at our next

NEWCOMERS CLASS

Starting next week, you can pick up empty boxes and drop off filled boxes on the patio, Preschool Bldg, and Kids Worship Center on

Sundays until Nov 11.

There will also be a packing party on Nov 6 in the Underground from 9:30-noon.

Pre-build: Saturday, November 3 in church parking lot 8 am. You can stiLl donate money

toward the building materials and suPplies for the house.

Get a suPply list and more info at pathwayonline.com/mexico

MEXICO TEAM 201822222019 Kentucky

aOutreach Teamay

JuJuJuJ nenenenene 2222223-33-3-33 292929292InInInInInInIInI fofofoff rmrmrmmrmatatatatatioioioiionananananal l l ll MeMeMeMeetetetettinininninng:g:g:g:g:

TODTODTODTODAY,AY,AYAAY,YY,Y,Y,, OcOOOcOcOOcOO t 2t 2t 22221,1,1,111,1 12p12p12p12p12 m im im im in tn tnn tn tn tnn theheehehehh ConConConConnferferferfererferfe encencencencence Re Re Re Re RRRoomoomoomoomoomoomoooom

LoLoLoLoLLoLoLots tts tsts ttss offof of of ofof f fffff areareareeaaareareareaarea as asasasas a to to tototo o o serserserersersersere ve:ve:ve:veve:ve:ve:ve:vee:ve:v YoYoYYoYYYoYYYoYoYYoYYY uthththuthuthhuthuthuth MiMiMMiMiMiMiMiMMiMiii iiiiinisnisnisnisnisnisnn trytttrytrytrytrytryytryt ,, ,,, ,

ioionioniConConCoConConConConnnstrstrstrstrstrstrstrstrt uctuctuctuctucttucttucttctionionionionionionioioon, G, G, G, G, G, GG, GGGardardardardrdardardardar enienienienienienienienineniniiing,ng,ng,ng,ng,ng,ngng,ng,ngngng, CoCoCoCoCoCoCoCoCoCoCoCoCommmmummummummummummummummummmmmm nitnitnitnitnitnitnitnity Oy Oy Oy Oy Oy Oy Oy Outrutuuttutrututruutut eaceaceacea h, h,iioiionioni

SenSenSenSenSenenSenSenS iorioriorioiorioriorior CaCaCaCaCaCaCaare re re rere re rr MinMinMinMinMinMinMinnisistiistististi ry.ry.ry.rrry.tttttttrrrrrSenSenSenenenenSenSeniorioriororioriorii CaCaCaCaCCaCarererereree MinMinMinMiMinMinMinMinistististististiSSSSSSSenSenSenSeSeSennSeniorioiorioriorooo CCCaCaCCaC rerereereree MinMinMinMinMMinMininistististististsti tryryryrryryr

GetGGetGetGetGee momomomomm rererere infinfnfinfinfnfinfnfo ao ao ao ao ao ao nd ndnd nd nd nd ndnd thethethethethetheththe apaapaapapppapplipliplipliplilipplililipliliicatcacatcatcatcaccaccatccationioiononioionioioon atatatatat oooo pppppppp

patpatpatpatpapatthhwahhwahwahwahwahwaayonyonyonoyooo linlinlinlininlinnne.ce.ce.ce.c.e.com/om/om/om//om/momm kenkenkenkenkkkennk tuctuctuctuctuctucuuckykkykkkyyttttthhh kkkkkk

SOULED OUTFOR KIDSOur annual shopping spree for kids in need is Dec. 6. $100 gives a local child in need the means to make their Christmas a little brighter. Details, donation portal, and signup at pathwayonline.com/souledout

UPCOMING EVENTS

FOR HIGH SCHOOL

& MIDDLE SCHOOL

Deadline to sign up is October 21

Qui

ck L

inks