Nucleotides, Nucleic Acids and Heredity
Bettelheim, Brown, Campbell and Farrell
Chapter 25—part 2
DNA and RNA
• The three differences in structure between DNA and RNA are– DNA bases are A, G, C, and TT; the RNA
bases are A, G, C, and UU– the sugar in DNA is 2-deoxy-D-ribose2-deoxy-D-ribose; in RNA
it is D-riboseD-ribose– DNA is always double strandeddouble stranded; there are
several kinds of RNA, all of which are single-single-strandedstranded
RNA
• RNA molecules are classified according to their structure and function
RNA type Size Function
Transfer(tRNA)
Ribosomal(rRNA)
Messenger(mRNA)
from 73 to 93 base pairs
very large;MW up to 106
combines with proteinsto form ribosomes
750 base pairson average
transports amino acidsto the site of proteinsynthesis
directs amino acidsequence of proteins
Ribozymes(catalytic RNA)
catalyze cleavage of partof their own sequencesin mRNA and tRNA
very large
Other RNAs• RNA molecules are classified according to their
structure and function
• snRNA –small nuclear RNA (100-200 b)Combine to make snRNPs to help processing of mRNA for
export from nucleus
• miRNA—microRNA• Bind to mRNA in development
• siRNA—small interfering RNA• Knock out mRNA for genes that are undesirable
t-RNA Structure• Contains some modified nucleotides, such as
1-methylguanosine• Actual 3-D shape is an L• Often shown as a 2-D “clover leaf” shape with
three “loops”• Some H-bonding between bases at base of loops• Anticodon bases contained on middle loop • 3’ end has CCA as terminal bases• 3’ end carries the amino acid
“Clover Leaf” Structure of tRNA
Fig. 24.10
Nucleic Acids and Heredity
• Chromosomes exist in pairs (23 pairs in humans) • Inherit one DNA copy from each parent. • Most cells in our body contain copies of both • Genetic information is carried in the sequence of
bases along the DNA strands. • Information is passed to daughter cells when cell
divides.
Genes, Exons, and Introns• Gene:Gene: a segment of DNA that carries a base
sequence that directs the synthesis of a particular protein, tRNA, or mRNA– there are many genes in one DNA molecule– in bacteria the gene is continuous– in higher organisms the gene is discontinuous
• Exon:Exon: a section of DNA that, when transcribed, codes for a protein or RNA
• Intron:Intron: a section of DNA that does not code for anything functional
Genes, Exons, and Introns
– introns are cut out of mRNA by ribozymes before the protein is synthesized
Central Dogma of Molecular Biology
DNA → RNA → Protein
Processes involved in transfer of hereditary information
• Replication: DNA → DNA (identical copy)
• Transcription: DNA → RNA (m-RNA)
• Translation: RNA → protein
DNA Replication• ReplicationReplication involves separation of the two original
strands and synthesis of two new daughter strands using the original strands as templates– DNA double helix unwinds at a specific point called an
origin of replicationorigin of replication– DNA replication is bidirectionalbidirectional: chains are synthesized
in both directions from the origin of replication– At each origin of replication, there are two replication replication
forksforks where where new polynucleotide strands are formed
Two NEW Strands Formed
Steps in Replication1.Weaken DNA-Histone interactions
– Histone Acetylase interferes with +/- interaction by adding acetyl group to lysine amino groups
2.Relax higher DNA superstructure– Topoisomerases (gyrases) eliminate supercoiling of DNA by
binding to one strand (via tyrosine and phosphate bond), nicking DNA, uncoiling DNA and rejoining DNA segments
3.Unwind Double Helix– Helicases attach to one strand and separate the two strands
(uses ATP for energy)
DNA Replication
Steps in Replication4.Primer/Primases
– Short RNA sequences needed to start DNA synthesis– Catalyzed by Primase
5.Polymerization (actual synthesis of new DNA strands)– DNA Polymerase– Catalyzes attachment base to new strand– New base is complementary to template base– Short Okasaki fragments formed (ca 200 bases)
6.Ligation– DNA ligase joins Okasaki fragments
DNA Replication– DNA is synthesized from its 5’ -> 3’ end (from the 3’ -> 5’
direction of the template)– the leading strand leading strand is synthesized continuously in the 5’ ->
3’ direction toward the replication fork – the lagging strand lagging strand is synthesized discontinuously as a
series of Okazaki fragmentsOkazaki fragments, also in the 5’ -> 3’ direction, but away from the replication fork
– Okazaki fragments of the lagging strand are joined by the enzyme DNA ligaseDNA ligase
– replication is semiconservativesemiconservative:: each daughter strand contains one original template strand and one newly synthesized strand
DNA Replication
Leading strand
Lagging strand
DNA ReplicationLeading strand (new strand synthesized from 5’ to 3’)
Lagging strand (new strand runs from 3’ to 5’ but synthesis of individual Okasaki fragments is 5’ to 3’)
Fig. 24.9
DNA Replication
Bond Formation in Replication
DNA Replication
Old strand:New strand:
ATTCGTAAAGGTCTAAGCATT
DNA Repair• Cells have DNA repair enzymes that can
detect, recognize, and repair mutations in DNA• Base excision repairBase excision repair (BER)(BER): one of the most
common repair mechanisms– DNA glycosylase recognizes the “damaged” base
and cuts out the base, leaving the sugar-phosphate backbone
APAP (apapurinic or apapyrimidinic) sitesite created
DNA Repair• EndonucleasEndonuclease catalyzes the hydrolysis of the
backbone
– an exonucleaseexonuclease liberates the sugar-phosphate unit of the damaged site
– DNA polymerase inserts the correct nucleotide
– DNA ligase seals the backbone to complete the repair
DNA Repair• NERNER (nnucleotide eexcision rrepair) removes
and repairs up to 24-32 units by a similar mechanism involving a number of repair enzymes
Top Related