1
Mitochondrial Transcription Factor A and Its Downstream Targets Are Upregulated in a
Rat Hepatoma*
Xiaocheng Dong§, Kalpana Ghoshal§, Sarmila Majumder§, Satya P. Yadav‡, and Samson T.
Jacob§†
§Department of Molecular and Cellular Biochemistry, College of Medicine, The Ohio State
University, Columbus, Ohio 43210, and ‡Molecular Biotechnology Core, Cleveland Clinic
Foundation, Lerner Research Institute, Cleveland, Ohio 44195
†To whom correspondence should be addressed:
Dr. Samson T. Jacob
Department of Molecular and Cellular Biochemistry
333 Hamilton Hall, 1645 Neil Avenue, Columbus, OH 43210
Tel: 614-688-5494
Fax: 614-688-5600
E-mail: [email protected]
Running Title: Increased Expression of Tfam and Its Targets
*This work was supported in part by U.S. Public Service Grants CA 81024 and ES 10874 (S.T.J)
from the National Cancer Institute and the National Institute of Environmental Health Sciences,
respectively. This research was performed in partial fulfillment of the requirement for Ph.D.
Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on August 26, 2002 as Manuscript M206958200 by guest on A
pril 11, 2020http://w
ww
.jbc.org/D
ownloaded from
2
degree in Molecular, Cellular and Developmental Biology Program of the Ohio State University
(XD).
ABSTRACT
Mitochondrial transcription factor A is a key regulator involved in mitochondrial DNA (mtDNA)
transcription and replication. In a poorly differentiated rat hepatoma, Morris hepatoma 3924A,
the mRNA and protein levels of this factor were elevated about 10 and 11 fold, respectively,
relative to the host liver. The mRNA levels for the hepatoma cytochrome c oxidase I, II, and
NADH dehydrogenase 5, 6, the downstream targets of Tfam, were augmented 10, 8, 5, and 3
fold, respectively. Interestingly, Tfam was also found in the hepatoma nucleus. The mRNA
levels for nuclear respiratory factor 1 and 2 (NRF-1, -2), the proteins that are known to interact
with specific regulatory elements on human TFAM promoter, were 5 and 3 fold higher,
respectively, in the hepatoma relative to the host liver. Unlike the human promoter, the rat Tfam
promoter did not form a specific complex with the NRF-1 in the liver or hepatoma nuclear
extracts, which is consistent with the absence of an NRF-1 consensus sequence in the proximal
rat promoter. A single specific complex formed between the rat promoter and the NRF-2 protein
was comparable in the two extracts. The DNA binding activity of Sp1 in the hepatoma nuclear
extract was 4 fold greater than that in the liver extract. In vivo genomic footprinting showed
occupancy of NRF-2 and Sp1 consensus sites on the promoter of rat Tfam gene. Tfam was also
upregulated in other hepatoma cells. Together, these results show upregulation of Tfam in some
tumors, particularly the liver tumors. Further, relatively high level of Sp1 binding to the
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
3
promoter in the hepatoma could play a major role in the upregulation of Tfam in these tumor
cells.
INTRODUCTION
Mammalian cells contain two distinct genomes that are localized in nuclear and mitochondrial
compartments, respectively. The maintenance of mitochondrial DNA (mtDNA)1 requires factors
encoded by nuclear DNA. Unlike nuclear DNA, mtDNA contains limited genetic information. In
fact, it encodes just 2 rRNAs, 22 tRNAs, and 13 polypeptides including cytochrome c oxidase I
–III (COX I-III), NADH dehydrogenase subunits 1-6 (ND1-6), cytochrome b (Cytb), and
ATPase 6, 8. These polypeptides are essential components of the mitochondrial electron
transport chain (ETC). Consequently, the majority of the mitochondrial proteins, including most
of the ETC subunits are encoded by the nuclear genome. It is, therefore, not surprising that the
mammalian mitochondrial transcription is directed by a limited number of proteins. The
mitochondrial transcription machinery is composed of at least two trans-acting factors: a core
RNA polymerase and a dissociable transcription factor. RNA polymerase is relatively non-
selective on the promoter sequence, while the dissociable factor confers the promoter specificity
and transcription efficiency (1, 2). The human dissociable factor was later purified and cloned,
designated human mitochondrial transcription factor A (TFAM) (3). The full-length cDNA of
this nuclear gene encodes 246 amino acids of TFAM (precursor form). The very N-terminal 42
amino acids function as mitochondrial targeting signal and are cleaved during mitochondrial
translocation. Thus the mature functional form of TFAM is comprised of 204 amino acids
(24,400 daltons). TFAM is a member of high mobility group (HMG)-box protein family that
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
4
contains two HMG box DNA-binding domains. The HMG-box proteins in the nucleus are
involved in transcription enhancement and chromatin packaging, and exhibit a dual DNA-
binding specificity that includes recognition of unique DNA sequence and common DNA
conformation (4). TFAM binds upstream of the transcriptional control elements in both heavy-
strand and light-strand promoters (HSP and LSP) of mitochondrial DNA and initiates its
transcription (5). The sequence specificity of TFAM binding is relatively less stringent since the
sequences of these two promoters are only partially similar (2). The mouse Tfam-/- knockout
embryos died at the early stage (E10.5) of embryonic development with mtDNA depletion and
abolished oxidative phosphorylation (6). In Tfam+/- heterozygous knockout mice, the mtDNA
copy number decreased by 34±7% in all tissues analysed, and the mitochondrial transcript levels
were reduced by 22±10% in heart and kidney (6). This observation demonstrated that Tfam is
essential for the mtDNA maintenance and embryonic development. Cloning and characterization
of the mouse homologue of TFAM (Tfam) resulted in the identification of a nuclear counterpart
of the protein (TS-HMG) in the mouse testis, but the physiological function of this nuclear
isoform is not yet clear (7).
Since mitochondria provide the energy for the cellular processes including cell growth,
proliferation, it is not uncommon that the alterations of mitochondrial gene expression often
occur in tumors (8, 9). Nuclear respiratory factors (NRF-1 and NRF-2) are the two major trans-
acting factors that have been suggested to play a key role in the transcription of human TFAM
gene (10, 11). As the name implies these two proteins are also involved in the expression of
several human and rodent cytochrome oxidase subunits (10) that are important for cellular
respiration. NRF-1 binds DNA as a homodimer, which is the active form of the factor. The
activation domain resides in the C-terminal end of the protein downstream from the DNA
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
5
binding domain (12) that does not belong to any known domain classes. On the other hand, NRF-
2 is a multisubunit protein that can bind to GGAA sequence motif in the human TFAM promoter
and activate its transcription activity as demonstrated by in vitro transcription or in vivo
transfection studies (11). NRF-2 is composed of five subunits: α, β1, β2, γ1, γ2, of which the α
subunit contains the DNA binding domain (ETS domain). Initially, the sequence analysis of
human TFAM promoter showed the absence of a typical TATA box in this promoter (13). Later,
the promoter of human TFAM gene was characterized by mutational analysis, and the finding
showed that there are at least three DNA-binding motifs in the proximal promoter: NRF-1, NRF-
2, and Sp1 (11). The promoter sequence alignments showed that the mouse and rat Tfam
promoters also contain well-conserved Sp1 and NRF-2 recognition sites, but neither of them
exhibited the consensus binding site for NRF-1 (14).
Mitochondria play very important roles in cellular metabolism, generation of reactive oxygen
species, and apoptosis (15, 16). Since TFAM is coded by nuclear DNA but controls the synthesis
of mitochondrial respiratory chain components, this protein has been suggested to play the role
of a key mediator between nuclear and mitochondrial genomes (11). For its dual role in
replication as well as transcription of mtDNA, it was of considerable interest to investigate the
role of Tfam in a rapidly growing tumor. Here, we explored the level of expression, localization,
and regulation of Tfam gene, and its effect on the downstream target genes in the rat liver and
Morris hepatoma transplanted into the same animal.
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
6
EXPERIMENTAL PROCEDURES
Maintenance of Morris Hepatoma 3924A. Morris hepatoma 3924A is a poorly differentiated,
rapidly growing tumor. The tumor was maintained in the hind leg of rats (ACI strain) as
described previously (17).
cDNA Library Construction and Screening. To isolate the full-length cDNA of rat Tfam, we
constructed rat Morris hepatoma 3924A cDNA library using the cDNA synthesis kit and
Gigapack III Gold Packaging Extract (Stratagene). Briefly, total RNA was isolated from the
hepatoma by the single-step method (18), and the poly(A)+ RNA was isolated from the total RNA
using the PolyATtract mRNA isolation system (Promega). The cDNA synthesis and packaging
reactions were performed as described in the manufacturer’s protocol (Stratagene). The cDNA
library screening was carried out following the standard protocol (19) using KpnI/PstI fragment
of mouse Tfam cDNA (pN26 clone, a generous gift from Dr. Nils-Göran Larsson, Karolinska
Institute, Stockholm, Sweden) as the probe. Ten positive clones (pHepTFA #1-#10) were picked
randomly and sequenced, and the DNA sequence was analyzed using the MacVector software
(Oxford Molecular Group PLC).
5' Rapid Amplification of cDNA Ends (5' RACE). Since the clones isolated from the rat hepatoma
cDNA library lack 5'-end sequence, we performed 5' RACE to complete the cDNA full-length
sequence using the 5' RACE System (Life Technologies). Briefly, the first strand of cDNA was
synthesized from poly(A)+ RNA of Morris hepatoma 3924A using rat Tfam gene-specific
primer Hep-GSP1 (5'-GTACACCTTCCACTCAG-3'), and was purified using the GlassMax
DNA isolation spin cartridge supplied with the kit. Following oligo-dC tail addition by TdT
enzyme, PCR amplification was performed to amplify the specific product with the Abridged
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
7
Anchor Primer (AAP: 5'-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG) and a gene-
specific primer Hep-GSP2 (5'-AGCTCCCTCCACATGGCTGCAAT). The primary PCR
product was re-amplified with an Abridged Universal Amplification Primer (AUAP: 5'-
GGCCACGCGTCGACTAGTAC-3') and a nested gene-specific primer Hep-GSP4 (5'-
TCAGTTCTGAAACTTTTGCATCTGGGTG-3'). The amplified 5' cDNA end was confirmed
by a nested PCR reaction with the primer Hep-GSP2 and another nested gene-specific primer
Hep-GSP3 (5'-TGTATTCCGAAGTGTTTTTCCAGCTTGG-3'). The 5' RACE cDNAs were
sequenced and subcloned into the hepatoma cDNA clone pHepTFA#1 to make a full-length
cDNA clone designated pHepTFA-FL.
Purification of Recombinant Rat Hepatoma Tfam. The coding region corresponding to the
mature form of the rat hepatoma Tfam (without the mitochondrial targeting signal peptide) was
obtained by PCR amplification of the above Tfam full-length cDNA clone pHepTFA-FL with
the primers Hep-ExF2 (5'-CGGGATCCAGCTTGGGTAATTATCCA-3') and Hep-ExB1 (5'-
GGGGTACCAATGACAACTCTGTCTTCAATC-3'). The amplified DNA was then subcloned
into the sites BamHI/KpnI of bacterial expression vector pQE30 (Qiagen), which contains 6-
histidine tag sequence at the 5' end. The recombinant plasmid was transformed into M15
bacteria. The expression of the recombinant Tfam protein was induced with 1mM IPTG added to
the bacterial culture in log phase and was grown for an additional 4 hours. The protein was
purified by chromatography on Ni-NTA Sepharose column under denaturing conditions as
described by the manufacturer (Qiagen).
Generation of Antibodies Against rat Tfam. Purified recombinant Tfam (1 mg) was separated on
12% SDS-polyacrylamide gel. The protein was visualized by staining with ice-cold 0.25 M KCl
for 5 min. The gel was then rinsed with cold ddH2O, and the protein band was cut out and rinsed
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
8
again with cold ddH2O. The gel slice containing Tfam was fragmented by passing through two 5-
ml syringes, and the protein was resuspended in 2 ml of PBS buffer. Prior to injection into
rabbits, 1 ml of antigen solution was mixed with 1 ml of complete Freund’s adjuvant (CFA,
Sigma) to prepare the emulsion. The standard procedure (20) for immunization was followed.
The antibody specificity was determined by Western blot analysis.
Isolation of RNA, Northern blot and RT-PCR Analyses. The procedure for poly(A)+ mRNA
isolation was as described above. For Northern blot analysis, 5 µg of poly(A)+ mRNA was
separated on 1.2% formaldehyde-agarose gel and transferred to Hybond N+ membrane
(Amersham)). The membrane was hybridized with [α-32P]dCTP-labeled mouse Tfam cDNA
(KpnI/PstI fragment) from pN26 clone and MBD2 cDNA (PCR amplified with the primers:
MBD2-F: 5'-GCTGTTGACCTTAGCAGTTTTGAC-3', MBD2-B: 5'-TTACGCCTCATCTCCA
CTGTCCAT-3') sequentially. Then the membrane was exposed to X-ray film (Kodak). For RT-
PCR analysis, the 20 ng of each poly(A)+ mRNA sample was used for reverse transcription. The
PCR reactions were carried out under the following conditions: 4 min at 94 °C; specified cycles
of 30 sec at 94 °C, 30 sec at particular annealing temperature, and 1 min at 72 °C for each gene
(see Table 1). The PCR products were resolved on a 1.5% agarose gel and stained with ethidium
bromide, the signal was quantified by Kodak Digital Science 1D image analysis software
(Eastman Kodak Company).
Subcellular Fractionation, immunoprecipitation and Western Blot Analysis. The rat liver and
hepatoma nuclei were isolated as described (17). The mitochondria from rat liver and hepatoma
were isolated as described (21, 22) with some modifications. Briefly, rat livers were
homogenized in the mitochondria isolation medium (225 mM Mannitol, 75 mM sucrose, 500
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
9
mM EDTA, 2 mM MOPS, pH 7.4). The homogenate was centrifuged at 800 × g for 10 min, and
the supernatant thus obtained was centrifuged again at 800 × g for 10 min. The mitochondrial
supernatant was centrifuged at 6,500 × g for 15 min to sediment the crude mitochondrial pellet.
The mitochondrial pellet was resuspended in a small volume of the isolation medium,
disaggregated using a Dounce homogenizer, and centrifuged at 6,500 × g for 10 min. The above
wash step was repeated once. The mitochondrial pellet was resuspended in the isolation medium
and then layered onto a step gradient containing 15-ml of 1.5 M sucrose, 10 mM Tris-HCl, pH
7.5, 5 mM EDTA and a 15-ml of 1.0 M sucrose, 10 mM Tris-HCl, pH 7.5, 5 mM EDTA. The
gradient was centrifuged at 80,000 × g for 1 hr and the phase between the layers of 1.0 M
sucrose and 1.5 M sucrose was collected. For the preparation of hepatoma mitochondria, the
tissue was homogenized in 10 mM Tris-HCl buffer (pH 7.4) containing 250 mM sucrose and 1
mM EDTA. The crude mitochondria were resuspended in sucrose-TE buffer (585 mM sucrose,
50 mM Tris-HCl, pH 7.5, 10 mM EDTA) before it was layered on sucrose gradient. The gradient
was then centrifuged, the mitochondrial layer was collected as above, and the purified
mitochondria were resuspended in mitochondrial lysis buffer (20 mM Tris-HCl, pH 8.0, 0.2 mM
EDTA, 1 mM DTT, 1mM PMSF, 15% glycerol, 0.1 µg/ml leupeptin, 0.1 µg/ml pepstatin A). For
further purification, Triton X-100 was added to a final concentration of 0.5%, the suspension was
homogenized with a tightly fitting motor-driven Teflon pestle, 4 M KCl was then added to a final
concentration of 0.35 M, and the homogenization was repeated. The mitochondrial lysate was
centrifuged for 60 min at 130,000 × g in a Ti 70 rotor (Beckman) and the supernatant
(mitochondrial extract) was carefully removed and saved for analyses.
The immunoprecipitation was performed according to the procedure described by Harlow and
Lane (23). Briefly, the purified nuclei were resuspended in RIPA lysis buffer (150 mM sodium
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
10
chloride, 1.0% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl, pH 8.0, 1 µg/ml
aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin A), incubated on ice for 30 min and sonicated
briefly to shear the DNA. The lysate was centrifuged for 10 min at 10,000 × g at 4 °C. Either the
preimmune serum or rat Tfam antiserum was added to aliquots of the lysate (0.5 ml per aliquot)
after the lysate was precleared with normal rabbit serum. The immune complexes were collected
by adding protein A-Sepharose beads (Life Technologies) and analyzed by SDS-PAGE followed
by Western blotting.
For Western blot analysis of Tfam protein, the protein samples were resolved on the SDS-PAGE
and transferred to ECL membrane (Amersham). The blot was incubated with rabbit anti-rat Tfam
serum (1:6000) for 1 h at room temperature, followed by donkey anti-rabbit IgG-peroxidase
conjugate (Amersham). The detection was performed with ECLTM Western Blotting Detection
Reagents (Amersham) following the manufacturer’s protocol. For internal control, the blot was
reprobed with mouse monoclonal anti-COX I antibodies at 0.4 µg/ml (Molecular Probes),
followed by sheep anti-mouse IgG-peroxidase conjugate (Amersham) and ECLTM detection. The
quantitation of protein amount was performed using a densitometer (Shimadzu). For Western
blot analysis of NRF-1, the blot was incubated with rabbit anti-NRF-1 serum (1:6000) for 1 h at
room temperature, followed by donkey anti-rabbit IgG-peroxidase conjugate (Amersham). The
detection was performed as described above. For internal control, the blot was reprobed with
mouse monoclonal anti-Ku70 antibodies (Neomarker, 1:1000), followed by sheep anti-mouse
IgG-peroxidase conjugate (Amersham) and ECLTM detection.
Electrophoretic Mobility Shift Assay (EMSA). The DNA binding reactions for NRFs were
performed as described previously (24). Briefly, oligonucleotides were labeled with [γ-32P]ATP
by using polynucleotide kinase, then annealed to double-strand oligonucleotides. Binding
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
11
reactions were carried out in 20 µl of reaction mixture containing 20 µg of nuclear extract, 4 µg
of poly(dI-dC), 0.2 ng of labeled oligonucleotide, 25 mM Tris, pH 7.9, 6.25 mM MgCl2, 0.5 mM
EDTA, 0.5 mM DTT, 50 mM KCl, and 10% (vol/vol) glycerol. For competition, specified molar
excess of unlabeled oligonucleotide was incubated with the extract at RT for 15 min prior to the
addition of labeled oligonucleotide. For supershift assays, 1 µl of antiserum was added first and
incubated for 30 min prior to addition of labeled oligonucleotide. The binding reactions were
incubated at RT for 15 min. The samples were electrophoresed on 5% polyacrylamide gel
(acrylamide : bis = 58 : 1) in 0.5 × TBE for 2.5 hr at 10V/cm. The gel was dried and then
exposed to a PhosphorImager screen.
The binding reaction for Sp1 was performed as described (17). Briefly, Sp1 consensus
oligonucleotide was labeled with [γ-32P]ATP by using polynucleotide kinase, and then annealed
into double-strand oligonucleotides. For the binding reaction, 10 µg of nuclear extract was
incubated with 0.2 ng of labeled oligonucleotide in the buffer containing 2 µg of poly(dI-dC), 10
mM Hepes, pH 7.9, 60 mM KCl, 5 mM MgCl2, 0.5 mM DTT, 10% glycerol. For competition,
the extract was incubated with 100 fold molar excess of unlabeled Sp1 consensus or mutant
oligonucleotide for 15 min on ice prior to the addition of labeled Sp1 consensus oligonucleotide.
The binding reaction was incubated on ice for 30 min, and electrophoresed on 4%
polyacrylamide gel (acrylamide:bis = 38.7:1.3) in 0.25 × TBE buffer. The gel was then dried and
exposed to X-ray film (Kodak).
The DNA sequences of oligonucleotides used for the EMSA were as follows:
RC4 –173/-147: 5'-GATCATGCTAGCCCGCATGCGCGCGCACCTT-3'
3'-TACGATCGGGCGTACGCGCGCGTGGAATCGA-5'
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
12
rTfam –95/-70: 5'-AACGGTGGGGGACACACTCCGCCTCC-3'
3'-TTGCCACCCCCTGTGTGAGGCGGAGG-5'
hTFAM –34/-13: 5'-GATCTCTACCGACCGGATGTTAGCAGATT-3'
5'-AGATGGCTGGCCTACAATCGTCTAATCGA-5'
rTfam –52/-27: 5'-GCTGCAGACCGGAAGTCTGGGCCTCC-3'
3'-CGACGTCTGGCCTTCAGACCCGGAGG-5'
Sp1 consensus:
5'-ATTCGATCGGGGCGGGGCGAGC-3'
3'-TAAGCTAGCCCCGCCCCGCTCG-5'
Sp1 mutant:
5'-ATTCGATCGGTTCGGGGCGAGC-3'
3'-TAAGCTAGCCAAGCCCCGCTCG-5'
In Vivo Genomic Footprinting. The procedure was essentially as described (17). Briefly, nuclei
were isolated as described above. For in vivo footprinting, the nuclei (1 × 108) were treated with
0.2% dimethylsulfate (DMS) for 2 min at RT followed by 3 washes in ice-cold PBS. Then the
nuclei were resuspended in 10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 followed by
addition of an equal volume of 2X TNESK solution (20 mM Tris-HCl, pH 7.4, 200 mM NaCl, 2
mM EDTA, 2% SDS, 200 µg/ml proteinase K). The lysis of nuclei was carried out for overnight
at RT. Genomic DNA was then isolated following the standard protocol. Meanwhile, genomic
DNA was also isolated from control nuclei that were not treated with DMS. Then the control
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
13
DNA samples were treated with 0.2% DMS for 2 min at RT, immediately followed by addition
of DMS stop solution (1.5 M Sodium acetate, pH 7.0, 1 M β-mercaptoethanol, 10 µg yeast
tRNA) and 3 volume of cold absolute ethanol. The DMS-treated DNA samples were cleaved by
piperidine for 30 min at 90 °C, followed by five times of lyophilization in a Speed Vac without
heat. Then the DNA pellets were dissolved in dH2O, and precipitated by addition of 0.1 vol. of 3
M sodium acetate, pH 7.0, 10 µg yeast tRNA, and 2.5 vol. absolute ethanol for 15 min at –20 °C.
Finally, the DNA pellets were dissolved in TE buffer, and quantified by measuring OD260
absorbance.
For reactions of ligation-mediated PCR (LM-PCR), amplification, and labeling, two sets of three
nested primers were designed following the criteria optimal for IVGF. The minus-strand primers
are: TFAFP3'-1: 5'-CCTACACACAGCCACGAAAC-3' (annealing temp: 57 °C), TFAFP3'-2:
5'-GGTACTCCAGGGGCTTGTTATC-3' (annealing temp: 59 °C), TFAFP3'-3: 5'-CTCCAGGG
GCTTGTTATCATGC-3' (annealing temp: 63 °C). The plus-strand primers are: TFAFP5'-1: 5'-
CCTTCCAGCAGAATACTCAGAG-3' (annealing temp: 56 °C), TFAFP5'-2: 5'-AGCAACACC
CTTGCCAAAC-3' (annealing temp: 59 °C), TFAFP5'-3: 5'-CAACACCCTTGCCAAACTAAA
CCG-3' (annealing temp: 64 °C). Each sample of 2.5 µg of DNA was used for the reaction that
was performed as described previously (17). The reactions were resolved on 6% sequencing gel,
dried, and then exposed to PhosphorImager screen.
Immunocytochemistry and Microscopy. The hepatoma nuclei prepared as above were used for
immunocytochemistry in order to remove the mitochondrial background. The
immunofluorescence procedure was essentially as described by Iborra et al (25). Briefly, the
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
14
nuclei purified by centrifuging through sucrose cushion twice and washing with the nuclear wash
buffer (0.34 M sucrose, 1 mM MgCl2, 0.3% Triton X-100, 2 µg/ml aprotinin, 2 µg/ml leupeptin,
1 µg/ml pepstatin A) were resuspended in PBS containing 100 mg/ml BSA, then fixed with 4%
paraformaldehyde on coverslips for 15 min at 4 °C, followed by 8% paraformaldehyde for 20
min at room temperature. The fixed nuclei were then treated with 0.3% Triton X-100. The
coverslips were blocked with 1% BSA for 1 hr at room temperature, then incubated with affinity
purified polyclonal rabbit anti-Tfam (1 µg/ml) and mouse anti-COX I (2 µg/ml, Molecular
Probes) antibodies for 1 hr at room temperature. After three washes in PBS, the coverslips were
incubated with Cy3-conjugated anti-rabbit IgG (Jackson ImmunoResearch, 1:200) and FITC-
conjugated anti-mouse IgG (Jackson ImmunoResearch, 1:200) for 1 hr at room temperature.
After three more washes with PBS, the coverslips were mounted with Vectashield mounting
medium containing DAPI (Vector Laboratories). The specificity of staining was assessed with
three different controls: 1) substitution of the primary antibody with normal rabbit IgG (1 µg/ml,
Sigma), 2) omission of the primary antibody, and 3) using the nuclei not washed with the nuclear
wash buffer as a positive control for COX I detection. Standard microscopy was performed using
Nikon E800 microscope equipped with HiQ FITC and TRITC/DAPI dual wavelength filter sets
(Chroma Technology) and nuclei were photographed under the ×60 oil-immersion lens. The
immunostained pure nuclei were also examined under a Bio-Rad MRC-600 confocal microscope
and photographed under the ×60 oil-immersion lens. The z-series images were captured and
converted into TIFF files using the Confocal Assistant software (Bio-Rad). The confocal
microscopy was performed at the Campus Microscopy and Imaging Facility at the Ohio State
University.
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
15
Citrate Synthase Assay. The citrate synthase was used as a mitochondrial marker to check the
purity of rat hepatoma nuclear extract. The assay was performed as described by Srere and
Kosicki (26). Briefly, the assay mixture contained 67 mM Tris-HCl, pH 8.0, 0.4 mM oxaloacetic
acid (OAA), and 0.15 mM acetyl-CoA in a final volume of 1.5 ml. The reaction was initiated by
adding specified amount of either nuclear or mitochondrial extract. The absorbance at 233 nm
was measured kinetically using a Beckman DU 640B spectrophotometer.
RESULTS
Tfam Gene Expression Is Upregulated in the Rat Hepatoma
Since Morris hepatoma 3924A is a rapidly growing tumor, we examined the mRNA level of
Tfam in the hepatoma and compared with that of the host liver. Northern blot analysis with
mouse Tfam as a probe suggested higher level (~8 fold) of Tfam expression in the hepatoma
relative to the host liver (Fig. 1A). To confirm and extend this observation, we studied the role of
Tfam in the mitochondrial function in this tumor (see Experimental Procedures for the
generation of this solid tumor). First, we constructed the rat hepatoma cDNA library and
generated Tfam cDNA clone. The full-length rat Tfam cDNA clone was nearly identical to the
Tfam entry (accession no. AB014089) in the GenBank. We then overexpressed Tfam in the
bacteria and purified the recombinant protein by affinity chromatography. The recombinant
mature form of Tfam was ~28 kDa on SDS-polyacrylamide gel, which is slightly greater than the
molecular size of the recombinant mouse Tfam (7). Polyclonal antibodies generated against the
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
16
recombinant Tfam reacted specifically with rat, mouse, and human Tfam in a Western blot
analysis (data not shown). Western blot analysis showed significantly higher Tfam protein level
in rat hepatoma (about 11 fold) relative to the host liver (Figure 1B, C). These data suggest that
the transcription of its gene and/or its translation is elevated in the hepatoma. To semi-quantify
the expression of its gene at mRNA level in the hepatoma, RT-PCR analysis was performed
using poly(A)+ RNA with gene-specific primers. The data showed that the steady state level of
Tfam transcripts was at least 10 fold higher in the hepatoma than that in the liver (Figure 1D, E),
implying that Tfam gene is upregulated at the transcriptional level or its mRNA is relatively
more stable in the hepatoma compared to the host liver.
Expressions of the Regulatory Factors of Tfam Gene Are Upregulated in the Hepatoma
Since the Tfam gene expression is significantly elevated in the rat hepatoma relative to the host
liver, we predicted that the key regulatory factors such as NRF-1 and NRF-2 involved in
humanTFAM gene transcription are likely to be upregulated in the hepatoma. The steady-state
levels of NRF-1 and NRF-2 mRNAs were analysed by semi-quantitative RT-PCR. As shown in
Figure 2A, NRF-1 and NRF-2 mRNA levels increased about 5 and 3 fold, respectively, in the
hepatoma compared to the levels in control liver. We then determined the NRF-1 protein level in
the liver and tumor using specific antibodies against this protein. The NRF-1 protein level was at
least three fold higher than that in the host liver, which suggests transcriptional control of NRF-1
gene expression as well in the tumor (Figure 2B). NRF-1 is known to undergo phosphorylation,
and serine phosphorylation in the amino-terminal domain can enhance DNA binding activity
(27). It was present predominantly in the phosphorylated state (the upper band in the Fig. 2B) in
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
17
both liver and hepatoma nuclei. NRF-2 protein level was not measured due to unavailability of
specific antibodies.
DNA Binding Activities of the Transcription Factors NRF-1 and Sp1 But Not of NRF-2 Are
Augmented in the Hepatoma
Human TFAM promoter is known to contain three major DNA-binding elements (11). It was of
interest to determine the conservation of these sequence elements between rat and human TFAM
gene promoters. The sequence alignment showed well conserved binding sites for Sp1 and NRF-
2, but no consensus NRF-1 binding site was observed in the proximal rat Tfam promoter (Figure
3A). Further analysis of rat Tfam promoter sequence of –462 to +100 (the longest promoter
sequence we can get from the GenBank database) could not reveal any NRF-1 consensus
sequence. Interestingly, sequence analysis revealed two other Sp1 binding sites upstream of the
conserved Sp1 site in the rat Tfam promoter. For the sake of convenience, these three Sp1 sites
are referred to as Sp1-A (-64 to –57), Sp1-B (-108 to –101), and Sp1-C (-121 to –116),
respectively, in the order from 3' to 5' orientation. To measure the DNA binding activity of these
factors in the rat hepatoma and host liver, electrophoretic mobility shift assay was performed in
the nuclear extracts prepared from the hepatoma and host liver. We used 32P labeled Sp1
consensus oligonucleotide as a probe for measuring Sp1 DNA binding activity. Two Sp1
complexes were formed with either the liver or the hepatoma nuclear extract (Fig. 3B). These
complexes could be disrupted by the 100 fold molar excess of unlabeled Sp1 consensus but not
mutant oligonucleotide, which confirmed the specificity of the complex formation. The Sp1
DNA binding activity was four fold higher in the hepatoma relative to the liver.
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
18
We also measured NRF-1 and NRF-2 binding activities in the rat hepatoma and host liver
nuclear extracts. For measurement of the DNA binding activity of NRF-2, the nuclear extracts
prepared from liver and hepatoma were incubated with 32P labeled NRF-2 oligonucleotide
corresponding to the human TFAM promoter (hTFAM –34/-13). The DNA binding activity of
NRF-2 was comparable in the liver and hepatoma (compare lanes 1 and 2 in Fig. 3C). Two
complexes were formed with human TFAM promoter sequence. Both complexes could be
competed by 50 fold molar excess of unlabeled TFAM promoter oligonucleotide (Fig. 3C, lanes
3 and 4). Interestingly, only the upper complex could be competed by the oligonucleotide
corresponding to NRF-2 element in the rat Tfam promoter at a concentration as low as 50 fold
molar excess (Fig. 3C, 7-10). The lower complex was not competed even at 100 fold molar
excess of rat NRF-2 oligonucleotide. Thus, only one NRF-2 complex can be formed with the rat
Tfam promoter sequence although NRF-2 forms two major complexes with human TFAM
promoter sequence. The specificity of the NRF-2 complexes was confirmed further by the lack
of competition with two unrelated oligonucleotides: the NRF-1 element of rat somatic
cytochrome c gene (RC4 –173/-147) and rat Tfam –95/-70, the sequence that aligned with the
human NRF-1 element (lanes 5, 6, 11, and 12 in Fig.3C).
For NRF-1 EMSA, similar assay was performed using the rat hepatoma and liver nuclear
extracts and the NRF-1 element from RC4 promoter (-173/-147) as a probe. The DNA binding
activity of NRF-1 in the hepatoma was about 4 fold higher than that in the liver (Fig. 3D,
compare lanes 2 and 3). The specific complex could be competed by 50 fold molar excess of
unlabeled NRF-1 element of an unrelated promoter, RC4 –173/-147 (lanes 4 and 5). The
complex could not, however, be competed out with 100 fold molar excess of rat Tfam promoter-
based oligonucleotide (rTfam –52/-27) that corresponds to NRF-1 element located in the human
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
19
TFAM promoter (based on a sequence alignment). This observation suggests that unlike the
corresponding region in the human TFAM promoter, rat Tfam –52/-27 sequence does not harbor
any NRF-1 binding site. The DNA binding data show that all the three major trans-acting factors
known to be involved in humanTFAM gene expression are abundant in the hepatoma and may
play critical role in the upregulation of Tfam expression in the rat hepatoma.
NRF-2 and Sp1 Binding Sites on Rat Tfam Promoter Are Occupied in vivo
To explore the involvement of NRF-1, -2 and Sp1 in rat Tfam promoter activation in vivo, we
performed in vivo genomic footprinting. We designed rat Tfam gene specific primers for LM-
PCR that would allow us to analyze the proximal promoter region (-141 to –3 bp with respect to
transcription start site). Nuclei isolated from rat liver and Morris hepatoma were subjected to
dimethyl sulfate treatment, genomic DNA was isolated and cleaved with piperidine, and Tfam
promoter region was amplified as described in Experimental Procedures. Naked genomic DNA
from both liver and hepatoma was also treated in a similar manner as intact nuclei and similar
PCR reactions were performed to provide the genomic G ladder. DNA-protein interaction
protecting a G residue at a cis-element was shown as a less intense band on the sequencing gel,
whereas more intense bands indicate hypersensitive G residues due to factor binding when
compared with naked DNA ladder. The footprinting data of the upper strand of hepatoma Tfam
promoter showed that two G residues in NRF-2 consensus binding site (-42 GGAA –39) were
protected by factor binding. Four G residues in and adjacent to NRF2 binding sites became
hypersensitive of which two are at the 3' end boundary, one inside the binding site, and another is
at the 5' end boundary (Fig. 4B). Distinct footprinting was also observed at Sp1-A site as shown
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
20
in the Fig. 4B. One G residue was protected in the Sp1-A binding site (-64 GCCCGCC –57), and
two G residues were hypersensitive of which one is in the Sp1 consensus sequence, and another
at the immediate upstream of the Sp1-A site. The footprinting analysis of the lower strand
detected two protected sites (underlined G residues) at the Sp1-A (-57 GGCGGGGC –64) and
Sp1-B (-101 GGCGGGGC –108) sites, respectively (Fig. 4A and B). A few hypersensitive G
residues were also observed on the lower strand. Three of them are located at the Sp1-C site (-
116 GGGCGG –121). Two other hypersensitive G residues are located at the 5' end boundary of
Sp1-A and Sp1-B binding site, respectively (Fig. 4A and B). No footprint was observed in the
sequence from –70 to –95 bp on rat Tfam promoter, which corresponds to the NRF-1 site in the
human TFAM promoter based on the alignment of these two promoter sequences (see Fig. 3A).
This is consistent with the electrophoretic mobility shift data where oligonucleotide
corresponding to putative rat NRF-1 element could not interact with the NRF-1 protein (Fig.
3D). These data suggest the probable involvement of NRF-2 and Sp1 in the rat Tfam gene
expression.
The Expressions of Mitochondrial Genes Regulated by Tfam Are Upregulated in the Rat
Hepatoma
Because Tfam is the major regulator of mitochondrial genome transcription in mammalian cells,
it is likely that the mitochondria-encoded genes are upregulated in the rat hepatoma in response
to enhanced Tfam expression. RT-PCR analyses were performed to explore the differential
expression of the mitochondrial genes such as COX I, II, ND1, 5, 6, and ATPase 6 in the
hepatoma and liver. Among these genes, the expressions of COXI, II and ND5 were elevated 10,
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
21
8, and 5 fold, respectively, in the hepatoma whereas the expression of ND6 was moderately high
(3 fold increase). On the other hand, the mRNA levels of ND1 and ATPase 6 were almost
identical in the tumor and liver (Figure 5). These data show that several proteins coded by
mtDNA are upregulated in the hepatoma at the mRNA level. This observation is consistent with
the upregulation of Tfam in the tumor.
Increased Expression of Tfam Occurs in Other Rodent Hepatoma Cells
To determine whether the upregulation of Tfam gene expression is a common event in the
hepatoma cells, we analyzed both mRNA and protein levels of Tfam in two other lines of rodent
hepatomas: rat H4-II-E-C3 and mouse Hepa cells. We performed RT-PCR analysis of the Tfam
gene expression using the same set of primers and identical PCR conditions for both cell lines
and control liver tissue. The RT-PCR data showed increased Tfam mRNA levels in both tumor
cells compared to the corresponding normal liver tissue. Interestingly, the mouse liver exhibited
higher basal expression of Tfam than rat liver (Figure 6A). The elevated expression of Tfam was
also observed at the protein level in the hepatoma cells as shown by Western blot analysis
(Figure 6B). It was also noted that the molecular size of rat Tfam (~28 kDa) is slightly larger
than that of mouse Tfam (~25 kDa). The molecular weight difference is probably due to the
amino acid composition. These data show that the upregulation of Tfam expression may be a
common phenomenon in at least hepatoma cells.
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
22
Tfam Exhibits Two Subcellular Locations in the Rat Hepatoma
In mouse, two forms of Tfam have been observed, one is the mitochondrial form and the other
one is a testis-specific nuclear form (7). Overexpression of this protein in the hepatoma prompted
us to investigate its subcellular localization in this tumor tissue. To determine the subcellular
distribution, pure nuclear and mitochondrial fractions from both tissues were isolated followed
by Western blot analysis of the proteins in the two subcellular fractions using anti-Tfam
antibodies. Tfam was indeed present in the hepatoma nuclei but not in the liver nuclei (Fig. 7A).
We also performed immunoprecipitation with anti-Tfam antibody using liver and hepatoma
nuclear extract. Western blot analysis of the protein immunoprecipitated with anti-Tfam antibody
(Fig. 7B) showed that Tfam was pulled down selectively from the hepatoma nuclear extract
which further confirmed enrichment of Tfam only in the hepatoma nuclear extract. To rule out
the possibility of mitochondrial contamination of the nuclear extract, we reprobed the same blot
with the antibody against the mitochondrial protein COX I. No COX I was detected in the
hepatoma nuclear extract, although it was very abundant in both liver and hepatoma
mitochondria (Fig. 7A). We also assayed the activity of citrate synthase in the hepatoma nuclear
and mitochondrial extracts, as the citrate synthase localized in the mitochondrial matrix is
commonly used as a mitochondrial marker. The citrate synthase activity increased with
increasing protein concentration when assayed with the hepatoma mitochondrial extract but was
barely detectable in the nuclear extract prepared from the same tissue (Fig. 7C). These results
further confirmed expression of an isoform of mitochondrial Tfam in the hepatoma nucleus.
To demonstrate further this unique phenomenon of dual subcellular localization of Tfam in the
rat hepatoma, we performed immunocytochemistry using isolated nuclei to eliminate the
mitochondrial background. The nuclei were purified by passing twice through sucrose cushion
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
23
followed by washing with the nuclear wash buffer containing 0.3% Triton X-100 to get rid of all
mitochondrial contaminants. Fluorescence microscopy showed that the nuclei were stained with
anti-Tfam IgG (Fig. 8A, panel a) but not by normal rabbit IgG (panel c), which suggested the
specificity of immunostaining. To confirm that the observed nuclear immunostaining was indeed
due to nuclear Tfam, we used antibodies specific for a mitochondrial marker enzyme, COX I.
The negative staining with the monoclonal anti-COX I antibody ruled out again the possibility of
any mitochondrial contamination (panels b and d). This finding strongly favors dual locations of
Tfam in the rat hepatoma. To examine further the distribution of Tfam within the nucleus,
confocal microscopy was performed with pure nuclei. With the aid of analysis software (Bio-Rad
Confocal Assistant software), the serial sections were captured from the top to the bottom of
the nucleus. The equatorial view indeed demonstrated localization of Tfam in the nucleus, and its
general distribution throughout the nucleus (Fig. 8B).
DISCUSSION
Mitochondria are involved in multiple cellular processes such as energy metabolism, apoptosis,
and generation of reactive oxygen species (ROS). The alteration of mitochondrial functions has
been reported in a variety of tumors, and is believed to play an important role in tumorigenesis
and tumor proliferation (8, 28-32). HeLa cells devoid of mitochondria (rho0) lose the capability
to form tumors when injected subcutaneously in nude mice. The tumorigenicity was restored
after the normal human fibroblast mtDNA was introduced (33). The rho0 cells derived from
human glioblastomas and breast cancer cells lose the capacity for anchorage-independent
growth, and this capability was restored upon introduction of the normal DNA-containing
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
24
mitochondria (34). As a key mitochondrial transcription factor, Tfam is essential for
mitochondrial biogenesis. The Tfam-/- knockout embryos die at the early embryonic stage with
severe mtDNA depletion. The heterozygous Tfam+/- knockout mice can survive but exhibit
reduced number of mtDNA and decreased mitochondrial gene expression in several organs (6).
In the fast growing tumors like Morris Hepatoma 3924A (doubling time: 4-5 days; tumor
growth: attaining 15-20 g within 4-5 weeks), not only more energy is needed to meet the rapid
proliferation rate, but very active mitogenesis is required to maintain relatively stable number of
mitochondria in the tumor cells. The present study revealed a significant increase in the overall
expression of Tfam in the hepatoma (about 10 and 11 fold in the levels of mRNA and protein
relative to the liver, respectively). The increased expression of Tfam was also observed in two
other hepatoma cell lines, H4-II-E-C3 and Hepa. These data suggest a common biochemical
phenotype with respect to interaction between nucleus and mitochondria in the hepatoma cells or
perhaps in rapidly growing tumors.
The increased expression of Tfam implies that the hepatoma contains critical factors in the nuclei
that can markedly activate the promoter of Tfam. Nuclear respiratory factors (NRF-1 and NRF-
2) have been suggested to play a key role in the transcription of human TFAM (10, 11). The
increase in mRNA and protein levels for NRF-1 as well as its binding to the respective cis
element and the increase in mRNA level for NRF-2 in the rat hepatoma relative to host liver
(Figure 2) are consistent with this notion. The augmented expression of these transcription
factors may be responsible for the upregulation of Tfam gene in the hepatoma. Sp1 is involved in
the transcriptional activation of numerous genes. The glutamine-rich activation domains of Sp1
are very important for protein-protein interaction. In Huntington's disease, this interaction could
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
25
be disrupted by the mutant huntingtin that contains an expanded glutamine tract (35).
Specifically, this mutant protein associates with Sp1 and TAFII130 and interferes with the
interaction of the latter two proteins. In this study, we found that the binding of Sp1 to the cis
element was also elevated in the hepatoma relative to the host liver, which suggests the
contribution of Sp1 to the transcription activity of Tfam gene in the rat hepatoma. These findings
agree with the mutational analysis of the TFAM promoter, which showed 4.4-fold reduction in
the reporter activity of human TFAM promoter following mutations in the Sp1, site. (11).
Binding of NRF-1 to its consensus element was not competed by the rat Tfam promoter sequence
–95/-70 (rTfam –95/-70) which is located in the similar position on the promoter to the human
NRF-1 element by sequence alignment analysis (Fig. 3D). Moreover, no conserved NRF-1
recognition site was observed in the rat Tfam promoter spanning from –1 to -132 (Fig. 3A).
The in vivo genomic footprinting data further suggested that NRF-2 and Sp1 are probably
involved in the regulation of Tfam gene. To our knowledge, this is the first report regarding the
occupancy of the binding sites of these transcription factors on Tfam promoter in the chromatin
context. The NRF-2 recognition site contains the consensus GGAA motif, and the G residues
(underlined) in the motif were significantly protected on the rat Tfam promoter in vivo, which is
consistent with the methylation interference footprinting for NRF-2 site on human TFAM
promoter (11). Three Sp1 recognition sites (Sp1-A, B, C) were identified in the rat Tfam
promoter (Fig. 3A). All of them were found to be footprinted as indicated by either protection at
particular G residues or hypersensitivity of G residues along the binding sites. Together with the
EMSA, these data demonstrate that the binding sites for Sp1 and NRF-2 are functional in rat,
which is consistent with the sequence analyses by us and others (14). Because no conserved
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
26
NRF-1 recognition site was observed in the proximal promoter of rat Tfam gene, no footprint for
NRF-1 was identified by IVGF at least in the region analyzed. In human, the region spanning
–55 to –72 demonstrated NRF-1 consensus site. No consensus NRF-1 site was detected within
this region of the rat Tfam promoter. The lack of footprinting at this site further reinforce the
notion that rat Tfam promoter does not harbor any NRF-1 site within the first 141 bp upstream
promoter region. In addition, analysis of the available rat Tfam promoter sequence up to –462 bp
did not reveal any NRF-1 consensus element. In this respect, the human TFAM promoter differs
from the corresponding rat promoter, as the latter promoter contains an NRF-1 consensus
sequence to which NRF-1 binds and trans-activates the human gene.
Since mitochondria provide the energy in the form of ATP for the cellular processes including
cell growth and proliferation, it is not unexpected to observe alterations of mitochondrial gene
expression in the fast-growing tumors. The elevated mitochondria-encoded gene expression has
been reported in a variety of solid tumors including cancers of breast, colon, liver, kidney, and
lung in human (8). The mRNA level of COX II increased in the breast cancer samples compared
to non-malignant tissue. No changes were observed in the mRNA levels for ND2, ND4, and
ATPase 6 (9). In rat Zajdela hepatoma cells, the steady-state mRNAs for COX I, II, and ND2
were elevated by five fold compared to the resting liver cells. In addition, it was also found that
the mitochondrial number decreased in this hepatoma (36). In another chemically induced rat
hepatoma, the elevated transcripts for ND5, COX II, and 16S rRNA were observed. No
differential expression of ND1 was found between the hepatoma and normal hepatocytes (37).
The steady state levels of transcripts for COX I, COX II, ND5, ND6 are elevated in the Morris
hepatoma 3924A compared to the host liver, which is consistent with the increased expression of
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
27
Tfam. No changes in the expression of ND1 and ATPase 6 were, however, observed. This
observation is consistent with mitochondrial gene transcription in other tumors including cancers
of breast, colon, liver, and some other rat hepatomas (9, 36-38). The present study has shown a
correlation between Tfam activity/level and the expression of some proteins coded by
mitochondrial DNA.
Interestingly, a nuclear isoform of Tfam was detected in the rat hepatoma. This unusual
localization was confirmed by different techniques including subcellular fractionation, Western
blot analysis, and immunocytochemistry. What is the probable function(s) of the nuclear form of
Tfam? The presence of HMG boxes in the Tfam protein suggests its potential role in the nuclear
transcription. The actual function of this nuclear form has not been established. A nuclear
isoform of Tfam from mouse testis (TS-HMG) has also been reported (7). The TS-HMG is a
splicing variant of Tfam, which is different from Tfam only in the first exon. Its physiological
function is, however, not clear, although a possible role as a nuclear transcription activator or as
a structural protein in the compaction of the nuclear DNA during spermatogenesis has been
suggested. The TS-HMG was not, however, detected in the human or rat testis (14). Further
study is necessary to establish the role of the nuclear isoform in the rat hepatoma.
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
28
Acknowledgments
We sincerely thank Dr. Nils-Göran Larsson (Karolinska Institute, Stockholm, Sweden) for
providing pN26 clone, Dr. Richard C. Scarpulla (Northwestern University Medical School) for
generously providing anti-NRF-1 antibody, Dr. Arthur H. Burghes for the generous use of his
microscopy facility for the fluorescence work, Dr. Jill Rafael for providing the Cy3 and FITC
conjugated IgG, Dr. Douglas R. Pfeiffer for advice on citrate synthase assay, Dr. Peter R. Cook
(Sir William Dunn School of Pathology, University of Oxford, Oxford, UK) for useful
discussions on paraformaldehyde fixation of isolated nuclei, Dr. Daniel D. Coovert for assistance
in fluorescence microscopy, and Qin Zhu for critically reading this manuscript.
REFERENCES
1. Fisher, R. P., and Clayton, D. A. (1985) J. Biol. Chem. 260, 11330-11338.
2. Fisher, R. P., Topper, J. N., and Clayton, D. A. (1987) Cell 50, 247-258.
3. Parisi, M. A., and Clayton, D. A. (1991) Science 252, 965-969.
4. Landsman, D., and Bustin, M. (1993) Bioessays 15, 539-546.
5. Taanman, J. W. (1999) Biochim. Biophys. Acta 1410, 103-123.
6. Larsson, N. G., Wang, J., Wilhelmsson, H., Oldfors, A., Rustin, P., Lewandoski, M., Barsh, G.S., and Clayton, D. A. (1998) Nat. Genet. 18, 231-236.
7. Larsson, N. G., Garman, J. D., Oldfors, A., Barsh, G. S., and Clayton, D. A. (1996) Nat. Genet.13, 296-302.
8. Penta, J. S., Johnson, F. M., Wachsman, J. T., and Copeland, W. C. (2001) Mutat. Res. 488,119-133.
9. Sharp, M. G., Adams, S. M., Walker, R. A., Brammar, W. J., and Varley, J. M. (1992) J.Pathol. 168, 163-168.
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
29
10. Scarpulla, R. C. (1997) J. Bioenerg. Biomembr. 29, 109-119.
11. Virbasius, J. V., and Scarpulla, R. C. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1309-1313.
12. Gugneja, S., Virbasius, C. M., and Scarpulla, R. C. (1996) Mol. Cell. Biol. 16, 5708-5716.
13. Tominaga, K., Akiyama, S., Kagawa, Y., and Ohta, S. (1992) Biochim. Biophys. Acta 1131,217-219.
14. Rantanen, A., Jansson, M., Oldfors, A., and Larsson, N. G. (2001) Mamm. Genome 12, 787-792.
15. Scheffler, I. E. (2001) Adv Drug Deliv Rev 49, 3-26.
16. Ferri, K. F., and Kroemer, G. (2001) Bioessays 23, 111-115.
17. Ghoshal, K., Majumder, S., Li, Z., Dong, X., and Jacob, S. T. (2000) J. Biol. Chem. 275, 539-547.
18. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159.
19. Quertermous, T. (1996) in Current Protocols in Molecular Biology (Ausubel, F. M., Brent, R.,Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., eds) Vol. 1, pp.6.1.1-6.1.4, John Wiley & Sons, Inc., New York
20. Cooper, H. M., and Paterson, Y. (1997) in Current Protocols in Molecular Biology (Ausubel,F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K.,eds) Vol. 2, pp. 11.12.11 - 11.12.19, John Wiley & Sons, Inc., New York
21. Rice, J. E., and Lindsay, J. G. (1997) in Subcellular Fractionation: A Practical Approach(Graham, J. M., and Rickwood, D., eds), pp. 107-119, IRL Press, New York
22. Rose, K. M., Morris, H. P., and Jacob, S. T. (1975) Biochemistry 14, 1025-1032.
23. Harlow, E., and Lane, D. (1999) Using antibodies: a laboratory manual, Cold Spring HarborLaboratory Press, New York
24. Evans, M. J., and Scarpulla, R. C. (1990) Genes Dev. 4, 1023-1034.
25. Iborra, F. J., Jackson, D. A., and Cook, P. R. (2001) Science 293, 1139-1142.
26. Srere, P. A., and Kosicki, G. W. (1961) J. Biol. Chem. 236, 2557-2559
27. Gugneja, S., and Scarpulla, R. C. (1997) J. Biol. Chem. 272, 18732-18739.
28. Brand, K. (1997) J. Bioenerg. Biomembr. 29, 355-364.
29. Capuano, F., Guerrieri, F., and Papa, S. (1997) J. Bioenerg. Biomembr. 29, 379-384.
30. Dorward, A., Sweet, S., Moorehead, R., and Singh, G. (1997) J. Bioenerg. Biomembr. 29, 385-392.
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
30
31. Mathupala, S. P., Rempel, A., and Pedersen, P. L. (1997) J. Bioenerg. Biomembr. 29, 339-343.
32. Preston, T. J., Abadi, A., Wilson, L., and Singh, G. (2001) Adv Drug Deliv Rev 49, 45-61.
33. Hayashi, J., Takemitsu, M., and Nonaka, I. (1992) Somat. Cell Mol. Genet. 18, 123-129.
34. Cavalli, L. R., Varella-Garcia, M., and Liang, B. C. (1997) Cell Growth Differ. 8, 1189-1198.
35. Dunah, A. W., Jeong, H., Griffin, A., Kim, Y. M., Standaert, D. G., Hersch, S. M., Mouradian,M. M., Young, A. B., Tanese, N., and Krainc, D. (2002) Science 296, 2238-2243.
36. Luciakova, K., and Kuzela, S. (1992) Eur. J. Biochem. 205, 1187-1193.
37. Corral, M., Paris, B., Baffet, G., Tichonicky, L., Guguen-Guillouzo, C., Kruh, J., and Defer, N.(1989) Exp. Cell Res. 184, 158-166.
38. Lu, X., Walker, T., MacManus, J. P., and Seligy, V. L. (1992) Cancer Res. 52, 3718-3725.
39. Majumder, S., Ghoshal, K., Datta, J., Bai, S., Dong, X., Quan, N., Plass, C., and Jacob, S. T.
(2002) J. Biol. Chem. 277, 16048-16058
FOOTNOTES
The nucleotide sequence reported in this paper has been deposited in the GenBankTM under
accession number AF377866.
1 The abbreviations used are: mtDNA, mitochondrial DNA; TFAM, human mitochondrial
transcription factor A; Tfam, rodent mitochondrial transcription factor A; HMG, high mobility
group; NRF, nuclear respiratory factor; LSP, light-strand promoter; BSA, bovine serum albumin;
PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; EMSA,
electrophoretic mobility shift assay; IVGF, in vivo genomic footprinting; RACE, rapid
amplification of cDNA ends; CS, citrate synthase; RT, reverse transcriptase; PCR, polymerase
chain reaction.
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
31
LEGENDS FOR FIGURES
FIGURE 1: Increased expression of Tfam gene in the rat hepatoma. (A) Northern blot
analysis of the mRNA levels of Tfam in the rat liver and hepatoma. Five µg each of rat liver and
hepatoma poly(A)+ mRNAs were resolved on 1.2% formaldehyde-agarose gel and transferred to
membrane. The membrane was hybridized with mouse Tfam and MBD-2 cDNAs sequentially.
MBD-2 was chosen as an internal control, as previous study showed that its mRNA levels are
comparable in the rat hepatoma and host liver (39). Lanes 1 and 2 represent rat liver (L) and
hepatoma (H) mRNA samples, respectively. (B) Immunoblotting of Tfam in the rat liver and
hepatoma. Mitochondrial extract (15 µg protein) from rat liver (L) or hepatoma (H) was resolved
on 12% SDS-polyacrylamide gel. The lower portion (below 50 kDa marker) of the gel was
transferred to ECL membrane. The blot was analysed with anti-Tfam antibodies. To show equal
loading of protein, a non-specific protein signal (NS) from the same blot and the Coomassie
Brilliant Blue R250 staining of the upper portion of the gel are included. (C) Semi-quantitation
of Tfam protein level. The protein signal from the ECL detection was quantified using a
densitometer, the ratio of Tfam/NS was then calculated. The data were derived from three
independent experiments, and are plotted as mean ± standard error. (D) Tfam mRNA levels for
liver (L) and hepatoma (H) were analysed by RT-PCR. The generated PCR products were
electrophoresed on 1.5% agarose gel, and stained with ethidium bromide. As an internal control,
the RT-PCR for rat β-actin mRNA was also performed using the same amount of mRNA. (E)
Relative quantitation of Tfam mRNA. The band signals from the agarose gel images in panel D
were quantified using Kodak Digital Science 1D image analysis software (Eastman Kodak
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
32
Company). The mRNA ratios of Tfam/β-actin were then calculated. The data were derived from
three independent sets of mRNA samples, and are plotted as mean ± standard error.
Figure 2. Upregulation of transcription factors NRF-1 and NRF-2 in the rat hepatoma
relative to the host liver. (A) The steady level of mRNAs for NRF-1 and NRF-2 were analysed
by RT-PCR. Each sample (20 ng of poly(A)+ mRNA) was reversely transcribed, and amplified
by gene-specific primers. The PCR products were separated on 1.5% agarose gel, and the image
was captured by a digital camera (Kodak). Lanes 1 and 2 represent rat liver (L) and hepatoma
(H) mRNA, respectively. (B) The protein level of NRF-1 was analysed by immunoblotting with
anti-NRF-1 antibodies. Nuclear extracts (90 µg protein) from rat liver and hepatoma were
separated on 12% SDS-PAGE, transferred to nitrocellulose, and the protein detected by anti-
NRF-1 using anti-Ku70 antibodies as a control. Lanes 1 and 2 correspond to rat liver and
hepatoma nuclear extracts, respectively.
Figure 3. The DNA binding activity of Sp1 and NRFs in the rat liver and hepatoma. (A)
The cis-elements in the proximal promoter of rat Tfam gene. The proximal promoter of rat Tfam
gene (Accession no. AF264733) was aligned with the corresponding human sequence (13). The
defined cis-elements in human TFAM promoter are underlined, and the identical residues are
bolded and indicated by asterisks. The cis-elements on the rat Tfam promoter are indicated by
dashed line above the sequence. The transcription initiation sites for human (13) and rat Tfam
(14) genes are indicated by bent arrows. (B) The DNA binding activity of Sp1 in the rat liver
and hepatoma nuclear extracts. The 32P-labeled Sp1 consensus oligonucleotides were incubated
with 10 µg of protein under optimal binding conditions. Lanes 1-2 indicate the reactions with
liver and hepatoma nuclear extract (LNE, HNE) in the absence of competitor, respectively.
Lanes 3-4 represent reactions with LNE and HNE, respectively, in the presence of 100 fold
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
33
molar excess of unlabeled Sp1 consensus oligonucleotide (wt-Sp1). Lanes 5-6 represent the
reactions with LNE and HNE in the presence of Sp1 mutant oligonucleotide (mut-Sp1). The non-
specific complex (NS) is also indicated. (C) The DNA binding activity of NRF-2 in the rat liver
and hepatoma nuclear extracts. The 32P-labeled NRF-2 recognition site in the human TFAM
promoter (hTFAM –34/-13) was incubated with either rat liver or hepatoma nuclear extract (20
µg protein) for the binding assays. Lanes 1-2, no competitor; lanes 3-4, in the presence of 50 fold
molar excess of unlabeled hTFAM –34/-13 oligonucleotide; lanes 5-6, in the presence of 50 fold
molar excess of NRF-1 recognition site in the rat RC4 gene promoter (RC4 –173/-147); lanes 7-
10, in the presence of 50 or 100 fold molar excess of NRF-2 recognition site in the rat Tfam
promoter (rTfam –52/-27), respectively; lanes 11-12, in the presence of 50 fold molar excess of
the rTfam –95/-70 oligonucleotide. The formed complexes (I and II) are indicated by the arrows.
(D) The DNA binding activity of NRF-1 in the rat liver and hepatoma. The 32P-labeled NRF-1
oligonucleotide of RC4 gene (RC4 –173/-147) was used as a probe for the binding assays. Lane
1, free probe; lane 2-3, binding with liver and hepatoma nuclear extracts (LNE and HNE),
respectively; lanes 4-7, in the presence of 50 or 100 fold molar excess of unlabeled RC4 –173/-
147 oligonucleotide, respectively; lanes 8-11, in the presence of 50 or 100 fold molar excess of
rTfam –95/-70, respectively; lanes 12-13, in the presence of anti-NRF-1 antibody. The specific
complex, non-specific complex and supershift complex are represented by CX, NS and SS,
respectively.
Figure 4. In vivo genomic footprinting of the proximal promoter of rat Tfam gene. (A) The
overview of IVGF profile on the rat Tfam promoter. The sequence of –32 to –131 bp of rat Tfam
promoter is shown. The recognition sites for Sp1 and NRF-2 are outlined by the boxes. The
protected G residues on the upper and lower strands of the Tfam promoter are indicated by
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
34
arrows. The hypersensitive G residues on the upper and lower strands are marked by asterisks.
(B) In vivo genomic footprinting of the rat T f a m promoter. The in vivo footprinting was
performed to check the occupancy of binding sites of the transcription factors on the rat Tfam
gene promoter in vivo. Lanes 1-4 and 5-8 indicate the reactions for the upper and lower strand of
rat Tfam promoter, respectively. Lanes 1, 5 and 2, 6 represent in vitro (N) and in vivo (V) DMS-
treated liver genomic DNA, respectively. Lanes 3, 7 and 4, 8 indicate in vitro and in vivo DMS-
treated hepatoma genomic DNA, respectively. The recognition sites for Sp1 and NRF-2 are
indicated by the vertical lines. The protected G residues are pointed by the arrows, and the
hypersensitive G residues are marked with the asterisks.
Figure 5: Increased expression of mitochondrial genes in the rat hepatoma. The mRNA
levels of mitochondria-encoded genes including COX I, II, ND1, 5, 6, and ATPase 6 were
analysed by RT-PCR. The same amount of cDNA for rat liver and hepatoma (lanes 1 and 2,
respectively) was used for the PCR reactions. The PCR products were resolved on 1.5% agarose
in TAE buffer. The β-actin gene was used as internal control for RT-PCR.
Figure 6: Upregulation of Tfam in other hepatoma cells. (A) The mRNA levels of Tfam in
the rat hepatoma H4-II-E-C3 and mouse hepatoma cells were analysed by RT-PCR. The same
amount of cDNA of each sample was used for the PCR reactions. The RT-PCR for β-actin was
also performed as internal control. (B) The protein levels of Tfam in the above two lines of
hepatomas were also analysed by immunblotting. Mitochondrial extracts (30 µg each) were
resolved on 12% SDS-polyacrylamide gel, and Tfam identified by Western blot using anti-Tfam
antibodies. Anti-COX I antibodies were used as a control. A non-specific protein signal (NS)
was also included to indicate equal loading of proteins.
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
35
FIGURE 7: The dual subcellular localization of Tfam in the hepatoma. (A) Detection of
Tfam in the hepatoma nuclear extract by Western blot analysis. Each sample of 30 µg of protein
extract was resolved on 12% SDS polyacrylamide gel and transferred to ECL membrane
(Amersham). The blot was detected with polyclonal anti-rat Tfam. To rule out the possibility of
mitochondrial contamination in the nuclear extracts, the same blot was reprobed with mouse
monoclonal anti-COX I antibody. A non-specific protein signal from either nuclear or
mitochondrial extract was also included for loading control. Lanes 1, 2, correspond to liver and
hepatoma nuclear extracts (LNE, HNE), respectively; lanes 3, 4, represent liver and hepatoma
mitochondrial extracts (LME, HME), respectively. (B) Immunoprecipitation of Tfam from
hepatoma nuclear extract. Nuclear extracts (500 µg) from liver (LNE) and hepatoma (HNE) were
used for immunoprecipitation. The immune complexes were analysed by SDS-PAGE and
Western blot using anti-rat Tfam antibodies. Lanes 1, 3, immunoprecipitation controls in the
absence of antibody for the liver and hepatoma nuclear extracts, respectively; lanes 2, 4,
immunoprecipitation of liver and hepatoma nuclear extracts, respectively, with anti-rat Tfam
antibodies. (C) Total citrate synthase (CS) activities in the hepatoma nuclear and mitochondrial
extracts. Varying amount of the extracts (25, 50, 75, 100 µg protein) were used for the assay.
Total CS activity in each extract was represented by the substrate turnover in nmols per minute.
The data were derived from three different extracts, and are plotted as mean ± standard error.
FIGURE 8: Detection of Tfam in the rat hepatoma nucleus by fluorescence microscopy. (A)
Either pure (with Triton X-100 wash) or partially pure (without Triton X-100 wash) nuclei were
fixed with paraformaldehyde, and blocked with 1% BSA, then incubated with affinity purified
anti-Tfam (1 µg/ml) and mouse monoclonal anti-COX I (2 µg/ml) antibodies. After three washes
in PBS, the coverslips were incubated with Cy3-conjugated anti-rabbit IgG (1:200) and FITC-
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
36
conjugated anti-mouse IgG (1:200). The microscopy was performed using Nikon E800
microscope and nuclei were photographed under the ×60 oil immersion lens. The total
magnification for the captured images is 600 ×. In all panels, Cy3 (pink), DAPI (blue), and FITC
(green) indicate staining for Tfam, DNA, and COX I, respectively. Panel a, Tfam staining in pure
nuclei; panel c, the negative control for rabbit anti-Tfam antibodies using normal rabbit IgG;
panel e, Tfam staining in partially pure nuclei; panels b, d, COX I staining in the pure nuclei;
panel f, COX I staining in the partially pure nuclei. (B) The confocal microscopy of hepatoma
nuclei. Pure nuclei treated as above were also examined under a Bio-Rad MRC-600 confocal
microscope and photographed under the ×60 oil immersion lens. The total magnification for the
image is 600 ×. The equatorial section is shown here.
Table 1: RT-PCR primers and reaction conditions
Primer names Sequences Annealing temperature Cycle number
Tfam-F 5'-AGTTCATACCTTCGATTTTC-3' 52 °C 30
Tfam-B 5'-TGACTTGGAGTTAGCTGC-3'
COX I-F 5'-CCCCC TGCTATAACCCAATATCAG-3' 60 °C 22
COX I-B 5'-TCCTCCATGTAGTGTAGCGAGTCAG-3'
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
37
COX II-F 5'-GGCTTACCCATTTCAACTTGGC-3' 60 °C 25
COX II-B 5'-CACCTGGTTTTAGGTCATTGGTTG-3'
ND1-F 5'-TTCGCCCTATTCTTCATAGCCG-3' 60 °C 22
ND1-B 5'-GGAGGTGCATTAGTTGGTCATATCG-3'
ND5-F 5'-CTACCTTGCTTTCCTCCACATTTG-3' 60 °C 25
ND5-B 5'-AAGTGATTATTAGGGCTCAGGCG-3'
ND6-F 5'-CTGCTATGGCTACTGAGGAATATC-3' 58 °C 30
ND6-B 5'-GCAAACAATGACCACCCAGC-3'
ATP6-F 5'-TCACACACCAAAAGGACGAACC-3' 60 °C 22
ATP6-B 5'-CTAGGGTAGCTCCTCCGATTAG-3'
NRF1-F 5'-GTATGCTAAGTGCTGATGAA-3' 58 °C 35
NRF1-B 5'-GGGTTTGGAGGGTGAGAT-3'
NRF2-F 5'-GCACAGAAGAAAGCATTG-3' 56 °C 35
NRF2-B 5'-AGTGTGGTGAGGTCTATATC-3'
β-actin-F: 5'-TTGTCCCTGTATGCCTCTGGTC-3' 62 °C 22
β-actin-B: 5'-TTGATCTTCATGGTGCTAGGAGC-3'
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
β-actin
Tfam
D. RT-PCRL H
1 2Liver Hepatoma
E. Relative quantitation of Tfam mRNA
Tfa
m/β
-act
in m
RN
A r
atio
0.15
1.58
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
0
Tfam
L H
1 2
B. Immunoblotting
C. Relative quantitation of Tfam protein
Liver Hepatoma
Tfa
m/N
S p
rote
in r
atio
0.26
2.96
0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
1 2
Tfam
MBD-2
L H
A. Northern blot
Figure 1
NS
Coomassie
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
L H
NRF-1
NRF-2
1 2
β-actin
A B
L H
1 2
NRF-1
Ku-70
ImmunoblottingRT-PCR
Figure 2
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
R-Tfam AGCCGCAGGCTCCGCCCCCAGTCAGCCCCGCCCACTGA---ACGGTGGGGGACACACTCCH-TFAM GCT-CTTATTCCTCCCCC-GCGAGGCC-GCCCACCGGGGTACGCTCTCCCGCGC-CTGC
** * *** ***** * ** ** ****** * *** * * * ** *
R-Tfam GCC--TCCCGTTT-GCCCCGCCTCCTGCTGCAGACCGGAAGTCTG--GGCCTCCCACAGTH-TFAM GCCAATTCCGCCCCGCCCCGCCCCCATCTACCGACCGGATGTTAGCAGATTTCCCATAGT *** * *** ******** ** ** * ******* ** * * ***** ***
R-Tfam GCCCCGCGCGCGCGGCGGGCATGATAACAAGCCCCTGGAGTACC-CACGCGGGTH-TFAM GCCTCGC-TA-GTGGCGGGCATGATAACACACGCC-GGAGGGTCGCACGCGGGT *** *** * **************** * ** **** * *********
+1
+1NRF-1 NRF-2Sp1
Sp1-A
Sp1-BSp1-C
NRF-1NRF-2
+33+50-1
-20
-2-21
G
-61-75
-76-62-117
-132
Figure 3A
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
1 2 3 4 5 6
Sp1 complex
-
-
-
+-
-
-
-
+ -
+L
NE
HN
E
I
II
1 2 3 4 5 6 7 8 9 10 11 12
Extract
- - - - - - - - - -
- - - - - - - - - -
- - - -- - - -
- - - - - - - -- -
hTFAM -34/-13
RC4 -173/-147
rTfam -52/-27
rTfam -95/-70
B
LN
E
HN
E
LN
EH
NE
LN
E
HN
E
LN
EH
NE
LN
E
HN
E
LN
EH
NE
50X
50X
50X
50X
50X
50X
50X
50X
100X
100X
C
D
1 2 3 4 5 6 7 8 9 10 11 12 13
RC4 -173/-147
rTfam -95/-70
α-NRF-1
Extract
- - -
50X
50X
100X
100X
50X
50X
100X
100X
- -- - - -
- - - - - - - - -
+ +- - - - - - - - - - -
LN
E
HN
EL
NE
HN
E
LN
E
HN
EL
NE
HN
EL
NE
HN
EL
NE
HN
E
-
NS
CX
SS
Figure 3B-D
LN
E
HN
E
LN
E
HN
E
wt-Sp1
mut-Sp1 +
NS
Free probe
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
GCCGCAGGCT CCGCCCCCAG TCAGCCCCGC CCACTGAACG GTGGGGGACACGGCGTCCGA GGCGGGGGTC AGTCGGGGCG GGTGACTTGC CACCCCCTGT
-131 -82
Sp1-C Sp1-B** * *
CACTCCGCCT CCCGTTTGCC CCGCCTCCTG CTGCAGACCG GAAGTCTGGGGTGAGGCGGA GGGCAAACGG GGCGGAGGAC GACGTCTGGC CTTCAGACCC
-81 -32
Sp1-A NRF-2
* ** *
*
** **
Figure 4A
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
COX II
L H
ND5
ND6
COX I
ND1
ATPase 6
β-actin
Figure 5
1 2
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
Tfam
β-actin
rLiv
er
H4
mL
iver
Hep
a
A. RT-PCR
B. Immunoblotting
Tfam
COX I
1 2 3 4
rLiv
er
H4
mL
iver
Hep
a
Figure 6
1 2 3 4
NS
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
Tfam
LN
E
HN
E
LM
E
HM
ECOXI
IgG
Tfam
anti-Tfam - + - +
LNE HNE
0 5 0 7 5 1 0 0
6 0
5 0
4 0
3 0
2 0
1 0
0
To
tal
acti
vity
of
Cit
rate
Syn
thas
e(n
mo
ls o
f su
bst
rate
tu
rno
ver
per
min
)
2 5
HME
HNE
Amount of extracts (µg)
C. Total CS Activity
A. Immunoblotting B. Immunoprecipitation
Figure 7
1 2 3 41 2 3 4
NS
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
a
c
Cy3 + DAPI FITC
anti-Tfam
Control IgG
A
B
anti-COXI
anti-COXI
anti-Tfamanti-COXI
a b
c d
e fe
Figure 8
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
JacobXiaocheng Dong, Kalpana Ghoshal, Sarmila Majumder, Satya P. Yadav and Samson T.
rat hepatomaMitochondrial transcription factor A and its downstream targets are upregulated in a
published online August 26, 2002J. Biol. Chem.
10.1074/jbc.M206958200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 11, 2020
http://ww
w.jbc.org/
Dow
nloaded from
Top Related