© 2019. Published by The Company of Biologists Ltd.
Keratins regulate Hsp70-mediated nuclear localization of
p38 Mitogen-activated protein kinase
So-Young Lee1, †, Sujin Kim1, †, Younglan Lim1, Han-Na Yoon1 and Nam-On Ku1, 2, 3
1Interdisciplinary Program of Integrated OMICS for Biomedical Science, Graduate School, Yonsei
University, Seoul 120-749, Korea and 2Department of Bio-Convergence ISED, Underwood
International College, Yonsei University, Seoul 120-749, Korea
† These two authors contributed equally to this work.
3Corresponding Author Address: Nam-On Ku
Interdisciplinary Program of Integrated OMICS for Biomedical Science, Graduate School, Yonsei
University, Seoul 120-749, Korea and Department of Bio-Convergence ISED, Underwood
International College, Yonsei University, Seoul 120-749, Korea
Telephone #: +82-2-2123-2697
FAX #: +82-2-364-8660
E-mails: [email protected]
Summary: Keratins are associated with p38 MAPK, but the effect of this interaction in cell
signaling is unknown. Lee et al. show that keratin 8 interacts with p38 via a specific docking site
and modulates the formation of the p38-Hsp70 complex, which regulates the subcellular
localization of p38.
Abbreviations; CD, common docking; Egr1, early growth response-1; ERK, extracellular signal-
regulated kinase; Hsp70, heat shock protein 70; IP, immunoprecipitation; JNK, c-Jun N- terminal
kinase; K, keratin; MAPK, mitogen-activated protein kinase; NLS, nuclear localization signal;
OA, okadaic acid; WT, wild type
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
JCS Advance Online Article. Posted on 19 August 2019
ABSTRACT
Intermediate filament protein keratin (K) 8 binds to Hsp70 and p38 MAPK, and is phosphorylated
at Ser74 by p38. However, a p38 binding site on K8 and the molecular mechanism of K8-p38
interaction related to Hsp70 are unknown. Here, we identify a p38 docking site on K8 (Arg148/149
and Leu159/161) that is highly conserved in other intermediate filaments. The docking-deficient
K8 mutation causes increased p38-Hsp70 interaction and enhanced p38 nuclear localization,
indicating that the p38 dissociated from mutant K8 makes a complex with Hsp70, known as a
potential chaperone for p38 nuclear translocation. Comparison of p38 MAPK binding with liver
disease-associated keratin variants shows that K18-I150V variant dramatically reduces binding
with p38, which is similar to the effect of the p38 docking-deficient mutation on K8. Since the p38
docking site on K8 (Arg148/149 and Leu159/161) and the K18-Ile150 residue are closely localized
in parallel K8/K18 heterodimer, the K18-I150V mutation may interfere K8-p38 interaction. These
findings show that keratins modulate the p38 nuclear localization, functioning as a cytoplasmic
anchor for p38, which might affect a number of p38-mediated signal transduction pathways.
Key Words: Keratin/ Intermediate filament/p38 MAPK/Hsp70/ Nuclear translocation
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
INTRODUCTION
Keratins (K) are the primary intermediate filament proteins present in epithelial cells (Eriksson et
al., 2009; Omary et al., 2009). They are subdivided into acidic type I (K9–K28; K31–K40) and
basic type II keratins (K1–K8; K71–K86), which form obligatory type I/type II keratin
heteropolymers (Jacob et al., 2018; Schweizer et al., 2006). Keratins are expressed in both tissue-
specific and cell type-specific manners. For example, simple epithelia, including liver, express K8
and K18, whereas stratified epithelia, such as epidermis, express K5 and K14 (Gonzales and Fuchs,
2017; Omary et al., 2009). Keratins play a particularly important role in providing mechanical
support for cells and enhancing their structural integrity (Coulombe and Omary, 2002; Kumar et
al., 2015). In addition, they also play an important role in non-mechanical functions such as
intracellular cell signaling by modulating cell growth, apoptosis, and cancer progression (Pan et
al., 2013).
Keratins are modulated by post-translational modifications such as phosphorylation,
which is known to regulate the assembly/disassembly of the filament, solubility, and subcellular
localization (Loschke et al., 2015; Omary et al., 2006; Snider and Omary, 2014). Mitogen-
activated protein kinase (MAPK) pathways are significant signal transduction modules that
regulate cell proliferation, differentiation, and apoptosis (Kyriakis and Avruch, 2012; Nishida and
Gotoh, 1993). MAPKs are activated by phosphorylation of their conserved Thr-X-Tyr dual
phosphorylation motif in response to a wide variety of cellular stressors (Raingeaud et al., 1995).
Previous studies have shown that the K8 Ser74 and Ser432 sites, matching a pSer/Thr-Pro
consensus motif for the MAPK target sequence, are phosphorylated by proline-directed MAPKs
such as extracellular signal-regulated kinases (ERKs) and c-Jun N-terminal kinases (JNKs) (He et
al., 2002; Ku et al., 2002a). In addition, p38, another member of the MAPKs family, associates
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
with K8/K18 and phosphorylates K8 Ser74, thereby significantly affecting keratin filament
reorganization (Ku et al., 2002a). Nevertheless, the interaction regions in K8 that are required for
specific and efficient phosphorylation by p38 have not been reported, and the functions of these
interactions are not fully understood.
MAPKs bind to their substrates via different sites. The interaction between the catalytic
cleft of the kinase and the phosphorylation site of the substrate is a key contributor to kinase-
substrate recognition (Ubersax and Ferrell, 2007). Moreover, the additional docking motif involves
increasing the overall specificity and efficiency of kinase-substrate interaction (Ubersax and
Ferrell, 2007). Two distinct docking domains, D domains and DEF domains (Docking sites for
ERK, FXFP), are well established in MAPK substrates (Cargnello and Roux, 2011; Ubersax and
Ferrell, 2007). The D domains are characterized by one or two basic residues, a short spacer, and
a hydrophobic groove (R/K1-2 –X2-6 -φ-X-φ, where φ is a hydrophobic residue) (Cargnello and
Roux, 2011; Tanoue and Nishida, 2003). Another MAPK docking site is known as the DEF
domain, which consists of a Phe/Tyr-X-Phe/Tyr-Pro motif and is identified in ERK and other
MAPK substrates (Fantz et al., 2001; Kyriakis and Avruch, 2012). The basic and hydrophobic
residues of the D domain in MAPK substrates bind to the acidic and hydrophobic area of MAPKs
called the common docking domain (CD domain) (Tanoue et al., 2000). Multiple domains on
MAPKs and their substrates cooperatively contribute to enhancing the specificity and efficiency
of signal transduction (Kyriakis and Avruch, 2012).
The translocation of MAPKs into the nucleus is important for the physiological function
upon extracellular stimulation. The p38 MAPKs reside in both the cytosol and the nucleus, and
phosphorylated p38 translocates into the nucleus upon environmental stress (Wood et al., 2009).
Although the p38 kinase does not contain the canonical nuclear localization signal (NLS), the
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
kinase translocates into the nucleus by interaction with importin-7 and importin-9 (Maik-Rachline
et al., 2018) or binding with NLS-containing Hsp70 (Gong et al., 2012). Notably, Hsp70 is known
to shuttle between the cytoplasm and nucleus, functioning as a chaperone responsible for the
translocation of client proteins such as importin α/β, Smad3, and p38 (Kose et al., 2005; Snider
and Omary, 2014; Zhou et al., 2010). Interestingly, under stress, K8-Hsp70 interaction is increased
(Liao et al., 1995) while K8-p38 interaction is reduced (Lee et al., 2013). Although Hsp70 is a
potential chaperone for p38 nuclear translocation in response to stress (Gong et al., 2012), the
underlying mechanism of the nucleo-cytoplasmic translocation of p38 related to K8 and Hsp70
remains largely unknown.
In this study, we identified a docking site (148RRQLETLGQEKLKL161) in K8 that plays a
critical role in its binding to p38. Mutations in these residues effectively reduced the ability of K8
to associate with p38 while at the same time increasing p38-Hsp70 binding, which led to p38
nuclear localization. Furthermore, the liver disease–associated keratin variant K18-I150V
significantly decreased its association with p38 while at the same time enhancing p38 nuclear
localization. Although K18 has neither p38 specific docking site nor phosphorylated site by p38,
the K18-I150V mutation interferes K8-p38 interaction likely due to the spatial proximity between
p38 docking sites on K8 (Arg148/149 and Leu159/161) and the K18-Ile150 residue in parallel
K8/K18 heterodimer. Moreover, the expression of the p38-dependent target genes such as
inducible nitric oxide synthase (iNOS), vascular cell adhesion molecule (VCAM), and vascular
endothelial growth factor C (VEGFC) tends to more increased in cells transfected with the K18
I150V mutant as compared with controls. Taken together, these results indicate that the interaction
of K8 and p38 is critical in determining the efficiency of p38-Hsp70 complex formation, which
affects the p38 nuclear localization and thereby p38-dependent signal transduction pathways.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
RESULTS
Interaction of K8/K18 with p38 kinase is phosphorylation-dependent
A previous study has shown that p38 kinase directly binds to K8 and phosphorylates K8 at Ser74
(Ku et al., 2002a). Based on an overlay assay with purified p38 kinase, the study clearly
demonstrates that p38 specifically interacts with K8 but not K18 (Ku et al., 2002a). The binding
of p38 and K8 is reduced by treatment with okadaic acid (OA), known as a protein phosphatase
inhibitor, which implies that their interaction is inhibited by phosphorylation (Lee et al., 2013).
To address whether the phosphorylation of the K8 Ser74 residue affected the interaction between
K8 and p38 kinase, BHK cells were transfected with K8 WT or K8 mutants containing
substitutions of Ser 74 with alanine (S74A) or aspartic acid (S74D) to block or to mimetic
phosphorylation, respectively. Immunofluorescence staining showed that the transfection
efficiencies were approximately similar in the cells transfected with different plasmids (Fig. S1).
Co-immunoprecipitation experiments have shown that K8 S74A enhances the interaction between
K8 and p38, whereas K8 S74D greatly reduces this interaction, suggesting that K8 Ser74
phosphorylation interferes with K8–p38 binding (Fig. 1A). The increased p38-K8 S74A
interaction as compared with p38-K8 WT is observed under treatment of OA (protein phosphatase
inhibitor) (Fig. S2A) and the p38-K8 WT interaction is almost equivalent to the p38-K8 S74A
interaction under treatment of PP2A phosphatase (Fig. S2B). It indicates that p38 is more
favorable to binding to the dephosphorylated K8/K18. Taken together, these results show that the
interaction between K8/K18 and p38 is phosphorylation-dependent.
The dual phosphorylation at the tri-peptide motif Thr-X-Tyr located in the activation loop
of p38 kinase is crucial for p38 to perform its physiological functions (Raingeaud et al., 1995). To
explore whether the dual phosphorylation in p38 has an effect on the K8–p38 association, we
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
compared K8 binding with p38 WT or p38 AF, a kinase-dead dominant negative form of p38 that
is mutated at the dual phosphorylation sites. Our results showed that when compared with p38
WT, p38 AF enhanced the interaction with K8/K18 (Fig. 1B), suggesting that p38 phosphorylation
inhibited the p38 interaction with K8/K18. This result (Fig. 1B) agreed with the result of the
previous study which demonstrated that p38 kinase was released from K8/K18 under a stress, such
as treatment with anisomycin, that causes the phosphorylation/activation of p38 (Lee et al., 2013).
Indeed, Raf kinase was also released from K8/K18 upon Raf hyperphosphorylation/activation
during oxidative stress (Ku et al., 2004). Taken together, our findings indicate that K8/K18 binds
and sequesters p38 under basal conditions, whereas stress-induced phosphorylation/activation of
p38 causes the dissociation of p38 from K8/K18, which allows the released p38 to be involved in
signal transduction under stress conditions.
K8 has a docking site for interaction with p38 kinase
In addition to the pSer/Thr-Pro consensus motif on the MAPK substrate, MAPKs also interact with
other additional docking domains on their substrates, including the D domain and the DEF domain,
to increase the efficiency and specificity of signal transduction (Cargnello and Roux, 2011). The
D domain is well-characterized by one or two positively charged amino acids surrounded by
hydrophobic residues (R/K1-2 –X2-6 -φ-X-φ, where φ is a hydrophobic residue) (Tanoue and
Nishida, 2003). In our study, we found six clusters of positively charged amino acids as potential
D domains for p38 in K8 and seven in K18 (Table 1). However, neither K8 nor K18 contains a
potential DEF domain consisting of a Phe/Tyr-X-Phe/Tyr-Pro motif.
To test the potential D domains in K8/K18, we constructed keratin mutants in which the
positively charged amino acids (R, K) were replaced by negatively charged glutamic acid (E)
(Table 1) and compared the binding efficiency with p38 kinase. Each keratin mutant is analyzed
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
based on the effect of mutation to p38 binding and Ser74 phosphorylation. The interaction between
p38 and K8 is not completely correlated with the phosphorylation status of K8 Ser74 (Fig. 2A).
For example, keratin mutations such as K185, R186E or R301/302E, K304E, positively correlate
with Ser74 phosphorylation but not with p38 binding. This suggests the involvement of other
kinases in Ser74 phosphorylation. Interestingly, K8 R148/149E mutation shows a dramatic effect
on both Ser74 phosphorylation and p38 binding (Fig. 2A). Taken together, the co-
immunoprecipitation assay showed that K8 R148/149E markedly decreased keratin-p38
interaction, while other mutations had minimal effects (Fig. 2A and 2B). Hence, in this study, we
focused on the R148/149E mutant. R148/149 residues lie downstream of the phosphoacceptor site
(Ser 74) in K8. Notably, the disrupted interaction between K8 R148/149E and p38 resulted in a
reduction of K8 Ser 74 phosphorylation (Fig. 2A), demonstrating that the positively charged amino
acids in the docking site contribute to binding and phosphorylation efficiency.
Given the D domain is well-characterized by one or two positively charged amino acids
surrounded by hydrophobic residues (R/K1-2 –X2-6 -φ-X-φ, where φ is a hydrophobic residue)
(Tanoue and Nishida, 2003), to further identify the p38 docking site on K8, L159/161 hydrophobic
amino acids nearby R148/149 residues in K8 were mutated to alanine (A). Mutations of the
positively charged residues and/or hydrophobic residues in K8 148RRQLETLGQEKLKL161 caused
a great reduction in its interaction with p38 and diminished K8 S74 phosphorylation (Fig. 2C).
Notably, quadruple mutation (R148/149E, L159/161A) more dramatically reduced K8 S74
phosphorylation (Fig. 2C), indicating that the docking interactions achieved using both two basic
amino acids and two hydrophobic amino acids are necessary for efficient phosphorylation of K8
Ser74. The p38 docking motif was localized in a rod domain of K8 and the motif was highly
conserved in other keratins and intermediate filament proteins (Table 2).
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
The newly identified D domain of K8 is particularly important for interaction with p38,
but not with ERKs and JNKs (Fig. S3), although ERKs and JNKs phosphorylate K8 Ser74 (He et
al., 2002; Ku et al., 2002a). In addition, we examined the impact of the quadruple mutation on
keratin filament organization and keratin solubility. The immunostained filament patterns of K8
WT and the R148/149E, L159/161A mutant were indistinguishable (Fig. S4A). The experiment of
serial cell fractionation demonstrated that the solubility of the quadruple mutant was similar to the
solubility of K8 WT (Fig. S4B). The mutation had no effect on both filament organization and
keratin solubility.
The CD domain in p38 kinase interacts with the docking site in K8
Several regions have been reported in the MAPK family that are involved in docking interactions
with their substrates (Rubinfeld et al., 1999; Tanoue et al., 2000). The negatively charged residues
of MAPKs establish critical electrostatic interactions with positively charged residues of the
docking domains of their substrates (Tanoue et al., 2000). The hydrophobic residues that have been
identified in MAPKs play a role in establishing hydrophobic interactions with hydrophobic
residues of the D domains of the substrate (Enslen and Davis, 2001). These sites are called common
docking (CD) domains, and they are located on the opposite side of the catalytic region of MAPKs
(Cargnello and Roux, 2011; Tanoue et al., 2001). Mutational analyses with p38 have identified the
negatively charged amino acids, Asp 313, 315, and 316 in p38 as acting the conserved docking
motif (Tanoue et al., 2000).
To examine the role of the CD domain in the p38-K8 association, we performed a co-
immunoprecipitation assay by co-transfection of K8/K18 WT with p38 WT or a mutant (CDm) in
which Asp 313, 315, and 316 were replaced by Asn. As shown in Fig. 3A, the interaction of p38
CDm with K8/K18 was significantly decreased compared with p38 WT, indicating the significance
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
of the three acidic amino acids of p38 in docking interactions with K8. We observed that the level
of K8 S74 phosphorylation is similar in both cells transfected with p38 WT or CDm. It is likely
due to K8 S74 phosphorylation by other MAPKs. Taken together, the negatively charged amino
acids in the CD domain of p38 and the positively charged/hydrophobic amino acids in the docking
site of K8 contribute to the regulation of their interaction (Fig. 3B). Two Y311 and H312 residues
of p38 are identified as the potential docking site that interact with the hydrophobic residues on
p38 substrates, and their positions are adjacent to the negatively charged residues in the CD domain
(Xu et al., 2001). The two residues of p38 likely interact with the hydrophobic residues (L159 and
L161) of K8 in the D domain (Fig. 3B).
K8 modulates the formation of p38-Hsp70 complexes and the Hsp70-mediated nuclear
translocation of p38
Since p38 and Hsp70 are known to associate with K8 (Ku et al., 2002a; Liao et al., 1995) and
Hsp70 is a potential chaperone for p38 nuclear translocation under stress (Gong et al., 2012), we
examined whether K8 could affect the formation of p38-Hsp70 complexes and thereby be involved
in p38 nuclear translocation. Co-immunoprecipitation experiments revealed that overexpression
of K8, not K18, reduced the p38-Hsp70 association (Fig. 4A), whereas overexpression of the p38
docking-deficient K8 mutant caused an increase in their interaction (Fig. 4B), suggesting that K8
regulated p38-Hsp70 association by sequestering p38 from Hsp70. The p38 MAPK has been
known to shuttle between the nucleus and the cytoplasm, and phosphorylated p38 kinase
translocates into the nucleus upon stress conditions (Brand et al., 2002; Wood et al., 2009).
Interestingly, the previous study has shown that Hsp70 interacts with p38 and serves as a potential
chaperone for nuclear translocation of p38 (Gong et al., 2012). Given that activated p38 is released
from K8/K18 under stress conditions (Lee et al., 2013) and that the kinase-inactive mutant of p38
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
(p38 AF), with mutated dual phosphorylation sites T180A and Y182F in the activation loop (Han
et al., 1994), exhibits increased interaction with K8/K18 (Fig. 1B), we hypothesize that K8/K18
may interfere with p38 nuclear translocation by sequestering p38 from Hsp70 under basal
conditions, and that phosphorylated/activated p38 kinase is released upon stress from K8/K18 and
forms a p38-Hsp70 complex that translocates into the nucleus.
To test whether K8 might influence the nuclear localization of p38 by modulating p38–
Hsp70 complex formation, the localization of p38 in both cytoplasm and nucleus was examined
using biochemical subcellular fractionation analysis. BHK cells were cotransfected with K8 WT
or with a docking-deficient mutant along with p38 and Hsp70, and were treated with OA, a
phosphatase inhibitor, which allowed for the detection of the phosphorylated/activated p38. After
OA treatment, the increased amount of p38 in the nucleus and the increased levels of
phosphorylated p38 in total lysates were observed independently of transfected K8 constructs.
However, the phosphorylated p38 was more prominently accumulated in the nucleus of cells
transfected with the p38 docking-deficient K8 mutant when compared with K8 WT (Fig. 4C).
These data clearly show that the disrupted docking interaction between K8 and p38 promotes the
nuclear distribution of phosphorylated p38. However, we observe no significant difference of
Hsp70 distribution in cells transfected with K8 WT or p38 docking-deficient K8 mutant (Fig. 4C).
It is likely that there is a technical difficulty to detect a subtle difference of Hsp70 distribution in
the subcellular fractionated lysates because Hsp70 is relatively abundant protein in cells and bind
to many different proteins for protein folding. The purity of cell fractionation was assessed in Fig
S5. We compare the p38 nuclear distribution in HepG2 cells treated with K8-specific siRNA or a
negative control sequence. We observed the reduction of K8 expression in cell treated with K8-
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
specific siRNA (Fig. S6A). However, in immunostaining assay under tested conditions, we
detected no significant difference in p38 nuclear localization in both cells (Fig. S6B).
A K18 I150V mutation interferes with p38-K8 interaction, which leads to enhanced p38-
Hsp70 formation, thereby resulting in nuclear translocation of p38
Mutations in the K8/K18 genes have been shown to be related to liver diseases (Ku et al., 2016;
Omary, 2017; Omary et al., 2004; Toivola et al., 2015). The mechanisms by which the identified
keratin mutations cause a predisposition to liver damage are not fully understood. Based on
previously described K8/K18 mutations associated with liver disease (Ku et al., 2005), we
examined whether these K8/K18 mutations have an effect on K8/K18 interaction with p38. Co-
transfection and co-immunoprecipitation assays showed that the K18 I150V variant, as compared
with the other tested variants, markedly inhibited the interaction between p38 and K8/K18 (Fig.
5A and 5B). Similar to the effect of the p38 docking-deficient K8 mutant, the co-transfected K8
WT should be heteromeric with K18 I150V variant, which resulted in less efficient
phosphorylation at K8 Ser74 (Fig. 5A). Interestingly, inhibition of K8 S74 phosphorylation in K8
G62C mutant (Fig. 5B) was observed as described in a previous study (Ku and Omary, 2006) while
the level of K8 S74 phosphorylation in other K8 mutants showed the variation without statistical
significance (Fig. 5B).
We then investigated whether K18 I150V has an effect on regulating the subcellular
localization of p38 by increasing physical interaction between p38 and Hsp70. A co-
immunoprecipitation analysis showed that the K18 I150V mutation caused a reduced association
of K8/K18-p38 kinase along with increased p38-Hsp70 interaction (Fig. 6A). Furthermore, cell
fraction analysis demonstrated that K18 I150V enhanced the nuclear localization of p38 kinase
(Fig. 6B). The purity of cell fractionation was assessed in Fig S7. We then examine the expression
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
of eight known p38-dependent target genes, including the inflammatory genes, by real-time
quantitative PCR (RT-qPCR). The expression of the target genes such as iNOS, VCAM, and
VEGFC is inclined to more increased in cells transfected with K18 I150V mutant as compared
with K18 WT (Fig 6C). These findings indicate that the interaction status between K8 and p38 is
critical in determining the efficiency of p38-Hsp70 complex formation, which may affect the
subcellular localization of p38 and thereby the expression of p38-dependent target genes (Fig. 7).
Taken together, our results suggest that K8 regulates the nuclear localization of p38, functioning
as a cytoplasmic anchor for protein kinases, which might affect a number of signal transduction
pathways.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
DISCUSSION
A role of cytoskeletal proteins in subcellular localization of proteins
Numerous studies have shown the linkage between the dynamic rearrangements of cytoskeletal
proteins and the expression of correlated genes. For example, monomeric G-actin in cytoplasm
binds to myocardin-related transcription factors (MRTFs) and retains MRTF in the cytoplasm
whereas incorporation of G-actin into filamentous actin (F-actin) filament releases MRTFs to enter
the nucleus and interact with serum response factor (SRF) (Olson and Nordheim, 2010). This
interaction causes the expression of SRP target genes. Actin cytoskeleton also involves in
localization of two related translational coactivators, Yes-associated protein 1 (YAP) and
transcriptional co-activator with PDZ-binding motif (TAZ), known as central effectors of the
Hippo signaling pathway (Aragona et al., 2013).
The role of cytoskeletons in the subcellular localization of interacting proteins is
somewhat controversial. Depending on cytoskeletal proteins and their associated proteins, their
interactions cause to promote the nuclear localization or cytoplasmic retention of the complexes.
Monomeric G-actin transports p53 towards the nucleus through direct protein-protein interaction
(Saha et al., 2016). Suppression of microtubule dynamics by TN16, which perturbs microtubule
assembly dynamics, increases the association of NF-kB with microtubules and facilitates nuclear
translocation of NF-kB (Rai et al., 2015). In contrast, microtubules bind directly to the myc-
interacting zinc finger protein (MIZ-1) and contribute to its sequestration in the cytoplasm
(Ziegelbauer et al., 2001), and K17 and K18, intermediate filament proteins, bind to the adaptor
protein 14-3-3 and the bindings cause the retention of 14-3-3 proteins in the cytoplasm (Kim et al.,
2006; Ku et al., 2002b). Although the cytoskeletal proteins clearly contribute to the subcellular
localization of interacting proteins, the molecular mechanisms, including the identification of
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
specific binding sites on the cytoskeletal proteins that interact with their partner proteins, are not
fully understood.
Characteristics of p38 and K8/K18 interaction.
Intermediate filament proteins associate with various protein kinases that phosphorylate them and
then cause filament reorganization (Omary et al., 2006; Snider and Omary, 2014). For example,
MAPKs phosphorylate lamins and cause disassembly of the nuclear lamina during mitosis
(Barascu et al., 2012; Nigg, 1992; Peter et al., 1992). Keratins, along with other intermediate
filament proteins, become phosphorylated and reorganized upon stress signals (Omary et al., 2006;
Snider and Omary, 2014). p38 MAPK, one of the stress-activated protein kinases, binds to K8/K18
heteropolymers through direct association with K8 and phosphorylates K8 Ser74 residue, which
leads to keratin filament reorganization (Ku et al., 2002a). Interestingly, p38 phosphorylates K5
Thr-150 and K6 Thr-145 in the LLS/TPL motif, which is a highly conserved motif in K8 (72LLSPL)
of type II keratins (Toivola et al., 2002). However, to date, the specific binding sites on
intermediate filament proteins where interaction with protein kinases takes place were not reported.
The findings herein represent the first evidence that the highly conserved docking domains
in keratins and other intermediate filaments mediate their interaction with specific protein kinases.
Our data clearly show that (i) the interaction of K8/K18 with p38 kinase is phosphorylation-
dependent [i.e. stress-induced phosphorylation/activation of p38 causes the dissociation of p38
from K8/K18 (Fig. 1)], (ii) K8 has a specific docking site for interaction with p38 kinase
(148RRQLETLGQEKLKL161) (Fig. 2), and (iii) the p38 docking motif on K8 is highly conserved
in other keratins and intermediate filament proteins (Table 2). The docking site on K8 is located
in the rod domain distinct from the phosphoacceptor residue, K8 Ser74, which is located in the
head domain. However, the head domain in an assembled filament folds back on the rod domain
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
and covers a coil 1A of rod domain in K8/K18 and other intermediate filaments (Herrmann and
Aebi, 2016; Premchandar et al., 2015). Thus, the phosphoacceptor residue K8 Ser74 that nominally
is located close to the N-terminus may be very close to the p38 docking motif in the rod domain
of K8, because of the folding of the head domain. Interestingly, the spacer residue between the
basic residues and the hydrophobic groove in keratins is R/K1-2 –X8-10 -φ-X-φ, which differs from
the conserved motif of D domains in other proteins, R/K1-2 –X2-6 -φ-X-φ. The longer spacer (X8-
10) in keratins likely arises due to their helical structure. Since the rod domain of keratins forms an
α-helix with 3.6 amino acid residues per turn (Eisenberg, 2003), the distance between the basic
residues and a hydrophobic groove may be closer than it seems; hence, the distance in keratins and
other proteins may have high similarity.
In addition, our study demonstrates the molecular basis for selective interaction of K8
with p38 but not other MAPKs, such as ERK1/2 and JNK1/2 (Fig. S3). Although ERK, JNK, and
p38 phosphorylate K8 Ser74 and/or Ser432 (Ku et al., 2002a; Omary et al., 2006), it seems that
they do not share the same D domain in their interaction with K8, implying that the D domain has
specificity for p38 MAPK but not for other kinases. In searching for potential D domains for p38
in K8, we found that there are six sequences in K8 and seven sequences in K18 that resemble the
docking sequences of p38 (Table 1). Although the newly identified K8 D domain for p38 is not
the D domain of other MAPKs, the remaining sites are the putative D domains for other MAPKs.
p38 docking interaction with K8 and its subcellular localization
It has been shown that docking interactions may function to regulate the nucleo-cytoplasmic
localization of MAPKs and MAPK-associated proteins. For example, the N-terminal residue of
MEK encompassing the ERK-binding site can regulate the subcellular distribution of ERK
(Fukuda et al., 1997). The p38 MAPK is distributed in both the cytosol and the nucleus, and
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
phosphorylated p38 translocates into the nucleus upon environmental stress (Wood et al., 2009).
Although the underlying mechanism of the nucleo-cytoplasmic translocation of p38 remains
largely unknown, beta-like importins-dependent processes (Maik-Rachline et al., 2018) and NLS-
containing protein (Hsp70) mediated mechanisms (Gong et al., 2012) have been reported to be
involved in p38 nuclear translocation. In addition, a previous study has demonstrated that the
microtubule depolymerizing reagent, nocodazole, can interfere with the nuclear translocation of
p38, indicating the role of cytoskeletal proteins in p38 transport (Gong et al., 2010). However, a
p38 docking site on cytoskeletal proteins, including tubulin, was not identified. Here, we identified
a p38 docking site on K8 (Fig. 2) and demonstrated the role played by keratins in Hsp70-mediated
p38 nuclear translocation (Fig. 7). K8 as a cytoplasmic anchor binds and sequesters p38 kinase
under basal conditions, whereas upon stress the phosphorylated/activated p38 phosphorylates K8
at Ser74 residue, which expedites p38 separation from keratin complexes. The released active form
of p38 makes a complex with NLS-containing Hsp70, a potential chaperone for p38 translocation
into the nucleus, which contains the substrates of p38 that are mediated in signaling pathways
under stress conditions.
Previous studies demonstrated that keratins are responsible for the localization of other
proteins. K17 and K18 interact with the adaptor protein 14-3-3 and their interaction then causes
the retention of 14-3-3 proteins in the cytoplasm (Kim et al., 2006; Ku et al., 2002b). K17 also
regulates cancer cell-cycle progression and tumor growth by promoting nuclear export of tumor
suppressor p27KIP1 (Escobar-Hoyos et al., 2015). Moreover, K19 is required for nuclear import
of transcription factor early growth response-1 (Egr1) through increased interaction between Egr1
and importin-7 (Ju et al., 2013). Our results in this study are consistent with an evidence that the
keratins influence the localization of other proteins.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Disrupted docking interaction between p38 and a liver disease-associated keratin variant
Although the K8 and K18 variants are associated with liver diseases (Ku et al., 2016; Omary et al.,
2004; Omary et al., 2009), the molecular mechanisms by which the identified keratin variants
cause a predisposition to liver damage are not fully understood. In this study, we demonstrated
that one of the tested variants, K18 I150V, significantly decreased interaction with p38 while at
the same time increasing the p38-Hsp70 complex that causes p38 nuclear localization. This
resembles the effect of p38 docking-deficient mutations on K8. Given the structural organization
of the keratins that K8 and K18 intertwine to form heterodimers—a structural organization in
which the helices run in parallel from the N- to the C-terminal (Herrmann et al., 2009)—the
observed results are likely due to the location of the K18 I150V mutation being close to the location
of the K8 docking site (Arg148/149 and Leu159/161) in heterodimers. Interestingly, K18 I150
residue is localized in the conserved potential docking site of p38 among keratins, as shown in
Table 2.
It is important to note that these molecular consequences might provide evidence for the
impact of disease-causing mutations on the outcome of liver disease. Interestingly, the results of
RT-qPCR demonstrated that the expression of tested inflammation-related genes tended to
enhance in cells transfected with K18 I150V mutant compared with control K18 WT (Fig. 6C).
Notably, the increased levels of iNOS, VCAM, and VEGFC are statistically significant (Fig. 6C).
The iNOS cause hepatotoxic effects such as hemorrhagic shock, ischemia/reperfusion injury, and
endotoxemia (Garcia-Monzon et al., 2000; Hierholzer et al., 1998; Nussler and Billiar, 1993).
Nitric oxide (NO) generated by iNOS is closely implicated in the development of various types of
liver disease such as hepatic fibrosis/cirrhosis (Iwakiri and Kim, 2015). Both VCAM and VEGFC
have been shown to regulate chronic vascular inflammation in various disease models (Hsu et al.,
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
2019; Kong et al., 2018). In summary, our results suggest that keratins regulate nuclear localization
of p38, functioning as a cytoplasmic anchor for protein kinases, which might affect a number of
signal transduction pathways and the expression of correlated genes.
MATERIALS AND METHODS
Antibodies and reagents: The antibodies used were as follows: L2A1 mouse monoclonal
antibody (Ku et al., 2004); anti-K8/K18 rabbit polyclonal antibody 8592 (Ku et al., 1995), which
recognizes human K18; rabbit anti-human/mouse K18 antibody 4668 (Ku et al., 1998); anti-p38
MAPK, phospho-p38 MAPK (Thr180/Tyr182), lamin A/C, p44/42 MAPK, and JNK2 antibodies
(Cell Signaling Technology, Danvers, MA); GFP, Hsp70, and JNK1/3 antibodies (Santa Cruz
Biotechnology, Dallas, Texas); cytokeratin 8 (TS1) and actin antibodies (Thermo Scientific,
Fremont, CA); anti-DDK antibody (OriGene, Rockville, MD); and alpha-tubulin antibody (Sigma-
Aldrich, St. Louis, MO).
Mutagenesis: Various mutations in K8, K18, and the α-isoform of p38 were constructed by PCR-
based mutagenesis. The mutants were generated using the QuikChange II XL site-directed
mutagenesis kit (Agilent Technologies, Santa Clara, CA) with designed corresponding pairs of
oligonucleotide primers. Each mutation was verified by DNA sequencing.
Cell culture and transfection: BHK-21 cells obtained from American Type Culture Collection
(Rockville, MD) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM)
supplemented with 10% fetal bovine serum (FBS), 1% penicillin/streptomycin, and 0.1%
methotrexate in the cell incubator (10% CO2, 37°C). Cells were transfected with plasmid DNA
using jetPRIME reagent (PolyPlus, Berkeley, CA, U.S.A), according to the manufacturers’
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
instructions. For analysis of cell fractionation, transfected cells were treated with okadaic acid (an
inhibitor of protein phosphatases 1 and 2A) for 2 hrs (1 ug/ml).
Co-immunoprecipitation and immunoblot analysis: The cultured cells were collected and lysed
in 1 ml of 0.5% Empigen (Sigma-Aldrich, St. Louis, MO) in a phosphate-buffered saline (PBS)
(pH 7.4) buffer containing 10 mM EDTA, 5 Mm sodium pyrophosphate, and 50 mM sodium
fluoride for 5 hrs at 4°C. After centrifugation at 14,000 rpm for 20 min, the supernatants were used
for immunoprecipitation with specific antibodies. The immunoprecipitates were resolved by SDS-
PAGE and then subjected to either Coomassie staining or immunoblotting. For immunoblotting,
proteins were transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA) and
detected with corresponding antibodies. Specific proteins were then visualized and quantified
using enhanced chemiluminescence (ECL).
Subcellular fractionation: Cells were resuspended in buffer A (containing 10 mM HEPES, 10
mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, and the proteases inhibitor cocktail) and
kept on ice for 10 min. IGEPAL CA-630 reagent (Sigma-Aldrich, St. Louis, MO) was added to a
0.5% v/v. The cytosolic fraction was isolated by centrifugation (800g, 10min at 4°C). The
remaining pellet was washed three times with the lysis buffer A and subjected to centrifugation at
800g for 10 min at 4°C. The pellets were solubilized in buffer B (containing 20 mM HEPES, 0.4
mM NaCl, 1 mM EDTA, 1mM EGTA, 1mM DTT, and the proteases inhibitor cocktail) followed
by incubation on ice for 30 min and centrifugation (16,000g, 20 min, at 4°C) to obtain the nuclear
fraction. Alpha-tubulin (cytosolic) or lamin A/C (nuclear) were used as fraction markers to verify
the purity of each fraction.
RNA purification and Real-time quantitative PCR (RT-qPCR) analysis: RNA purification
and cDNA synthesis was performed as described previously (Roh et al., 2018). In brief, total RNA
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
was isolated using TRIzol reagent (Ambion, Foster City, USA), and then cDNA was synthesized
using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Fremont, CA). RT-
qPCR was conducted using SensiFAST Sybr No-Rox Mix (Bioline, London, UK). Quantification
and relative gene expression analyses were performed by a CFX384 Real-Time PCR system (Bio-
Rad, Berkeley, CA). Primers for RT-qPCR are described in Table S1.
Statistical analysis: Densitometry was prepared using ImageJ/FIJI software and the graph data
were presented as the mean ± SD. Statistical analysis was performed using Student’s t-test from
the three independent experiments and data were analyzed using GraphPad Prism software. The
p-value of less than 0.05 was considered as statistically significant. * and ** in figures indicated
p<0.05 and p<0.005, respectively.
ONLINE SUPPLEMENTAL MATERIAL
Fig. S1 shows that transfection efficiency is approximately similar in transfected cells with K8
WT, S74A, and S74D together with K18 WT. Fig. S2 shows that p38 MAPK is more favorable to
binding to the dephosphorylated K8/K18. Fig. S3 shows that the docking-deficient mutation of K8
(R148/149, L159/161A), which disrupting the interaction with p38, has no effect on the interaction
with ERK1/2 or JNK1/2. Fig. S4 shows that the p38 docking-deficient mutation of K8 has no
effect on both filament organization and keratin solubility. Fig. S5 shows the purity of subcellular
fractions that are described in Fig. 4C. Fig. S6 shows the comparison of p38 distribution in HepG2
cells treated with K8-siRNA specific to keratin 8 or a control sequence. Fig. S7 shows the purity
of subcellular fractions that are described in Fig. 6B. Table S1 shows forward and reverse primer
sequences for RT-qPCR.
.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
ACKNOWLEDGMENTS
This work was supported by the Korean Ministry of Education, Science, and Technology grant
2016R1A2B4012808 and 2018R1D1A1A02086060, and the Yonsei University Research Fund
2018-22-0072 (to N-O.K.). The authors thank Hayan Lee for editing the manuscript.
CONFLICT OF INTEREST
The authors declare no competing financial interests.
AUTHOR CONTRIBUTIONS
So-Young Lee and Sujin Kim carried out the experiments, performed data analysis, prepared
figures, and wrote the manuscript; So-Young Lee and Younglan Lim generated plasmids; Han-Na
Yoon and Sujin Kim performed microscopic experiments; and Nam-On Ku performed data
analysis, prepared figures, and wrote the manuscript.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
REFERENCES
Aragona, M., Panciera, T., Manfrin, A., Giulitti, S., Michielin, F., Elvassore, N., Dupont, S.
and Piccolo, S. (2013). A mechanical checkpoint controls multicellular growth through
YAP/TAZ regulation by actin-processing factors. Cell 154, 1047-1059.
Barascu, A., Le Chalony, C., Pennarun, G., Genet, D., Imam, N., Lopez, B. and Bertrand, P.
(2012). Oxidative stress induces an ATM-independent senescence pathway through p38
MAPK-mediated lamin B1 accumulation. EMBO J 31, 1080-94.
Brand, P., Plochmann, S., Valk, E., Zahn, S., Saloga, J., Knop, J. and Becker, D. (2002).
Activation and translocation of p38 mitogen-activated protein kinase after stimulation of
monocytes with contact sensitizers. J Invest Dermatol 119, 99-106.
Cargnello, M. and Roux, P. P. (2011). Activation and function of the MAPKs and their substrates,
the MAPK-activated protein kinases. Microbiol Mol Biol Rev 75, 50-83.
Coulombe, P. A. and Omary, M. B. (2002). 'Hard' and 'soft' principles defining the structure,
function and regulation of keratin intermediate filaments. Curr Opin Cell Biol 14, 110-22.
Eisenberg, D. (2003). The discovery of the alpha-helix and beta-sheet, the principal structural
features of proteins. Proc Natl Acad Sci U S A 100, 11207-10.
Enslen, H. and Davis, R. J. (2001). Regulation of MAP kinases by docking domains. Biology of
the Cell 93, 5-14.
Eriksson, J. E., Dechat, T., Grin, B., Helfand, B., Mendez, M., Pallari, H. M. and Goldman,
R. D. (2009). Introducing intermediate filaments: from discovery to disease. J Clin Invest
119, 1763-71.
Escobar-Hoyos, L. F., Shah, R., Roa-Pena, L., Vanner, E. A., Najafian, N., Banach, A.,
Nielsen, E., Al-Khalil, R., Akalin, A., Talmage, D. et al. (2015). Keratin-17 Promotes
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
p27KIP1 Nuclear Export and Degradation and Offers Potential Prognostic Utility. Cancer
Res 75, 3650-62.
Fantz, D. A., Jacobs, D., Glossip, D. and Kornfeld, K. (2001). Docking sites on substrate
proteins direct extracellular signal-regulated kinase to phosphorylate specific residues. J
Biol Chem 276, 27256-65.
Fukuda, M., Gotoh, Y. and Nishida, E. (1997). Interaction of MAP kinase with MAP kinase
kinase: its possible role in the control of nucleocytoplasmic transport of MAP kinase.
EMBO J 16, 1901-8.
Garcia-Monzon, C., Majano, P. L., Zubia, I., Sanz, P., Apolinario, A. and Moreno-Otero, R.
(2000). Intrahepatic accumulation of nitrotyrosine in chronic viral hepatitis is associated
with histological severity of liver disease. J Hepatol 32, 331-8.
Gong, X., Luo, T., Deng, P., Liu, Z., Xiu, J., Shi, H. and Jiang, Y. (2012). Stress-induced
interaction between p38 MAPK and HSP70. Biochem Biophys Res Commun 425, 357-62.
Gong, X., Ming, X., Deng, P. and Jiang, Y. (2010). Mechanisms regulating the nuclear
translocation of p38 MAP kinase. J Cell Biochem 110, 1420-9.
Gonzales, K. A. U. and Fuchs, E. (2017). Skin and Its Regenerative Powers: An Alliance between
Stem Cells and Their Niche. Dev Cell 43, 387-401.
Han, J., Lee, J. D., Bibbs, L. and Ulevitch, R. J. (1994). A MAP kinase targeted by endotoxin
and hyperosmolarity in mammalian cells. Science 265, 808-11.
He, T., Stepulak, A., Holmstrom, T. H., Omary, M. B. and Eriksson, J. E. (2002). The
intermediate filament protein keratin 8 is a novel cytoplasmic substrate for c-Jun N-
terminal kinase. J Biol Chem 277, 10767-74.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Herrmann, H. and Aebi, U. (2016). Intermediate Filaments: Structure and Assembly. Cold
Spring Harb Perspect Biol 8.
Herrmann, H., Strelkov, S. V., Burkhard, P. and Aebi, U. (2009). Intermediate filaments:
primary determinants of cell architecture and plasticity. J Clin Invest 119, 1772-83.
Hierholzer, C., Harbrecht, B., Menezes, J. M., Kane, J., MacMicking, J., Nathan, C. F.,
Peitzman, A. B., Billiar, T. R. and Tweardy, D. J. (1998). Essential role of induced nitric
oxide in the initiation of the inflammatory response after hemorrhagic shock. J Exp Med
187, 917-28.
Hsu, M. C., Pan, M. R. and Hung, W. C. (2019). Two Birds, One Stone: Double Hits on Tumor
Growth and Lymphangiogenesis by Targeting Vascular Endothelial Growth Factor
Receptor 3. Cells 8.
Iwakiri, Y. and Kim, M. Y. (2015). Nitric oxide in liver diseases. Trends Pharmacol Sci 36, 524-
36.
Jacob, J. T., Coulombe, P. A., Kwan, R. and Omary, M. B. (2018). Types I and II Keratin
Intermediate Filaments. Cold Spring Harb Perspect Biol 10.
Ju, J. H., Yang, W., Lee, K. M., Oh, S., Nam, K., Shim, S., Shin, S. Y., Gye, M. C., Chu, I. S.
and Shin, I. (2013). Regulation of cell proliferation and migration by keratin19-induced
nuclear import of early growth response-1 in breast cancer cells. Clin Cancer Res 19, 4335-
46.
Kim, S., Wong, P. and Coulombe, P. A. (2006). A keratin cytoskeletal protein regulates protein
synthesis and epithelial cell growth. Nature 441, 362-5.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Kong, D. H., Kim, Y. K., Kim, M. R., Jang, J. H. and Lee, S. (2018). Emerging Roles of
Vascular Cell Adhesion Molecule-1 (VCAM-1) in Immunological Disorders and Cancer.
Int J Mol Sci 19.
Kose, S., Furuta, M., Koike, M., Yoneda, Y. and Imamoto, N. (2005). The 70-kD heat shock
cognate protein (hsc70) facilitates the nuclear export of the import receptors. J Cell Biol
171, 19-25.
Ku, N. O., Azhar, S. and Omary, M. B. (2002a). Keratin 8 phosphorylation by p38 kinase
regulates cellular keratin filament reorganization: modulation by a keratin 1-like disease
causing mutation. J Biol Chem 277, 10775-82.
Ku, N. O., Fu, H. and Omary, M. B. (2004). Raf-1 activation disrupts its binding to keratins
during cell stress. J Cell Biol 166, 479-85.
Ku, N. O., Lim, J. K., Krams, S. M., Esquivel, C. O., Keeffe, E. B., Wright, T. L., Parry, D.
A. and Omary, M. B. (2005). Keratins as susceptibility genes for end-stage liver disease.
Gastroenterology 129, 885-93.
Ku, N. O., Michie, S., Resurreccion, E. Z., Broome, R. L. and Omary, M. B. (2002b). Keratin
binding to 14-3-3 proteins modulates keratin filaments and hepatocyte mitotic progression.
Proc Natl Acad Sci U S A 99, 4373-8.
Ku, N. O. and Omary, M. B. (2006). A disease- and phosphorylation-related nonmechanical
function for keratin 8. J Cell Biol 174, 115-25.
Ku, N. O., Strnad, P., Bantel, H. and Omary, M. B. (2016). Keratins: Biomarkers and
modulators of apoptotic and necrotic cell death in the liver. Hepatology 64, 966-76.
Kumar, V., Bouameur, J. E., Bar, J., Rice, R. H., Hornig-Do, H. T., Roop, D. R., Schwarz,
N., Brodesser, S., Thiering, S., Leube, R. E. et al. (2015). A keratin scaffold regulates
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
epidermal barrier formation, mitochondrial lipid composition, and activity. J Cell Biol 211,
1057-75.
Kyriakis, J. M. and Avruch, J. (2012). Mammalian MAPK signal transduction pathways
activated by stress and inflammation: a 10-year update. Physiol Rev 92, 689-737.
Lee, J., Jang, K. H., Kim, H., Lim, Y., Kim, S., Yoon, H. N., Chung, I. K., Roth, J. and Ku,
N. O. (2013). Predisposition to apoptosis in keratin 8-null liver is related to inactivation of
NF-kappaB and SAPKs but not decreased c-Flip. Biol Open 2, 695-702.
Liao, J., Lowthert, L. A., Ghori, N. and Omary, M. B. (1995). The 70-kDa heat shock proteins
associate with glandular intermediate filaments in an ATP-dependent manner. J Biol Chem
270, 915-22.
Loschke, F., Seltmann, K., Bouameur, J. E. and Magin, T. M. (2015). Regulation of keratin
network organization. Curr Opin Cell Biol 32, 56-64.
Maik-Rachline, G., Zehorai, E., Hanoch, T., Blenis, J. and Seger, R. (2018). The nuclear
translocation of the kinases p38 and JNK promotes inflammation-induced cancer. Sci
Signal 11.
Nigg, E. A. (1992). Assembly-disassembly of the nuclear lamina. Curr Opin Cell Biol 4, 105-9.
Nishida, E. and Gotoh, Y. (1993). The MAP kinase cascade is essential for diverse signal
transduction pathways. Trends Biochem Sci 18, 128-31.
Nussler, A. K. and Billiar, T. R. (1993). Inflammation, immunoregulation, and inducible nitric
oxide synthase. J Leukoc Biol 54, 171-8.
Olson, E. N. and Nordheim, A. (2010). Linking actin dynamics and gene transcription to drive
cellular motile functions. Nat Rev Mol Cell Biol 11, 353-65.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Omary, M. B. (2017). Intermediate filament proteins of digestive organs: physiology and
pathophysiology. Am J Physiol Gastrointest Liver Physiol 312, G628-G634.
Omary, M. B., Coulombe, P. A. and McLean, W. H. (2004). Intermediate filament proteins and
their associated diseases. N Engl J Med 351, 2087-100.
Omary, M. B., Ku, N. O., Strnad, P. and Hanada, S. (2009). Toward unraveling the complexity
of simple epithelial keratins in human disease. J Clin Invest 119, 1794-805.
Omary, M. B., Ku, N. O., Tao, G. Z., Toivola, D. M. and Liao, J. (2006). "Heads and tails" of
intermediate filament phosphorylation: multiple sites and functional insights. Trends
Biochem Sci 31, 383-94.
Pan, X., Hobbs, R. P. and Coulombe, P. A. (2013). The expanding significance of keratin
intermediate filaments in normal and diseased epithelia. Curr Opin Cell Biol 25, 47-56.
Peter, M., Sanghera, J. S., Pelech, S. L. and Nigg, E. A. (1992). Mitogen-activated protein
kinases phosphorylate nuclear lamins and display sequence specificity overlapping that of
mitotic protein kinase p34cdc2. Eur J Biochem 205, 287-94.
Premchandar, A., Kupniewska, A., Tarnowski, K., Mucke, N., Mauermann, M., Kaus-
Drobek, M., Edelman, A., Herrmann, H. and Dadlez, M. (2015). Analysis of distinct
molecular assembly complexes of keratin K8 and K18 by hydrogen-deuterium exchange.
J Struct Biol 192, 426-440.
Rai, A., Kapoor, S., Singh, S., Chatterji, B. P. and Panda, D. (2015). Transcription factor NF-
kappaB associates with microtubules and stimulates apoptosis in response to suppression
of microtubule dynamics in MCF-7 cells. Biochem Pharmacol 93, 277-89.
Raingeaud, J., Gupta, S., Rogers, J. S., Dickens, M., Han, J., Ulevitch, R. J. and Davis, R. J.
(1995). Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem
270, 7420-6.
Roh, J. I., Kim, Y., Oh, J., Kim, Y., Lee, J., Lee, J., Chun, K. H. and Lee, H. W. (2018).
Hexokinase 2 is a molecular bridge linking telomerase and autophagy. PLoS One 13,
e0193182.
Rubinfeld, H., Hanoch, T. and Seger, R. (1999). Identification of a cytoplasmic-retention
sequence in ERK2. J Biol Chem 274, 30349-52.
Saha, T., Guha, D., Manna, A., Panda, A. K., Bhat, J., Chatterjee, S. and Sa, G. (2016). G-
actin guides p53 nuclear transport: potential contribution of monomeric actin in altered
localization of mutant p53. Sci Rep 6, 32626.
Schweizer, J., Bowden, P. E., Coulombe, P. A., Langbein, L., Lane, E. B., Magin, T. M.,
Maltais, L., Omary, M. B., Parry, D. A. D., Rogers, M. A. et al. (2006). New consensus
nomenclature for mammalian keratins. The Journal of Cell Biology 174, 169.
Snider, N. T. and Omary, M. B. (2014). Post-translational modifications of intermediate filament
proteins: mechanisms and functions. Nat Rev Mol Cell Biol 15, 163-77.
Tanoue, T., Adachi, M., Moriguchi, T. and Nishida, E. (2000). A conserved docking motif in
MAP kinases common to substrates, activators and regulators. Nat Cell Biol 2, 110-6.
Tanoue, T., Maeda, R., Adachi, M. and Nishida, E. (2001). Identification of a docking groove
on ERK and p38 MAP kinases that regulates the specificity of docking interactions. EMBO
J 20, 466-79.
Tanoue, T. and Nishida, E. (2003). Molecular recognitions in the MAP kinase cascades. Cell
Signal 15, 455-62.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Toivola, D. M., Boor, P., Alam, C. and Strnad, P. (2015). Keratins in health and disease. Curr
Opin Cell Biol 32, 73-81.
Toivola, D. M., Zhou, Q., English, L. S. and Omary, M. B. (2002). Type II keratins are
phosphorylated on a unique motif during stress and mitosis in tissues and cultured cells.
Mol Biol Cell 13, 1857-70.
Ubersax, J. A. and Ferrell, J. E., Jr. (2007). Mechanisms of specificity in protein
phosphorylation. Nat Rev Mol Cell Biol 8, 530-41.
Wood, C. D., Thornton, T. M., Sabio, G., Davis, R. A. and Rincon, M. (2009). Nuclear
Localization of p38 MAPK in Response to DNA Damage. International Journal of
Biological Sciences 5, 428-437.
Xu, B., Stippec, S., Robinson, F. L. and Cobb, M. H. (2001). Hydrophobic as well as charged
residues in both MEK1 and ERK2 are important for their proper docking. J Biol Chem 276,
26509-15.
Zhou, Y., Mao, H., Li, S., Cao, S., Li, Z., Zhuang, S., Fan, J., Dong, X., Borkan, S. C., Wang,
Y. et al. (2010). HSP72 inhibits Smad3 activation and nuclear translocation in renal
epithelial-to-mesenchymal transition. J Am Soc Nephrol 21, 598-609.
Ziegelbauer, J., Shan, B., Yager, D., Larabell, C., Hoffmann, B. and Tjian, R. (2001).
Transcription factor MIZ-1 is regulated via microtubule association. Mol Cell 8, 339-49.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Tables
Table 1. K8 and 18 constructs mutated in potential docking sites for p38.
Mutant Amino acid change
Keratin 8
R148/149E 145
NNLRRQLETL154 → NNLEEQLETL
K185,R186E 182
EINKRTEMEN191 → EINEETEMEN
K197/198E 194
VLIKKDVDEA202 → VLIEEDVDEA
R301/302,K304E 298
DDLRRTKTEI307 → DDLEETETEI
R392,K393E 389
ATYRKLLEGE398 → ATYEELLEGE
R464/465E 461
VVVKKIETRD470 → VVVEEIETRD
Keratin 18
R106/107E 103
TENRRLESKI110 → TENEELESKI
K118/119E 115
HLEKKGPQVR123 → HLEEEGPQVR
R186,K187E 183
HGLRKVIDDT192 → HGLEEVIDDT
K214/215E 211
LFMKKNHEEE220 → LFMEENHEEE
R300/301E 297
TELRRTVQSL305 → TELEETVQSL
R381/382E 378
ATYRRLLEDG387 → ATYEELLEDG
R411/412E 408
TTTRRIVDGK417 → TTTEEIVDGK
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Table 2. Protein domain structure of keratin 8 and sequence alignment of p38 docking domains in keratins and other intermediate filaments.
Protein domain structure of keratin 8
p38 docking motif (Basic) φ φ
Keratins hK8 148 R R Q L E T L G Q E K L K L 161
hK1 239 R R R V D Q · K S D Q S R L 252 hK2 237 K R Y · D G · T A · R T S Q 250 hK3 259 R S Y · D N I L G · R G R L 272 hK4 208 R K · · D · · · N D · G R L 221 hK5 227 R R · · D S I V G · R G R L 240 hK6a 222 R R · · D S I V G · R G R L 235 hK6b 222 R R · · D N I V G · R G R L 235 hK6c 222 R R · · D S I V G · R G R L 235 hK7 149 R G · · · A · Q V D G G R L 162 hK9 212 K D · I V D · T V G N N · T 225 hK10 207 K N · I L N · T T D N A N I 220 hK12 187 R N K I I S A S I G N A Q L 200 hK13 163 R D K I L · A T I · N N R V 176 hK14 173 R N K I L · A T V D N A N V 186 hK15 164 R D K I M A T T I D N S R V 177 hK16 175 R N K I I A A T I · N A Q P 188 hK17 142 Q N K I L · A T V D N A N I 155 hK18 137 R A · I F A N T V D N A R I 150 hK19 138 R D K I L G A T I · N S R I 151 hK20 128 R S I K D A Q L Q N A R C 141 Other IFs Desmin 163 R R · V · V · T N Q R A R V 176 Peripherin 152 R R E L · L · · R · R D R V 165 Vimentin 158 R R · V D Q · T N D · A R V 171 Lamin A/C 90 R K T · D S V A K · R A R L 103 Lamin B1 89 R R A · D D T A R · R A L 102 Lamin B2 103 R R V · D E T A R · R A R L 116 GFAP 124 R L R · D Q · T A N S A R L 137 α-internexin 151 R A · · · E A S S A R S Q A 164 NFH 162 R G A V L R · · A A R G Q L 175 NFM 158 R A T · · M V N H · · A Q V 171 NFL 147 R L A A · D A T N · · Q A L 160 Synemin 68 R Q · · D E · S W A T A L A 81
Sequence comparison is performed by using Clustal Omega program in UNIPORT. The p38 docking domains on its substrates are characterized by one or two basic residues, a short spacer, and a hydrophobic groove (R/K1-2 –X2-6 -φ-X-φ, where φ is a hydrophobic residue). Note that keratins and other intermediate filaments (IFs) have a longer spacer (X8-10). The positively charged basic amino acids are shown in bold red; hydrophobic amino acids are shown in bold blue. Dots indicate amino acid residues that are identical to the corresponding K8 sequence.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Figures
Figure 1. Interaction between K8/K18 and p38 is phosphorylation-dependent. (A) BHK cells
were co-transfected with either a combination of K18 WT, DDK-p38 WT, and K8 WT or a
phosphorylation mutant construct (K8 S74A or S74D). DDK-p38 is a human p38 MAPK clone
with DDK tag that is the same as FLAG tag. Total lysates and K8/K18 immunoprecipitates were
separated by SDS-PAGE and visualized by Coomassie blue staining or transferred to a
polyvinylidene difluoride membrane and immunoblotted with the indicated antibodies. (B) BHK
cells were co-transfected with the K8 WT, K18 WT, and DDK-p38 WT or p38 AF. The p38 AF
is a kinase-inactive form made inactive via double mutations at the phosphorylation sites T180A
and Y182F in the activation loop. Cell lysates were analyzed as described in panel A. Molecular
masses are shown in kilodaltons. The graph represents the mean S.D. of three independent
experiments. **p<0.005
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Figure 2. K8 has a docking site for interaction with p38 kinase. (A, B) BHK cells were co-
transfected with the indicated keratin constructs and with DDK-p38 WT. Two or three of the
positively charged amino acids (Arg and Lys) on the putative docking site of K8 or K18 for p38
kinase were replaced by a negatively charged amino acid (Glu), as shown in Table 1. Total lysates
were prepared and analyzed by immunoblotting using corresponding antibodies. Co-
immunoprecipitation was performed using anti-K8/K18, followed by Coomassie blue staining or
immunoblotting. Mobility shift in the SDS-PAGE gel was detected in several mutants, which was
likely due to the change in charge (+ to -) of the amino acid(s) following mutations. (C)
Transfection of K8 WT, R148/149E, L159/161A or the quadruple mutant (R148/149E, L159/161A)
together with K18 WT and DDK-p38 WT was performed in BHK cells. K8/K18
immunoprecipitates and total lysates were prepared and analyzed as described in panels A and B.
The graph represents the mean S.D. of three independent experiments. *p<0.05, **p<0.005.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Figure 3. The CD domain of p38 is required for p38-K8 interaction. (A) BHK cells were co-
transfected with DDK-p38 WT or CD mutants (CDm) together with K8/K18 WT. Asp 313, 315,
and 316 in the CD domain of p38 kinase were replaced by Asn in p38 CDm. Cell lysates were
analyzed as described in Fig 2. (B) A schematic representation of the interaction between K8 and
p38. K8 is phosphorylated at the conserved pSer-Pro motif of K8 Ser74 by p38. Besides the
phosphoacceptor residue K8 Ser74, p38 recognizes K8 via the docking domain of K8 (R148/149,
L159/161). The negatively charged amino acids (D313/315/316) in the CD domain of p38 interact
with the positively charged amino acids (R148/149) in the docking site of K8. Two Y311 and
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
H312 residues of p38 are identified as the potential docking site that interacts with the hydrophobic
residues on p38 substrates, and their positions are adjacent to the negatively charged residues in
the CD domain. The two residues of p38 likely interact with the hydrophobic residues (L159 and
L161) of K8 in the D domain.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Figure 4. K8 hinders the interaction of p38 and Hsp70. (A) K8, K18, or both K8 and K18 were
co-transfected with DDK-p38 and GFP-Hsp70 in BHK cells. Hsp70 immunoprecipitates and total
lysates were prepared and analyzed by immunoblotting using the indicated antibodies. Actin was
used as a control. (B) BHK cells were co-transfected with a K8 WT or a docking-deficient mutant
of K8 (R148/149E, L159/161A) together with K18 WT, DDK-p38 WT, and GFP-Hsp70 WT. p38
immunoprecipitates and total lysates were prepared and immunoblotted with the indicated
antibodies. (C) BHK cells were transfected with the indicated DNA constructs and incubated with
or without OA for 2 hrs. Total cell lysates and both cytosolic and nuclear fraction were prepared
and analyzed by immunoblotting using corresponding antibodies. Tubulin (cytosol) and lamin A/C
(nucleus) were used as controls for subcellular fractionation. Molecular masses are given in
kilodaltons. Note that the bands of K8 and K18 in gel become broad because of phosphorylation
after OA treatment. The graph represents the mean S.D. of three independent experiments.
*p<0.05.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Figure 5. Effect of liver disease-associated keratin mutations in p38-keratin association. (A)
BHK cells were co-transfected with DDK-p38 WT, K8 WT, and one of the indicated K18 mutants.
The K8/K18 immunoprecipitates and total lysates were prepared and analyzed by SDS-PAGE and
immunoblot with the indicated antibodies. (B) Co-transfection of DDK-p38 WT, K18 WT and one
of the indicated K8 mutants was performed and then analyzed as described in panel A. The graph
represents the mean S.D. of three independent experiments. *p<0.05.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Figure 6. K18 I150V enhanced the nuclear localization of p38 kinase and the expression of
p38-dependent target genes. (A) BHK cells were co-transfected with K18-WT or K18 I150V
together with K8, DDK-p38, and GFP-Hsp70 WT. p38 immunoprecipitates and total lysates were
immunoblotted with the indicated antibodies. (B) BHK cells were transfected with K18 WT or
I150V together with K8, DDK-p38, and GFP-Hsp70 WT. The transfected cells were incubated
with or without OA for 2 hrs. Total cell lysates and both cytosolic and nuclear fractions were
prepared and analyzed by immunoblotting using corresponding antibodies. Tubulin (cytosol) and
lamin A/C (nucleus) were used as controls for subcellular fractionation. Molecular masses are
given in kilodaltons. Note that the bands of K8 and K18 in gel become broad because of
phosphorylation after OA treatment. (C) Expression of p38-dependent target genes was examined
by RT-PCR. BHK cells were co-transfected with either a combination of K18 WT, p38 WT, and
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
K8 WT or K8 I150V mutant construct. cDNA was synthesized by PCR with mRNA construct and
then RT-PCR was run with target gene primers. Real-time quantitative PCR (RT-qPCR) was
performed to analyze mRNA levels of the p38-dependent target genes. The mRNA levels in cells
transfected with K8 I150V mutant compared to the mRNA levels in cells transfected with K8 WT.
The graph represents the mean S.D. of three independent experiments. Statistical significance
was determined using two-tailed Student’s t-tests. *p<0.05, **p<0.005.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Figure 7. A schematic model for a role of keratins in Hsp70-mediated p38 nuclear
translocation. K8 and K18 form obligate noncovalent heterodimers through the N- to C- terminal
parallel association. In resting cells, K8 as a cytoplasmic anchor binds and sequesters p38 kinase.
Upon stress, the phosphorylated/activated p38 phosphorylates K8 at Ser74, facilitating p38
dissociation from keratin complexes. The released active form of p38 makes a complex with Hsp70,
a potential chaperone for p38 translocation into the nucleus where contains the substrates of p38
that are involved in signaling pathways under stress conditions. On the other hand, a liver disease-
associated K18-I150V mutation occurs near the residues of K18 that are close to the location of
the p38 docking site on K8 in the parallel K8/K18 heterodimer, and the mutation interferes the
association of p38 with K8/K18 and enhances the formation of p38- Hsp70, which leads in turn to
p38 nuclear localization. Abbreviation: aa, amino acid.
Jour
nal o
f Cel
l Sci
ence
• A
ccep
ted
man
uscr
ipt
Table S1. Forward and Reverse Primer sequences for RT-qPCR.
Gene Forward Primer (5ꞌ to 3ꞌ) Reverse Primer (5ꞌ to 3ꞌ)
TNF GGTGCCTATGCCTCAGCCTCT T GCCATGGAGCCGATGATAGGGTT
VCAM GCTATGAGA ATGGAAGATTCTGG ATCTTTGCAGACACCCAGGGTC
VEGFC TCCTAGAAACCGACCCCTGA GGTCGTCTGTAACAACTGCAT
iNOS GAGACAGGGAAGTCTGAAGTG C CCAGTAGTAATTCCTCGTCTTC
HSPB8 AGA AAATCCAGCTTCCCGCAGAA AAGGACCGAGGCTGA ATTCTT AG
RGS19 AGCTGTGAAGTTTGCACTCC GGACTGTGCCCAGCTTTGTA
TFEB AGCCCAAGGCTCTCCCAAG TGACGTCATCAAACTCCTTTTCAG
GADD45 AAGACCGAAAGGATGGACACG CACAGTACCACGTTGTCGGG
ACTIN CATTGCTGACCGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAGG
J. Cell Sci.: doi:10.1242/jcs.229534: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
FIG. S1
Figure S1. Transfection efficiencies were similar in the cells transfectedwith different plasmids.
BHK cells were transfected transfected with K8 WT, S74A, and S74D together withK18 WT. The transfected cells were fixed with methanol and then immunostainedwith K8/K18 (red) antibody. Scale bar is 100μm.
J. Cell Sci.: doi:10.1242/jcs.229534: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
FIG. S2
Figure S2. p38 MAPK is bound to K8/K18 in phosphorylation-dependent manner.
A B
(A) BHK cells were co-transfected with either a combination of K18 WT, DDK-p38 WT, andK8 WT or a phosphorylation mutant construct (K8 S74A or S74D) and the cells treated withOA (1 μg/ml for 2 hrs). K8/K18 immunoprecipitates and total lysates are prepared and immunoblotted with indicated antibodies. (B) BHK cells were transfected as described inpanel A. Cell lysates were prepared and treated with PP2A phosphatase (0.1 μg/ml for 1 hr).K8/K18 immunoprecipitates and total lysates are prepared and immunoblotted with indicatedantibodies.
J. Cell Sci.: doi:10.1242/jcs.229534: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
FIG. S3
A B
Figure S3. K8 docking site has specificity for p38 MAPK, but not other MAP Kinases.
BHK cells were co-transfected with K8 WT or docking-deficient mutant for p38 together withK18 WT and other MAPKs such as ERK1 (A), ERK2 (B), or JNK1 (C) or JNK2 (D). K8/K18 immunoprecipitates and total lysates were prepared, analyzed by SDS-PAGE and then immunoblotted with the indicated antibodies.
C D
J. Cell Sci.: doi:10.1242/jcs.229534: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
J. Cell Sci.: doi:10.1242/jcs.229534: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
FIG. S5
Figure S5. Subcellular fractionation analysis.
Nuclear and cytosol fractions are prepared as described in Fig 4C legend. To assessthe purity of fractions, the samples are immunoblotted with antibodies against laminA/C (nuclear marker) or alpha-tubulin (cytoplasmic marker).
J. Cell Sci.: doi:10.1242/jcs.229534: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
J. Cell Sci.: doi:10.1242/jcs.229534: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
FIG. S7
Figure S7. Cell fractionation assay.
Nuclear and cytosol fractions are prepared as described in Fig 6B legend. To assessthe purity of fractions, the samples are immunoblotted with antibodies against laminA/C (nuclear marker) or alpha-tubulin (cytoplasmic marker).
J. Cell Sci.: doi:10.1242/jcs.229534: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Top Related