Download - Incest and folk-dancing ….

Transcript
Page 1: Incest and folk-dancing ….

Incest and folk-dancing ….

Page 2: Incest and folk-dancing ….

                                    

      Steve Jones 2001 Pan Pacific

Bodybuilding Champion

Steve jones

Page 3: Incest and folk-dancing ….

Elephant seal

Page 4: Incest and folk-dancing ….

Testosterone Molecule

Page 5: Incest and folk-dancing ….

M-f mortality

Page 6: Incest and folk-dancing ….

Female anglerfish and her partners

Page 7: Incest and folk-dancing ….

The Y

Page 8: Incest and folk-dancing ….

MaleMale

Page 9: Incest and folk-dancing ….

Thames at Westminster

Page 10: Incest and folk-dancing ….

Thames near Source

Page 11: Incest and folk-dancing ….

Drosophila bifurca – testis, the single sperm, and a standard of comparison

Page 12: Incest and folk-dancing ….

The Apocalypse according to William Blake

Page 13: Incest and folk-dancing ….

The city of Megiddo – the biblical Armageddon

Armageddon

Page 14: Incest and folk-dancing ….

THE ARITHMETIC OF ARMAGEDDON – 722 BC

2, 4, 8, 16, 32 …… fifty times: comes to

100,000,000,000,000,(a hundred million million) supposed ancestors.

At a generous guess the real number of people then was 100,000,000 (a hundred million).

Ie not enough ancestors - which means SHARED ANCESTRY AND UNIVERSAL INBREEDING!

Page 15: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

Page 16: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

Page 17: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

Page 18: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

Page 19: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

Page 20: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

Page 21: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

Page 22: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

Page 23: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

Page 24: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

Page 25: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

Page 26: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

Page 27: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

Page 28: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

3 ancestors

Page 29: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

3 ancestors

2 ancestors

Page 30: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

3 ancestors

2 ancestors

2 ancestors

Page 31: Incest and folk-dancing ….

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

3 ancestors

2 ancestors

2 ancestors

1 ancestor

Page 32: Incest and folk-dancing ….

Present

Time

Page 33: Incest and folk-dancing ….

Present

Time

Most recent common ancestor(MRCA)

Page 34: Incest and folk-dancing ….
Page 35: Incest and folk-dancing ….

Inbreedign euro royalty

Serious inbreeding among European Royals (max at 7 generations = 128 ancestors)Generations 4 5 6 7 Ift de Espana (1901-1964) 8 12 12 12

Gottfried of Tuscany (1901-) 8 10 15 18

Alfonso XII King of Spain (1857-1885) 4 4 6 8

Francesco, Duke of Marchena (1861-1923) 2 4 8 8

Maria Antonia of Austria (1669-1692) 4 4 6 10

Louis XV King of France (1710-1774) 4 8 12 16

Page 36: Incest and folk-dancing ….
Page 37: Incest and folk-dancing ….

Tutankhamun’s pedigree - incest

Page 38: Incest and folk-dancing ….

Feet of an inbred God - Tutankhamun

Page 39: Incest and folk-dancing ….

3000 lines of descent 4000 lines of descent

Inbred – identity by descent

Page 40: Incest and folk-dancing ….

Charles Darwin’s cousin marriage

Page 41: Incest and folk-dancing ….

The Bulldog in 1817

Page 42: Incest and folk-dancing ….

The Bulldog in 2008

Page 43: Incest and folk-dancing ….

Rare surnames (Attenborough but not Smith) share a Y chromosome

Page 45: Incest and folk-dancing ….

Consang marriage rates ww

Page 46: Incest and folk-dancing ….

Finnish genetic disease

Page 47: Incest and folk-dancing ….

VLINCL pedigrees in Finland

Page 48: Incest and folk-dancing ….

Inbreeding loops in Finland

Page 49: Incest and folk-dancing ….
Page 50: Incest and folk-dancing ….

Likely world colonisation routes, and genetic distance from E Africa (shades of green)

Page 51: Incest and folk-dancing ….
Page 52: Incest and folk-dancing ….

Extent of diversity against distance to Addis Ababa – lowest in Americas

Page 53: Incest and folk-dancing ….

Runs of homozygosity – shared names, and shared lengths of DNA

attenboroughattenborough

agccccttaattaagccccttaatta

Page 54: Incest and folk-dancing ….

Inbreeding in Croatia

Page 55: Incest and folk-dancing ….

Runs of homozygosity of different lengths, island and mainland

Page 56: Incest and folk-dancing ….

Close correlation between inbreeding as measured from pedigrees and from runs of homozygosity

Page 57: Incest and folk-dancing ….

Runs of homozygosity: more inbreeding in hunter-gatherers than farmers

Page 58: Incest and folk-dancing ….

Runs of homozygosity (green blocks) in boy with multiple medical problems. May be son of incestuous relationship

Page 59: Incest and folk-dancing ….

The locations of the identified IBD segments (black horizontal bars) among the genomes of the colon cancer patients and the control data sets.

Page 60: Incest and folk-dancing ….

Runs of homozygosity and schizophrenia: odds increase by 17% for every 1% increase in genome-wide autozygosity.

Page 61: Incest and folk-dancing ….

ROH in Early Onset Parkinson’s Disease; cases blue controls red. Black line – ratio.

Page 62: Incest and folk-dancing ….

Increase in infection rates with inbreeding

Page 63: Incest and folk-dancing ….

Sex and the 747 – American flight patterns

Page 64: Incest and folk-dancing ….

Decline in US runs of homozygosity (inbreeding) with birth date from 1900 to 2000

Page 65: Incest and folk-dancing ….

Jones in 1881

Page 66: Incest and folk-dancing ….

Jones in 1998

Page 67: Incest and folk-dancing ….
Page 68: Incest and folk-dancing ….
Page 69: Incest and folk-dancing ….

Fig. 1 Language locations and regional variation in phonemic diversity – bottlenecks on the way across the world.

Q D Atkinson Science 2011;332:346-349

Published by AAAS

Page 70: Incest and folk-dancing ….

Outbred and inbred slug populations

Oxfordshire (left); Skye (right)

Page 71: Incest and folk-dancing ….