Phylogeny
• Major sequencing efforts
• Minor sequencing efforts
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
~14 MY
~45 MY
Papilionoideae in GenBank
GSS EST Nucleotide Total Total bpLens 485 na 189 674 413,706Vicia 686 1 949 1,636 1,087,983Pisum 154 3,592 2,391 6,137 4,385,740Melilotus na na 60 60 33,298Trifolium 35,181 38,208 2,997 76,386 34,558,567Medicago 168,810 256,447 5,910 431,167 535,567,512Cicer 48,339 1,948 974 51,261 37,288,840Lotus 46,569 150,684 2,190 199,443 212,142,103Phaseolus 92,009 45,721 2,182 139,912 90,443,599Vigna 50,216 728 1,192 52,136 37,921,985Glycine 368,272 411,806 6,209 786,287 468,155,008Cajanus 357 884 42 1,283 668,582
GenBank Records
Types of sequencing
• Physical map --> Sequence map– Traditional--human & Arabidopsis
• Sequence map --> Physical map– Drosophila
• Incomplete sequence map– With or without physical information
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Genome
..actggtcgtaatgtagttgccctcagfgttagtaattttattgtagtatgatgt..
?
150 kb fragments
BAC library
Physical to Sequence (rice, Arabidopsis, human)
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
fingerprint Integrate genetic physical map
Map-based Genome Sequencing
Chromosome
Genetic map
Physical map
actggagtggatgaactgactaaactgtaactgtacgatcgtttagctacggcggcgatcgatcgggtcagcacgtagctagctgacgtgggctagctaattatacgatcggagatcgatcgtaatcggatcgatcgcgcggcatctacgatcgatcgtagctagtc
Minimum Tiling Path
Shotgun sequencing
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Soybean chromosomes
contig
scaffold
•Lots of contigs/scaffolds
•Not anchored to genetic map
Outcomes• Map-based approach
– Highly ordered, clone-based, genetically integrated, contiguous sequence (gold standard)
– Slower, costly
• Shotgun approach– Initially disordered, though can be genetically
integrated– May or may not have underlying physical map– May have assembly problems– Fast and less expensive
Prerequisites
• Understand genome structure– Neopolyploidy?– Repeat content?– Repeat distribution?– Comparisons to related genomes. How
valuable will they be?
Leveraging Genomes
• Understand and introgress diversity
• Marker development for selection and gene cloning
• Basic questions: evolution, genome structure
How to deal with incompletely sequenced genomes
• Genetic and physical maps/information are imperative
• Leverage related genomes to aid in assembly
• Target finishing to regions of interest– Genic/QTLs/anchored scaffolds…
• Low coverage sequencing of MTP or entire BAC library
Top Related