Evaluation of anti-inflammatory and anti-arthritic activities of Juglans
regia L and Trigonella gharuensis Rechf
submitted by
Aisha Mobashar
DPHR02153003
In partial fulfillment for the Degree of doctor of philosophy
in pharmacology
FACULTY OF PHARMACY
THE UNIVERSITY OF LAHORE
LAHORE PAKISTAN
2020
In the name of ALLAH
The Most Beneficial
The Most Merciful
AUTHORrsquoS DECLARATION
I Aisha Mobashar hereby state that my thesis titled ldquoEvaluation of anti-
inflammatory and anti-arthritic activities of Juglans regia L and Trigonella
gharuensis Rechfrdquo is my own work and has not been submitted previously by
me for taking any degree from this university ldquoThe University of Lahorerdquo or
anywhere else in the countryworld
At any time if my statement is found to be incorrect even after my
graduation the university has the right to withdraw my PhD degree
Aisha Mobashar
October 2019
CERTIFICATE OF APPROVAL
This is to certify that research work presented in the thesis entitled ldquoEvaluation of anti-
inflammatory and anti-arthritic activities of Juglans regia L and Trigonella gharuensis
Rechfrdquo was conducted by Ms Aisha Mobashar under the supervision of Dr Arham
Shabbir
No part of this thesis has been submitted anywhere else for any other degree This thesis is
submitted to the university in partial fulfillment of requirements for the degree of Doctor of
Philosophy in the field of Pharmacology Faculty of Pharmacy The University of Lahore
Student Name
Aisha Mobashar Signature
Supervisor Name
Dr Arham Shabbir Signature
Associate Professor
Co-Supervisor Name
Prof Dr Saeed-ul-Hassan Signature ________________________
Professor
Name of Head MPhilPhD Program
Dr Mahtab Ahmad Khan__
Signature Date
Name of HOD
Prof Dr Javed Iqbal_______
Signature Date
i
DEDICATION
I would like to dedicate this thesis to my beloved Teachers and family because whatever
I am today is all due to their prayers and their support
ii
ACKNOWLDGEMENTS
Words are bounded and knowledge is limited to praise ALLAH (SWT) The Most Beneficent
The Merciful Gracious and The Compassionate Whose bounteous blessing and exaltation
flourished my thoughts and thrived my ambition to have the cherished fruit of my modest
efforts in the form of His manuscripts from the blooming spring of blossoming knowledge
Countless blessings upon HOLY PROPHET HAZRAT MUHAMMAND (PBUH) who has
shown the right direction to humanity and thereby enlightening their ways with faith through
his eternal teachings
Itrsquos a great honor and pleasure to pay thanks to my supervisor Dr Arham Shabbir Associate
professor Head of Pharmacy Department The University of Lahore-Gujrat campus for
lending his skilled advice guidance decision devotion support and co-operation His
competence and goodwill encouraged me a lot to complete this important task I consider
myself honored being supervised by my research mentor He is a person with amazing
command on contemporarily research and techniques
My special thanks goes to my co-supervisor Prof Dr Syed Saeed-ul-Hassan The University
of Lahore Pakistan for his invaluable help of constructive comments and suggestions
throughout the thesis work
My sincere gratitude to Prof Dr Javed Iqbal Head of Department The University of Lahore
Pakistan for his unconditional support and encouragement
My sincere appreciation to Dr Muhammad Shahzad Associate Professor University of
Health Sciences Lahore for ensuring provision of lab facilities It wouldnrsquot have been easy
iii
without his countless support and guidance Also my special regards to the professional team
at Department of immunology University of Health Sciences Lahore Pakistan
My in-depth appreciations to Higher Education Commission (HEC) Pakistan for providing
resources and financial assistance in the carrying out of my research in Australia under
International Research Supportive Initiative Program (IRSIP)
I am truly grateful to my husband and parents for being on my side through every thick and
thin during this long journey My extra-ordinary recognition for the support extended by my
colleagues and friends They have always encouraged me to explore my potential and pursue
my dreams
Aisha Mobashar
iv
TABLE OF CONTENTS
DEDICATION i
ACKNOWLDGEMENTS ii
TABLE OF CONTENTS iv
LIST OF TABLES xi
LIST OF FIGURES xiii
LIST OF ABBREVIATIONS xvii
ABSTRACT xix
CHAPTER 1 INTRODUCTION 1
11 Hypothesis 3
111 Null hypothesis 3
112 Alternate hypothesis 3
12 Aim of the study Error Bookmark not defined
13 Objective of study Error Bookmark not defined
CHAPTER 2 LITERATURE REVIEW 4
21 Epidemiology 4
22 Pathophysiology 5
23 Treatments 7
24 Inflammation 10
25 Role of Carrageenan histamine serotonin xylene and dextran 11
26 Plants used 12
CHAPTER 3 MATERIALS AND METHODS 15
31 Plant collection 15
32 Preparation of extracts 15
33 Assessment of anti-arthritic activities 16
331 Arthritis induction 16
v
332 Evaluation of arthritic progression 17
333 Assessment of paw volume 17
334 Histopathological investigations 17
34 Assessment of mRNA expression levels of TNF-α NF-κB IL-6
IL-1β COX-1 COX-2 and IL-4 17
341 RNA extraction 17
3411 Homogenization of blood 18
3412 Phase separation 18
3413 Method of RNA precipitation 18
3414 Washing of RNA 18
3415 Re-suspension of RNA pellets 18
3416 RNA Quantification 18
343 Primer designing 19
344 cDNA synthesis 21
345 Working solution of primers 22
346 Polymerase chain reaction 22
347 Ingredients required for the formulation of TAE reaction
buffer (50X) 22
348 Gel preparation and Gel electrophoresis 23
349 Densitometry 23
3410 Determination of serum PGE2 levels using ELISA 23
34101 Preparation of standard 24
34102 Biotinylated Detection Antibody 24
34103 Concentrated HRP Conjugate 24
34104 Substrate reagent 24
34105 Procedure of ELISA 24
3411 Evaluation of hematological parameters 25
3412 Evaluation of biochemical parameters 25
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
In the name of ALLAH
The Most Beneficial
The Most Merciful
AUTHORrsquoS DECLARATION
I Aisha Mobashar hereby state that my thesis titled ldquoEvaluation of anti-
inflammatory and anti-arthritic activities of Juglans regia L and Trigonella
gharuensis Rechfrdquo is my own work and has not been submitted previously by
me for taking any degree from this university ldquoThe University of Lahorerdquo or
anywhere else in the countryworld
At any time if my statement is found to be incorrect even after my
graduation the university has the right to withdraw my PhD degree
Aisha Mobashar
October 2019
CERTIFICATE OF APPROVAL
This is to certify that research work presented in the thesis entitled ldquoEvaluation of anti-
inflammatory and anti-arthritic activities of Juglans regia L and Trigonella gharuensis
Rechfrdquo was conducted by Ms Aisha Mobashar under the supervision of Dr Arham
Shabbir
No part of this thesis has been submitted anywhere else for any other degree This thesis is
submitted to the university in partial fulfillment of requirements for the degree of Doctor of
Philosophy in the field of Pharmacology Faculty of Pharmacy The University of Lahore
Student Name
Aisha Mobashar Signature
Supervisor Name
Dr Arham Shabbir Signature
Associate Professor
Co-Supervisor Name
Prof Dr Saeed-ul-Hassan Signature ________________________
Professor
Name of Head MPhilPhD Program
Dr Mahtab Ahmad Khan__
Signature Date
Name of HOD
Prof Dr Javed Iqbal_______
Signature Date
i
DEDICATION
I would like to dedicate this thesis to my beloved Teachers and family because whatever
I am today is all due to their prayers and their support
ii
ACKNOWLDGEMENTS
Words are bounded and knowledge is limited to praise ALLAH (SWT) The Most Beneficent
The Merciful Gracious and The Compassionate Whose bounteous blessing and exaltation
flourished my thoughts and thrived my ambition to have the cherished fruit of my modest
efforts in the form of His manuscripts from the blooming spring of blossoming knowledge
Countless blessings upon HOLY PROPHET HAZRAT MUHAMMAND (PBUH) who has
shown the right direction to humanity and thereby enlightening their ways with faith through
his eternal teachings
Itrsquos a great honor and pleasure to pay thanks to my supervisor Dr Arham Shabbir Associate
professor Head of Pharmacy Department The University of Lahore-Gujrat campus for
lending his skilled advice guidance decision devotion support and co-operation His
competence and goodwill encouraged me a lot to complete this important task I consider
myself honored being supervised by my research mentor He is a person with amazing
command on contemporarily research and techniques
My special thanks goes to my co-supervisor Prof Dr Syed Saeed-ul-Hassan The University
of Lahore Pakistan for his invaluable help of constructive comments and suggestions
throughout the thesis work
My sincere gratitude to Prof Dr Javed Iqbal Head of Department The University of Lahore
Pakistan for his unconditional support and encouragement
My sincere appreciation to Dr Muhammad Shahzad Associate Professor University of
Health Sciences Lahore for ensuring provision of lab facilities It wouldnrsquot have been easy
iii
without his countless support and guidance Also my special regards to the professional team
at Department of immunology University of Health Sciences Lahore Pakistan
My in-depth appreciations to Higher Education Commission (HEC) Pakistan for providing
resources and financial assistance in the carrying out of my research in Australia under
International Research Supportive Initiative Program (IRSIP)
I am truly grateful to my husband and parents for being on my side through every thick and
thin during this long journey My extra-ordinary recognition for the support extended by my
colleagues and friends They have always encouraged me to explore my potential and pursue
my dreams
Aisha Mobashar
iv
TABLE OF CONTENTS
DEDICATION i
ACKNOWLDGEMENTS ii
TABLE OF CONTENTS iv
LIST OF TABLES xi
LIST OF FIGURES xiii
LIST OF ABBREVIATIONS xvii
ABSTRACT xix
CHAPTER 1 INTRODUCTION 1
11 Hypothesis 3
111 Null hypothesis 3
112 Alternate hypothesis 3
12 Aim of the study Error Bookmark not defined
13 Objective of study Error Bookmark not defined
CHAPTER 2 LITERATURE REVIEW 4
21 Epidemiology 4
22 Pathophysiology 5
23 Treatments 7
24 Inflammation 10
25 Role of Carrageenan histamine serotonin xylene and dextran 11
26 Plants used 12
CHAPTER 3 MATERIALS AND METHODS 15
31 Plant collection 15
32 Preparation of extracts 15
33 Assessment of anti-arthritic activities 16
331 Arthritis induction 16
v
332 Evaluation of arthritic progression 17
333 Assessment of paw volume 17
334 Histopathological investigations 17
34 Assessment of mRNA expression levels of TNF-α NF-κB IL-6
IL-1β COX-1 COX-2 and IL-4 17
341 RNA extraction 17
3411 Homogenization of blood 18
3412 Phase separation 18
3413 Method of RNA precipitation 18
3414 Washing of RNA 18
3415 Re-suspension of RNA pellets 18
3416 RNA Quantification 18
343 Primer designing 19
344 cDNA synthesis 21
345 Working solution of primers 22
346 Polymerase chain reaction 22
347 Ingredients required for the formulation of TAE reaction
buffer (50X) 22
348 Gel preparation and Gel electrophoresis 23
349 Densitometry 23
3410 Determination of serum PGE2 levels using ELISA 23
34101 Preparation of standard 24
34102 Biotinylated Detection Antibody 24
34103 Concentrated HRP Conjugate 24
34104 Substrate reagent 24
34105 Procedure of ELISA 24
3411 Evaluation of hematological parameters 25
3412 Evaluation of biochemical parameters 25
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
AUTHORrsquoS DECLARATION
I Aisha Mobashar hereby state that my thesis titled ldquoEvaluation of anti-
inflammatory and anti-arthritic activities of Juglans regia L and Trigonella
gharuensis Rechfrdquo is my own work and has not been submitted previously by
me for taking any degree from this university ldquoThe University of Lahorerdquo or
anywhere else in the countryworld
At any time if my statement is found to be incorrect even after my
graduation the university has the right to withdraw my PhD degree
Aisha Mobashar
October 2019
CERTIFICATE OF APPROVAL
This is to certify that research work presented in the thesis entitled ldquoEvaluation of anti-
inflammatory and anti-arthritic activities of Juglans regia L and Trigonella gharuensis
Rechfrdquo was conducted by Ms Aisha Mobashar under the supervision of Dr Arham
Shabbir
No part of this thesis has been submitted anywhere else for any other degree This thesis is
submitted to the university in partial fulfillment of requirements for the degree of Doctor of
Philosophy in the field of Pharmacology Faculty of Pharmacy The University of Lahore
Student Name
Aisha Mobashar Signature
Supervisor Name
Dr Arham Shabbir Signature
Associate Professor
Co-Supervisor Name
Prof Dr Saeed-ul-Hassan Signature ________________________
Professor
Name of Head MPhilPhD Program
Dr Mahtab Ahmad Khan__
Signature Date
Name of HOD
Prof Dr Javed Iqbal_______
Signature Date
i
DEDICATION
I would like to dedicate this thesis to my beloved Teachers and family because whatever
I am today is all due to their prayers and their support
ii
ACKNOWLDGEMENTS
Words are bounded and knowledge is limited to praise ALLAH (SWT) The Most Beneficent
The Merciful Gracious and The Compassionate Whose bounteous blessing and exaltation
flourished my thoughts and thrived my ambition to have the cherished fruit of my modest
efforts in the form of His manuscripts from the blooming spring of blossoming knowledge
Countless blessings upon HOLY PROPHET HAZRAT MUHAMMAND (PBUH) who has
shown the right direction to humanity and thereby enlightening their ways with faith through
his eternal teachings
Itrsquos a great honor and pleasure to pay thanks to my supervisor Dr Arham Shabbir Associate
professor Head of Pharmacy Department The University of Lahore-Gujrat campus for
lending his skilled advice guidance decision devotion support and co-operation His
competence and goodwill encouraged me a lot to complete this important task I consider
myself honored being supervised by my research mentor He is a person with amazing
command on contemporarily research and techniques
My special thanks goes to my co-supervisor Prof Dr Syed Saeed-ul-Hassan The University
of Lahore Pakistan for his invaluable help of constructive comments and suggestions
throughout the thesis work
My sincere gratitude to Prof Dr Javed Iqbal Head of Department The University of Lahore
Pakistan for his unconditional support and encouragement
My sincere appreciation to Dr Muhammad Shahzad Associate Professor University of
Health Sciences Lahore for ensuring provision of lab facilities It wouldnrsquot have been easy
iii
without his countless support and guidance Also my special regards to the professional team
at Department of immunology University of Health Sciences Lahore Pakistan
My in-depth appreciations to Higher Education Commission (HEC) Pakistan for providing
resources and financial assistance in the carrying out of my research in Australia under
International Research Supportive Initiative Program (IRSIP)
I am truly grateful to my husband and parents for being on my side through every thick and
thin during this long journey My extra-ordinary recognition for the support extended by my
colleagues and friends They have always encouraged me to explore my potential and pursue
my dreams
Aisha Mobashar
iv
TABLE OF CONTENTS
DEDICATION i
ACKNOWLDGEMENTS ii
TABLE OF CONTENTS iv
LIST OF TABLES xi
LIST OF FIGURES xiii
LIST OF ABBREVIATIONS xvii
ABSTRACT xix
CHAPTER 1 INTRODUCTION 1
11 Hypothesis 3
111 Null hypothesis 3
112 Alternate hypothesis 3
12 Aim of the study Error Bookmark not defined
13 Objective of study Error Bookmark not defined
CHAPTER 2 LITERATURE REVIEW 4
21 Epidemiology 4
22 Pathophysiology 5
23 Treatments 7
24 Inflammation 10
25 Role of Carrageenan histamine serotonin xylene and dextran 11
26 Plants used 12
CHAPTER 3 MATERIALS AND METHODS 15
31 Plant collection 15
32 Preparation of extracts 15
33 Assessment of anti-arthritic activities 16
331 Arthritis induction 16
v
332 Evaluation of arthritic progression 17
333 Assessment of paw volume 17
334 Histopathological investigations 17
34 Assessment of mRNA expression levels of TNF-α NF-κB IL-6
IL-1β COX-1 COX-2 and IL-4 17
341 RNA extraction 17
3411 Homogenization of blood 18
3412 Phase separation 18
3413 Method of RNA precipitation 18
3414 Washing of RNA 18
3415 Re-suspension of RNA pellets 18
3416 RNA Quantification 18
343 Primer designing 19
344 cDNA synthesis 21
345 Working solution of primers 22
346 Polymerase chain reaction 22
347 Ingredients required for the formulation of TAE reaction
buffer (50X) 22
348 Gel preparation and Gel electrophoresis 23
349 Densitometry 23
3410 Determination of serum PGE2 levels using ELISA 23
34101 Preparation of standard 24
34102 Biotinylated Detection Antibody 24
34103 Concentrated HRP Conjugate 24
34104 Substrate reagent 24
34105 Procedure of ELISA 24
3411 Evaluation of hematological parameters 25
3412 Evaluation of biochemical parameters 25
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
CERTIFICATE OF APPROVAL
This is to certify that research work presented in the thesis entitled ldquoEvaluation of anti-
inflammatory and anti-arthritic activities of Juglans regia L and Trigonella gharuensis
Rechfrdquo was conducted by Ms Aisha Mobashar under the supervision of Dr Arham
Shabbir
No part of this thesis has been submitted anywhere else for any other degree This thesis is
submitted to the university in partial fulfillment of requirements for the degree of Doctor of
Philosophy in the field of Pharmacology Faculty of Pharmacy The University of Lahore
Student Name
Aisha Mobashar Signature
Supervisor Name
Dr Arham Shabbir Signature
Associate Professor
Co-Supervisor Name
Prof Dr Saeed-ul-Hassan Signature ________________________
Professor
Name of Head MPhilPhD Program
Dr Mahtab Ahmad Khan__
Signature Date
Name of HOD
Prof Dr Javed Iqbal_______
Signature Date
i
DEDICATION
I would like to dedicate this thesis to my beloved Teachers and family because whatever
I am today is all due to their prayers and their support
ii
ACKNOWLDGEMENTS
Words are bounded and knowledge is limited to praise ALLAH (SWT) The Most Beneficent
The Merciful Gracious and The Compassionate Whose bounteous blessing and exaltation
flourished my thoughts and thrived my ambition to have the cherished fruit of my modest
efforts in the form of His manuscripts from the blooming spring of blossoming knowledge
Countless blessings upon HOLY PROPHET HAZRAT MUHAMMAND (PBUH) who has
shown the right direction to humanity and thereby enlightening their ways with faith through
his eternal teachings
Itrsquos a great honor and pleasure to pay thanks to my supervisor Dr Arham Shabbir Associate
professor Head of Pharmacy Department The University of Lahore-Gujrat campus for
lending his skilled advice guidance decision devotion support and co-operation His
competence and goodwill encouraged me a lot to complete this important task I consider
myself honored being supervised by my research mentor He is a person with amazing
command on contemporarily research and techniques
My special thanks goes to my co-supervisor Prof Dr Syed Saeed-ul-Hassan The University
of Lahore Pakistan for his invaluable help of constructive comments and suggestions
throughout the thesis work
My sincere gratitude to Prof Dr Javed Iqbal Head of Department The University of Lahore
Pakistan for his unconditional support and encouragement
My sincere appreciation to Dr Muhammad Shahzad Associate Professor University of
Health Sciences Lahore for ensuring provision of lab facilities It wouldnrsquot have been easy
iii
without his countless support and guidance Also my special regards to the professional team
at Department of immunology University of Health Sciences Lahore Pakistan
My in-depth appreciations to Higher Education Commission (HEC) Pakistan for providing
resources and financial assistance in the carrying out of my research in Australia under
International Research Supportive Initiative Program (IRSIP)
I am truly grateful to my husband and parents for being on my side through every thick and
thin during this long journey My extra-ordinary recognition for the support extended by my
colleagues and friends They have always encouraged me to explore my potential and pursue
my dreams
Aisha Mobashar
iv
TABLE OF CONTENTS
DEDICATION i
ACKNOWLDGEMENTS ii
TABLE OF CONTENTS iv
LIST OF TABLES xi
LIST OF FIGURES xiii
LIST OF ABBREVIATIONS xvii
ABSTRACT xix
CHAPTER 1 INTRODUCTION 1
11 Hypothesis 3
111 Null hypothesis 3
112 Alternate hypothesis 3
12 Aim of the study Error Bookmark not defined
13 Objective of study Error Bookmark not defined
CHAPTER 2 LITERATURE REVIEW 4
21 Epidemiology 4
22 Pathophysiology 5
23 Treatments 7
24 Inflammation 10
25 Role of Carrageenan histamine serotonin xylene and dextran 11
26 Plants used 12
CHAPTER 3 MATERIALS AND METHODS 15
31 Plant collection 15
32 Preparation of extracts 15
33 Assessment of anti-arthritic activities 16
331 Arthritis induction 16
v
332 Evaluation of arthritic progression 17
333 Assessment of paw volume 17
334 Histopathological investigations 17
34 Assessment of mRNA expression levels of TNF-α NF-κB IL-6
IL-1β COX-1 COX-2 and IL-4 17
341 RNA extraction 17
3411 Homogenization of blood 18
3412 Phase separation 18
3413 Method of RNA precipitation 18
3414 Washing of RNA 18
3415 Re-suspension of RNA pellets 18
3416 RNA Quantification 18
343 Primer designing 19
344 cDNA synthesis 21
345 Working solution of primers 22
346 Polymerase chain reaction 22
347 Ingredients required for the formulation of TAE reaction
buffer (50X) 22
348 Gel preparation and Gel electrophoresis 23
349 Densitometry 23
3410 Determination of serum PGE2 levels using ELISA 23
34101 Preparation of standard 24
34102 Biotinylated Detection Antibody 24
34103 Concentrated HRP Conjugate 24
34104 Substrate reagent 24
34105 Procedure of ELISA 24
3411 Evaluation of hematological parameters 25
3412 Evaluation of biochemical parameters 25
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
i
DEDICATION
I would like to dedicate this thesis to my beloved Teachers and family because whatever
I am today is all due to their prayers and their support
ii
ACKNOWLDGEMENTS
Words are bounded and knowledge is limited to praise ALLAH (SWT) The Most Beneficent
The Merciful Gracious and The Compassionate Whose bounteous blessing and exaltation
flourished my thoughts and thrived my ambition to have the cherished fruit of my modest
efforts in the form of His manuscripts from the blooming spring of blossoming knowledge
Countless blessings upon HOLY PROPHET HAZRAT MUHAMMAND (PBUH) who has
shown the right direction to humanity and thereby enlightening their ways with faith through
his eternal teachings
Itrsquos a great honor and pleasure to pay thanks to my supervisor Dr Arham Shabbir Associate
professor Head of Pharmacy Department The University of Lahore-Gujrat campus for
lending his skilled advice guidance decision devotion support and co-operation His
competence and goodwill encouraged me a lot to complete this important task I consider
myself honored being supervised by my research mentor He is a person with amazing
command on contemporarily research and techniques
My special thanks goes to my co-supervisor Prof Dr Syed Saeed-ul-Hassan The University
of Lahore Pakistan for his invaluable help of constructive comments and suggestions
throughout the thesis work
My sincere gratitude to Prof Dr Javed Iqbal Head of Department The University of Lahore
Pakistan for his unconditional support and encouragement
My sincere appreciation to Dr Muhammad Shahzad Associate Professor University of
Health Sciences Lahore for ensuring provision of lab facilities It wouldnrsquot have been easy
iii
without his countless support and guidance Also my special regards to the professional team
at Department of immunology University of Health Sciences Lahore Pakistan
My in-depth appreciations to Higher Education Commission (HEC) Pakistan for providing
resources and financial assistance in the carrying out of my research in Australia under
International Research Supportive Initiative Program (IRSIP)
I am truly grateful to my husband and parents for being on my side through every thick and
thin during this long journey My extra-ordinary recognition for the support extended by my
colleagues and friends They have always encouraged me to explore my potential and pursue
my dreams
Aisha Mobashar
iv
TABLE OF CONTENTS
DEDICATION i
ACKNOWLDGEMENTS ii
TABLE OF CONTENTS iv
LIST OF TABLES xi
LIST OF FIGURES xiii
LIST OF ABBREVIATIONS xvii
ABSTRACT xix
CHAPTER 1 INTRODUCTION 1
11 Hypothesis 3
111 Null hypothesis 3
112 Alternate hypothesis 3
12 Aim of the study Error Bookmark not defined
13 Objective of study Error Bookmark not defined
CHAPTER 2 LITERATURE REVIEW 4
21 Epidemiology 4
22 Pathophysiology 5
23 Treatments 7
24 Inflammation 10
25 Role of Carrageenan histamine serotonin xylene and dextran 11
26 Plants used 12
CHAPTER 3 MATERIALS AND METHODS 15
31 Plant collection 15
32 Preparation of extracts 15
33 Assessment of anti-arthritic activities 16
331 Arthritis induction 16
v
332 Evaluation of arthritic progression 17
333 Assessment of paw volume 17
334 Histopathological investigations 17
34 Assessment of mRNA expression levels of TNF-α NF-κB IL-6
IL-1β COX-1 COX-2 and IL-4 17
341 RNA extraction 17
3411 Homogenization of blood 18
3412 Phase separation 18
3413 Method of RNA precipitation 18
3414 Washing of RNA 18
3415 Re-suspension of RNA pellets 18
3416 RNA Quantification 18
343 Primer designing 19
344 cDNA synthesis 21
345 Working solution of primers 22
346 Polymerase chain reaction 22
347 Ingredients required for the formulation of TAE reaction
buffer (50X) 22
348 Gel preparation and Gel electrophoresis 23
349 Densitometry 23
3410 Determination of serum PGE2 levels using ELISA 23
34101 Preparation of standard 24
34102 Biotinylated Detection Antibody 24
34103 Concentrated HRP Conjugate 24
34104 Substrate reagent 24
34105 Procedure of ELISA 24
3411 Evaluation of hematological parameters 25
3412 Evaluation of biochemical parameters 25
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
ii
ACKNOWLDGEMENTS
Words are bounded and knowledge is limited to praise ALLAH (SWT) The Most Beneficent
The Merciful Gracious and The Compassionate Whose bounteous blessing and exaltation
flourished my thoughts and thrived my ambition to have the cherished fruit of my modest
efforts in the form of His manuscripts from the blooming spring of blossoming knowledge
Countless blessings upon HOLY PROPHET HAZRAT MUHAMMAND (PBUH) who has
shown the right direction to humanity and thereby enlightening their ways with faith through
his eternal teachings
Itrsquos a great honor and pleasure to pay thanks to my supervisor Dr Arham Shabbir Associate
professor Head of Pharmacy Department The University of Lahore-Gujrat campus for
lending his skilled advice guidance decision devotion support and co-operation His
competence and goodwill encouraged me a lot to complete this important task I consider
myself honored being supervised by my research mentor He is a person with amazing
command on contemporarily research and techniques
My special thanks goes to my co-supervisor Prof Dr Syed Saeed-ul-Hassan The University
of Lahore Pakistan for his invaluable help of constructive comments and suggestions
throughout the thesis work
My sincere gratitude to Prof Dr Javed Iqbal Head of Department The University of Lahore
Pakistan for his unconditional support and encouragement
My sincere appreciation to Dr Muhammad Shahzad Associate Professor University of
Health Sciences Lahore for ensuring provision of lab facilities It wouldnrsquot have been easy
iii
without his countless support and guidance Also my special regards to the professional team
at Department of immunology University of Health Sciences Lahore Pakistan
My in-depth appreciations to Higher Education Commission (HEC) Pakistan for providing
resources and financial assistance in the carrying out of my research in Australia under
International Research Supportive Initiative Program (IRSIP)
I am truly grateful to my husband and parents for being on my side through every thick and
thin during this long journey My extra-ordinary recognition for the support extended by my
colleagues and friends They have always encouraged me to explore my potential and pursue
my dreams
Aisha Mobashar
iv
TABLE OF CONTENTS
DEDICATION i
ACKNOWLDGEMENTS ii
TABLE OF CONTENTS iv
LIST OF TABLES xi
LIST OF FIGURES xiii
LIST OF ABBREVIATIONS xvii
ABSTRACT xix
CHAPTER 1 INTRODUCTION 1
11 Hypothesis 3
111 Null hypothesis 3
112 Alternate hypothesis 3
12 Aim of the study Error Bookmark not defined
13 Objective of study Error Bookmark not defined
CHAPTER 2 LITERATURE REVIEW 4
21 Epidemiology 4
22 Pathophysiology 5
23 Treatments 7
24 Inflammation 10
25 Role of Carrageenan histamine serotonin xylene and dextran 11
26 Plants used 12
CHAPTER 3 MATERIALS AND METHODS 15
31 Plant collection 15
32 Preparation of extracts 15
33 Assessment of anti-arthritic activities 16
331 Arthritis induction 16
v
332 Evaluation of arthritic progression 17
333 Assessment of paw volume 17
334 Histopathological investigations 17
34 Assessment of mRNA expression levels of TNF-α NF-κB IL-6
IL-1β COX-1 COX-2 and IL-4 17
341 RNA extraction 17
3411 Homogenization of blood 18
3412 Phase separation 18
3413 Method of RNA precipitation 18
3414 Washing of RNA 18
3415 Re-suspension of RNA pellets 18
3416 RNA Quantification 18
343 Primer designing 19
344 cDNA synthesis 21
345 Working solution of primers 22
346 Polymerase chain reaction 22
347 Ingredients required for the formulation of TAE reaction
buffer (50X) 22
348 Gel preparation and Gel electrophoresis 23
349 Densitometry 23
3410 Determination of serum PGE2 levels using ELISA 23
34101 Preparation of standard 24
34102 Biotinylated Detection Antibody 24
34103 Concentrated HRP Conjugate 24
34104 Substrate reagent 24
34105 Procedure of ELISA 24
3411 Evaluation of hematological parameters 25
3412 Evaluation of biochemical parameters 25
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
iii
without his countless support and guidance Also my special regards to the professional team
at Department of immunology University of Health Sciences Lahore Pakistan
My in-depth appreciations to Higher Education Commission (HEC) Pakistan for providing
resources and financial assistance in the carrying out of my research in Australia under
International Research Supportive Initiative Program (IRSIP)
I am truly grateful to my husband and parents for being on my side through every thick and
thin during this long journey My extra-ordinary recognition for the support extended by my
colleagues and friends They have always encouraged me to explore my potential and pursue
my dreams
Aisha Mobashar
iv
TABLE OF CONTENTS
DEDICATION i
ACKNOWLDGEMENTS ii
TABLE OF CONTENTS iv
LIST OF TABLES xi
LIST OF FIGURES xiii
LIST OF ABBREVIATIONS xvii
ABSTRACT xix
CHAPTER 1 INTRODUCTION 1
11 Hypothesis 3
111 Null hypothesis 3
112 Alternate hypothesis 3
12 Aim of the study Error Bookmark not defined
13 Objective of study Error Bookmark not defined
CHAPTER 2 LITERATURE REVIEW 4
21 Epidemiology 4
22 Pathophysiology 5
23 Treatments 7
24 Inflammation 10
25 Role of Carrageenan histamine serotonin xylene and dextran 11
26 Plants used 12
CHAPTER 3 MATERIALS AND METHODS 15
31 Plant collection 15
32 Preparation of extracts 15
33 Assessment of anti-arthritic activities 16
331 Arthritis induction 16
v
332 Evaluation of arthritic progression 17
333 Assessment of paw volume 17
334 Histopathological investigations 17
34 Assessment of mRNA expression levels of TNF-α NF-κB IL-6
IL-1β COX-1 COX-2 and IL-4 17
341 RNA extraction 17
3411 Homogenization of blood 18
3412 Phase separation 18
3413 Method of RNA precipitation 18
3414 Washing of RNA 18
3415 Re-suspension of RNA pellets 18
3416 RNA Quantification 18
343 Primer designing 19
344 cDNA synthesis 21
345 Working solution of primers 22
346 Polymerase chain reaction 22
347 Ingredients required for the formulation of TAE reaction
buffer (50X) 22
348 Gel preparation and Gel electrophoresis 23
349 Densitometry 23
3410 Determination of serum PGE2 levels using ELISA 23
34101 Preparation of standard 24
34102 Biotinylated Detection Antibody 24
34103 Concentrated HRP Conjugate 24
34104 Substrate reagent 24
34105 Procedure of ELISA 24
3411 Evaluation of hematological parameters 25
3412 Evaluation of biochemical parameters 25
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
iv
TABLE OF CONTENTS
DEDICATION i
ACKNOWLDGEMENTS ii
TABLE OF CONTENTS iv
LIST OF TABLES xi
LIST OF FIGURES xiii
LIST OF ABBREVIATIONS xvii
ABSTRACT xix
CHAPTER 1 INTRODUCTION 1
11 Hypothesis 3
111 Null hypothesis 3
112 Alternate hypothesis 3
12 Aim of the study Error Bookmark not defined
13 Objective of study Error Bookmark not defined
CHAPTER 2 LITERATURE REVIEW 4
21 Epidemiology 4
22 Pathophysiology 5
23 Treatments 7
24 Inflammation 10
25 Role of Carrageenan histamine serotonin xylene and dextran 11
26 Plants used 12
CHAPTER 3 MATERIALS AND METHODS 15
31 Plant collection 15
32 Preparation of extracts 15
33 Assessment of anti-arthritic activities 16
331 Arthritis induction 16
v
332 Evaluation of arthritic progression 17
333 Assessment of paw volume 17
334 Histopathological investigations 17
34 Assessment of mRNA expression levels of TNF-α NF-κB IL-6
IL-1β COX-1 COX-2 and IL-4 17
341 RNA extraction 17
3411 Homogenization of blood 18
3412 Phase separation 18
3413 Method of RNA precipitation 18
3414 Washing of RNA 18
3415 Re-suspension of RNA pellets 18
3416 RNA Quantification 18
343 Primer designing 19
344 cDNA synthesis 21
345 Working solution of primers 22
346 Polymerase chain reaction 22
347 Ingredients required for the formulation of TAE reaction
buffer (50X) 22
348 Gel preparation and Gel electrophoresis 23
349 Densitometry 23
3410 Determination of serum PGE2 levels using ELISA 23
34101 Preparation of standard 24
34102 Biotinylated Detection Antibody 24
34103 Concentrated HRP Conjugate 24
34104 Substrate reagent 24
34105 Procedure of ELISA 24
3411 Evaluation of hematological parameters 25
3412 Evaluation of biochemical parameters 25
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
v
332 Evaluation of arthritic progression 17
333 Assessment of paw volume 17
334 Histopathological investigations 17
34 Assessment of mRNA expression levels of TNF-α NF-κB IL-6
IL-1β COX-1 COX-2 and IL-4 17
341 RNA extraction 17
3411 Homogenization of blood 18
3412 Phase separation 18
3413 Method of RNA precipitation 18
3414 Washing of RNA 18
3415 Re-suspension of RNA pellets 18
3416 RNA Quantification 18
343 Primer designing 19
344 cDNA synthesis 21
345 Working solution of primers 22
346 Polymerase chain reaction 22
347 Ingredients required for the formulation of TAE reaction
buffer (50X) 22
348 Gel preparation and Gel electrophoresis 23
349 Densitometry 23
3410 Determination of serum PGE2 levels using ELISA 23
34101 Preparation of standard 24
34102 Biotinylated Detection Antibody 24
34103 Concentrated HRP Conjugate 24
34104 Substrate reagent 24
34105 Procedure of ELISA 24
3411 Evaluation of hematological parameters 25
3412 Evaluation of biochemical parameters 25
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
vi
35 Acute toxicity study 26
36 Evaluation of anti-inflammatory activities 26
361 Experimental design and induction of paw edema using
carrageenan 28
362 Experimental design and paw edema induction using
histamine 28
363 Experimental design and paw edema induction using
serotonin 28
364 Experimental design and induction of paw edema using
dextran 29
365 Experimental design for ear edema induced by xylene 29
366 Experimental design for castor oil-induced diarrhea model 29
37 Phytochemical Evaluation 30
371 Test for Alkaloids 30
3711 Mayerrsquos reagent 30
3712 Wagnerrsquos reagent 31
372 Test for the steroids 31
373 Keller-Kilani for cardiac glycosides 31
374 Tests for terpenoids 31
3741 Salkowski test 31
375 Tests for Phenols 31
376 Test for saponins 32
377 Test for flavonoids 32
38 Gas chromatography-mass spectrometry Analysis 32
39 Statistical analysis 32
CHAPTER 4 RESULTS 33
41 J regia and T gharuensis significantly reduced paw edema in
FCA-induced arthritic model 33
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
vii
411 Measurement of paw edema at day 8 33
412 Measurement of paw edema at day 15 34
413 Measurement of paw edema at day 22 35
414 Measurement of paw edema at day 28 36
42 J regia and T gharuensis attenuated arthritic Score 39
421 At Day 8 39
422 At Day 15 40
423 At Day 22 41
424 At Day 28 42
43 J regia and T gharuensis attenuated histopatological parameters 45
431 J regia significantly reduced inflammation 45
432 J regia significantly attenuated pannus formation 46
433 J regia significantly reduced erosion of bone 47
44 J regia and T gharuensis downregulated mRNA expression levels
of pro-inflammatory markers and upregulated anti-inflammatory
marker 57
441 J regia and T gharuensis downregulated mRNA expression
levels of TNF-α 57
442 J regia suppressed mRNA expression levels of NF-κB 58
443 J regia and T gharuensis reduced IL-6 mRNA expression
levels 59
444 J regia and T gharuensis decreased the mRNA expression
levels of IL-1β 60
445 J regia and T gharuensis down regulated COX-1 mRNA
expression levels 61
446 J regia and T gharuensis down regulated the mRNA
expression levels of COX-2 62
447 J regia and T gharuensis up regulated the mRNA expression
levels of IL-4 63
viii
448 J regia and T gharuensis significantly reduced PGE2 Levels
64
449 J regia and T gharuensis nearly normalized hematological
parameters 66
4491 J regia and T gharuensis nearly normalized RBC
count 66
4492 J regia and T gharuensis nearly normalized Hb
content 67
4493 J regia and T gharuensis nearly normalized WBC
count 68
4494 J regia and T gharuensis nearly normalized
platelet count 69
4410 J regia and T gharuensis effects on biochemical parameters
71
44101 J regia and T gharuensis effects on urea levels 71
44102 J regia and T gharuensis did not alter creatinine
levels 72
44103 J regia and T gharuensis effects on ALT levels 73
44104 J regia and T gharuensis effects on AST levels 74
44105 J regia and T gharuensis extracts significantly
reduced ALP levels 75
4411 Evaluation of acute Toxicity of extracts of J regia and T
gharuensis 77
45 Pre-treatment with J regia and T gharuensis inhibited paw edema
induced by carrageenan 78
451 At 1st hr 78
452 At 2nd hr 79
453 At 3rd hr 80
454 At 4th hr 81
ix
455 At 5th hr 82
46 Pre-treatment with J regia and T gharuensis inhibited histamine-
induced paw edema 85
461 At 1st hr 85
462 At 2nd hr 86
463 At 3rd hr 87
47 Pretreatment with J regia and T gharuensis prevented serotonin-
induced paw edema 90
471 At 1st hr 90
472 At 2nd hr 91
473 At 3rd hr 92
48 Pretreatment with J regia and T gharuensis inhibited dextran-
induced paw edema 95
481 At 1st hr 95
482 At 2nd hr 96
483 At 3rd hr 97
484 At 4th hr 98
485 At 5th hr 99
49 Pretreatment with J regia and T gharuensis inhibited xylene-
induced paw edema 102
491 Onset time of diarrhea 103
492 Number of wet feces 104
493 Total weight of wet feces 105
494 Total number of feces 106
410 Qualitative analysis of J regia and T gharuensis extracts 108
411 GC-MS analysis of J regia and T gharuensis extracts 109
4111 Assessment of GC-MS analysis of J regia ethanolic extract 109
4112 Assessment of GC-MS of n- hexane extract of J regia 126
x
4113 GC-MS analysis of ethanolic extract of T gharuensis 137
4114 GC-MS analysis of T gharuensis n-hexane extract 148
CHAPTER 5 DISCUSSION 168
CHAPTER 6 CONCLUSION 175
REFERENCES 177
xi
LIST OF TABLES
Page
Table 1 RNA quantification of samples 19
Table 2 Sequences of primers 22
Table 3 Acute inflammatory models 28
Table 4 J regia and T gharuensis extracts significantly reduced paw edema in
FCA induced arthritis model
40
Table 5 J regia and T gharuensis attenuated arthritic development 46
Table 6 J regia and T gharuensis attenuated histopatological parameters 50
Table 7 J regia and T gharuensis attenuated mRNA expression levels of pro-
inflammatory markers and up-regulated anti-inflammatory marker
66
Table 8 J regia and T gharuensis nearly normalized hematological parameters 71
Table 9 J regia and T gharuensis did not alter biochemical parameter 77
Table 10 Acute toxicity study of ethanolic and n-hexane extracts of J regia and
T gharuensis
78
Table 11 The anti-inflammatory properties of the anti-inflammatory
characteristics of J regia and T gharuensis extracts on carrageenan-
induced paw edema
84
xii
Table 12 The anti-inflammatory properties of J regia and T gharuensis extracts
on histamine-induced paw edema model
88
Table 13 The anti-inflammatory properties of J regia and T gharuensis extracts
on serotonin-induced paw edema model
92
Table 14 The anti-inflammatory properties of J regia and T gharuensis extracts
on dextran-induced Paw edema model
98
Table 15 Pretreatment with J regia and T gharuensis extracts inhibited castor
oil-induced diarrhea
104
Table 16 Qualitative analysis of J regia and T gharuensis extracts 105
Table 17 List of identified constituents of ethanolic extract of J regia 107
Table 18 List of identified constituents of n-hexane extract of J regia 126
Table 19 List of identified constituents of ethanolic extract of T gharuensis 137
Table 20 GC-MS analysis of T gharuensis n-hexane extract 148
xiii
LIST OF FIGURES
Page
Figure 1 Paw edema at day 8 35
Figure 2 Paw edema at day 15 36
Figure 3 Paw edema at day 22 37
Figure 4 Paw edema at day 28 38
Figure 5 Paw edema 39
Figure 6 Arthritic score at day 8 41
Figure 7 Arthritic score at day 15 42
Figure 8 Arthritic score at day 22 43
Figure 9 Arthritic score at day 28 44
Figure 10 Arthritic Score 45
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells 47
Figure 12 J regia and T gharuensis reduced pannus formation 48
Figure 13 J regia and T gharuensis reduced bone erosion 49
Figure 14 Histopathology of normal control 51
Figure 15 Histopathology of diseased control 52
Figure 16 Histopathology of piroxicam 53
xiv
Figure 17 Histopathology of EEJR 54
Figure 18 Histopathology of NHJR 55
Figure 19 Histopathology of EETG 56
Figure 20 Histopathology of NHTG 57
Figure 21 J regia and T gharuensis downregulated mRNA expression levels
of TNF-α
58
Figure 22 J regia and T gharuensis downregulated mRNA expression levels
of NF-κB
59
Figure 23 J regia and T gharuensis downregulated mRNA expression levels
of IL-6
60
Figure 24 J regia and T gharuensis downregulated mRNA expression levels
of IL-1β
61
Figure 25 J regia and T gharuensis downregulated mRNA expression levels
of COX-1
62
Figure 26 J regia and T gharuensis downregulated mRNA expression levels
of COX-2
63
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of
IL-4
64
Figure 28 J regia and T gharuensis downregulated levels PGE2 65
xv
Figure 29 J regia and T gharuensis nearly normalized RBC count 67
Figure 30 J regia and T gharuensis nearly normalized Hb content 68
Figure 31 J regia and T gharuensis nearly normalized WBC count 69
Figure 32 J regia and T gharuensis nearly normalized Platelet count 70
Figure 33 J regia and T gharuensis effects on urea levels 72
Figure 34 J regia and T gharuensis effects Creatinine level 73
Figure 35 J regia and T gharuensis effects ALT levels 74
Figure 36 J regia and T gharuensis effects AST levels 75
Figure 37 J regia and T gharuensis effects ALP levels 76
Figure 38 Carrageenan At first hour 79
Figure 39 Carrageenan At second hour 80
Figure 40 Carrageenan At third hour 81
Figure 41 Carrageenan At fourth hour 82
Figure 42 Carrageenan At fifth hour 83
Figure 43 Histamine At first hour 85
Figure 44 Histamine At second hour 86
Figure 45 Histamine At third hour 87
xvi
Figure 46 Serotonin At first hour 89
Figure 47 Serotonin At second hour 90
Figure 48 Serotonin At third hour 91
Figure 49 Dextran At first hour 93
Figure 50 Dextran At second hour 94
Figure 51 Dextran At third hour 95
Figure 52 Dextran At fourth hour 96
Figure 53 Dextran At fifth hour 97
Figure 54 Xylene induced ear edema 99
Figure 55 Onset time of diarrhea 100
Figure 56 Number of wet feces 101
Figure 57 Total weight of wet feces 102
Figure 58 Total number of feces 103
xvii
LIST OF ABBREVIATIONS
RA Rheumatoid arthritis
J regia Juglans regia
T gharuensis Trigonella gharuensis
FCA Freundrsquos complete adjuvant
EEJR Ethanolic extract of J regia
NHJR n- hexane extract of j regia
EETG Ethanolic extract of T gharuensis
NHTG n- hexane extract of T gharuensis
AST Aspartate aminotransferase
ALT Alanine transaminase
ALP Alkaline phosphatase
Hb Haemoglobin
RBC Red blood cells
WBC White blood cells
RT-PCR Reverse transcriptase polymerase chain reaction
TNF-α Tumour necrosis factor alpha
NF-κB Nuclear factor kappa B
IL-1β Interleukin 1 beta
IL-6 Interleukin 6
IL-4 Interleukin 4
COX-1 Cyclooxygenase 1
COX-2 Cyclooxygenase 2
PXM Piroxicam
xviii
IND Indomethacin
DPH Diphenhydramine
Dexa Dexamethasone
LOP Loperamide
ANOVA Analysis of variance
GCMS Gas chromatography mass spectroscopy
I2 Iodine
H2SO4 Sulphuric acid
KI Potassium iodide
NGF Nerve growth factor
DW Distilled water
SM
bw
PO
Synovial membrane
Body weight
Per oral
xix
Evaluation of anti-inflammatory and anti-arthritic activities of
Juglans regia L and Trigonella gharuensis Rechf
ABSTRACT
Background The genus of Juglans and Trigonella have long been used in folk remedy for the
treatment of rheumatoid arthritis and inflammatory disorders The leaves of Juglans regia and
herb of Trigonella gharuensis were collected from Northeast and Southwest areas of Pakistan
respectively
Purpose The study aimed to investigate the immunomodulatory and anti-inflammatory
activities of ethanol and n-hexane extracts of J regia and T gharuensis in different in-vivo
models of acute and chronic inflammation
Methodology Arthritis was induced in rodents using Freundrsquos complete adjuvant induced
model of chronic inflammation Extracts of J regia leaves and T gharuensis were administered
in the doses of 500 mgkg bw po and 400 mgkg bw po respectively Treatment was
started at 8th day of arthritic induction and sustained for 20 days with extracts and piroxicam
as control At 28th day all animals were sacrificed Arthritis was determined using an arthritic
scoring index Blood analysis and biochemical parameters were determined RNA extraction
reverse transcription and polymerase chain reaction (RT-PCR) was performed to determine
expression of pro-inflammatory cytokines such as TNF-α NF-ĸB IL-6 IL-1β COX-1 COX-
2 and anti-inflammatory cytokine IL-4 Prostaglandin E2 level (PGE2) was evaluated using
ELISA Paw edemas were measured using digital water plethysmometer
For evaluation of anti-inflammatory activities acute inflammatory paw edema models
(carrageenan- histamine- serotonin- and dextran-induced paw edema) ear edema model
xx
(xylene-induced ear edema) and castor oil-induced diarrhea model were used Qualitative
analysis and gas chromatography-mass spectrometry (GC-MS) analysis were performed for
the identification of potential anti-inflammatory phytochemicals
Results Treatment with J regia and T gharuensis extracts inhibited arthritic development and
significantly attenuated paw edema All evaluated histopathological parameters were found
significantly reduced after treatment with plant extracts The RT-PCR analysis showed
significant attenuation of pro-inflammatory TNF-α NF-κB IL-6 and IL-1β levels and
potentiation of IL-4 levels COX-2 expression level was also found reduced in extracts treated
groups ELISA demonstrated suppression of PGE2 levels in all extracts treated groups The
results of all extracts were comparable to the effects of piroxicam The treated groups restored
levels of Hb and RBC Moreover levels of WBCs and platelets were found to be nearly
normalized in treated groups The non-significant difference in the levels of creatinine urea
ALT and AST were observed Both plants extracts significantly reduced paw edema induced
by carrageenan in first (early) and second (late) acute inflammation phases indicating the
possible inhibition of autacoids as one of the mechanisms of anti-inflammatory activity The
extracts also significantly prevented histamine- and serotonin-induced paw edema which
complemented inhibition of carrageenan-induced inflammation in the first acute phase
Suppression of edema by plant extracts in dextran- and xylene-induced inflammatory models
supported inhibition of autacoids Attenuation of castor oil-induced diarrhea by both extracts
supported inhibition of carrageenan-induced inflammation via prostaglandin inhibition in the
second acute inflammation phase Qualitative phytochemical screening and gas
chromatography-mass spectrometry analysis indicated constituents with anti-inflammatory
activity for example fatty acid esters and flavonoids in both extracts
xxi
Conclusion Extracts of J regia leaves and T gharuensis herb ameliorated experimentally
induced arthritis which may be ascribed to their immunomodulatory effects Moreover
attenuation of inflammatory edema in different acute models not only validated anti-
inflammatory potential but also suggested possible inhibition of autacoids as one of the
mechanisms along with immunomodulatory effects of both plants
1
CHAPTER 1 INTRODUCTION
Rheumatoid arthritis (RA) is a chronic and autoimmune disease having worldwide prevalence
of 1 in industrialized populations (1 2) The symptoms of RA are characterized by stiffness
pain synovitis of diarthrodial joints resulting into articular destruction bone erosion and
pannus formation (3) TNF-α (tumor necrosis factor-α) stimulates IL-6 (interleukin-6)
production which causes deterioration of proteoglycans and collagen causing joint destruction
(4) It is also stimulator of B and T cells (5) IL-1β (interleukin-1 beta) is present in inflamed
rheumatoid synovial tissue and stimulates bone erosion and pannus formation NF-κB (Nuclear
factor-κB) stimulates recruitment of pro-inflammatory cytokines such as TNF-α IL-1β and IL-
6 (6) Activation of cyclo-oxygenase-2 (COX-2) by NF-κB exacerbates the inflammation
COX-2 activation also leads to the production of prostaglandin-E2 (PGE2) which in turn
causes bone erosion and cartilage destruction All these cytokines contribute towards
progression of RA (7 8)
FCA was used to induce arthritis in rat model Induction of arthritis through FCA in rat paw is
a well-recognized model of arthritis The features of this chronic poly-arthritic model closely
resemble with human arthritic model This model has been extensively used to evaluate anti-
inflammatory and immunomodulatory properties of plant extracts and therapeutic agents (9)
Inflammation is regarded as cardinal answer to injury and pathogens caused by body It is
manifested by augmented vascular permeability recruitment of leukocytes release of
cytokines and chemotaxis The two types of inflammatory conditions acute and chronic are
based on time duration and underlying cascades of events that lead to physical symptoms The
acute phase can be further classified into first (early) and second (late) phases (10) The early
acute phase is caused by the release of histamine and serotonin followed by the release of
2
bradykinin prostaglandins leukotrienes and activation of polymorphonuclear cells in the late
acute phase Increased vascular permeability leads to edema and inflammation (11 12)
Although inflammation is a shielding phenomenon of the body to injurious stimuli but its
pathophysiological implications are often undesirable Steroids opiates and Non-steroidal
anti-inflammatory drugs (NSAIDs) are preferred remedies to control the negative outcomes of
inflammation (13) Various disease-modifying anti-rheumatic drugs (DMARD) such as
methotrexate TNF-α and IL-1β antagonists have been used to treat autoimmune disorders but
their use is limited due to higher vulnerability of patients to infections (14 15) NSAIDs may
induce gastric perforation erosion and bleeding due to inhibition of prostaglandins (16)
Tolerance and dependence are associated with opiates (3) Peptic ulcer precipitation of
diabetes osteoporosis and increased susceptibility to infections are associated with
corticosteroids (17)
DMARDs are used as the mainstream for the management of inflammation and pain in arthritic
patients in addition to NSAIDs However the adverse effects of synthetic drugs suggest a need
to focus on medicinal plants due to the easy availability of plants and lower cost (18) The
undesirable adverse effects of above mentioned drugs specify worth of traditional medicinal
plants for the cure of inflammation and arthritis (19)
Juglans regia L (Enaglish name walnut local name Akhrot) belongs to the family
Juglandaceae These plants are distributed all over the world in temperate regions in particular
Asia United States Western South America and Europe (20) J regia leaves have been
extensively used in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant hepatoprotective (20)
3
anti-atherogenic osteoblastic (23) aphicidal (21) antihyperlipidemic (24) antiproliferative
(25) antitumour immunoregulatory (26) and antimycobacterial (27) activities
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole 1 cm long leaflets (28) Its distribution
is worldwide (29) It belongs to family Fabeacae the second largest family of flowering plants
(30) Traditionally member of genus Trigonella were used to treat inflammatory diseases
Different plants of Trigonella genus such as Trigonella stellate and Trigonella foenum
graceum possess known pharmacological anti-inflammatory properties (18 31) T gharuensis
is also known for possessing medicinally important active ingredients (32) We did not find out
any literature regarding its anti-inflammatory prospective So prime focus of this study was to
explore its anti-arthritic and anti-inflammatory potential
In order to evaluate antirheumatic properties of J regia and T gharuensis using FCA induced
chronic model of inflammation this current study was performed Furthermore this study also
investigated anti-inflammatory mechanisms of both plant extracts in various acute
inflammatory models using mice
11 Hypothesis
111 Null hypothesis
Extracts of J regia and T gharuensis do not possess anti-arthritic and anti-inflammatory
properties
112 Alternate hypothesis
Extracts of J regia and T gharuensis possess anti-arthritic and anti-inflammatory properties
4
CHAPTER 2 LITERATURE REVIEW
Rheumatoid arthritis (RA) is progressive as well as reversible when diagnosed at early stages
Joint inflammation redness cartilage damage and bone erosion are prominent clinical
manifestations of RA Laboratory findings showed leukocytosis anemia fever weight loss
and anorexia Joint inflammation is absent in early rheumatoid arthritis However when disease
progresses joint swelling appears with fusiform appearance RA can be classified into four
stages First stage does not include any destructive changes Second stage includes moderate
destruction of subchondral bone and cartilage damage Joint deformities are absent at this stage
although mobility of joint is compromised Stage 3 is crucial and it causes muscle atrophy
Stage 4 involves lesion of soft tissues of extra-articular organs (33) Extra articular involvement
affects other organs such as eyes lungs renal nervous system and various gastrointestinal
system It usually associated with mortality Usually 40 patients get affected with extra
articular disease when they encountered with this disease and during the course of disease (34)
21 Epidemiology
Rheumatoid arthritis is occurring throughout world Majority of population suffering with this
disease and its estimated prevalence is about 05-1 in Northern Europe and North American
and mean annual incidence is 002ndash005 Patient survival is decreased in 3 to 10 years It is a
multifactorial disease involving genetic as well as environmental factors The major risk factors
are sex age smoking infectious agents These factors contribute towards severity of disease
Females have higher risk of developing arthritis as compared to male due to estrogen which
has stimulatory effect on immune system (35)
Cytokines control inflammatory processes which participate in RA progression Imbalance is
well understood between anti-inflammatory and pro-inflammatory roles of cytokines This
5
imbalance causes the stimulation of chronic inflammatory mediators as a result of which ankle
joint damage occurs Therefore cytokines are the new targets for the treatment of arthritis (36)
22 Pathophysiology
Immunologic mechanisms RA gave a wide knowledge about the pathogenesis and etiology of
rheumatoid arthritis However the exact immune pathways for understanding pathogenesis and
etiology of RA is still insufficient There are some clinical and pathological manifestations that
are obtained from the activation of various interrelated immune pathways Modern concepts of
RA that is supported by laboratory studies animal models and clinical observation have
revised and reestablished some of the opinions Early study emphasized on the importance of
immune complexes and auto-antibodies in the initiation of RA It suggested a function of T
cells in initiating inflammatory response in RA It was recognized that these interrelated
mechanisms suggestively contribute in pathogenesis of RA T cells also play function in
initiating and perpetuation of disease Immune pathways play role in defining the implication
of possible treatment because their modulation directed towards specific targets gives benefits
to the patients suffering with RA (36)
RA is a progressive autoimmune disease having systemic effects The precise pathogenesis of
this disease is unidentified but there are some environmental as well as genetic factors which
play contributory role in this disease The interaction between pro-inflammatory cytokines as
well as B- and T cells promotes progression of RA The destruction of joint starts from synovial
membrane Activation of mononuclear cells and angiogenesis leads to synovitis in joints
Pannus is a part of the synovial membrane that is rich with osteoclast cells Pannus destroys
bones and the enzymes which are released by chondrocytes and synoviocytes degrade the
cartilage Antigen-activated CD4 T cells strengthen the immune response of body by activating
osteoclast mononuclear cells chondrocytes and also synovial fibroblasts The release of
6
cytokines from these cells especially the release of TNF-α IL-1 and IL-6 lead to inflammation
of synovial membrane In addition to articular effects of cytokines the pro-inflammatory
cytokines stimulate the systemic effects which include acute-phase proteins production
cardiovascular diseases anemia and osteoporosis (37)
Synovial fibroblast is a part of composite cellular network that plays a significant function in
pathogenesis of RA Lymphocytes and macrophages secreted factors that play role in the
activation of fibroblasts This activation pattern is further characterized by the changes in
regulating signaling cascades and genes expression and alterations in these pathways lead to
apoptosis (38) IL-1 along with TNF-α play role in dys-regulation of cartilage and bone
remodeling characteristics of RA In case of bone remodeling both cytokines stimulate the
formation of NF-κB ligand receptor activator that plays role in stimulating bone resorption
caused by osteoclastic activity TNF-α increases the formation of mature osteoclasts IL-1
cytokines show its effect directly on osteoclast to stimulate both cells which stimulate bone-
resorbing ability TNFα and IL-1 both cytokines aggravate the remodeling of cartilage but IL-
1 cytokine is more effective than another This cytokine stimulates the production of factors
and also increase degradation of cartilage matrix The improved understanding of pathways
mechanism that underlays the processes of destruction of the joint will enable for more specific
and selective application of pharmacological and therapeutic agents which target these pro-
inflammatory cytokines (39)
Study was conducted to determine different types of arthritis that was expressed by both
biologically and histo-chemically active nerve growth factor in synovium A model of arthritis
induced by carrageenan was used to assess joint inflammation on the level of NGF The study
determined that in the rats experimentally induced arthritis is caused by stimulation in nerve
growth factor in peri-vascular area in synovium It was determined that nerve growth factor
7
injection in synovium did not lead to any inflammation and destruction of the peripheral
sympathetic innervations considerably reduced both level of nerve growth factor and
inflammation following carrageenan injection
A histomorphometric method was used to determine the association between ostopenia and
arthritis that emphasized total changes in the composition of bone Carrageenan injection was
injected into the knee of mature rabbit to check the trabecular bone volume and its turnover
Histomorphometry method was used to study trabecular bone volume of femoral condyles and
was established by the special technique photodensitometry on the standard macroradiographs
Calcein fluorochrome is a newly developed technique that was used to study osteogenesis by
using histological sections which were not decalcified A major defeat of the cancellous bone
occurred within 49 days in lateral and medial femoral condyle in the arthritis group The net
Osteogenesis was emphasized within four hold It was considered that rise in the total bone
resorption leads to negative bone balance The study also showed that periarticular bone loss
of the RA is also directly linked with increased bone turnover When quantitative study on the
kinetics of bone remodeling in RA was done it provides the foundation for therapeutic attempts
to reverse or prevent the therapeutic attempts Osteopenia also increases the risk of fracture in
inflammatory arthritis (40)
23 Treatments
NSAIDs are extensively used drugs all over the world The adverse effects which restrain its
uses is GIT bleeding Endoscopic studies showed that 15 to 30 of patients usually
encountered with gastric or duodenal ulcer The major side effects of NSAIDs are bleeding and
more than 100000 patients are hospitalized and among which 16500 patients die as a result of
gastrointestinal events in the United States NSAIDS inhibited cyclooxygenase which is
involved in the synthesis of prostaglandin COX-I is overexpressed constitutively and it
8
protects gastric mucosa While COX-2 increases prostaglandin production which mediates
inflammation COX-2 inhibition prevented harmful effects of prostaglandin which is
inflammation and pain while COX-I inhibition is associated with harmful effects in the GIT
wall and inhibition of platelets aggregation Agents that inhibit COX-2 enymes showed similar
effects such as reduction of inflammation and pain similar to non-selective NSAIDs (41)
NSAIDs was invented in 1972 and they was introduced in market in 1982 by Pfizer Piroxicam
has long half-life which is 45 hours in human being It possesses analgesic and antipyretic It
has been used in treatment of RA Like others NSAIDs its mechanism of action is inhibition of
cyclooxygenase (42)
Cyclooxygenase act on arachidonic acid to form prostaglandins While isomers of these
enzymes transform the arachidonic acid to prostaglandins COX-1 a constitutive enzyme form
is present in the human body and play a role in the homeostatic function for example influence
blood flow and maintain normal gastric mucosa The COX-2 on another hand acts as an
inducer and is expressed to physiological stimuli and is also concerned in prostaglandins
production which arbitrate the pain as well as inflammation Non-specifically the Nonsteroidal
anti-inflammatory drugs (NSAIDs) reduce the production of both forms The beneficial effects
of NSAIDs through minimizing inflammation and producing analgesic effects occur by
decreasing synthesis of COX-2 but with some unwanted effects like mild bleeding and
gastrointestinal adverse effects occur due to concurrent inhibition of important COX-1 The
agents which selectively decrease the COX-2 synthesis while sparing the COX-1 regarded as
an highly interesting and beneficial therapeutically and can also characterize as a chief progress
in the treatment of RA as well as osteoarthritis (43)
Inhibitors of synthesis of PGE2 nonsteroidal anti-inflammatory drugs and some other
prostanoids can be used in the treatment the RA To understand mechanism by which
prostaglandin plays role in pathogenesis of this disease experiment was conducted on rats
9
Rats which lack each of the four known prostaglandin receptor E2 receptors were used
Homozygous deletion of all receptors (E1 E2 and E3) did not influence the arthritis
development while disease progress was found in mice which have low expression of above-
mentioned receptor These rats also showed the reduction in the inflammation when assessed
with low circulating serum amyloid A and IL-6 levels Therefore antagonists of these receptors
give new agents for treatment of RA (44)
Cyclooxygenase-2 is stimulated in inflamed joint tissues and is involved in the production of
prostaglandin While the exact phenomenon of cyclooxygenase expression is regulated stays
to be elucidated Various study suggested that prostaglandin play role in inflammation
angiogenesis and apoptosis These events are responsible of possible structural changes which
characterize the arthritic disease NSAIDs are prescribed for the treatment of RA and give
effective relief from the symptoms of RA while serious GIT complications occur with their
use The mechanism by which NSAIDS can reduce pain and inflammation in patients of
rheumatoid arthritis is that they inhibit the production of cyclooxygenase -2 while toxicity is
related to inhibition of COX-1 Selective C0X-2 inhibitors show better results when compared
with placebo and are effective for the management of RA symptoms They also improve the
GIT safety and tolerability Various studies also shows that there is still some complication of
NSAIDs with the selective COX-2 inhibitors The major feature is the rheumatoid arthritis is
overexpression of -2 protein in articular tissues While the exact molecular mechanisms are
still unclear By understanding more clear mechanism of COX-2 it will become effective to
treat rheumatoid arthritis easily
When anti-tumur necrosis factor α antibody (infliximab) and methotrexate are administered in
a combination for the treatment of RA it shows a positive effect Though some patients did
not show any response to this treatment The study was conducted on a patients with
10
rheumatoid arthritis by administering repeated high dose of intra-articular infliximab and
infliximab infusions into an inflamed knee When the patient was assessed it was determined
that that there were not any clinical effects When knee arthroscopic biopsy was done before
injection it was demonstrated that TNFα staining was present there Moreover
immunohistochemistry report revealed presence of lymphotoxin α Thus it was suggested that
the resistance to TNF receptor blockage might be due to insufficient amount of TNFα The
study also suggested that LTα may also have a significant role in RA
RA synovium is associated with increased levels of COX-2 as well as angiogenesis Both
phenomena were investigated and it was found that selective COX-2 inhibitor such as rofecoxib
effects on human dermal and reduce ability of angiogenesis and chemotactic activity The
pretreatment with selective COX-2 inhibitor (rofecoxib) considerably decreased angiogenesis
When RA was firstly treated with selective COX-2 inhibitor (rofecoxib) for at least 14 hours
followed by stimulation with the IL-1β less angiogenesis was observed The COX-2 induced
angiogenic activity is the important active mechanism in RA synovium hence these are
preferred drug therapies in the treatment of RA
24 Inflammation
Inflammation helps the body in healing wounds infections or damage and without
inflammatory response it is impossible to heal wounds Inflammation is very beneficial for the
body but can also be harmful if it is present in more quantity and can persist in body for long
time than usual When a baby is born various defences are naturally present in the body of
human which is known as innate immunity Inflammation is of two types In acute
inflammation onset of action in acute inflammation is very rapid however time period of
action is short The symptoms of chronic and acute inflammation vary depending upon nature
of disease The causes of acute inflammation are chemical agents (tissue necrosis reducing
11
agents alkalis and corrosive acids) physical agents (trauma vibration heat cold ionizing
agents) hypersensitivity reactions and microbial infections Chronic inflammation has slow
onset of action but duration of action is long
25 Role of Carrageenan histamine serotonin xylene and dextran
Carrageenan is commonly used chemical that play role in releasing inflammatory and
histamine prostaglandins leukotrienes TNF-α as well as bradykinin Acute inflammation
route of carrageenan is a biphasic and when carageenan is injected serotonin kinins and
histamine is released in first phase while second phase is responsible of release of prostaglandin
(45)
Histamine play crucial part in early inflammatory response Stored histamine present in white
blood cells eg basophils eosinophils and mast cells Mast cells are present in large quantity
at the site of potential injury such as feet mouth internal body surfaces nose and blood vessels
Non-mast cells histamine is also found in various tissues such as in brain where it functions as
neurotransmitter Another significant site where histamine is stored and released is ECL of
stomach The important function of histamine release from mast cells and basophils is
immunologic (46)
Basophilocytes from the patients (patients with rheumatoid arthritis) respond to the leukocyte
nuclei from normal people with the release of histamine A similar release of histamine induced
by nuclear components of DNA and RNA has been demonstrated in normal people Patients
with RA were treated with anti-histamines (H1 and H2) and results showed that there was a
direct effect of histamine in RA (47)
12
Serotonin has two functions related to inflammation that it increases vascular permeability and
causes vasodilation It is also a vasoactive amine just like histamine It also plays role in the
dilation of capillaries and in contraction of non-vascular smooth muscles (48)
Xylene is responsible for severe vasodilation and can cause edematous changes of skin that is
sign of acute inflammation Xylene is also responsible for histopathological changes such as it
increase the thickness of skin tissues when it is applied topically (49)
Dextran is responsible for infilteration of mononuclear cells as well as regenerative changes in
epithelium The exact mechanism through which dextran play role in inflammation is no clear
but studies show that it induces B cells T cells macrophages and polymorphonuclear changes
26 Plants used
There are eight genera of plant Juglandaccac family while the best-known species of the family
is J regia because it produces timber that can used for many purposes and edible nuts It is
cultivated in all over the world especially in South of Asia West Indies South Eastern Eurpoe
Japan and in Eastern and Southern region of US The height of this plant is 25-35m while the
diameter of its trunk is 2m and grow well in full light of moon It is mostly present in mountain
region of Central Asia for the purpose of making medicaments J regia leaves has been
extensively use in the pharmaceutical and cosmetic industry due to its easy accessibility (21)
Traditionally J regia leaves have been used to treat rheumatic pains (22) Its decoction has
also been used for rheumatic pain and inflammatory disorders (7) The plant is known to
possess antinociceptive (21) antidiabetic antimicrobial antioxidant and hepatoprotective (20)
anti-atherogenic and osteoblastic (23) aphicidal (21) antihyperlipidemic (24)
antiproliferative (25) antitumour immunoregulatory (26) and anti-mycobacterial (27)
activities Walnut is made up of many chemical compounds such as flavonoids caffeic acid
quercetin and ascorbic acid and due to presence of these compounds it has anti-oxidant activity
13
(50) The roots of Juglans are use to treat diabetes and its related drugs The leaves of plant
have anti-inflammatory anthelmintic depurative and astringent activity Thus they are used
to treat chronic cough dairrhoea asthma dyspepsia and constipation They are also used to
treat stramous sores skin ailments and to purify the blood The rind of plant has astringent and
anodyne activity They are used to treat anemia and diarrhea The seeds of plant are stimulant
and diuretic The oil of seed is anthelmintic It is also used to treat dry skin and menstrual
problems The cotyledons are used to treat cancer because this plant has anti-cancer activity
(51)
Trigonella gharuensis Rech f is collected from the hilly areas of Quetta It is perennial herb
suberect 6-9 mm broad 50cm tall 14 cm long Petiole and 1 cm long leaflets (28) Its
distribution is worldwide (29) It belongs to family Fabeacae the second largest family of
flowering plants It has 650 genus and 18000 species It contains perennial and annual herbs
with trifoliate leaves It is most widely present in Iran and almost 48 taxa of genus are present
in Iran (30) Traditionally member of genus Trigonella were considered as best treatment for
inflammatory disorders Different plants of Trigonella genus such as Trigonella stellate and
Trigonella foenum graceum possess known pharmacological anti-inflammatory properties T
gharuensis is also known for possessing medicinally important active ingredients (32) T
gharuensis is used as anti-cancer drug It is also used as flavoring agent The literature
determined that it has as anti-diabetic activity anti-fungal activity anti-bacterial activity anti-
carcinogenic anti-lipidemic and anti-carcinogenic activities It has little side-effects
therefore widely used in pharmaceutical nutritional and therapeutic potential (52)
14
Aim of the study
To evaluate anti-arthritic and anti-inflammatory potentials of J regia and T gharuensis
extracts using different experimental models of acute and chronic inflammation
Objective of study
Arthritic score and paw edema were assessed through macroscopic criteria and plethysmometer
in FCA induced arthritic model respectively Histopathological parameters such as pannus
formation bone erosion and cartilage damage were evaluated using H amp E staining method
Effects of extracts were checked on expression levels of IL-4 TNF-α IL1β IL-6 NF-кB
COX-1 and COX-2 using reverse transcription PCR The levels of prostaglandin E2 were
measured through ELISA Effects of extracts were evaluated on hematological parameters
(WBC platelets and RBC counts and Hb content) liver function tests (AST and ALT) and
renal function tests (urea and creatinine) Paw edema models such as Carrageenan- histamine-
serotonin- and dextran- induced models were used to evaluate anti-inflammatory effects of
extracts Xylene induced ear edema and castor oil-induce diarrhea models were also used to
assess anti-inflammatory effects of extracts Qualitative analysis was performed on all types of
extracts Identification of T gharuensis and J regia extracts constituents were carried out using
GC-MS analysis
15
CHAPTER 3 MATERIALS AND METHODS
31 Plant collection
J regia leaves were gathered from Chitral in the northeast area of Pakistan The plants were
identified by a botonist namely Dr Abdul Rehman Niazi The Department of Botany
University of the Punjab Lahore and a token sample (LAH 7261) was deposited on 02-05-
2018 in the herbarium wwwtheplantlistorg at 18-07-2018 was the website from where plant
name was checked
The herb T gharuensis was acquired from district Quetta Balochistan Pakistan Prof Rasool
Baksh Tareen identified this herb from University of Balochistan (UOB) Quetta Pakistan The
plant was kept in university herbarium and it was allotted voucher specimen no TG- RBT-
05
32 Preparation of extracts
Leaves of J regia were dried under shade and pounded by using electrical grinder The powder
(100 g) was soaked for seven days in ethanol (500 ml) or n-hexane (500 ml) and incubated at
25 C (room temperature) with occasional trembling The mixtures were strained through
muslin fabric followed by filter paper Filtrates were then concentrated at 37 ˚C in rotary
evaporator (IKA Germany) Extracts were dried in an incubator at 40 ˚C The percentage yield
was calculated as 15 for ethanolic extract and 7 for n-hexane extract
Herb of T gharuensis was dried under shade and it was chopped into small pieces Crushing
was performed by using electrical grinder The powdered herb (1kg) underwent cold
maceration using 3 liters of ethanol and n-hexane separately for seven days Mixtures were
filtered using muslin cloth Then the whole mixtures were filtered Filtrate was subjected to
evaporation in a rotary evaporator maintaining conditions of constant temperature at 37 ˚C
under reduced pressure Semi solid crude extracts was obtained and it was placed into
16
incubator at 40 ˚C for further drying (53) The extract was dissolved in 1 Tween 80 (54 55)
The yield of ethanolic extract of T gharuensis was 18 while yield of n-hexane extract of T
gharuensis was 10 The doses of extracts of J regia leaves and T gharuensis used in the
experiments were picked on the basis of previous literature of anti-inflammatory studies (56
57)
33 Housing of Animals
Sprague-Dawley rats 6ndash8 weeks old of both genders weighing 200ndash250 g were allowed to
familiarize with environment for one week before the start of experiment Natural day and night
cycles (12 h) were maintained Temperature as well as moisture were kept at 25˚C plusmn 2 and 60-
70 respectively Rats were provided with free access to food and water To determine anti-
inflammatory activities 6-8 weeks-old BALBc mice weighing 28-33 grams were used with
same above-mentioned conditions Experiments were conducted after getting permission from
the Institutional Research Ethics Committee The University of Lahore (IREC-2017-23) (12)
34 Assessment of anti-arthritic activities
341 Arthritis induction
Thirty rats were segregated into five groups with each having 6 animals Group-I (vehicle
control) and group-II (arthritic control) were given vehicle ie 1 Tween 80 in water (54)
Group-III was considered as reference group and received piroxicam (10 mgkg bw po)
(58) Group-IV (EEJR) and group-V (NHJR) were treated with the dose of 500 mgkg bw
po respectively While group-VI (EETG) and group-VII (NHTG) were administered 400
mgkg bw po respectively (56) FCA (015 ml) was injected into left paws of all the animals
(sub plantar region) except vehicle control group at 0 day Animals were treated with extracts
and piroxicam starting from day 8 till day 28 (12)
17
342 Evaluation of arthritic progression
Inflammation redness and erythema were observed on day 8 15 22 and 28 Arthritic scoring
was done on the basis of macroscopic observation of paw inflammation redness and swelling
Score 0 (normal) 1 (minimal) 2 (mild) 3 (moderate) and 4 (severe ) were used to evaluate
redness erythema and inflammation of paws (12)
343 Assessment of paw volume
Arthritis was induced at 0 day and then paw edema was evaluated using digital water
displacement plethysmometer at day eight fifteen twenty two and twenty eight after injecting
FCA (59)
344 Histopathological investigations
Rats were sacrificed on day 28 and ankle joints were separated Ankle joints were transected
longitudinally to obtain equal halves and immersed in 10 formalin for fixation The samples
were decalcified using formic acid The tissue slides were prepared by first embedding in
paraffin blocks and then slicing into thin sections (5microm) Slides were treated with H amp E
(hematoxylin and eosin) Blinded histopathologist evaluated slides for different parameters
such as pannus formation as well as bone erosion Scoring criteria was used as mentioned in
342 (12)
35 Assessment of mRNA expression levels of TNF-α NF-κB IL-6 IL-1β COX-1 COX-
2 and IL-4
351 RNA extraction
Total RNA was extracted from blood of rats using TRIzol method
18
3511 Homogenization of blood
Blood (200 micro) and TRIzol LS reagent (600 microL) was mixed in an Eppendorf tube It was
homogenized using vortex mixer After that it was incubated for five minutes
3512 Phase separation
200 microL of chilled chloroform was taken and it was added in each tube followed by vigorous
mixing for 15-30 seconds Vortex mixer was used for this purpose Mixture was placed at 15-
30degC for 2 mins Samples were centrifuged using 12000 rpm for fifteen minutes at controlled
temperature of 4degC The resultant upper transparent layer containing RNA was carefully
separated
3513 Method of RNA precipitation
Aqueous phase was transferred in tube Isopropanol was mixed with it and amount of
isopropanol was same as of aqueous phase Then these tubes were kept at room temperature
for ten minutes Tubes were placed in centrifuged machine for ten minutes whose rpm was
12000 at 4degC RNA pellet was precipitated
3514 Washing of RNA
For washing of RNA pellet 75 ethanol (1 ml in each tube) was used Tubes were placed in
centrifugal machine After that excess ethanol was removed and air dried to get RNA pellets
3515 Re-suspension of RNA pellets
RNA pellet was dissolved in 20 microL of RNAase free water Finally RNA was stored at -80degC
3516 RNA Quantification
Nanodrop spectrophotometric technique was used to quantify the total RNA
19
352 Primer designing
Sequence of primers for example IL-6 IL-1β NF-κB IL-4 COX-1 and COX-2 were picked
from previously published studies (58 60) Steps of manually designing of TNF-α and GAPDH
primers are given below
Ensemble Genome browser was consulted to find out gene sequences of TNF-α and
GAPDH
Both Forward as well as reverse primers were selected from gene exons having 20 base
pairs sequence
Physical characteristics of all primers were checked using online oligocalc calculator
Annealing temperatures of all primers were kept at 55-60oC
GC content of primers were selected between 50-55
Product size of primers were kept between 190-300 bp
In-silico PCR was performed
Hairpin formation and self-annealing were absent
In end specificity of primers was checked using nucleotide blast
20
Table 1 Sequences of primers
Genes Forward primer Reverse primer Product size Reference
IL-4
5´- CACCTTGCTGTCACCCTGTT -3´
231 (58)
5´-TCACCGAGAACCCCAGACTT-3´
IL-6
5-CCCACCAAGAACGATAGTCA-3
247 (5)
5-CTCCGACTTGTGAAGTGGTA-3
TNF-α
5prime-AGTCCGGGCAGGTCTACTTT-3prime
202 NM_0126753
5prime-GGAAATTCTGAGCCCGGAGT -3prime
NF-КB
5prime-TGAGATCCATGCCATTGGCC-3prime
207 (58)
5ʹ-AGCTGAGCATGAAGGTGGATG-3ʹ
COX-1
5prime -CTGCCCTCTGTACCCAAAGA-3prime
200 (59)
5ʹ-GGACCCATCTTTCCAGAGGT-3 ʹ
COX-2
5´-CCAGATGGCCAGAGGACTCA-3ʹ
237 (58)
5´-TGTGAGTCCCGAGGGAATAGA-3
IL-1β
5-GCTGTCCAGATGAGAGCATC-3
293 (58 60)
5-GTCAGACAGCACGAGGCATT-3
GAPDH
5´-GTCATCAACGGGAAACCCAT-3ʹ
197 NM_0170084
5´ATCACAAACATGGGGGCATC-3ʹ
21
353 cDNA synthesis
cDNA synthesis kit (Thermo Scientific America) was used to synthesize cDNA by
using reverse transcription technique
Sterile tube was placed in ice box and following order was adopted for cDNA synthesis
Total RNA (1000 ng) was used for reverse transcription in each sample
1 microL of oligo dt primer was added in each tube containing sample
Nuclease free water (qs) was added to adjust volume up to 12 microL
Then mixture was placed in centrifuge machine for a short time period
Mixture was incubated in thermal cycler at 65 oC for five minutes in thermal cycler model
no 9902 (Applied Bio-Rad system Veriti)
The mixture was chilled on ice immediately
After that remaining components of kits were added in the following sequence
4 microL of reaction Buffer (5X) (20 mM of magnesium chloride 250 mM of Tris-HCl
250 mM of KCl (pH=83) and 50 mM of DTT) was added
1 microL of Ribolock RNAse inhibitor (20 UmicroL) was added
2 microL of dNTP mix (10 mM) was mixed
1 microL of M-MuLV enzyme (200 UmicroL) was added
20 microL mixture of each sample was prepared and it was centrifuged for a short time period
Then all sample tubes were kept at 40 ordmC for 60 min in thermal cycler followed by
reaction termination by heating at 70 ordmC for 5 min
The synthesized cDNA was stored at -20 ordmC
22
354 Working solution of primers
Stock solution was prepared by taking 25 nm primers were diluted with 250 microL nuclease free
water Concentration of stock solutions was100 microM15 microL of stock solution was diluted with
nuclease free water (135 microL) The concentration of stock solution was 10 microM
355 Polymerase chain reaction
cDNA was synthesized by taking cDNA (2 microL) of each sample in each separate tube then
primer (1 microL) followed by mixing of PCR Master Mix (6 microL) and nuclease free water (3 microL)
Then vials were placed in thermal cycler For denaturation 95oC temperature was set for 10
seconds For annealing 58-62 oC temperature was adjusted for 20 seconds and extension was
performed at 72 oC for 30 seconds 35 cycles were adjusted
356 Ingredients required for the formulation of TAE reaction buffer (50X)
Each one litre
Tris base 242 g
Glacial acetic acid 571 ml
05M EDTA 100 ml
Trisaminomethane base was dissolved in distilled water (qs) using magnetic stirrer up-to
600ml
Anhydrous acetic acid was mixed with DW
EDTA was added in above mixture
Total volume was adjusted up-to 1 litre
23
357 Gel preparation and Gel electrophoresis
Following steps were used
11 gram of agarose gel was taken in beaker and it was mixed with 55 ml of TAE (1Χ)
buffer
Then flask was heated in an oven to dissolve all solid particles After that flask was
immediately cooled using tap water
Subsequently ethidium bromide (3 microL) was added in above flask for visualization Gel
caster was taken and liquefied gel present in flask was transferred into gel caster
Gel electrophoresis apparatus was filled with TAE buffer (1Χ) All samples were loaded
with blue dye (2 microL)
DNA ladder having 100 bp (5 microL) was added in first well while rest of wells were loaded
with samples (5 microL)
Gel was run at 120 volts up to forty-five minutes Gel documentation system was
applied to visualize bands Resultant bands were calculated against standard ladder
358 Densitometry
Finally result of all samples were finalized using image J software Sample results were semi-
quantified through densitometry
359 Determination of serum PGE2 levels using ELISA
ELISA kit protocols of Elab Science (E-EL-0034 96T) were followed for the evaluation of
serum PGE2 levels Following were the reagents which were prepared before initiation of
experiment
24
3591 Preparation of standard
Standard was prepared 15 min before the start of experiment Standard reference vial was
centrifuged at 10000 g for one min It was reconstituted by taking 10 ml of reference diluent
with 1 ml of sample diluent Vial was tightly closed and the contents were mixed thoroughly
This stock solution had concentration of 2000 pgml Then serial dilutions of 1000 500 250
125 625 3125 and 0 pgml were prepared
3592 Biotinylated Detection Antibody
Stock tube was centrifuged and concentrated biotinylated detection antibody was diluted to
working solution 1100 ratio 200 microL excess amount was prepared
3593 Concentrated HRP Conjugate
Stock tube was centrifuged and concentrated HRP Conjugate was diluted to working solution
1100 ratio 200 microL excess amount was prepared Total amount of 6000 microL was prepared
3594 Substrate reagent
Substrate reagent is light sensitive so it was added into wells immediately after opening of
bottle due to its light sensitivity Sterilized tips were used to aspirate required dose of this
reagent and unused reagent was discarded after its use
3595 Procedure of ELISA
50 microL standard (duplicate) and sample were added in the each well of ELISA plate
carefully After that concentrated biotinylated antibiotic was added to each well
immediately
The plate was incubated for 45 min in an incubator
All samples present in wells were aspirated and then plate was kept in automated
washer for washing of plate This procedure was repeated for three times
25
After washing of plate 100 microL of HRP conjugate was added to each well Then the
plate was sealed and it was incubated at 37 C for 15 min
Again the sample from all wells were aspirated and plate was subjected to washing for
five times
90 microL of substrate reagent was added to each well The plate was sealed and it was
incubated for 15 min at 37 C in an incubator
After that 50 microL of stop solution was added into each well The analysis of samples
was performed twice and OD (optical density) was determined by ELISA reader
(BioTek ELx-800) while wavelength was set at 450 nm
3510 Evaluation of hematological parameters
Through cardiac puncture blood samples were collected in vacutainer (Lab Vac) containing
EDTA (ethylenediaminetetraacetic acid) Hb contents red blood cells (RBC) white blood cells
(WBC) and platelets were counted using an automated hematology analyzer (Sysmex XT-
1800i)
3511 Evaluation of biochemical parameters
Firstly blood was collected (intracardiac puncture) in BD Vacutainer containing gel Then
serum was separated Different commercially available kits were used to measure urea and
creatinine for evaluation of renal function while ALT AST and ALP for assessing liver
function by using chemistry analyzer which was automated (Humalyzer 3500) and protocols
of kit manufacturers were followed
26
36 Acute toxicity study
Nine groups of N=6 BALBc mice were used Group I was administered with vehicle only
Doses of EEJR and NHJR ie 050 gkg 1 gkg 15 kg and 2 gkg were administered orally
to Groups II III IV and V and Doses of EETG and NHTG 040 gkg 8 gkg 12 kg and
16 gkg were given to Groups VI VII VIII and IX respectively After the extract
administration food was withheld for two hours The extracts were given by oral gavage (po)
All groups were kept under close observation over 72 h and then for 14 days for signs of acute
toxicity Different effects including restlessness respiratory distress diarrhea motor activity
posture and mortality if any were determined (61)
37 Evaluation of anti-inflammatory activities
Table 2 Acute inflammatory models
Models Groups
Carrageenan-induced paw edema 01 mL 1 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg )
EETG (400 mgkg)
NHTG (400 mgkg)
Piroxicam (10 mgkg )
Histamine-induced paw edema 01mL 1 wv in normal saline
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Serotonin-induced paw edema VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
27
01thinspmL 10-3thinspmgmL dissolved in distilled
water
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Indomethacin (10 mgkg)
Xylene-induced ear edema 03 ml of xylene
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Dexamethasone (1 mgkg)
Dextran-induced paw edema 01 ml of 15 wv in distilled water
VC 3 mlkg (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Diphenhydramine (60 mgkg)
Castor oil-induced diarrhea 03 ml of castor oil
VC 3 mlkg bw (1 Tween 80)
EEJR (500 mgkg)
NHJR (500 mgkg)
EETG (400 mgkg)
NHTG (400 mgkg)
Loperamide (5 mgkg)
VC = vehicle control EEJR = Ethanolic extract of J regia NHJR = n-hexane extract of J
regia EETG = Ethanolic extract of T gharuensis NHTG = n-hexane extract of T gharuensisa
bw = body weight
28
371 Experimental design and induction of paw edema using carrageenan
Mice were allocated into different four groups (n=6) Vehicle and piroxicam were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
carrageenan (01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of carrageenan (12) The
percentage inhibition was calculated using the formula given by Uroos et al (62)
372 Experimental design and paw edema induction using histamine
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin were given to
group I and group VI while extracts were administered orally to group II (EEJR) group III
(NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting histamine
(01mL 1 wv in normal saline) into the sub plantar tissue of the right hind paw after one
hour of extracts administration Measurement of paw edema was done at one hour intervals for
three hours by plethysmometer after administration of histamine (12) The percentage
inhibition was calculated using the formula given by Uroos et al (62)
373 Experimental design and paw edema induction using serotonin
Mice were allocated into different four groups (n=6) Vehicle and Indomethacin orally were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
serotonin (01thinspmL 10-3thinspmgmL dissolved in distilled water) into the sub plantar tissue of the
right hind paw after one hour of extracts administration Measurement of paw edema was done
29
at one hour intervals for three hours by plethysmometer after administration of serotonin (12)
The percentage inhibition was calculated using the formula given by Uroos et al (62)
374 Experimental design and induction of paw edema using dextran
Mice were allocated into different four groups (n=6) Vehicle and Diphenhydramine were
given to group I and group VI while extracts were administered orally to group II (EEJR)
group III (NHJR) group IV (EETG) and group V (NHTG) Edema was induced by injecting
dextran (01 ml of 15 wv in distilled water) into the sub plantar tissue of the right hind paw
after one hour of extracts administration Measurement of paw edema was done at one hour
intervals for five hours by plethysmometer after administration of dextran (12 63)
375 Experimental design for ear edema induced by xylene
Mice were allocated into four sets of mice containing (N = 6) as given in table 1 Xylene drop
was applied on the inner surface of the right ear of all groups The other ear (left) was
considered as untreated control Vehicle (group I) EEJR (group II) NHJR (group III) EETG
(group IV) and NHTG (group V) and dexamethasone (group VI) was administered one hour
before application of xylene After 15 minutes mice were sacrificed Both ears of mice were
cut and weighed using established methods (10)
376 Experimental design for castor oil-induced diarrhea model
Diarrhea was induced by castor oil using established methods (64) and detail of grouping was
mentioned in table1 Pretreatment with extracts and loperamide were conducted thirty minutes
30
before induction of diarrhea Diarrhea was induced using 06 ml of castor oil Four parameters
were evaluated for four hours time of onset of first diarrhea (min) total number of drywet
feces and total weight of wet feces (g) (65 66)
38 Phytochemical Evaluation
The initial screening of extracts were performed for different chemical constituents for
example alkaloids steroids terpenoids glycosides tannins phenols saponins and flavonoids
using previously published methods (67-70)
381 Test for Alkaloids
Mayerrsquos reagent and Wagnerrsquos reagent were extensively used to assess the presence of
alkaloids Crude extracts of EEJR NHJR EETG and NHTG were slightly warmed with dilute
HCl for 2 min in separate test tubes Filter paper was used for filtration After that solution was
divided into two parts and poured into two different tubes 2 to 3 drops of Mayerrsquos reagent or
Wagnerrsquos reagent was added in test tube White creamy precipitation was obtained which
showed positive result with Mayerrsquos reagent While reddish-brown precipitate with Wagnerrsquos
reagent confirmed the presence of alkaloids in the extract (71)
3811 Mayerrsquos reagent
5 grams of KI was mixed with DW Then more distilled water (qs) was added to make up its
volume up to 20 ml (Solution A) 136 g of mercuric iodide was mixed in 60 ml DW (Solution
B) After mixing both solutions their final volume was adjusted up to 01 litre (71)
31
3812 Wagnerrsquos reagent
Two grams of KI and 127 grams of I2 soln were taken in test tube Then DW (qs) was added
in tube up to 10ml (71)
382 Test for the steroids
Crude extracts of EEJR NHJR EETG and NHTG extracts of plant were mixed with 2 ml of
chloroform Conc H2S04 was mixed alongside wall of test tube After that acetic acid (2ml)
was added The formation of Green color confirmed that steroids are present in the extracts
(68)
383 Keller-Kilani for cardiac glycosides
Crude extracts of EEJR NHJR EETG and NHTG were mixed with glacial CH₃COOH (2ml)
having one drop of FeCl3 solution Then 1 ml of conc Sulphuric acid was poured with the wall
of test tube Ultimately dark brown ring appeared that indicates the existence of cardiac
glycosides (70)
384 Tests for terpenoids
3841 Salkowski test
Crude extracts of EEJR NHJR EETG and NHTG and chloroform (2 ml) were mixed
Subsequently 1-2 ml of conc H2S04 was poured into side wall of test tube A dark brown ring
appeared where acid and extracts interact to each other (70)
385 Tests for Phenols
EEJR NHJR EETG and NHTG extracts were mixed in 2 to 3 ml of water in each test tubes
After that dilute I2 solution was added Phenols were confirmed due to production of transient
red colour (71)
32
386 Test for saponins
500 mg of crude extract of EEJR NHJR EETG and NHTG were mixed with 5 ml of DW in
each test tube After thoroughly shaking persistent froth was observed Then three olive oil
drops were added in each tube and mixtures were shaken again vigorously to notice the
emulsion formation (70)
387 Test for flavonoids
Crude extracts of EEJR NHJR EETG and NHTG were taken in separate tubes and they were
treated with of 1 aluminum solution (few drops) Appearance of yellow color confirmed
presence of flavonoids in extracts (72)
39 Gas chromatography-mass spectrometry Analysis
GC-MS analysis was conducted using a previously published protocol with minor
modifications (62) GC-MS analysis was performed using capillary column (025 μm 30 m x
025 mm) Following were the settings Carrier gas Helium column velocity flow 10 mlmin
mode split less injection volume 05 microl Conditions of mass spectrometer were as follows
initial temperature 110 ˚C for 2 min raised at 10 ˚C per min until reached to 200 ˚C then rate
decreased to 5 ˚C per min until 280 ˚C ionizing voltage 70 eV mz range 20-800 (62)
310 Statistical analysis
Graph Pad Prism (V 60) was selected for interpretation of data Data was presented as mean plusmn
SEM (standard error of mean) was used Data of pharmacological activities were analyzed by
using one or two way ANOVA (one way analysis of variance) which is followed byTukeyrsquos
post-hoc test for comparison Significance level was observed as p lt 005
33
CHAPTER 4 RESULTS
41 J regia and T gharuensis significantly reduced paw edema in FCA-induced arthritic
model
411 Measurement of paw edema at day 8
The piroxicam (0970 plusmn 0006) EEJR (0958 plusmn 0007) NHJR (0943 plusmn 0007) EETG (0936 plusmn
0008) and NHTG (0931 plusmn 0013) inhibited paw edema when compared to positive control
group (0940 plusmn 0010) at day 8
Figure 1 Paw edema at day 8
Figure 1 indicates increase in paw edema in comparison to vehicle control group at day 8
shows the comparison between vehicle control group and arthritic control group
34
412 Measurement of paw edema at day 15
The piroxicam (0783 plusmn 0008) EEJR (0788 plusmn 0010) NHJR (0883 plusmn 0006) EETG (0770 plusmn
0013) and NHTG (0863 plusmn 0006) reasonably decreased (p lt 0001) paw edema in comparison
to positive control group (1144 plusmn 0017) at day 15
Figure 2 Paw edema at day 15
Figure 2 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG p lt 0001 as compared to arthritic group indicates difference between vehicle
control and arthritic control group
35
413 Measurement of paw edema at day 22
Similarly at day 22 significant inhibition (p lt 0001) was determined while treating edema
with piroxicam (0718 plusmn 0007) EEJR (0753 plusmn 0011) NHJR (0744 plusmn 0011) EETG (0737
plusmn 0009) and NHTG (0727 plusmn 0010) as compared to arthritic control group (1242 plusmn 0012)
Figure 3 Paw edema at day 22
Figure 3 shows significant attenuation of paw edema in Piroxicam EEJR NHJR EETG and
NHTG groups p lt 0001 as compared with arthritic group indicates difference
between two control groups
36
414 Measurement of paw edema at day 28
Significant inhibition (p lt 0001) was observed with piroxicam (0627 plusmn 0008) EEJR (0647
plusmn 0010) NHJR (0688 plusmn 0018) EETG (0630 plusmn 0007) and NHTG (0670 plusmn 0017) treated
groups in contrast to arthritic control group (1366 plusmn 0009) at day 28
Figure 4 Paw edema at day 28
Figure 4 denotes significantly attenuation of paw edema in Piroxicam EEJR NHJR EETG
and NHTG treated groups p lt 0001 as compared with arthritic control group indicates
difference between two control groups
37
Figure 5 Paw edema
Figure 5 shows that treated groups significantly reduced inflammation at day 8 15 22 and 28
p lt 001 and p lt 0001 in contrast with arthritic control group
38
Table 1J regia and T gharuensis extracts significantly reduced paw edema in FCA induced arthritis model
Days Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 0942 plusmn 0013 0960 plusmn0013 0950 plusmn 0004 0943 plusmn0008 0937 plusmn 0008 0932 plusmn 0014
Day 15 1144 plusmn 0017 0783 plusmn 0008 0788 plusmn 0010 0883 plusmn 0006 0770 plusmn 0013 0863plusmn0006
Day 22 1242 plusmn 0012 0718 plusmn 0007 0753 plusmn 0011 0744 plusmn 0011 0737 plusmn 0009 0727 plusmn 0010
Day 28 1366 plusmn 0009 0627 plusmn 0008 0647 plusmn 0010 0688 plusmn 0018 0630 plusmn 0007 0670 plusmn 0017
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 0001 in contrast to arthritic control group
39
42 J regia and T gharuensis attenuated arthritic Score
421 At Day 8
The development of arthritis was observed on day 8 in piroxicam (3083 plusmn 0083) EEJR (3083
plusmn 0083) NHJR (300 plusmn 0129) EETG (3083 plusmn 0083) and NHTG (3083 plusmn 0083) in
comparison with arthritic group (3083 plusmn 0083)
Figure 6 Arthritic score at day 8
Figure 6 shows increase in arthritic score at day 8 There is no difference between treatment
groups and arthritic control group Bar chart of vehicle group is invisible because the values of
the normal group are represented as 0 in these figures
40
422 At Day 15
Attenuation in arthritic development was found with piroxicam (2250 plusmn 0111 p lt 0001)
EEJR (2750 plusmn 0111 p lt 001) NHJR (2750 plusmn 0111 p lt 001) EETG (2833 plusmn 0105 p lt
001) and NHTG (2833 plusmn 0106 p lt 001) treated groups in comparison to arthritic control
group (3417 plusmn 0083) on day 15
Figure 7 Arthritic score at day 15
Figure 7 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 001 and p lt 0001 in contrast to arthritic control
group
41
423 At Day 22
Similarly at day 22 significant inhibition was observed with piroxicam (2500 plusmn 0182 p lt
0001) EEJR (2583 plusmn 0153 p lt 0001) NHJR (2750 plusmn 0111 p lt 001) EETG (2667 plusmn
0105 p lt 001) and NHTG (2917 plusmn 0153 p lt 005) treated groups in comparison to arthritic
control group (3500 plusmn 0129)
Figure 8 Arthritic score at day 22
Figure 8 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 005 p lt 001 and p lt 0001 in contrast to arthritic
control group
42
424 At Day 28
The trend continued on 28th day as we observed significant inhibition with (p lt 0001) with
piroxicam (2083 plusmn 0083) EEJR (2583 plusmn 0153) NHJR (2583 plusmn0083) EETG (2533 plusmn
0105) and NHTG (2500 plusmn 0129) treated groups as compared to diseased group (3583 plusmn
0153)
Figure 9 Arthritic score at day 28
Figure 9 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG and
NHTG Bar chart of vehicle group is invisible because the values of the normal group are
represented as 0 in these figures p lt 0001 in contrast to arthritic control group
43
Figure 10 Arthritic Score
Figure 10 shows attenuation of arthritic development with Piroxicam EEJR NHJR EETG
and NHTG Bar charts of vehicle group are invisible because the values of the normal group
are represented as 0 in these figures p lt 0001 in contrast to arthritic control group
44
Table 2 J regia and T gharuensis attenuated arthritic development
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
Days
Arthritic Control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM (ml)
Day 8 3083 plusmn 0083 3083 plusmn 0083 3000 plusmn 0129 3000plusmn 0129 3083 plusmn 0083 3083 plusmn 0083
Day 15 3417 plusmn 0083 2250 plusmn 0111 2750plusmn 0111 2750 plusmn 0111 2833 plusmn 0105 2833 plusmn 0166
Day 22 3500 plusmn0129 2500 plusmn0182 2583plusmn 0153 2750 plusmn 0111 2667 plusmn 0105 2917 plusmn 0153
Day 28 3583plusmn 0153 2083 plusmn0083 2580 plusmn 0153 2583 plusmn 0083 2533 plusmn 0105 2500 plusmn 0129
45
43 J regia and T gharuensis attenuated histopathological parameters
431 J regia significantly reduced inflammation
Significant reduction in inflammation was observed with piroxicam (1583 plusmn 0083 p lt 0001)
EEJR (1833 plusmn 0083 p lt 0001) NHJR (2083 plusmn 0083 p lt 005) EETG (1917 plusmn 0154 p lt
0001) NHTG (2083 plusmn 0083 p lt 005) and piroxicam treated groups in contrast to arthritic
control group (2583 plusmn 0083)
Figure 11 J regia and T gharuensis reduced infiltration of inflammatory cells
Figure 11 shows reduction of infiltration of inflammatory cells Bar chart of vehicle group is
invisible because normal group values are represented as 0 in these figures p lt 005 and p
lt 0001 in contrast to arthritic control group
46
432 J regia significantly attenuated pannus formation
Reduction (p lt 0001) in pannus formation was observed with piroxicam (2333 plusmn 0105) EEJR
(2583 plusmn 0083) NHJR (2667 plusmn 0105) EETG (2583 plusmn 0083) and NHTG (2583 plusmn 0083) in
comparison to arthritic group (3417 plusmn 0083)
Figure 12 J regia and T gharuensis reduced pannus formation
Figure 12 explains reduction of pannus formation Bar chart of vehicle group is invisible
because normal group values are represented as 0 in these figures p lt 0001 in contrast to
arthritic control group
47
433 J regia significantly reduced erosion of bone
Significant elevation of bone destruction was observed in arthritic control group (2583 plusmn
0083) in contrast to vehicle group A significant attenuation of bone erosion was observed
with piroxicam (2083 plusmn 0083 p lt 001) EEJR (2083 plusmn 0083 p lt 001) NHJR (2167 plusmn
0105 p lt 005) EETG (2083 plusmn 0083 p lt 001) and NHTG (2167 plusmn 0105 p lt 005) in
contrast to arthritic control group
Figure 13 J regia and T gharuensis reduced bone erosion
Figure 13 indicates that Piroxicam EEJR NHJR EETG and NHTG significantly attenuated
bone erosion Bar chart of vehicle group is invisible because normal group values are
represented as 0 in these figures p lt 005 and p lt 001 in contrast to arthritic control group
48
Table 3J regia and T gharuensis attenuated histopatological parameters
Parameters
Arthritic control
Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
Infiltration of
inflammatory cells 2583 plusmn 0083 1583 plusmn 0083 1833 plusmn 0105 2083 plusmn 0083 1917 plusmn 0154 2083 plusmn 0083
Pannus formation 3417 plusmn 0083 2333plusmn 0105 2583 plusmn 0083 2667 plusmn 0105 2583 plusmn 0083 2583 plusmn 0083
Bone erosion 2583 plusmn 0083 2083 plusmn 0083 2083 plusmn 0083 2167 plusmn 00105 2083 plusmn 0083 2167 plusmn 0105
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG
n-hexane extract of Trigonella gharuensis p lt 005 p lt 001 and p lt 0001 in contrast to arthritic control group
49
Figure 14 Histopathology of normal control
Normal Control Thin synovial membrane layer surrounded by flattened epithelium of synovial
lining Arrows was used to specify it The oblong circle spans sub-intimal (supportive) layer of
synovial membrane which consists of adipose tissue as well as fibrous tissue in addition to
blood vessels No cell infiltrate of inflammatory cells was seen in the synovial membrane No
pannus formation is present (Fig 9)
50
Figure 15 Histopathology of diseased control
Arthritic control Diffuse and extensive infiltrate of inflammatory cell (I) surrounding synovial
membrane (SM) large plaques of fibrovascular tissue as well as granulation tissue involving
central as well as peripheral synovial membrane Focus of bone erosion (BE) is also shown
(Fig 15)
51
Figure 16 Histopathology of Piroxicam
Piroxicam synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell
infiltrate Central part of SM is marked by circle which indicates inflammation of pauci area
Line spans the large plaques of fibro vascular tissue as well as granulation tissue (Figure 16)
52
Figure 17 Histopathology of EEJR
EEJR Arrow indicates thin layer of SM whereas oblong circles point out sub-intimal layer of
SM This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory
cells and pannus formation are absent (Figure 17)
53
Figure 18 Histopathology of NHJR
NHJR Arrow indicates thin layer of SM whereas rectangle points out sub-intimal layer of SM
This layer consists of blood vessels fibrous as well as tissues Moreover inflammatory cells
and pannus formation are absent Figure 18
54
Figure 19 Histopathology of EETG
TE synovial membrane (SM) is surrounded by focal aggregates of inflammatory cell infiltrate
Most of the areas of SM are pauci-inflamed which are denoted by oblong circles The inlet on
right lower corner depicts a closer look at the above-mentioned findings (Figure 19)
55
Figure 20 Histopathology of NHTG
NHTG Focal scattered inflammatory cells around SM Most of the areas of SM are pauci-
inflamed which are denoted by oblong circles The inlet on right lower corner depicts a closer
look at the above-mentioned findings with no focus on pannus formation (Figure 20)
56
This picture shows reduction of inflammation of pannus formation in experimental groups as
compared to diseased control group which shows bone erosion
57
44 J regia and T gharuensis downregulated mRNA expression levels of pro-
inflammatory markers and upregulated anti-inflammatory marker
441 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
An increase (p lt 0001) in expression levels were detected in arthritic control group (5019 plusmn
1983) in contrast with the vehicle group (3342 plusmn 1787) Treatment with Piroxicam (3292 plusmn
1043) EEJR (3396 plusmn 1639) NHJR (3588 plusmn 0792) EETG (3429 plusmn 1538) and NHTG
(3538 plusmn 0571) significantly down regulated (p lt 0001) the levels of TNF α
Figure 21 J regia and T gharuensis downregulated mRNA expression levels of TNF-α
Figure 21 shows that J regia and T gharuensis downregulated mRNA expression levels p
lt 0001 in contrast with diseased arthritic control group indicates difference between two
control groups
58
442 J regia suppressed mRNA expression levels of NF-κB
An upregulation (p lt 0001) in levels of NF-κB were observed in arthritic control group (5369
plusmn 0684) in contrast with vehicle control group (3403 plusmn 1541) Significant attenuation (p lt
0001) of NF-κB expression levels were seen with piroxicam (3592 plusmn 1236) EEJR (3892 plusmn
1100) NHJR (4290 plusmn 1333) EETG (3908 plusmn 1365) and NHTG (4125 plusmn 0690) treated
groups
Figure 22 J regia and T gharuensis downregulated mRNA expression levels of NF-κB
Figure 22 shows that J regia and T gharuensis suppressed mRNA expression levels of NF-
κB p lt 0001 in contrast with arthritic control group indicates difference between two
control groups
59
443 J regia and T gharuensis reduced IL-6 mRNA expression levels
Significant downregulation of IL-6 was observed with piroxicam (3209 plusmn 1043 p lt 0001)
EEJR (3209 plusmn 1639 p lt 001) NHJR (3392 plusmn 0901 p lt 001) EETG (3386 plusmn 0850 p lt
001) and NHTG (3361 plusmn 1195 p lt 001) treated groups in comparison to arthritic control
group (4069 plusmn 1188)
Figure 23 J regia and T gharuensis downregulated mRNA expression levels of IL-6
Figure 23 shows treatment with piroxicam EEJR NHJR EETG and NHTG attenuated IL-6
levels p lt 001 and p lt 0001 as compared with arthritic control group indicates
difference between two control groups
60
444 J regia and T gharuensis decreased the mRNA expression levels of IL-1β
IL-1β expression levels were upregulated (p lt 0001) in arthritic control group (5269 plusmn 1445)
in comparison with vehicle group (3409 plusmn 1472) Significant inhibition (p lt 0001) was
determined with piroxicam (3225 plusmn 1236) EEJR (3409 plusmn 1682) NHJR (3692 plusmn 0835)
EETG (3446 plusmn 1239) and NHTG (3583 plusmn 0649) treated groups
Figure 24 J regia and T gharuensis downregulated mRNA expression levels of IL-1β
Figure 24 shows that treatment with piroxicam EEJR NHJR EETG and NHTG attenuated
levels of IL-1β p lt 0001 as compared with arthritic control group indicates difference
between two control groups
61
J regia and T gharuensis down regulated COX-1 mRNA expression levels
COX-1 expression levels were upregulated (p lt 0001) in arthritic control group (5163 plusmn
1484) as compared to the vehicle control group (3387 plusmn 1036) Significant attenuation (p lt
0001) in COX-1 levels were observed with piroxicam (3287 plusmn 1036) EEJR (3337 plusmn 1747)
NHJR (3655 plusmn 0715) EETG (3298 plusmn 1757) and NHTG (3678 plusmn 863) treated groups
Figure 25 J regia and T gharuensis downregulated mRNA expression levels of COX-1
Figure 25 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
attenuated mRNA expression levels of COX-1 p lt 0001 as compared to arthritic control
group indicates difference between two control groups
62
445 J regia and T gharuensis down regulated the mRNA expression levels of COX-2
COX-2 expression levels were increased significantly (p lt 0001) in arthritic control group
(5506 plusmn 1223) as compared to vehicle control group (3342 plusmn 1787) COX-2 levels were
significantly reduced (p lt 0001) in piroxicam (3317 plusmn 0888) EEJR (3317 plusmn 0888) NHJR
(3469 plusmn 0650) EETG (3106 plusmn 0791) and NHTG (3473 plusmn 0499) treated groups
Figure 26 J regia and T gharuensis downregulated mRNA expression levels of COX-2
Figure 26 represents that treatment with piroxicam EEJR NHJR EETG and NHTG
significantly attenuated mRNA expression levels of COX-2 p lt 0001 as compared with
arthritic control group indicates difference between two control groups
63
446 J regia and T gharuensis up regulated the mRNA expression levels of IL-4
IL-4 expression levels were decreased (p lt 0001) in arthritic control group (2085 plusmn 1757) as
compared to the vehicle control group (2348 plusmn 0516) Significant up-regulation (p lt 0001)
in IL-4 was determined in piroxicam (2892 plusmn 0734) EEJR (3064 plusmn 0650) NHJR (3247 plusmn
0760) EETG (3182 plusmn 0551) and NHTG (3316 plusmn 0427) treated groups
Figure 27 J regia and T gharuensis upregulated mRNA expression levels of IL-4
Figure 27 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
upregulated mRNA expression levels of IL-4 p lt 0001 as compared with arthritic control
group indicates difference between two control groups
64
447 J regia and T gharuensis significantly reduced PGE2 Levels
There were increased (p lt 0001) in PGE2 levels in arthritic control group (0986 plusmn 0027) as
compared to the vehicle control group (0486 plusmn 0043) We observed significant reduction (p lt
0001) in PGE2 levels with piroxicam (0628 plusmn 0021) EEJR (0759 plusmn 0035) NHJR (0780 plusmn
0035) EETG (0747 plusmn 0026) and NHTG (0837plusmn 0017) treated groups
Figure 28 J regia and T gharuensis reduced levels of PGE2
Figure 28 shows treatment with piroxicam EEJR NHJR EETG and NHTG significantly
down-regulated prostaglandin E2 levels p lt 0001 as compared with arthritic control group
indicates difference between two control groups
65
Table 4 J regia and T gharuensis attenuated mRNA expression levels of pro-inflammatory markers and up-regulated anti-inflammatory
marker
Markers
Vehicle
Control
Arthritic
Control Piroxicam
EEJR
NHJR
EETG
NHTG
Mean plusmn SEM
TNF-α 3342 plusmn 1787 5019 plusmn 1983 3292 plusmn 1043 3396 plusmn 1639 3588 plusmn 0792 3429 plusmn 1538 3538 plusmn 0571
NF-κB
3403 plusmn 1541 5369 plusmn 0684 3592 plusmn 1236 3892 plusmn 1100 4290 plusmn 1333 3908plusmn 1365 4125plusmn 0690
IL-6
3375 plusmn 1751 4069 plusmn 1188 3209 plusmn 1043 3209plusmn 1639 3392 plusmn 0901 3386 plusmn 0850 3361plusmn 1195
IL-1β
3409 plusmn 1472 5269 plusmn 1445 3225 plusmn 1236 3409 plusmn 1682 3692 plusmn 0835 3446 plusmn 1239 3583 plusmn 0649
COX-1
3387 plusmn 1036 5163 plusmn 1484 3287 plusmn 1036 3337 plusmn 1747 3655 plusmn 0715 3298 plusmn1757 3678 plusmn 0863
COX-2 3342 plusmn 1787 5506 plusmn 1223 3317 plusmn 0888 3317 plusmn 0888 3469 plusmn 0650 3106 plusmn0791 3473 plusmn 0499
IL-4 3475 plusmn 1004 2348 plusmn 0516 2892 plusmn 0734 3064 plusmn 0650 3247 plusmn 0760 3182 plusmn 0551 3316 plusmn 0427
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group presents comparison
between two control groups
66
448 J regia and T gharuensis nearly normalized hematological parameters
4481 J regia and T gharuensis nearly normalized RBC count
Suppression (p lt 0001) of RBC count in the arthritic control group (5642 plusmn 0336) was noticed
in comparison to vehicle control group (8298 plusmn 0315) Significant elevation (p lt 001) in RBC
counts were observed with piroxicam (6807 plusmn 0372) EEJR (7280 plusmn 0200) NHJR (7465 plusmn
0183) EETG (736 plusmn 0365) and NHTG (7337 plusmn 0304) as compared to arthritic control
group
Figure 29 J regia and T gharuensis nearly normalized RBC count
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized RBC levels p lt 001 as compared with arthritic control group indicates
difference between two control groups
67
4482 J regia and T gharuensis nearly normalized Hb content
Suppression (p lt 0001) of Hb content in the arthritic control group (1173 plusmn 0237) was
observed in comparison to vehicle control group (1475 plusmn 0131) Statistically significant
elevation of Hb content was observed with piroxicam (1367 plusmn 0353 p lt 001) EEJR (1397
plusmn 0458 p lt 0001) NHJR (1343 plusmn 0145 p lt 001) EETG (1402 plusmn 0425 p lt 0001) and
NHTG (1367 plusmn 0353 p lt 001) in comparison to arthritic control group
Figure 30 J regia and T gharuensis nearly normalized Hb content
Figure shows that treatment with piroxicam EEJR NHJR EETG and NHTG nearly
normalized Hb content p lt001 and p lt 0001 as compared with arthritic control group
indicates difference between two control groups
68
4483 J regia and T gharuensis nearly normalized WBC count
The data showed reduction in WBC count with piroxicam (1291 plusmn 0239 p lt 0001) EEJR
(1288 plusmn 0209 p lt 0001) NHJR (12580 plusmn 0416 p lt 0001) EETG (1288 plusmn 0209 p lt
0001) and NHTG (1325 plusmn 0324 p lt 001) treatment in comparison to arthritic control group
(1512 plusmn 0256)
Figure 31 J regia and T gharuensis nearly normalized WBC count
Figure 31 shows that treatment with piroxicam EEJR NHJR EETG and NHTG significantly
reduced WBC count as compared to arthritic control p lt 001 and p lt 0001 as compared
with arthritic control group indicates difference between two control groups
69
4484 J regia and T gharuensis nearly normalized platelet count
Elevated platelet count (1444 plusmn 1844) was found in arthritic control group when compared
with vehicle control group (7987 plusmn 2782) Reduction (p lt 0001) in platelet count was
observed with piroxicam (1044 plusmn 3237) EEJR (9372 plusmn 1330) NHJR (1163 plusmn 4131) EETG
(9108 plusmn1584) and NHTG (1099 plusmn 3413) as compared to arthritic control group
Figure 32 J regia and T gharuensis nearly normalized Platelet count
Figure 32 displays treatment with piroxicam EEJR NHJR EETG and NHTG significantly
decreased platelets counts p lt 0001 as compared with arthritic control group indicates
difference between two control groups
70
Table 5 J regia and T gharuensis nearly normalized hematological parameters
Parameters
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
RBC
(106Ul) 8298 plusmn 0315 5642 plusmn 0366 7473 plusmn 0348 7280 plusmn 0200 7465 plusmn 0183 7360 plusmn 0365 7337 plusmn 0304
Hb
(gdl)
14750 plusmn 0131 1173 plusmn 0237 1367 plusmn 0212 1397 plusmn 0458 1343 plusmn 0145 1402 plusmn 0425 1367 plusmn 0353
WBC
(103Ul)
1001 plusmn 0335 1512 plusmn 0256 1291 plusmn 0239 1288 plusmn 0209 12580 plusmn 0416 1288 plusmn 0209 1325 plusmn 0324
Platelets
(103Ul)
7987 plusmn 2782 1444 plusmn 1844 1044 plusmn 3237 9372 plusmn 1330 1163 plusmn 4131 9108 plusmn 1584 1099 plusmn 3413
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared with arthritic control group indicates difference between
two control groups
71
449 J regia and T gharuensis effects on biochemical parameters
4491 J regia and T gharuensis effects on urea levels
No differences in urea levels were observed with piroxicam (2617 plusmn 0401) EEJR (2733 plusmn
0333) NHJR (2633 plusmn 0210) EETG (2767 plusmn 0421) and NHTG (2617 plusmn 0477) when
compared with arthritic control group (2633 plusmn 0614)
Figure 33 J regia and T gharuensis effects on urea levels
Figure 33 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not produce
any sign of nephrotoxicity as indicated by non-significant difference among the levels of urea
in all groups
72
4492 J regia and T gharuensis did not alter creatinine levels
No differences in creatinine levels were observed with piroxicam (0850 plusmn 0022) EEJR (0800
plusmn 0025) NHJR (0800 plusmn 0025) EETG (0866 plusmn 0021) and NHTG (0858 plusmn 0020) as
compared to arthritic control group (0833 plusmn 0210)
Figure 34 J regia and T gharuensis effects on creatinine level
Figure 34 represents treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
73
4493 J regia and T gharuensis effects on ALT levels
Insignificant change was observed in ALT levels when vehicle control (3033 plusmn 0557) arthritic
control (3183 plusmn 0477) piroxicam (3367 plusmn 0421) EEJR (3367 plusmn 0872) NHJR (3383plusmn
0792) EETG (3317 plusmn 0654) and NHTG (3317 plusmn0792) groups were compared with each
other
Figure 35 J regia and T gharuensis effects on ALT levels
Figure 35 shows that treatment with piroxicam EEJR NHJR EETG and NHTG did not alter
creatinine levels
74
4494 J regia and T gharuensis effects on AST levels
Insignificant differences were observed in AST levels among vehicle control (9671 plusmn 1714)
arthritic control (9886 plusmn 1519) piroxicam (9471 plusmn 0190) EEJR (96 plusmn 1852) NHJR (9557
plusmn 1212) EETG (9800 plusmn 0617) and NHTG (9671 plusmn134) groups when compared with each
other
Figure 36 J regia and T gharuensis effects on AST levels
Figure 36 shows treatment with piroxicam EEJR NHJR EETG and NHTG did not alter AST
levels
75
4495 J regia and T gharuensis extracts significantly reduced ALP levels
The comparison between arthritic control group (1567 plusmn 2472) and normal control group
(1308 plusmn 1621) indicates a significant enhancement in ALP levels between both groups
Comparison of arthritic control group with piroxicam (131 plusmn 1633) EEJR (1313 plusmn 1333)
NHJR (1322 plusmn 1493) EETG (131 plusmn 1065) and NHTG (1322 plusmn 1167) indicates reduction
(p lt 0001) of raised ALP levels
Figure 37 J regia and T gharuensis extracts significantly reduced ALP levels
Figure 37 presents J regia and T gharuensis extracts significantly attenuated ALP levels near
to control group p lt 0001 as compared with arthritic control group indicates
difference between two control groups
76
Table 6 J regia and Tgharuensis did not alter biochemical parameter
Biochemical
Parameters
Vehicle
Control Arthritic control Piroxicam EEJR NHJR EETG NHTG
Mean plusmn SEM
Urea
(mgdl) 2633plusmn 0614 28plusmn 0856 2617plusmn 0401 2733plusmn 0333 2633plusmn 0210 2767plusmn 0421 2617 plusmn0477
Creatinine
(mgdl) 0833plusmn 0210 0883plusmn 0016 0850plusmn 0022 0800plusmn 0025 0800plusmn 0025 0866plusmn 0021 0858plusmn 0020
AST
(IUL) 9671plusmn 1714 9886plusmn 1519 9471plusmn 1190 96plusmn 1852 9557plusmn 1212 98plusmn0617 9671plusmn 134
ALT
(IUL) 3033plusmn 0557 3183plusmn 0477 3367plusmn 0421 3367plusmn 0872 3383plusmn 0792 3317plusmn 0654 3317plusmn 0792
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis Whereas p lt 005 was considered significant
77
4410 Evaluation of acute Toxicity of extracts of J regia and T gharuensis
Acute toxicity studies revealed safety of ethanolic and n- hexane extracts of J regia and T
gharuensis extracts up to maximum dose of 2000 mgkg Different doses of J regia extracts
(500 mgkg 1000 mgkg 1500 mgkg and 2000 mgkg) and T gharuensis extracts (400 mgkg
800 mgkg 1200 mgkg and 1600 mgkg) were given orally and they did not produce any signs
of toxicity such as restlessness respiratory distress diarrhea motor activity posture
abnormality and mortality during 72 hours as presented in Table 10
Table 7 Acute toxicity study of ethanolic and n-hexane extracts of J regia and T
gharuensis
Groups Restless Respiratory
distress Diarrhea
Motor
activity
Posture
abnormality Mortality
Group-1 - - - - - -
Group-1I - - - - - -
Group-1II - - - - - -
Group-1V - - - - - -
Group-V - - - - - -
Group-VI - - - - - -
Group-VII - - - - - -
Group-
VIII - - - - - -
GROUP-
IX - - - - - -
78
45 Pre-treatment with J regia and T gharuensis inhibited paw edema induced by
carrageenan
451 At 1st hr
Substantial edema inhibition (p lt 0001) was observed with EEJR (0210 plusmn0003) NHJR
(0235 plusmn 0002) EETG (0226 plusmn0004) NHTG (0255 plusmn 0003) and piroxicam (0208 plusmn 0007)
in contrast with control group (0288 plusmn 0004) The percentage inhibition in these groups were
found to be 2708 1840 2139 1145 and 2777 respectively At first hour the
maximum inhibition was shown by EEJR
Figure 38 Carrageenan At first hour
Figure 38 depicts inhibition of paw edema as a consequence of pre-treatment p lt 0001 in
contrast with control group
79
452 At 2nd hr
At second hour pretreatment with piroxicam (0213 plusmn 0004) EEJR (0195 plusmn 0002) NHJR
(0218 plusmn 0003) EETG (0236 plusmn 0005) and NHTG (0250 plusmn 0002) demonstrated significant
inhibition (p lt 0001) in contrast with control group (0290 plusmn 0003) The percentage inhibition
in these groups were found to be 3275 2482 1866 and 1379 and 2655
respectively The maximum inhibition was shown by EEJR at second hour
Figure 39 Carrageenan At second hour
Figure 39 depicts significant inhibition of paw edema as a consequence of pre-treatment
p lt 0001 in contrast with control group
80
453 At 3rd hr
Consistent prevention was noticed in treatment groups for instance EEJR (0172 plusmn 0003 P lt 0001)
NHJR (0206 plusmn 0003 P lt 0001) EETG (0231 plusmn 0006 P lt 0001) NHTG (0280 plusmn 0010 P lt 001)
and piroxicam (0210 plusmn 0003 P lt 0001) in contrast to control group (0318 plusmn 0007) The percentage
inhibition in these groups were found to be 4591 3522 2735 1194 and 3396
respectively The maximum inhibition was shown by EEJR at third hour
Figure 40 Carrageenan At third hour
Figure 40 depicts suppression of paw edema as a consequence of pre-treatment p lt 001
and P lt 0001 in contrast with control group
81
454 At 4th hr
Considerable decrease (p lt 0001) remained the hallmark of pretreatment with EEJR (0156 plusmn 0003)
NHJR (0193 plusmn 0003) EETG (0210 plusmn 0006) NHTG (0260 plusmn 0010) and piroxicam (0183 plusmn 0004)
in comparison with control group (0340 plusmn 0007) The percentage inhibition in these groups were
found to be 5411 4323 3823 2352 and 4617 respectively The maximum
inhibition was shown by EEJR at fourth hour
Figure 41 Carrageenan At fourth hour
Figure 41 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
82
455 At 5th hr
Notable (P lt 0001) anti-inflammatory activity of EEJR (0125 plusmn 0003) NHJR (0175 plusmn 0003) EETG
(0195 plusmn 0008) NHTG (0236 plusmn 001) and piroxicam (0165 plusmn 0003) were detected in contrast with
control group (0358 plusmn 0008) The percentage inhibition in these groups were found to be 6508
5111 4553 3407 and 5391 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 42 Carrageenan At fifth hour
Figure 42 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
83
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis
84
Table 8 The anti-inflammatory characteristics and percentage inhibition of paw edema caused by J regia and T gharuensis extracts on
carrageenan-induced paw edema
Groups
1st hr 2nd hr 3rd hr 4th hr 5th hr
Mean plusmn SEM ( paw edema inhibition)
Control 0288 plusmn 0004 0290 plusmn 0003 0318 plusmn 0007 0340 plusmn 0007 0358 plusmn 0008
EEJR
(500 mgkg)
0210 plusmn0003
(2708)
0195 plusmn 0002
(3275)
0172 plusmn0003
(4591)
0156 plusmn0004
(5411)
0125 plusmn 0003
(6508)
NHJR
(500 mgkg)
0235 plusmn 0002
(1840)
0218 plusmn 0003
(2482)
0206 plusmn0003
(3522)
0193 plusmn0003
(4323)
0175 plusmn 0003
(5111)
EETG
(400 mgkg)
0226 plusmn0004
(21387)
0236 plusmn 0005
(1866)
0231 plusmn0006
(2735)
0210 plusmn0006
(3823)
0195 plusmn 0008
(4553)
NHTG
(400 mgkg)
0255 plusmn0003
(1145)
0250 plusmn 0002
(1379)
0280 plusmn0010
(1194)
0260 plusmn0010
(2352)
0236 plusmn 0011
(3407)
Piroxicam
(10 mgkg)
0208 plusmn0007
(2777)
0213 plusmn 0004
(2655)
0210 plusmn0003
(3396)
0183 plusmn0004
(4617)
0165 plusmn 0003
(5391)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
85
46 Pre-treatment with J regia and T gharuensis inhibited histamine-induced paw
edema
461 At 1st hr
Treatment with EEJR (0235 plusmn 0002) NHJR (0251 plusmn 0003) EETG (0240 plusmn 0004) NHTG (0256 plusmn
0004) and indomethacin (0238 plusmn 0003) produced anti-inflammatory effects (P lt 0001) in treatment
groups in contrast with control group (0301 plusmn 0003) The percentage inhibition in these groups
were found to be 2192 1860 2093 1993 and 2093 respectively The
maximum inhibition was shown by EEJR at first hour
Figure 43 Histamine At first hour
Figure 43 depicts significant inhibition of paw edema as a consequence of pre-treatment P
lt 0001 in contrast with control group
86
462 At 2nd hr
Extracts of EEJR (0220 plusmn 0003) NHJR (0240 plusmn 0002) EETG (0228 plusmn 0005) NHTG (0246 plusmn
0002) and indomethacin (0223 plusmn 0002) depicted remarkable reduction (P lt 0001) in comparison to
control group (0318 plusmn 0001) at second hour The percentage inhibition in these groups were found
to be 3081 2452 2830 2264 and 2087 respectively The maximum inhibition
was shown by EEJR at second hour
Figure 44 Histamine At second hour
Figure 44 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
87
463 At 3rd hr
A significant inhibition (p lt 0001) was observed with EEJR (0186 plusmn 0004) NHJR (0225 plusmn 0008)
EETG (0225 plusmn 0005) NHTG (0236 plusmn 0002) and indomethacin (0203 plusmn 0004) in contrast with
control group (0321 plusmn 0004) at third hour The percentage inhibition in these groups were found
to be 4205 2990 2990 2647 and 3676 respectively The maximum inhibition
was shown by EEJR at third hour
Figure 45 Histamine At third hour
Figure 45 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
88
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG
hexane extract of Trigonella gharuensis Ind Indomethacin
89
Table 9The anti-inflammatory properties and percentage inhibition of J regia and T gharuensis extracts on histamine-induced paw
edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
(Mean plusmnSEM)
(ml)
Inhibition
Control 0301 plusmn 0003
- 0318 plusmn 0001 - 0321 plusmn 0004 -
EEJR
( 500 mgkg)
0235 plusmn 0002
2192
0220 plusmn 0003
3081
0186 plusmn 0004
4205
NHJR
( 500 mgkg)
0251 plusmn 0003
1860
0240 plusmn 0002
2452
0225 plusmn 0008
2990
EETG
( 400 mgkg) 0240 plusmn 0004 2093 0228 plusmn 0005 2830 0225 plusmn 0005 2990
NHTG
( 400 mgkg) 0256 plusmn 0004 1993 0246 plusmn 0002 2264 0236 plusmn 0002 2647
Indomethacin
(10 mgkg)
0238 plusmn 0003
2093
0223 plusmn 0002
2987
0203 plusmn 0004
3676
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
90
47 Pretreatment with J regia and T gharuensis prevented serotonin-induced paw edema
471 At 1st hr
Significant inhibition (p lt 0001) was observed with EEJR (0236 plusmn 0005) NHJR (0258 plusmn 0004)
EETG (0238 plusmn 0006) NHTG (0261 plusmn 0003) and indomethacin (0238 plusmn 0003) in contrast with
control group (0291 plusmn 0003) The percentage inhibition in these groups were found to be 2411
1704 2347 1607 and 2347 respectively The maximum inhibition was shown
by EEJR at first hour
Figure 46 Serotonin At first hour
Figure 46 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
91
472 At 2nd hr
Significant inhibition (p lt 0001) was noticed with EEJR (0223 plusmn 0004) NHJR (0236 plusmn 0004) EETG
(0238 plusmn 0003) NHTG (0253 plusmn 0003) and indomethacin (0230 plusmn 0005) in contrast to control group
(0331 plusmn 0004) The percentage inhibition in these groups were found to be 3262 2870
2809 2356 and 2051 respectively The maximum inhibition was shown by EEJR at
second hour
Figure 47 Serotonin At second hour
Figure 47 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
92
473 At 3rd hr
Substantial inhibition (p lt 0001) of edema was observed with EEJR (0206 plusmn 0003) NHJR (0225 plusmn
0005) EETG (0183 plusmn 0004) NHTG (0241 plusmn 0001) and indomethacin (0195 plusmn 0003) in contrast
to control group (0340 plusmn 0004) The percentage inhibition in these groups were found to be 3941
3382 3588 2911 and 4264 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 48 Serotonin At third hour
Figure 48 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
93
This picture shows inhibition of paw edema induced by serotonin with experimental groups as compared to control group EEJR Ethanolic extract
of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-NHTG hexane extract of
Trigonella gharuensis Ind Indomethacin plt 0001 as compared to control group
94
Table 10 The anti-inflammatory properties of J regia and T gharuensis extracts on serotonin-induced paw edema model
Groups
1sthr 2ndhr 3rdhr
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
(Mean plusmn SEM)
(ml) Inhibition
Control 0311 plusmn 0003
- 0331 plusmn 0004 - 0340 plusmn 0004 -
EEJR
( 500 mgkg)
0236 plusmn 0005
2411
0223 plusmn 0004
3262
0206 plusmn 0003
3941
NHJR
( 500 mgkg)
0258 plusmn 0004
1704
0236 plusmn 0004
2870
0225 plusmn 0005
3382
EETG
( 400 mgkg) 0238plusmn 0006 2347 0238 plusmn 0003 2809 0218 plusmn 0004 3588
NHTG
( 400 mgkg) 0261 plusmn 0003 1607 0253 plusmn 0003 2356 0241plusmn 0001 2911
Indomethacin ( 10 mgkg) 0238 plusmn 0003
2347
0230 plusmn 0005
2051
0195 plusmn 0003
4264
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
95
48 Pretreatment with J regia and T gharuensis inhibited dextran-induced paw edema
481 At 1st hr
EEJR (0216 plusmn 0004 p lt 0001) NHJR (0238 plusmn 0006 p lt 0001) EETG (0243 plusmn 0001 p lt 0001)
NHTG (0266 plusmn 0006 p lt 001) and diphenhydramine (0193 plusmn 0004 p lt 0001) extracts presented
anti-inflammatory activity in contrast to control group (0300 plusmn 0005) The percentage inhibition in
these groups were found to be 28 2066 19 and 1133 and 2667 respectively
The maximum inhibition was shown by EEJR at first hour
Figure 49 Dextran At first hour
Figure 49 depicts suppression of paw edema as a consequence of pre-treatment p lt 001 and
P lt 0001 in contrast with control group
96
482 At 2nd hr
An inhibition (p lt 0001) was detected with EEJR (0206 plusmn 0004) NHJR (0225 plusmn 0002) EETG (0226
plusmn 0004) NHTG (0245 plusmn 0008) and diphenhydramine (0195 plusmn 0004) in comparison with control
group (0316 plusmn 0003) The percentage inhibition in these groups were found to be 4801 2879
2848 2246 and 3829 respectively The maximum inhibition was shown by EEJR
at second hour
Figure 50 Dextran At second hour
Figure 50 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
97
483 At 3rd hr
EEJR (0193 plusmn 0004) NHJR (0205 plusmn 0006) EETG (0213plusmn 0004) NHTG (0223 plusmn 0006) and
diphenhydramine (0176 plusmn 0003) produced significant inhibitory effects (p lt 0001) in contrast with
control group (0336 plusmn 0005) The percentage inhibition in these groups were found to be 4255
3898 3660 3363 and 4761 respectively The maximum inhibition was shown
by EEJR at third hour
Figure 51 Dextran At third hour
Figure 51 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
98
484 At 4th hr
EEJR (0175 plusmn 0002) NHJR (0193 plusmn 0004) EETG (0195 plusmn 0002) NHTG (0218 plusmn 0005) and
diphenhydramine (0168 plusmn 0003) prevented (p lt 0001) paw edema development in contrast with
control group (0345 plusmn 0004) The percentage inhibition in these groups were found to be 4297
4405 4347 3681 and 5130 The maximum inhibition was shown by EEJR at
fourth hour
Figure 52 Dextran At fourth hour
Figure 52 represents suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast with control group
99
485 At 5th hr
EEJR (0173 plusmn 0004) NHJR (0183 plusmn 0009) EETG (0185 plusmn 0004) NHTG (0205 plusmn 0006) and
diphenhydramine (0161 plusmn 0006) caused significant prevention (p lt 0001) of edema in contrast with
control group (0353 plusmn 0006) The percentage inhibition in these groups were found to be 5099
4815 4815 4192 and 5443 respectively The maximum inhibition was shown
by EEJR at fifth hour
Figure 53 Dextran At fifth hour
Figure 53 depicts suppression of paw edema as a consequence of pre-treatment p lt 0001
in contrast to control group
100
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis DPH Diphenhydramine
101
Table 11 The anti-inflammatory properties of J regia and T gharuensis extracts on dextran-induced Paw edema model
Groups
1sth
2ndh
3rdh
4thh
5thh
Mean plusmn SEM (ml)
Control 0300 plusmn 0005
0316 plusmn 0003 0336 plusmn 0005 0345 plusmn 0004 0353 plusmn 0006
EEJR
(500 mgkg)
0216 plusmn 0004
(28)
0206 plusmn 0004
(4801)
0193 plusmn 0004
(4255)
0175 plusmn 0002
(4927)
0173 plusmn 0004
(5099)
NHJR
(500 mgkg)
0238 plusmn 0006
(2066)
0225 plusmn 0002
(2879)
0205 plusmn 0006
(3898)
0193 plusmn 0004
(4405)
0183 plusmn 0009
(4815)
EETG
(400 mgkg)
0243 plusmn 0005
(19)
0226 plusmn 0004
(2848)
0213 plusmn 0004
(3660)
0195 plusmn 0002
(4347)
0183 plusmn 004
(4815)
NHTG
(400 mgkg)
0266 plusmn 0005
(1133)
0245 plusmn0005
(2246)
0223 plusmn 0006
(3363)
0218 plusmn 0005
(3681)
0205 plusmn 0006
(4192)
DPH
(60 mgkg)
0220 plusmn 0004
(2667)
0195 plusmn 0004
(3829)
0176 plusmn 0003
(4761)
0168 plusmn 0003
(5130)
0161 plusmn0 006
(5443)
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis NHTG n-
hexane extract of Trigonella gharuensis DPH Diphenhydramine p lt 001 and p lt 0001 as compared to control group
102
49 Pretreatment with J regia and T gharuensis inhibited xylene-induced paw edema
Contrary to control group (0035 plusmn 0002) EEJR (0213 plusmn 0005 p lt 0001) NHJR (0026 plusmn
0006 p lt 0001) EETG (0033 plusmn 0001 p lt 0001) NHTG (0037 plusmn 0006 p lt 001) and
dexamethasone (0012 plusmn 0001 p lt 0001) showed substantial inhibition of ear edema
induced by xylene
Figure 54 Xylene induced ear edema
Figure 54 depicts significant suppression of ear edema as a consequence of pre-treatment p
lt 001 and p lt 0001 as compared with control group
103
413 Pretreatment with J regia and T gharuensis prevented castor oil- induced diarrhea
491 Onset time of diarrhea
Onset of diarrhea in groups pre-treated with EEJR (1922 plusmn 2136) NHJR (1652 plusmn 1302)
EETG (1947 plusmn 1838) NHTG (1742 plusmn 1537) and loperamide (218 plusmn 3559) was significantly
delayed (p lt 0001) as compared to control group (1095 plusmn 1335) Pretreatment with both
extracts significantly prolong onset time of diarrhea
Figure 55 Onset time of diarrhea
Figure 55 depicts that time of onset of diarrhea was prolonged as a consequence of pre-
treatment p lt 0001 as compared with control group
104
492 Number of wet feces
As compared to control group (9833 plusmn 0307) number of wet feces was significantly reduced
(p lt 0001) due to pretreatment with EEJR (4167 plusmn 0307) NHJR (5833 plusmn 0401) EETG
(5833 plusmn 0401) NHTG (7500 plusmn 0223) and loperamide (5333 plusmn 0210)
Figure 56 Number of wet feces
Figure 56 depicts that as a consequence of pretreatment number of feces were reduced p lt
0001 as compared with control group
105
493 Total weight of wet feces
Total weight of wet feces was significantly reduced (p lt 0001) with EEJR (2045 plusmn 1335)
NHJR (2575 plusmn 1118) EETG (210 plusmn 1693) NHTG (2608 plusmn 2330) and loperamide (1865 plusmn
2473) as compared to control group (4057 plusmn 1542)
Figure 57 Total weight of wet feces
Figure 57 depicts significant attenuation of total weight of feces as a consequence of pre-
treatment p lt 0001 as compared with control group
106
494 Total number of feces
Total number of feces was significantly reduced (p lt 0001) with EEJR (4167 plusmn 0307) NHJR
(7500 plusmn 0341) EETG (6167 plusmn 0307) NHTG (9500 plusmn 0341) and loperamide (4500 plusmn
0223) in comparison to control group (1333 plusmn 0614)
Figure 58 Total number of feces
Figure 58 depicts reduction of total number of feces because of pre-treatment with extracts and
loperamide p lt 0001 as compared with control group
107
Table 12 Pretreatment with J regia and T gharuensis extracts inhibited castor oil-induced diarrhea
Parameters
Control group EEJR NHJR EETG NHTG Piroxicam
Mean plusmn SEM
Time of onset of
diarrhea (mins) 1095 plusmn 1335 1922 plusmn 2136 1652 plusmn 1302 1947 plusmn 1838 1742 plusmn 1537 218 plusmn 3559
Number of wet feces 9833 plusmn 0307 4167 plusmn 0307 5833 plusmn 0401 5833 plusmn 0401 75 plusmn 0223 5333 plusmn 0210
Total weight of feces
(grams) 4057 plusmn 1542 2045 plusmn 1335 2575 plusmn 1118 210 plusmn 1693 2608 plusmn 2330 1865 plusmn 2473
Total number of feces 1333 plusmn 0614 4167 plusmn 0307 7500 plusmn 0341 6167 plusmn 0307 9500 plusmn 0341 4500 plusmn 0223
EEJR Ethanolic extract of Juglans regia NHJR n-hexane extract of Juglans regia EETG Ethanolic extract of Trigonella gharuensis n-hexane
extract of Trigonella gharuensis p lt 001 and p lt 0001 as compared to control group
108
410 Qualitative analysis of J regia and T gharuensis extracts
Qualitative analysis confirmed presence of many biological compounds such as alkaloids
saponins phenols terpenoids flavonoids and tannins in both extracts while it revealed the
absence of glycosides saponins and steroids as presented in Table 16
Table 13 Qualitative analysis of J regia and T gharuensis extracts
Tests EEJR NHJR EETG NHTG
Alkaloids + + + +
Glycosides _ _ _ _
Saponins _ _ _
Phenols + + + +
Terpenoids + + + +
Steroids _ _ _ _
Flavonoids + + + +
Tannins + _ + +
109
411 GC-MS analysis of J regia and T gharuensis extracts
Detail of GC-MS analysis of J regia and T gharuensis extracts was elucidated below
4111 Assessment of GC-MS analysis of J regia ethanolic extract
GC-MS analysis of EEJR revealed the presence of thirty compounds All compound names
retention times molecular formulae molecular weights and their chemical names are
presented in Table 17 Benzene (1-butylheptyl) Benzene (1-pentylheptyl) and Benzene (1-
pentyloctyl) were found in the highest concentration (12704 8340 and 6753
respectively) in EEJR These compounds belong to different classifications alkyl halides (1-
chlorododecane) aliphatic compounds (decane undecane dodecane and heptacosane)
aromatic compounds (Benzene (1-butylhexyl)- Benzene (1-butylheptyl)- Benzene (1-
pentylheptyl)- and Benzene(1-pentyloctyl) saturated fatty acid esters (methyl palmitate and
ethyl palmitate) saturated fatty acid esters (methyl palmitate ethyl palmitate 16-
Methylheptadecanoic acid methyl ester) plasticizer compound such as 12-
benzenedicarboxylic acid mono (2-ethylhexyl) ester and triterpene (squalene)
110
Table 14 List of identified constituents of ethanolic extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 4880 1062 1-chlorododecane C12H25Cl 204
2 5350 3956 Decane C10H22 142
3 6255 1169 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
4 6795 2182 Undecane C11H24 156
CH3
CH3
CH3 Cl
CH3
CH3
111
5 8311 0859 Dodecane C12H26 170
CH3
CH3
6 14886 3267 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
7 15077 2691 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
8 15461 2345 Benzene (1-ethyloctyl)- C16H26 218
CH3CH3
9 16236 2542 Benzene (1-methylnonyl)- C16H26 218 CH3
CH3
112
10 17045 12704 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
11 17246 6128 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
12 17664 5710 Benzene (1-ethylnonyl)- C17H28 232
CH3
CH3
13 18430 4841 Benzene (1-methyldecyl)- C17H28 232
CH3
CH3
14 18988 8340 Benzene (1-pentylheptyl)- C18H30 246
CH3
CH3
113
15 19101 4175 Benzene (1-butyoctyl)- C18H30 246
CH3
CH3
16 19327 5055 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
17 19745 4279 Benzene (1-ethyldecyl)- C18H30 246
CH3
CH3
18 20512 3754
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
19 20947 6753 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
114
20 21086 4226 Benzene (1-butylnonyl)- C19H32 260
CH3
CH3
21 21313 3038 Benzene (1-propyldecyl)- C19H32 260
CH3 CH3
22 21748 2501 Benzene (1-ethylundecyl)- C19H32 260
CH3
CH3
23 22506 2311
Benzene (1-
methyldodecyl)-
C19H32 260
CH3 CH3
24 22758 1105 Methyl palmitate C17H34O2 270
CH3
O
O CH3
25 25475 0713 Methyl linoleate C19H34O2 294
CH3
O
O
CH3
115
26 25580 1165 Methyl linolenate C19H32O2 292
O
O
CH3
CH3
27 25885 0319 Methyl stearate C19H38O2 298 CH3
O
O
CH3
28 30178 0212
12-Benzenedicarboxylic
acid mono(2-ethylhexyl)
ester
C16H22O4 278
O
OH
O
O
CH3
CH3
29 32303 1309 Squalene C30H50 410
CH3
CH3
CH3
CH3
CH3
CH3
CH3
CH3
30 32738 0380 Heptacosane C27H56 380
CH3
CH3
116
117
1 Dodecane 1-chloro-
2 Decane
30( E )-3 (10)-Caren-4-ol
118
4 Undecane
5 Dodecane
6 Benzene (1-propylheptyl)
119
7 Benzene (1ethyloctyl)-
8 Benzene (1-methylonyl)-
9 Benzene (1-butylheptyl)-
120
10 Benzene (1-propyloctyl)-
11 Benzene (1-methyldecyl)-
12 Benzene (1-pentylheptyl)-
121
13 Benzene (1-butyloctyl)-
14 Benzene (1-propylonyl)-
15 Benzene (1-ethyldecyl)-
122
16 Benzene (1-methylundecyl)-
17 Benzene (1-pentyloctyl)-
18 Benzene (1-Butylonyl)-
123
19 Benzene (1-propyldecyl)
20
Benzene (1-ehtylundecyl)-
21Benzene (1-methyldodecyl)-
124
22 Hexadecanoic acid methyl ester
23 912-Octadecadienoic acid (ZZ)- methyl ester
24 91215 -Octadecadienoic acid methyl ester (ZZZ)-
125
25 Octadecanoic acid methyl ester
2612-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
27 Heptacosane
126
4112 Assessment of GC-MS of n- hexane extract of J regia
GC-MS analysis of NHJR revealed presence of fifteen compounds in NHJR Ethyl palmitate
(16955) ethyl linolenate (1533) squalene (15138) ethyl linolelaidate (7868)
heptacosane (7554) vitamin E (6222) and ethyl stearate (5535) were found in the
highest concentration These compounds belong to different chemical classifications aromatic
compounds (Benzene (1-butylheptyl) Benzene (1-methylundecyl)- Benzene(1-pentylheptyl)
aliphatic compounds octadecane heptacosane octadecane and 3-ethyl-5-(2-ethylbutyl)
triterpene (squalene) naphthalone derivative (388-Trimethoxy-3-piperidyl-22-
binaphthalene-1144-tetrone) sesquiterpene lactone (224-trimethyl-1233a68a-
hexahydroazulene-57-dicarbaldehyde also known as costunolide) unsaturated fatty acid
esters (methyl lineoleate and linolenic acid methyl ester) saturated fatty acid esters (ethyl
palmitate) diterpene alcohol (phytol) and tocopherol (vitamin E) (Table 18)
127
Table 15 List of identified constituents of n-hexane extract of J regia
Sr
No
Retention
Time
(Minute)
Total
Percentage
Name of Identified
Compound
Molecular
Formula
Molecular
Weight
(gmol)
Structures
1 16845 2133 Benzene (1-butylheptyl) C17H28 232
CH3
CH3
2 17498 4905
Velleral
C15H20O2 232 CH3
CH3
CH3O
O
3 20372 2361
Benzene (1-
methylundecyl)-
C18H30 246
CH3
CH3
128
4 20773 2105
Benzene (1-
pentylheptyl)
C18H30 246
5 20930 2199
ZZZ-1469-
Nonadecatetraene
C19H32 260
CH3 CH2
6 23934 16955 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
7 25737 4597 Phytol C20H40O 296
OH CH3
CH3
CH3
CH3
129
8 26311 7868 Ethyl linolelaidate C20H36O2 308 O
CH3
O
CH3
9 26407 15553 Ethyl linolenate C20H34O2 306 O CH3
O
CH3
10 26686 5535 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
11 30178 2740
388-Trimethoxy-3-
piperidyl-22-
binaphthalene-1144-
tetrone
C28H25NO7 487
N
O
O
O
O
O
O
CH3CH3
O
CH3
130
12 32294 15138 Squalene C30H50 410
CH3
CH3
CH3
CH3CH3
CH3
CH3
CH3
13 32730 4184
Octadecane3-ethyl-5-(2-
ethylbutyl)-
C26H54 366 CH3
CH3
14 34193 7504 Heptacosane C27H56 380 CH3
CH3
15 34759 6222 Vitamin E C29H50O2 430 O
CH3
CH3
OH
CH3
CH3
CH3
CH3
CH3
131
132
1 Benzene (1-butylheptyl)-
2 56-Azulenedicarboxaldehyde 123a8a-Hexahydro-228-trimethyl-
1 Benzene (1-methylundecyl)-
133
2 Benzene (1-pentylheptyl)-
5 ZZZ ndash 1469-Nonadecatetraene
6 Hexadecanoic acid ethyl ester
134
7 Phytol
8 912-Octadecadienoic acid ethyl ester
9 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
135
10 Octadecanoic acid ethyl ester
11 3rsquo88rsquoTrimethoxy-3-piperidyl22rsquobinaphthalene-11rsquo44rsquo-tetrone
6 Squalene
136
7 Octadecane 3-ethyl-5-(2-ethylbutyl)-
8 Heptacosane
9 Vitamin E
137
4113 GC-MS analysis of ethanolic extract of T gharuensis
Assessment of GC-MS analysis of ethanolic extract of T gharuensis revealed presence of
fifteen compounds 2H-1-Benzopyran-2-one (53050) 1H-2-Benzopyran-1-one34-dihydro
(15848) and ethyl palmitate (6588) were found in the highest concentrations These
compounds belong to different classifications the unsaturated fatty acids esters (ethyl
linolenate and ethyl linoelaidic acid) saturated fatty acid esters (ethyl myristate ethyl laurate
ethyl stearate and ethyl palmitate) diterpene (phytol) coumarins (2H-1-Benzopyran-2-one
and 1H-2-Benzopyran-1-one34-dihydro) aromatic compound (2-methylbenzaldehyde) and
aliphatic compounds (Nonacosane 3-Ethyl-5-(2-ethylbutyl)octadecane and hexatriacontane)
(Table 19)
138
Table 16 List of identified constituents of ethanolic extract of T gharuensis
SrNo Retention
Time (mins)
Total
(age)
Name of Identified
Compound Mol Formula
MW
(gmol) Structures
1 8398 0430 Benzaldehyde 2-methyl- C8H8O 120
O
CH3
2 12186 15848 1H-2-Benzopyran-1-
one34-dihydro C9H8O2 148
OO
3 13588 53050 2H-1-Benzopyran-2-one C9H6O2 146 OO
4 15983 1342 Dodecanoic acid ethyl
ester C14H28O2 228
5 16175 1580
Tetracyclo
[33101(39)]decan-10-
one
C10H12O 148 OO
139
6 20093 0951 Tetradecanoic acid ethyl
ester C16H32O2 256
CH3
O
CH3
O
7 23803 1281 n-Hexadecanoic acid C16H32O2 256 CH3
OH O
8 23969 6588 Ethyl palmitate C18H36O2 284
CH3
O
O
CH3
9 25737 0614 Phytol C20H40O 296 OH CH3
CH3
CH3
CH3
10 26320 2475 912-Octadecadienoic acid
ethyl ester C20H36O2 308
O
CH3
O
CH3
140
11 26425 4714 91215-Octadecatrienoic
acid ethyl ester C20H34O2 306
O CH3
O
CH3
12 26686 1110 Ethyl stearate C20H40O2 312 O
CH3
O
CH3
13 32764 6519 Nonacosane C29H60 408 CH3
CH3
14 33435 0459 Octadecane3-ethyl-5-(2-
ethylbutyl)- C26H54 366 CH3
CH3
15 34210 3039 Hexatriacontane C36H74 506 CH3
CH3
141
142
1 Benzaldehyde 2-methyl-
2 1H-2-Benzopyran-1-one 34-dihydro-
3 1H-2-Benzopyran-1-one 34-dihydro-
143
4 2H-1-Benzopyran-2-one
5 Dodecanoic acid ethyl ester
6 Tetracyclo[33101(39)]decan-10-one
144
7 Tetradecanoic acid ethyl ester
8 n-Hexadecanoic acid
9 Hexadecanoic acid ethyl ester
145
10 Phytol
11 912-Octadecadienoic acid ethyl ester
12 91215-Octadecatrienoic acid ethyl ester (ZZZ)-
146
13 Octadecanoic acid ethyl ester
14 Nonacosane
15 Octadecane 3-ethyl-5-(2-ethylbutyl)-
147
16 Hexatriacontane
148
4114 GC-MS analysis of T gharuensis n-hexane extract
Assessment of T gharuensis extract revealed presence of thirty-three compounds Benzene
(1-butylheptyl)- (11968) Benzene (1 pentylheptyl)- (8653) and Benzene (1-
pentyloctyl)- (6996) were found in the highest concentration The unsaturated fatty acids
esters (Ethyl linolenate Ethyl linolelaidate Ethyl stearate and Linolenic acid methyl ester)
saturated fatty acid esters (tetradecanoic acid ethyl ester Ethyl palmitate) diterpene (phytol)
triterpene (squalene) aromatic compounds (benzene-1-ethyl-3-methyl) decan-5-ylbenzene
Dodecan-6-ylbenzene benzene-1-pentyloctyl) flavonoids (2H-1-Benzopyran-2-one)
aliphatic compounds (decane undecane dodecane nonacosane Octadecane 3-ethyl-5-2-
ethylbutyl tetratriacontane and hexatriacontane) naphthalone derivative (388-Trimethoxy-3-
piperidyl-22-binaphthalene-1144-tetrone) Tetracyclo [33101(39)]decan-10-one (Table
20)
149
Table 17 GC-MS analysis of T gharuensis n-hexane extract
Sr
No
Retention
Time
(mins)
Total
(age) Name of Identified Compound
Mol
Formula
MW
(gmol) Structures
1 4914 1538 Benzene 1-ethyl-3-methyl- C9H12 120
CH3
CH3
2 5358 3731 Decane C10H22 142 CH3
CH3
3 5663 0376 Decane 4-methyl- C11H24 156 CH3
CH3
CH3
4 6264 1048 (E)-3(10)-Caren-4-ol C10H16O 152
OH
CH2
CH3
CH3
150
5 6804 1990 Undecane C11H24 156 CH3
CH3
6 8311 0750 Dodecane C12H26 170 CH3
CH3
7 13536 4238 2H-1-Benzopyran-2-one C9H6O2 146 OO
8 14920 2977 Benzene (1-butylhexyl)- C16H26 218
CH3
CH3
9 15103 2458 Benzene (1-propylheptyl)- C16H26 218
CH3
CH3
10 15486 2170 Benzene (1-ethyloctyl)- C16H26 218 CH3
CH3
151
11 16262 2355 Benzene (1-methylnonyl)- C16 H26 218 CH3
CH3
12 17089 11968 Benzene (1-butylheptyl)- C17H28 232
CH3
CH3
13 17289 5794 Benzene (1-propyloctyl)- C17H28 232
CH3
CH3
14 17698 5073 Benzene (1-ethylnonyl)- C17H28 232 CH3
CH3
15 18465 4620 Benzene (1-methyldecyl)- C17H28 232 CH3
CH3
152
16 19048 8653 Benzene (1 pentylheptyl)- C18H30 246
CH3
CH3
17 19379 5031 Benzene (1-propylnonyl)- C18H30 246
CH3
CH3
18 19789 4412 Benzene (1-ethyldecyl) C18H30 246
CH3
CH3
19 20555 3701 Benzene (1-methylundecyl) C18H30 246 CH3
CH3
20 20990 6996 Benzene (1-pentyloctyl)- C19H32 260
CH3
CH3
21 21138 4273 Benzene (1-butylnonyl) C19H32 260
CH3
CH3
153
22 21365 3206 Benzene (1-propyldecyl) C19H32 260
CH3 CH3
23 21792 2679 Benzene (1-ethylundecyl) C19H32 260
CH3
CH3
24 22540 2403 Benzene (1-methyldodecyl)- C19H32 260 CH3 CH3
25 22749 0590 Hexadecanoic acid methyl ester C17H34O2 270 CH3O
O
CH3
26 23986 1301 Hexadecanoic acid ethyl ester C18H36O2 284
CH3
O
O
CH3
27 25562 0356 91215- Octadecatrienoic acid
methyl ester (ZZZ)- C19H32O2 292
O
O
CH3
CH3
154
28 26320 0252 912- Octadecatrienoic acid ethyl
ester C20H36O2 308
O
CH3
O
CH3
29 26425 0830 91215- Octadecatrienoic acid
ethyl ester (ZZZ)- C20H34O2 306
O CH3
O
CH3
30 26694 0214 Octadecanoic acid ethyl ester C20H40O2 312 O
CH3
O
CH3
31 30187 0535 12- Benzenedicarboxylic acid
mono(2-ethylhexyl) ester C16H22O4 278
O
OH
O
O
CH3
CH3
155
32 32799 2525 Nonacosane C29H60 408
CH3
CH3
33 34227 0957 Tetratriacontane C34H70 478 CH3
CH3
156
157
1 Decane
2 Decane 4-methyl-
3 (E)-3(10)-caren-4-ol
158
3 Undecane
4 Dodecane
6 2H-1-Benzopyran-2-one
159
7 Benzene (1-butylhexyl)-
8 Benzene (1-propylheptyl)-
9 Benzene (1-ethyloctyl)-
160
10 Benzene (1-methylnonyl)-
12 Benzene (1-butylheptyl)-
12 Benzene (1-propyloctyl
161
13 Benzene (1-ethylnonyl)-
14 Benzene (1-methyldecyl)-
15 Benzene (1-pentylheptyl)-
162
17 Benzene (1-propylnonyl)-
17 Benzene (1-ethyldecyl)-
18 Benzene (1-methylundecyl)
163
19 Benzene (1-pentyloctyl)-
20 Benzene (1-butylnonyl)-
21 Benzene (1-propyldecyl
164
22 Benzene (1-ethylundecyl)-
23 Benzene (1-methyldodecyl)-
24 Hexadecanoic acid methyl ester
165
25 Hexadecanoic acid ethyl ester
26 9 12 15-Octadecatrienoic acid methyl ester (ZZZ)-
27 912-Octadecadienoic acid ethyl ester28
166
28 9 12 15-Octadecatrienoic acid ethyl ester (ZZZ)-
29 Octadecanoic acid ethyl ester
3012-Benzenedicarboxylic acid mono(2-ethylhexyl) ester
167
31 Nonacosane
32 Tetratriacontane
33 Benzene 1-ethyl-3-methyl
168
CHAPTER 5 DISCUSSION
The roles of anti-inflammatory and immunomodulatory substances in treating chronic
inflammatory conditions are well established RA is characterized by over production of TNF-
α NF-ĸB IL-6 IL-1β and PGE2 and reduced levels of anti-inflammatory IL-4 Substances
which down regulate pro-inflammatory cytokines have gained importance in the treatment of
inflammatory disorders (58 60)
J regia and T gharuensis have been frequently used for the treatment of arthritis in folk
medicine (56) FCA-induced model of rheumatoid arthritis is preferred due to its similarities
with human arthritic disorder characterized by synovial hyperplasia vascular formation
cartilage destruction and bone erosion (12) The pannus formation is a hallmark of RA which
is mainly composed of macrophages and fibroblasts like synoviocytes (73) It is believed that
erosion observed during rheumatic diseases is mainly due to TNF-α IL-6 and IL-1β (74) J
regia and T gharuensis extracts significantly attenuated bone erosion and pannus formation in
joints which was ascribed to attenuation of pro-inflammatory cytokines levels
The key focus in the treatment of RA is to reduce inflammation caused by pro-inflammatory
cytokines TNF-α is considered as main cytokine involved in the inflammatory disorders It
activates IL-6 in both paracrine and autocrine manner Activation of fibroblasts by TNF-α tends
to destroy cartilage by producing matrix degrading enzyme (58) NF-ĸB is associated with
resorption of bone by differentiation besides activation of osteoclasts These events also lead
to the development of Th1 response It is a transcription factor which activates other cytokines
IL-6 TNF-α in addition IL-1β and causes recruitment neutrophils as well as activation COX-
2 is activated by NF-ĸB thus amplifying prostaglandin production and inflammatory response
(5) This study showed that J regia and T gharuensis significantly decreased TNF-α and NF-
169
ĸB mRNA expression levels This might had caused minimizing of bone erosion inflammation
and formation of pannus These consequences are in line with the previous study (2)
IL-6 was considered a major instigator of joint inflammation in RA Earlier studies showed
that IL-1β and TNF-α are the major inducers of IL-6 and these are further responsible for
synovial inflammation and cartilage destruction in arthritic patients (75) It was a pleiotropic
cytokine maintaining hematopoiesis and bone metabolism It also regulated many immune
responses Increased production of IL-6 results into systemic inflammation and auto-immune
disorders It is responsible for osteoporosis and joint destruction in RA patients Inhibition of
IL-6 can prevent osteoclast activity in RA patients (76) IL-1β is more abundant in the
destructive tissues of RA patients (77) It is over expressed in inflamed synovial tissue
particularly in synovial lining and is elevated in lymphatic drainage of affected joints In
addition it is localized in affected joint thus causing pannus formation in the arthritic patients
(78) An increase in IL-1β levels in joints has been associated with the histological features of
RA There is a reason to believe that IL-1β is an essential cytokine that promotes inflammation
and joint destruction in RA (6) J regia and T gharuensis attenuated the mRNA levels Our
outcomes of this research study are similar with the inferences of already published study
which established that attenuated levels of IL-1β and IL-6 reduced cartilage and bone
destruction (79)
IL-4 mediates anti-inflammatory response and repression of macrophage activation (80)
Moreover it is responsible for negative regulation of NF-ĸB by increasing IКB IL-4 inhibits
osteoclasts which is liable for destruction of cartilage and bone erosion occur in arthritic
patients (81) Therapy with recombinant IL-4 have resulted in the inhibition of cytokine
production in patients suffering from RA (82) J regia and T gharuensis extracts significantly
170
increased IL-4 levels thus reducing RA development by upregulating anti-inflammatory
response
COX-1 and COX-2 enzymes possess effective physiological roles in biological signaling
pathways COX-1 entails homeostatic and inflammation-modulating potentials while COX-2
induces generation of prostaglandins to carry out inflammatory and pain outcomes (83) COX-
2 is over expressed in RA resulting in the over-production of PGE2 (84 85) Various studies
describe functions of COX-1 in maintaining the gastric mucosa integrity facilitating normal
platelet function and regulating renal blood flow The COX-1 and COX-2 levels were
significantly reduced by J regia and T gharuensis which could result in the inhibition of PGE2
levels However the extent of COX-1 suppression did not significantly counter the constitutive
outcomes of COX-1 which is in line with the results of other studies that the constitutive
functions of this enzyme are hardly affected in COX-1 knock-out mice (83)
We evaluated the levels of PGE2 and found high levels in arthritic control group (86) Binding
of PGE2 to prostaglandin receptors initiate the process of erosion of juxta-articular cartilage
(58) Treatment with J regia and T gharuensis attenuated PGE2 levels These outcomes are
in line with the study of (60 73) who showed that suppression of PGE2 was involved in bone
remodeling and suppression of inflammation caused by arthritis The considerable reduction of
TNF-α IL-6 IL-1β and increased levels of IL-4 in extracts treated groups confirm
immunomodulatory role of both extracts (87)
Hb content and RBC counts were reduced in arthritic control group which indicate anemic
condition in rats The anemia might be associated to low plasma iron levels that is negatively
correlated with significantly higher IL-6 levels (88 89) Bone marrow produced inadequate
cells in anemia and aberrant deposits of iron in synovial tissues (12) J regia and T gharuensis
171
nearly normalized these altered hematological parameters which are in accordance with the
result of the previous study (10) On the other hand WBC and platelet counts were found
increased in blood samples IL-6 could be responsible for high rise in leukocyte levels and
platelets (90 91) Treatment with J regia and T gharuensis restored white blood cell counts
and platelets Increased levels of ALP may be responsible for bone destruction and
mineralization (58) Both plant extracts and piroxicam significantly reduced ALP levels in
treatment groups To find out the safety of extracts we measured different biochemical
parameters for instance urea creatinine ALT and AST levels The results explained that no
significant difference was observed among all groups Hence validating the safety of extracts
in term of liver and renal parameters
Inflammation is a normal body response to harmful agents in order to get rid of noxious stimuli
but uncontrolled inflammation may lead to tissue damage (92) Modern scientific research is
inclined towards treatment of inflammation with natural products having least side effects and
being cheapest source (18) Investigation of anti-inflammatory activities of J regia and T
gharuensis extracts were performed using carrageenan as phlogistic agents while various other
agents were used to determine the autacoids inhibition as one the anti-inflammatory
mechanisms by extracts of plants Different supporting models like dextran-induced paw
edema castor oil-induced diarrhea and xylene-induced ear edema were also developed to
strengthen the inferences (93)
An excellent model was used for elucidation of the cascade of complex events such as
carrageenan-induced edema especially the interactions of autacoids as an anti-inflammatory
mechanism The first phase (1-2 h) started with the release of histamine serotonin and kinin
while the second phase was ascribed with the release of prostaglandin and bradykinins (12)
Extracts of J regia and T gharuensis inhibited paw edema at first stage and prevention was
172
also observed till fifth hours indicating its efficacy at second stage Results were authenticated
with the inferences of reported literature (56 94)
To determine possible inhibitory effect on markers involved in first phase we further
developed serotonin- as well as histamine- induced paw edema models Histamine and
serotonin increase vascular permeability and are potent vasodilators which in turn accumulate
fluids and leukocytes imparting edema and inflammation (95) All these events contribute
towards principal signs of inflammation It was previously suggested that inhibitory effect of
plant extracts determined using both serotonin- and histamine- induced paw edema models
might be ascribed to the inhibition of releasesynthesis of these autacoids (12) Significant
inhibitions were observed in both models when they were pre-treated with extracts of plants
Similar to the results of carrageenan-induced paw edema pre-treatment with ethanolic and n-
hexane extracts caused significantly higher prevention of paw edema These results were
further validated through dextran-induced paw edema model
Dextran-induced paw edema was commonly taken as an experimental model for inflammation
This model was accompanied by different mechanism of inflammation such as vascular
permeation which was increased due to release of serotonin and histamine followed by
activated kinins further promoted accumulation of neutrophils and osmotic edema having low
protein levels (96) The ethanolic as well as n-hexane extracts of J regia and T gharuensis
prevented dextran-induced paw edema significantly thus strengthening the inhibitory effects
of J regia and T gharuensis found using two different paw edema models induced by
histamine and serotonin
Xylene-induced ear edema was another model used to further strengthen inhibitory effects of
J regia and T gharuensis extracts on autacoids inhibitions Xylene mediates the release of
substance P an undecapeptide neurotransmitter which is widely distributed in central as well
173
as peripheral nervous system responsible for many physiological processes Vasodilation and
plasma extravasation caused by the release of substance P result into neurogenic inflammation
(97) Other studies described that mechanism of xylene induced inflammation was also in part
involved with the release of histamine and other mediators (98) The two suggested
mechanisms of inflammation are interlinked as substance P and histamine both induce the
release of each other Thus inhibition of substance P can negatively influence the release of
histamine and vice versa (99) Current study revealed that inhibition of paw edema induced by
histamine further validates attenuation of xylene-induced ear edema Thus inhibition of ear
edema further validated autacoids inhibition was another unique anti-inflammatory mechanism
of J regia and T gharuensis extracts
Castor-oil induced diarrhea model was used to evaluate role of prostaglandins in inflammatory
conditions (100) Castor oil is metabolized to ricinoleic acid which irritates the gastric mucosa
The irritation of mucosa in turn releases prostaglandin which stimulates intestinal motility and
mucus secretion (101) Both ethanolic and n-hexane extracts of J regia and T gharuensis
significantly prevented diarrhea Inhibition of castor oil-induced diarrhea validated inhibitory
effect of plants extracts in 2nd stage of carrageenan-induced paw edema Thus plants extracts
inhibited prostaglandin which was also suggested along with inhibition of histamine and
serotonin as underlying mechanisms of anti-inflammatory activity Plant extracts having
important biological compounds such as tannin flavonoids and alkaloids had been described
to have considerable anti-diarrheal activity (102 103) Flavonoids especially played an
imperative part in inhibiting synthesis of prostaglandin (104 105) Qualitative analysis of
plants extracts revealed that these contained flavonoids alkaloids and tannins in both plant
extracts which might be attributed anti-diarrheal activity and prostaglandin inhibitory activity
Anti-inflammatory activities are also frequently reported with detected phytochemical
constituents in current study (106)
174
Experimental studies of acute toxicity of plants extracts revealed that extracts were found
nontoxic at 2 gkg for J rgia and 16 gkg for T gharuensis The extract did not show any sign
of mortality and behavior changes This is in line with findings of Ruijun et al (53)
The GC-MS method is considered a direct and precise technique to evaluate the presence of
medicinally important components in plant extracts The analysis showed that J regia and T
gharuensis possesses different constituents with previously reported anti-inflammatory and
anti-oxidant properties such as methyl linoleate phytol along with squalene (107 108)
Presence of phytol ethyl palmitate and nonacosane impart anti-inflammatory activity to EETG
and to n-hexane NHTG extract Costunolide (224-trimethy-1233a68a-hexahydroazulene-
57-dicarbaldehyde) present in n-hexane extract of J regia significantly reduced
inflammation by inhibiting NF-kB (Chaturvedi et al 2011) and inhibits IL-1β expression
levels (109) hence validating the anti-inflammatory properties of J regia and T gharuensis
extracts The 388-Trimethoxy-3-piperidyl-22-binaphthalene-1144-tetrone present in n-
hexane extract of J regia also attenuated inflammation because it possessed considerable anti-
inflammatory and anti-arthritic properties (110) Ezhilan and Neelamegam had stated that 12-
Benzenedicarboxylic acid mono (2-ethylhexyl) ester retained considerable anti-inflammatory
in addition to antioxidant properties and interestingly we have found this compound in our
extract (111)
175
CHAPTER 6 CONCLUSION
The current study validates the traditional use of J regia and T gharuensis in inflammatory
disorders and RA Amelioration of joint inflammation in both acute and chronic models of
inflammation highlighted that J regia and T gharuensis extracts possessed significant
immunomodulatory and anti-inflammatory properties The attenuation of RA might be
ascribed to downregulation of pro-inflammatory markers such as TNF-α IL- -6 NF-kB COX-
1 and COX-2 and up-regulation of anti-inflammatory IL-4 Moreover PGE2 levels were also
found reduced after treatment with plant extracts The inhibition of autacoids in different
models of acute inflammation is suggested as one of the possible mechanisms of anti-
inflammatory activity Further studies are warranted to isolate active phytochemicals which
are responsible for anti-arthritic and anti-inflammatory effects
176
FUTURE PERSPECTIVE
J regia and T gharuensis possess considerable anti-arthritic compounds and anti-
inflammatory compounds which should be separated on the basis of activity-based
fractionation and isolation of compounds
Plants extracts should be administered through specific targeted drug delivery system
J regia and T gharuensis attenuated FCA induced arthritis by downregulating of pro-
inflammatory cytokines and upregulating of anti-inflammatory cytokine therefore
plants extracts may be effective in treatment of other inflammatory disorders such as
asthma ulcer gout and acute hepatitis etc
There is a need to further evaluate reproductive mutagenic teratogenic and toxicity
studies of J regia and T gharuensis extracts so as to determine their safe use in special
population groups such as animals of childbearing potential pregnant females and
neonates
Clinical studies are required to evaluate safety and efficacy of extracts on human
population
REFERENCES
1 Lequerre T Richez C Pathophysiology of rheumatoid arthritis La Revue du praticien
201262(8)1085-93
2 Arjumand S Shahzad M Shabbir A Yousaf MZ Thymoquinone attenuates
rheumatoid arthritis by downregulating TLR2 TLR4 TNF-α IL-1 and NFκB expression
levels Biomedicine amp Pharmacotherapy 2019111958-63
3 Deane KD Holers VM The natural history of rheumatoid arthritis Clinical
therapeutics 2019
4 Vasanthi P Nalini G Rajasekhar G Role of tumor necrosis factor‐alpha in rheumatoid
arthritis a review International Journal of Rheumatic Diseases 200710(4)270-4
5 Aziz RS Siddiqua A Shahzad M Shabbir A Naseem N Oxyresveratrol ameliorates
ethanol-induced gastric ulcer via downregulation of IL-6 TNF-α NF-ĸB and COX-2 levels
and upregulation of TFF-2 levels Biomedicine amp Pharmacotherapy 2019110554-60
6 Alten R Gram H Joosten LA van den Berg WB Sieper J Wassenberg S et al The
human anti-IL-1β monoclonal antibody ACZ885 is effective in joint inflammation models in
mice and in a proof-of-concept study in patients with rheumatoid arthritis Arthritis research amp
therapy 200810(3)R67
7 Choudhary M Kumar V Malhotra H Singh S Medicinal plants with potential anti-
arthritic activity Journal of intercultural ethnopharmacology 20154(2)147
8 McInnes IB Schett G The pathogenesis of rheumatoid arthritis New England Journal
of Medicine 2011365(23)2205-19
9 Kocyigit A Guler EM Kaleli S Anti-inflammatory and antioxidative properties of
honey bee venom on Freunds Complete Adjuvant-induced arthritis model in rats Toxicon
20191614-11
10 Akhtar G shabbir A Urginea indica attenuated rheumatoid arthritis and inflammatory
paw edema in diverse animal models of acute and chronic inflammation Journal of
Ethnopharmacology 2019
11 Diegelmann RF Evans MC Wound healing an overview of acute fibrotic and delayed
healing Front Biosci 20049(1)283-9
12 Shabbir A Batool SA Basheer MI Shahzad M Sultana K Tareen RB et al Ziziphora
clinopodioides ameliorated rheumatoid arthritis and inflammatory paw edema in different
models of acute and chronic inflammation Biomedicine amp Pharmacotherapy 2018971710-
21
13 Sostres C Gargallo CJ Arroyo MT Lanas A Adverse effects of non-steroidal anti-
inflammatory drugs (NSAIDs aspirin and coxibs) on upper gastrointestinal tract Best practice
amp research Clinical gastroenterology 201024(2)121-32
14 Fan A Lao L Zhang R Zhou A Wang L Moudgil K et al Effects of an acetone
extract of Boswellia carterii Birdw(Burseraceae) gum resin on adjuvant-induced arthritis in
lewis rats Journal of Ethnopharmacology 2005101(1-3)104-9
15 Guo Q Wang Y Xu D Nossent J Pavlos NJ Xu J Rheumatoid arthritis pathological
mechanisms and modern pharmacologic therapies Bone research 20186(1)15
16 Scheiman JM NSAID-induced Gastrointestinal Injury Journal of clinical
gastroenterology 201650(1)5-10
17 Oray M Abu Samra K Ebrahimiadib N Meese H Foster CS Long-term side effects
of glucocorticoids Expert opinion on drug safety 201615(4)457-65
18 Eldin SS Radwan M Wanas A Khan S Habib A Kassem F et al Phenolics And
Isoflavans From Trigonella Stellata And Their NF-Kb And Inos Inhibitory Activity Planta
Medica 201682(05)PC63
19 Haumluser W Petzke F Fitzcharles M Efficacy tolerability and safety of cannabis‐based
medicines for chronic pain managementndashAn overview of systematic reviews European Journal
of Pain 201822(3)455-70
20 Hu Y Woeste KE Zhao P Completion of the chloroplast genomes of five Chinese
Juglans and their contribution to chloroplast phylogeny Frontiers in plant science
201771955
21 Vieira V Prieto MA Barros L Coutinho JA Ferreira IC Ferreira O Enhanced
extraction of phenolic compounds using choline chloride based deep eutectic solvents from
Juglans regia L Industrial crops and products 2018115261-71
22 Delaviz H Mohammadi J Ghalamfarsa G Mohammadi B Farhadi N A review study
on phytochemistry and pharmacology applications of Juglans regia plant Pharmacognosy
reviews 201711(22)145
23 Papoutsi Z Kassi E Chinou I Halabalaki M Skaltsounis L Moutsatsou P Walnut
extract (Juglans regia L) and its component ellagic acid exhibit anti-inflammatory activity in
human aorta endothelial cells and osteoblastic activity in the cell line KS483 British Journal
of Nutrition 200899(4)715-22
24 Hosseini S Jamshidi L Mehrzadi S Mohammad K Najmizadeh AR Alimoradi H et
al Effects of Juglans regia L leaf extract on hyperglycemia and lipid profiles in type two
diabetic patients a randomized double-blind placebo-controlled clinical trial Journal of
Ethnopharmacology 2014152(3)451-6
25 Vieira V Pereira C Pires TC Calhelha RC Alves MJ Ferreira O et al Phenolic
profile antioxidant and antibacterial properties of Juglans regia L(walnut) leaves from the
Northeast of Portugal Industrial Crops and Products 2019134347-55
26 Ruijun W Shi W Yijun X Mengwuliji T Lijuan Z Yumin W Antitumor effects and
immune regulation activities of a purified polysaccharide extracted from Juglan regia
International journal of biological macromolecules 201572771-5
27 Silva-Mares D Rivas-Galindo VM Salazar-Aranda R Peacuterez-Lopez LA Waksman De
Torres N Peacuterez-Meseguer J et al Screening of north-east Mexico medicinal plants with
activities against herpes simplex virus and human cancer cell line Natural product research
201933(10)1531-4
28 Tareen R Qadir S Phytosociology of the hills of Quetta district Pak J Bot
199123(1)90-114
29 Martin E Akan H Ekici M Aytac Z New chromosome numbers in the genus
Trigonella L(Fabaceae) from Turkey African journal of Biotechnology 201110(2)116-25
30 Ranjbar M Hajmoradi Z Karamian R Cytogenetic study and pollen viability of four
populations of Trigonella spruneriana Boiss(Fabaceae) in Iran 2011
31 Nathiya S Durga M Devasena T Therapeutic role of Trigonella foenum-graecum
[Fenugreek]ndasha review Int J Pharmaceut Sci Rev Res 20142774-80
32 Bahmani M Shirzad H Mirhosseini M Mesripour A Rafieian-Kopaei M A review on
ethnobotanical and therapeutic uses of fenugreek (Trigonella foenum-graceum L) Journal of
evidence-based complementary amp alternative medicine 201621(1)53-62
33 Steinbrocker O Traeger CH Batterman RC Therapeutic criteria in rheumatoid
arthritis Journal of the American Medical Association 1949140(8)659-62
34 Cojocaru M Cojocaru IM Silosi I Vrabie CD Tanasescu R Extra-articular
manifestations in rheumatoid arthritis Maedica 20105(4)286
35 Alamanos Y Drosos AA Epidemiology of adult rheumatoid arthritis Autoimmunity
reviews 20054(3)130-6
36 Chen Z Bozec A Ramming A Schett G Anti-inflammatory and immune-regulatory
cytokines in rheumatoid arthritis Nature Reviews Rheumatology 201915(1)9-17
37 Choy E Understanding the dynamics pathways involved in the pathogenesis of
rheumatoid arthritis Rheumatology 201251(suppl_5)v3-v11
38 Hou Y-N Guo L-H Role of synovial fibroblasts in the pathogenesis of rheumatoid
arthritis Chinese Journal of Cell Biology 20092
39 Goldring S Pathogenesis of bone and cartilage destruction in rheumatoid arthritis
Rheumatology 200342(suppl_2)ii11-ii6
40 Bogoch E Gschwend N Bogoch B Rahn B Perren S Juxtaarticular bone loss in
experimental inflammatory arthritis Journal of orthopaedic research 19886(5)648-56
41 Bombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B et al
Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with
rheumatoid arthritis New England Journal of Medicine 2000343(21)1520-8
42 de Miranda A Juacutenior W da Silva Y Alexandre-Moreira M Castro R Sabino J et al
Design synthesis antinociceptive and anti-inflammatory activities of novel piroxicam
analogues Molecules 201217(12)14126-45
43 Simon LS Role and regulation of cyclooxygenase-2 during inflammation The
American journal of medicine 1999106(5)37S-42S
44 McCoy JM Wicks JR Audoly LP The role of prostaglandin E2 receptors in the
pathogenesis of rheumatoid arthritis The Journal of clinical investigation 2002110(5)651-8
45 Yan L Anderson GM DeWitte M Nakada MT Therapeutic potential of cytokine and
chemokine antagonists in cancer therapy European journal of cancer 200642(6)793-802
46 Haley PJ Species differences in the structure and function of the immune system
Toxicology 2003188(1)49-71
47 Permin H Skov PS Norn S Geisler A Klysner R Andersen V et al Possible role of
histamine in rheumatoid arthritis treatment with cimetidine and mepyramine Allergy
198136(6)435-6
48 Shajib M Khan W The role of serotonin and its receptors in activation of immune
responses and inflammation Acta physiologica 2015213(3)561-74
49 Kiernan J A study of chemically induced acute inflammation in the skin of the rat
Quarterly Journal of Experimental Physiology and Cognate Medical Sciences Translation and
Integration 197762(2)151-61
50 Al-Snafi AE Chemical constituents nutritional pharmacological and therapeutic
importance of Juglans regia-A review IOSR Journal of Pharmacy 20188(11)1-21
51 Balci I Balta F Kazankaya A Sen S Promising native walnut genotypes (Juglans regia
L) of the east black sea region of Turkey Journal of the American Pomological Society
200155(4)204
52 Ranjbar M Zahra H Chromosome numbers and biogeography of the genus Trigonella
(Fabaceae) Caryologia 201669(3)223-34
53 Hosseinzadeh H Zarei H Taghiabadi E Antinociceptive anti-inflammatory and acute
toxicity effects of Juglans regia L leaves in mice Iranian Red Crescent Medical Journal
201113(1)27
54 Sridhar N Lakshmi DS Goverdhan P Effect of ethanolic extracts of Justicia neesii
Ramam against experimental models of pain and pyrexia Indian journal of pharmacology
201547(2)177
55 Siddiqui WA Shahzad M Shabbir A Ahmad A Evaluation of anti-urolithiatic and
diuretic activities of watermelon (Citrullus lanatus) using in vivo and in vitro experiments
Biomed Pharmcother 20181212-21
56 Erdemoglu N Kuumlpeli E Yeşilada E Anti-inflammatory and antinociceptive activity
assessment of plants used as remedy in Turkish folk medicine Journal of Ethnopharmacology
200389(1)123-9
57 Suresh P Kavitha CN Babu SM Reddy VP Latha AK Effect of ethanol extract of
Trigonella foenum graecum (Fenugreek) seeds on Freunds adjuvant-induced arthritis in albino
rats Inflammation 201235(4)1314-21
58 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Discovery of New Benzothiazine
Derivative as Modulator of Pro-and Anti-inflammatory Cytokines in Rheumatoid Arthritis
Inflammation 201639(6)1918-29
59 Shabbir A Shahzad M Ali A Zia-ur-Rehman M Anti-arthritic activity of Nprime-[(2 4-
dihydroxyphenyl) methylidene]-2-(3 4-dimethyl-5 5-dioxidopyrazolo [4 3-c][1 2]
benzothiazin-1 (4H)-yl) acetohydrazide European journal of pharmacology 2014738263-72
60 Uttra AM Shahzad M Shabbir A Jahan S Ephedra gerardiana aqueous ethanolic
extract and fractions attenuate Freund Complete Adjuvant induced arthritis in Sprague Dawley
rats by downregulating PGE2 COX2 IL-1β IL-6 TNF-α NF-kB and upregulating IL-4 and
IL-10 Journal of Ethnopharmacology 2018
61 Shafi S Tabassum N Acute oral toxicity and hypoglycaemic study of ethanolic extract
of portulaca oleracea (whole plant) in swiss albino mice methods 201323(24)25
62 Uroos M Abbas Z Sattar S Umer N Shabbir A Sharif A Nyctanthes arbor-tristis
Ameliorated FCA-Induced Experimental Arthritis A Comparative Study among Different
Extracts Evidence-Based Complementary and Alternative Medicine 20172017
63 de Morais Oliveira-Tintino CD Pessoa RT Fernandes MNM Alcacircntara IS da Silva
BAF de Oliveira MRC et al Anti-inflammatory and anti-edematogenic action of the Croton
Campestris A St-Hil (Euphorbiaceae) essential oil and the compound β-caryophyllene in in
vivo models Phytomedicine 20184182-95
64 Awouters F Niemegeers C Lenaerts F Janssen P Delay of castor oil diarrhoea in rats
a new way to evaluate inhibitors of prostaglandin biosynthesis Journal of Pharmacy and
Pharmacology 197830(1)41-5
65 Shoba FG Thomas M Study of antidiarrhoeal activity of four medicinal plants in
castor-oil induced diarrhoea Journal of Ethnopharmacology 200176(1)73-6
66 Mobashar A Shabbir A Saees-ul- H Anti-inflammatory effects of Trigonella
gharuensis Comparative analysis in BALBC mouse model 201932(5)2287-93
67 Trease G Evans M Text book of Pharmacognosy 13th Edition Bailiere Tindall
London Toronto Tokyo Pgs 1989200-1
68 Raphael E Phytochemical constituents of some leaves extract of Aloe vera and
Azadirachta indica plant species Global Advanced Research Journal of Environmental Science
and Toxicology 20121(2)14-7
69 Verma J Verma R Sethi V Singh R Pharmacognostic study of Trigonella
foenumgraecum Int Jof Res and Development in Pharmacy and Life 2013708-15
70 Yadav R Agarwala M Phytochemical analysis of some medicinal plants Journal of
phytology 2011
71 Rakesh MR Ashok K Kumar SA Amitabh T Formulation of herbal shampoos from
Asparagus racemosus Acacia concin Sapindus mukorossi Int J Pharm Sci Rev Res
2010439-44
72 Edeoga HO Okwu D Mbaebie B Phytochemical constituents of some Nigerian
medicinal plants African journal of biotechnology 20054(7)685-8
73 Akaogi J Nozaki T Satoh M Yamada H Role of PGE2 and EP receptors in the
pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy Endocrine Metabolic
amp Immune Disorders-Drug Targets (Formerly Current Drug Targets-Immune Endocrine amp
Metabolic Disorders) 20066(4)383-94
74 Chang X He H Zhu L Gao J Wei T Ma Z et al Protective effect of apigenin on
Freundrsquos complete adjuvant-induced arthritis in rats via inhibiting P2X7NF-κB pathway
Chemico-biological interactions 201523641-6
75 Hwang S-Y Kim J-Y Kim K-W Park M-K Moon Y Kim W-U et al IL-17 induces
production of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF-κB-and PI3-
kinaseAkt-dependent pathways Arthritis Res Ther 20046(2)R120
76 Nishimoto N Hashimoto J Miyasaka N Yamamoto K Kawai S Takeuchi T et al
Study of active controlled monotherapy used for rheumatoid arthritis an IL-6 inhibitor
(SAMURAI) evidence of clinical and radiographic benefit from an x ray reader-blinded
randomised controlled trial of tocilizumab Annals of the rheumatic diseases 200766(9)1162-
7
77 Smeets T Barg E Kraan M Smith M Breedveld F Tak P Analysis of the cell infiltrate
and expression of proinflammatory cytokines and matrix metalloproteinases in arthroscopic
synovial biopsies comparison with synovial samples from patients with end stage destructive
rheumatoid arthritis Annals of the rheumatic diseases 200362(7)635-8
78 Wang J-H Shih K-S Liou J-P Wu Y-W Chang AS-Y Wang K-L et al Anti-arthritic
effects of magnolol in human interleukin 1β-stimulated fibroblast-like synoviocytes and in a
rat arthritis model PLoS One 20127(2)e31368
79 Zhang Q Yu Y Li J Guan Y Huang J Wang Z et al Anti-arthritic activities of ethanol
extracts of Circaea mollis Sieb amp Zucc(whole plant) in rodents Journal of
ethnopharmacology 2018225359-66
80 Aslam H Shahzad M Shabbir A Irshad S Immunomodulatory effect of thymoquinone
on atopic dermatitis Molecular immunology 2018101276-83
81 Lubberts E Joosten LA Chabaud M van den Bersselaar L Oppers B Coenen-de Roo
CJ et al IL-4 gene therapy for collagen arthritis suppresses synovial IL-17 and osteoprotegerin
ligand and prevents bone erosion The Journal of clinical investigation 2000105(12)1697-
710
82 Fraser D Thoen J Reseland J Foslashrre Oslash Kjeldsen-Kragh J Decreased CD4+
lymphocyte activation and increased interleukin-4 production in peripheral blood of
rheumatoid arthritis patients after acute starvation Clinical Rheumatology 199918(5)394-
401
83 Mabrok HB Mohamed MS Induction of COX-1 suppression of COX-2 and pro-
inflammatory cytokines gene expression by moringa leaves and its aqueous extract in aspirin-
induced gastric ulcer rats Molecular biology reports 201946(4)4213-24
84 Myers LK Kang AH Postlethwaite AE Rosloniec EF Morham SG Shlopov BV et
al The genetic ablation of cyclooxygenase 2 prevents the development of autoimmune arthritis
Arthritis amp Rheumatism 200043(12)2687-93
85 Woods JM Mogollon A Amin MA Martinez RJ Koch AE The role of COX-2 in
angiogenesis and rheumatoid arthritis Experimental and molecular pathology
200374(3)282-90
86 Brown KD Claudio E Siebenlist U The roles of the classical and alternative nuclear
factor-kappaB pathways potential implications for autoimmunity and rheumatoid arthritis
Arthritis research amp therapy 200810(4)212
87 Bagde S Biswas D A review on some selected traditional Indian medicinal plants of
immunomodulatory potential and their therapeutic use in rheumatoid arthritis Int J Pharm Sci
Res 201910(5)2087-100
88 Song S-NJ Iwahashi M Tomosugi N Uno K Yamana J Yamana S et al Comparative
evaluation of the effects of treatment with tocilizumab and TNF-α inhibitors on serum hepcidin
anemia response and disease activity in rheumatoid arthritis patients Arthritis research amp
therapy 201315(5)R141
89 Avau A Mitera T Put S Put K Brisse E Filtjens J et al Systemic juvenile idiopathic
arthritisndashlike syndrome in mice following stimulation of the immune system with Freunds
complete adjuvant regulation by interferon‐γ Arthritis amp rheumatology 201466(5)1340-51
90 Griffin GK Newton G Tarrio ML Bu D-x Maganto-Garcia E Azcutia V et al IL-17
and TNF-α sustain neutrophil recruitment during inflammation through synergistic effects on
endothelial activation The Journal of Immunology 20121200385
91 Safak S Uslu AU Serdal K Turker T Sonar S Lutfi A Association between mean
platelet volume levels and inflammation in SLE patients presented with arthritis African health
sciences 201414(4)919-24
92 Agbaje E Fageyinbo M Evaluating Anti-Inflammatory activity of aqueous root extract
of Strophanthus hispidus DC(Apocynaceae) International Journal of Applied Research in
Natural Products 20124(4)7-14
93 Morris CJ Carrageenan-induced paw edema in the rat and mouse Inflammation
protocols Springer 2003 p 115-21
94 Nabavi SF Ebrahimzadeh MA Nabavi SM Mahmoudi M Keyvani S Rad2
Biological activities of Juglans regia flowers
Brazilian Journal of Pharmacognosy
3(21)465-70
95 Sowemimo A Onakoya M Fageyinbo MS Fadoju T Studies on the anti-inflammatory
and anti-nociceptive properties of Blepharis maderaspatensis leaves Revista Brasileira de
Farmacognosia 201323(5)830-5
96 Suumlleyman H Buumlyuumlkokuroglu ME The effects of newly synthesized pyrazole
derivatives on formaldehyde- carrageenan- and dextran-induced acute paw edema in rats
Biological and Pharmaceutical Bulletin 200124(10)1133-6
97 Junping K Yun N Wang N Liang L Zhi-Hong H Analgesic and anti-inflammatory
activities of total extract and individual fractions of Chinese medicinal plants Polyrhachis
lamellidens Biol Pharm Bull 200528(1)176-80
98 D Guo LXu XCao Y Guo YYe C-OChan et al Antiinflammatory activities and
mechanisms of action of the petroleum ether fraction of Rosa multiflora Thunb hips J
Ethnopharmacol 2011138(3)717ndash22
99 A Rosa R Fantozzi The role of histamine in neurogenic inflammation Br J
Pharmacol 170(1)38ndash45
100 Chitme HR Chandra R Kaushik S Studies on anti-diarrhoeal activity of Calotropis
gigantea R Br in experimental animals J Pharm Pharm Sci 20047(1)70-5
101 Pierce NF Carpenter CC Elliott HL Greenough WB Effects of prostaglandins
theophylline and cholera exotoxin upon transmucosal water and electrolyte movement in the
canine jejunum Gastroenterology 197160(1)22-32
102 Carlo G Izzo A Maiolino P Mascolo N Viola P Diurno M et al Inhibition of
Intestinal Motility and Secretion by Flavonoids in Mice and Rats Structure‐activity
Relationships Journal of pharmacy and pharmacology 199345(12)1054-9
103 Dosso K Nrsquoguessan B Bidie A Gnangoran B Meacuteiteacute S Nrsquoguessan D et al
Antidiarrhoeal activity of an ethanol extract of the stem bark of Piliostigma reticulatum
(Caesalpiniaceae) in rats African Journal of Traditional Complementary and Alternative
Medicines 20129(2)242-9
104 Williams CA Hoult J Harborne JB Greenham J Eagles J A biologically active
lipophilic flavonol from Tanacetum parthenium Phytochemistry 199538(1)267-70
105 Middleton E Kandaswami C Theoharides TC The effects of plant flavonoids on
mammalian cells implications for inflammation heart disease and cancer Pharmacological
reviews 200052(4)673-751
106 Gnanavel V Saral AM GC-MS analysis of petroleum ether and ethanol leaf extracts
from Abrus precatorius Linn Int J Pharm Bio Sci 20134(3)8
107 Gnanavel V Saral AM GC-MS ANALYSIS OF PETROLEUM ETHER AND
ETHANOL LEAF EXTRACTS FROM ABRUS PRECATORIUS LINN 2013
108 Sermakkani M Thangapandian V GC-MS analysis of Cassia italica leaf methanol
extract Asian J Pharm Clin Res 20125(2)90-4
109 Kang JS Yoon YD Lee KH Park S-K Kim HM Costunolide inhibits interleukin-1β
expression by down-regulation of AP-1 and MAPK activity in LPS-stimulated RAW 2647
cells Biochemical and biophysical research communications 2004313(1)171-7
110 Al-Tameme HJ Hameed IH Idan SA Hadi MY Biochemical analysis of Origanum
vulgare seeds by fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-
mass spectrometry (GC-MS) Journal of Pharmacognosy and Phytotherapy 20157(9)221-37
111 Ezhilan BP Neelamegam R GC-MS analysis of phytocomponents in the ethanol
extract of Polygonum chinense L Pharmacognosy Research 20124(1)11
Top Related