7/30/2019 Dna Fp...Mahtab
1/24
MD.MAHTABM.Sc.
BIOTECHNOLOGY
7/30/2019 Dna Fp...Mahtab
2/24
Era of DNA Technology:Information through
DNA
The molecule is so beautiful. Its glory was reflected on Francis and me.
- James Watson on DNA
7/30/2019 Dna Fp...Mahtab
3/24
Biometricsuniquely recognizing humans
7/30/2019 Dna Fp...Mahtab
4/24
The blueprints (genetic information) formaking proteins is stored within our DNA. It is
the job of DNA to control the order in whichthese 20 different amino acids are put together.
The DNA of every human being on the planet is99.9% the same. It is the 0.1% that makes all
the difference!
Any type of organism can be identified byexamination of DNA sequences which is
unique to that species.
The molecule of life: DNA
7/30/2019 Dna Fp...Mahtab
5/24
Technology Transition
DNA Fingerprinting Dr. Alec Jeffrey 1985
DNA Profiling FBI (RFLP) 1988
PCR STRs 1993
Mitochondrial DNA - 1996
SNPs
Chips
7/30/2019 Dna Fp...Mahtab
6/24
YOUR DNA: Your Ultimate Genetic Bar Code
DNA Fingerprinting is a methodwhere:
a persons genetic traits, genes, are
used to make specific strings of DNA
letters that are cut into patterns ofshorter strings separated by length
these banding patterns canidentify a unique human being!
YOUR DNABandingPattern Will Identify
YOU! Image of a DNA fingerprint
7/30/2019 Dna Fp...Mahtab
7/24
7/30/2019 Dna Fp...Mahtab
8/24
Restriction Fragment Length
Polymorphism (RFLP)
Detects a single base pair change in DNA
Must occur within a restriction enzyme cleavage sequence to be
visible
It is the length differences associated with DNA strandsor RFLPs that allow one to distinguish one person fromanother
Often used in disease screening such as in the detection ofsickle cell anemia
7/30/2019 Dna Fp...Mahtab
9/24
RFLP
7/30/2019 Dna Fp...Mahtab
10/24
7/30/2019 Dna Fp...Mahtab
11/24
What creates this unique pattern?
Satellite DNA: repetitive DNA sequence.
Macrosatellite: core sequence 100 to 6500bp
Minisatellite: core sequence of 10-20bp repeatedmultiple times
Microsatellite: small arrays of tandem repeats of2 to 4bp in length
7/30/2019 Dna Fp...Mahtab
12/24
Repeats of Satellite DNA
Repeat units vary in length from 2bp to long stretches of6000bp or more
These repeat units are lined up head to tail and composesatellite DNA and are interspersed throughout the genome
The number of units varies person to person
Thus these sequences are calledVNTRs (variable numberof tandem repeats)
A VNTR is a locus that is hyper variable due to a largenumber of alleles each characterized by a differentnumber of repeat units
7/30/2019 Dna Fp...Mahtab
13/24
Southern blotting can be used to visualize the variation
Probes specific to the repeat unit are hybridized to DNAcut with a restriction enzyme that cuts just outside theVNTR
This allows for the difference in VNTR length to be
detected
Two commonly used probes are known as:
33.6 (AGGGCTGGAGG)18
31.5 (AGAGGTGGGCAGGTGG)29
These are multi-locus minisatellite probesand show about17 different DNA bands for each individual
7/30/2019 Dna Fp...Mahtab
14/24
PCR amplification of VNTR
PCR is particularly useful in forensic analysis as it allowsminute amounts of DNA to be analyzed
DNA can be obtained from blood stains, semen, saliva, orhair roots
Instead of digesting the DNA PCR is used to amplify theVNTRs and the products are run on a gel and visualized by
stainingThis process requires primers that anneal just outside theVNTR
7/30/2019 Dna Fp...Mahtab
15/24
7/30/2019 Dna Fp...Mahtab
16/24
7/30/2019 Dna Fp...Mahtab
17/24
Short Tandem Repeats (STR)
Are a variation on VNTRs, but use the smallest repeatsunits often only 2 to 4 bp in length
aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatgga
gt
tattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacg
aa
ctaacgatagatagatagatagatagatagatagatagatagatagatagatagacag
at
tgatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatt
tg
13 core loci of tetrameric repeats are tested together tomake a DNA profile
The sequence above is locus D7S280 which is located on
chromosome 7
7/30/2019 Dna Fp...Mahtab
18/24
7/30/2019 Dna Fp...Mahtab
19/24
CriminalIdentification &Forensics
DNA fingerprints can be usedas biological evidence
Strands of DNA can be foundon hair, blood or semen.
DNA isolated from thoseevidence can be comparedthrough VNTR patterns.
Useful in solving crimes likemurder and rape.
Example: The scandal ofPresident Clinton with MonicaLewinsky
http://rds.yahoo.com/S=96062857/K=Lewinsky+and+Clinton/v=2/TID=I001_0/SID=w/l=II/SS=i/OID=ed8d134fe00a0c5a/R=1/*-http://images.search.yahoo.com/search/images/view?back=http%3a//images.search.yahoo.com/search/images%3fsrch=1%26p=Lewinsky%2band%2bClinton%26ei=UTF-8%26n=20%26fl=0&h=121&w=150&imgcurl=www.washingtonpost.com/wp-srv/images/homepg2/clinton_lewinsky_montage.jpg&imgurl=www.washingtonpost.com/wp-srv/images/homepg2/clinton_lewinsky_montage.jpg&name=%3cb%3eclinton%3c/b%3e_%3cb%3elewinsky%3c/b%3e_montage.jpg&p=Lewinsky+and+Clinton&rurl=http%3a//www.washingtonpost.com/wp-srv/politics/special/clinton/faq.htm&rcurl=http%3a//www.washingtonpost.com/wp-srv/politics/special/clinton/faq.htm&type=jpeg&no=1&tt=137http://rds.yahoo.com/S=96062857/K=DNA+fingerprinting/v=2/TID=I001_0/SID=w/l=II/SS=i/OID=cd44fa1707c4864a/R=3/*-http://images.search.yahoo.com/search/images/view?back=http%3a//images.search.yahoo.com/search/images%3fp=DNA%2bfingerprinting%26ei=UTF-8%26cop=mss%26tab=3%26b=1&h=208&w=106&imgcurl=www.vetark.co.uk/Images/DNA%2520fingerprint.jpeg&imgurl=www.vetark.co.uk/Images/DNA%2520fingerprint.jpeg&name=%3cb%3eDNA%3c/b%3e+fingerprint.jpeg&p=DNA+fingerprinting&rurl=http%3a//www.vetark.co.uk/birdDNApages.html&rcurl=http%3a//www.vetark.co.uk/birdDNApages.html&type=jpeg&no=3&tt=364http://en.wikipedia.org/wiki/File:Codis.svg7/30/2019 Dna Fp...Mahtab
20/24
CODISCombined DNA Index
System
National software developed by the FBI
Distributed to local, state, and national crime labs
All 50 states mandate inclusion of DNA fingerprint (if available)from violent and sexually motivated crimes
Mostly a database of STR regions
Thousands of matches have led to the capture of criminals thatotherwise would not have been caught
This has led numerous people to suggest a national DNA database
that would include only polymorphism information
http://en.wikipedia.org/wiki/File:Codis.svg7/30/2019 Dna Fp...Mahtab
21/24
7/30/2019 Dna Fp...Mahtab
22/24
Parentage tests
determine if the alleged father of a child is
the biological father
The child (C) will share one band with thebiological mother (M) and one band with
alleged father #1 (AF1), the biological father.
No bands are shared between the child andalleged father #2 (AF2), the excluded male.
7/30/2019 Dna Fp...Mahtab
23/24
References DNA Fingerprinting Using Amplified Fragment Length Polymorphisms (RFLP)
By: Heidi Chial, Ph.D. (Write Science Right) 2008 Nature Education
Citation: Chial, H. (2008) DNA fingerprinting using amplified fragment length polymorphisms (AFLP): No genomesequence required. Nature Education1(1)
Forensics, DNA Fingerprinting, and CODIS
By: Karen Norrgard, Ph.D. (Write Science Right) 2008 Nature Education
Citation: Norrgard, K. (2008) Forensics, DNA fingerprinting, and CODIS. Nature Education1(1)
"CODIS National DNA Index System". Fbi.gov. Retrieved 2010-04-03.
Codis Statistics, 06/2008,
(http://www.fbi.gov/hq/lab/codis/clickmap.htm)
Kijkmagazine, 01 January 2009
Use of DNA in Identification". Accessexcellence.org. Retrieved 2010-04-03.
"Restrictions on use and destruction of fingerprints and samples". Wikicrimeline.co.uk. 2009-09-01. Retrieved 2010-04-03.
Lewinsky scandal", The Columbia Encyclopedia, Sixth Edition, 2008,As Retrieved 2010-02-09
John M. Butler, Forensic DNA Typing: Biology, Technology, and Genetics of STR Markers, Second Edition, Academic
Press, 2005.
DNA Fingerprint Analysis of Three Short Tandem Repeat (STR)
Loci for Biochemistry and Forensic Science Laboratory CoursesS
Received for publication, November 21, 2005, and in revised form, April 3, 2006 Kathleen McNamara-Schroeder,
Cheryl Olonan, Simon Chu, Maria C. Montoya, Mahta Alviri,
Shannon Ginty, and John J. Love
From the Department of Chemistry and Biochemistry, San Diego State University,
San Diego, California 92182-1030
http://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.accessexcellence.org/RC/AB/BA/Use_of_DNA_Identification.phphttp://www.wikicrimeline.co.uk/index.php?title=Identification_by_body_samples_and_impressionshttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.encyclopedia.com/topic/Lewinsky_scandal.aspxhttp://www.wikicrimeline.co.uk/index.php?title=Identification_by_body_samples_and_impressionshttp://www.accessexcellence.org/RC/AB/BA/Use_of_DNA_Identification.phphttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htmhttp://www.fbi.gov/hq/lab/codis/national.htm7/30/2019 Dna Fp...Mahtab
24/24
Top Related