CLONING, REGULATION, AND PROMOTER ANALYSIS OF THE cadA GENE IN DICTYOSTELIUM DISCOIDEUM
Chunzhong Yang
A thesis submitted in conformity with the requirements
for the Degree of Master of Science
Graduate Department of Biochemistry
University of Toronto
Q Copyright by Chunzhong Yang 1998
National Library mu of Cam& Biblbt h&que nationale du Canada
Acquisitions and Acquisitions et Biiliographic SeMces seMces bibliographiques 395 Wellington Street 395, nie WeiEngîori OtrawaûN KtAON4 ût?awaON K1AûN4 Canada Caneda
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sel1 copies of this thesis in microfom, paper or electronic formats.
The author retains ownership of the CG?-jmght in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/fii~n, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protege cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
In memory of my mother, Minghua Guo, who passed away during
my study not being able to see me in her last moment.
Cloning, Regulation, and Promoter Analysis of the cadA Gene
in Diclyostdiurn discoideum
Chunzhong Yang
Master of Science
Department of Biochernistry
University of Toronto
1998
ABSTRACT
The cadA gene encodes the Dictyostelium discoideum cell adhesion molecule DdCAD-1 which mediates ceIl-cell adhesion during the early stage of development. My earlier work showed that the cadA gene has a unique pattern of expression which is influenced by the prestawation factor (PSF), CAMP, and different growth conditions. These absenrations suggest the presence of both PSF and cAMP response elements in the promoter region of the cadA gene. To further characterize the details of cadA gene regulation, I have cloned the cadA gene. A total of -4 kb of genomic DNA, which contains the complete coding region, 2.5 kb of 5'-upstream sequence, and 400 bp of 3'-flanking sequence, was sequenced. cadA is a single copy gene. It contains two introns and has 3 major transcription initiation sites. A 631 bp 5' flanking sequence is sufficient to confer both cAMP and PSF responsiveness. Deletion analyses show that an 80 bp region of the promoter sequence is essential for CAMP- and PSF-responsive gene expression. Gel mobility shift assays show that this 80 bp region can shift a nuclear protein speclically. The amount of shifted protein increases when cells are treated with cAMP pulses. An 18 bp O-rich sequence (box2) within this 80 bp region also effectively shifts a nuclear protein. Mutation of the box2 sequence leads to a dramatic decrease in the arnount of bound nuclear protein. Efforts were also made to distinguish between the cAMP response and the PSF response element.
These few years of experience in Dr. Siu's lab has been very important to me. I leamed the differences in life and academic research between China and Canada. Step by step, I moved onto the way to be an independent and hard- working researcher, this will benefi me for my whoie life. I thank Dr. Siu, my supervisor, for his teaching, support, and trust in me to be capable of doing chalenging project through al1 these years.
l also want to thank my CO-supewisors, Dr. Segall and Dr. Sodek. Both of them have been very enthusiastic about my research and have provided lots of key advices to ensure that my project goes well and that I can have an excellent thesis upon my graduation. Especially during the last period of my writing, they have spent lots of time reading and correcting my thesis and taken their extra evening time to discuss with me. Their strict attitude towards science set a good example for me to follow in my future career.
People in the lab have been very helpful to me, I want to thank al1 of them, past and present. Tak Yee Lam has always been there for al1 the technical support. Also, I want to thank people in the Best lnstitute and Department of Biochemistry. It is those great seminars and discussions that always attract me to study harder and expand my knowledge.
My wife, Bin, and my son, Luke, have been accompanying me al1 these years. Without them, my life and research would be much harder. I owe my success to them.
iii
Abstract ...........................................s.......................................s............................... ii
.......................................................................................... Acùnowledgements iii
.............................................................................................. Table of Contents iv
List of Figures and Tables ....................................................e......................~.....e vi
........................................................... .................... List of Abbreviations .. .... x
Chapter 1 : INTRODUCTION ................................. ...................S......
A. The life cycle and cell type differentiation of Dictyostelium
................................................................... ........... ...... dbcddwrn ,,.... i.i
B. Cell adhesion systems of Oictyoste/ium ........................ ... ...... C. Dictyosfelium as a model system in genetic studies ...............
(1 ) Classical Genetics
(2) Molecular Genetics
D. Reg ulation of Dictyosfelium gene expression ....................... Expression patterns of different Dictyostelium genes
Dictyostelium genes utilize separate promoter elements to respond to
PSF, CAMP, and other signals during growth and at different
developmental stages
GBF and the regulation of late gene expression
Nuclear proteins responsible for cell type specific gene expression
Signaling pathways of CAMP regulation of early gene expression
Secreted factors that regulate gene expression
E . Compariron of transcriptional regulation by CAMP in
Dictyostelium and mammalian systems ............. ................... . 34
F . DdCAD-1 tunctions as a cell adhesion moleculo ............... 39
G . Objectives d thesir ......................................................................... 42
................................. Chapter 2: MATERIALS AND METHODS 44
CeII Strains and Culture Conditions ..................... .... ........ Culture of Transfectants .........................S....................................
................................................................. Southern Blot Analysir
Construction and Screening of Genomic Library ............ ............................................. Sepuencing of the cadA Gene
Mapplng of Transcription Start Sites of the cadA Gene ... Isolation of Nuclei ..........................................................................
Nuclear Run-on Assay ................................. ..... ........................... 1 . Gel Mobility Shift Assay .............................................................. J . RNA Blot Analyris ...........................................................................
........... K . Deletion Constructs and Subctoning Procedures
L . Transformation and Selection of Transformants .............. ......................... M . pGalactoddase Activlty Assay ... ........,..m.
Chapter 3: RESULTS .............................................................................. 62
A . Regulation of cadA Gene Expression During
O . discoideum Devdopment ................... .... ..........m............... 63
B . Molecular Cloning and Characterization of
WlClA ................... .I ........................................................... 65
C . Structural Features of the cadA Gene ........................... 66
D . Promoter Anrlysis of the cadA Gene ............................ .... 68
E . Binding of Specific Nuclear Factor($) to the Promoter
DNA of the cadA Gene ................................................................ 75
Chapter 4: DISCUSSION ............................ ............m.e...................... 114
A . Çeatures of the cadA Promoter Region ................................ 115
B . The PSF Responsive Elementr in Early Genes ............... 118
..... C . CAMP Response Elements in Early Gene Promoters 124
D . GE-rich Elements of Late Genes .......................................... 125
E . Perspectives .......................... ... ............................................... 129
REFERENCES .............................................. ..............m............ 131
Chapter 1 : INTRODUCTION
Fig. 1 .1. The life cycle and cell type differentiation of
Oictyostdium discoideum cells.
Fig. 1.2. Expression of the four different cell adhesion systems
du ring Dictyostelium development.
Fig. 1.3. Schematic drawing showing the expression pattern of
different stage-specific genes.
Table 1 .1 . Modular structure of Dictyostelium promoters
Fig. 1.4. Model for extracellular cAMP signaling pathway in
Dictyustelium.
Fig. 1.5. Signaling pathway of extracellular cAMP induced gene
reg u lat ion in Dictyostelium discoideum.
Fig. 1.6. Model for CAMP-inducible transcription in rnammalian
cells.
Fig. 1.7. Cornparison of the expression of cadA with early
genes and aggregation stage genes.
Chapter 2: MATERIALS AND METHODS
Table 2.1. Oligonucleotides used for cadA sequencing
vii
Chapter 3: RESULTS
Figure 3.1 . Effect of different growth conditions on cAMP
induction of cadA expression.
Figure 3.2. Effects of exogenous cAMP on the transcription rate
of the cadA gene.
Figure 3.3. Sequencing strategy and restriction map of the cadA
genomic DNA.
Figure 3.4. Nucleotide sequence of the cadA gene.
Figure 3.5. Mapping of the transcriptional start sites of the cadA
gene using primer extension.
Figure 3.6. Characteristics of the upstream region of the cadA
gene.
Figure 3.7. GC-rich elements present in the upstream sequence
of the cadA gene.
Figure 3.8. Construction of the plasmid DdGal(b31).
Figure 3.9. Expression of the repoiter gene of DdGal(-631) in
transfected cells.
Figure 3.1 0. P-Galactosidase activity in cells transfected with
different deletion constructs.
Figure 3.1 1. Expression levels of the reporter gene in vegetative
cells.
Figure 3.12. Effects of cAMP on lac2 expression in transfectants
containing different deletion constructs.
Figure 3.13. Features of the 80 bp sequence between -359 and
-280.
viii
Figure 3.14. Cloning strategy of the cadA CRE element.
Figure 3.1 5. fbgalactosidase activities of cells transfected with
constmcts containing the putative PSF elements.
Figure 3.16. Enzyme activities of cells transfected with
constructs containing the putative CR€ element.
Fig.3.17. Gel rnobility shift assays using cadA 5' fragments L and
S and cold S as cornpetitor.
Fig. 3.1 8. Gel shift assays using labeled probe S(-359 to -280)
and cold box2
Fig. 3.1 9. Gel mobility shift assay using [32P]-labeled box 2 DNA
as the probe.
Fig. 3.20. Effect of CAMP on the relative amount of DNA fragment
S shifted by nuclear factor.
Fig. 3.21. Gel shift assays using gP-labeled box1 as a probe.
Chaptei 4: DISCUSSION
Fig. 4.1. Comparison of PSF responsive elements in
Dictyostelium genes with putative PSF responsive elements
in the cadA gene.
Fig. 4.2. Sequences of DNA fragments that have PSF
responsiveness but lack a TTG box.
Fig. 4.3. Comparison of cadA elements with CR€ elements of
other genes.
Fig. 4.4. Cornpanson of G/C rich element sequences.
LIST OF ABBREVIATIONS
AC
ACA
ALC
ALF
BSA
cAMP
CAR
CBP
CMF
CP1
CP2
CPRG
CRAC
CRE
CREB
CREM
OCRE
DEPC
DIF
DNA
EDTA
EGTA
ERK
rsd
Ga2
adenylyl cyclase
adenylyl cyclase A
anterior-like cells
a-L-fucosidase
bovine serum albumin
adenosine 33'- monophosphate
cAMP receptor
CREB binding protein
conditioned medium factor
cysteine proteinase 1
cysteine proteinase 2
chlorophenolred-P-D-galactopyranoside
cytosolic regulator of adenylyl cyclase
cAMP response element
CRE-binding protein
CRE modulator
Dictyostelium cAMP response element
diet hy l pyrocarbonate
diff erentiation inducing factor
deoxyribonucleic acid
ethylenediamine tetra-acetic acid
ethylenebis(oxyethylene-nitrilo)tetra-acetic acid
extracellular regulated kinase
frigjd
G protein a2 subunit
GBY
GBF
GBRE
G4l8
GTP
gP
JAK
KID
Mb
MEK
MEKK
MOPS
NCAM
ONPG
PDE
PKA
PKA-Rm
PLC
PRE
PSF
PSK
PstA
Pst6
Pst0
RF LP
RNA
rRNA
G protein By subunit
G-box binding factor
G-box regulatov element
geneticin disulfate
guanosine triphosphate
glycoprotein
Janus kinase
kinase inducible domain
mega- (x IO6) base pairs
MAP kinase kinase
MEK kinase
3-(N-morpholino)propanesulfonic acid
neural cell adhesion molecute
O-nitrophenyl-b-D-galactopyranoside
phosphodiesterase
CAMP-dependent protein kinase
PKA regulatory subunit mutant
phospholipase C
PSF response element
prestarvation factor
plasmid pBluescript
prestalk A
prestalk B
prestalk O
restriction fragment length polymorphism
ribonucleic acid
ribosome RNA
SDS sodium dodecyl sulphate
SH2 Src homology domain II
SSC standard saline citrate
STAT signal transducer and activator of transcription
UDPG uridine diphosphoglucose
YAC yeast artificial chromosome
xii
Chapter 1
INTRODUCTION
A. The Life Cycle and Cell Type Differentiation of Dictyostelium discoideum
The cellular slime mold Dictyoste/lium discddeum has been widely used
as a model organism in the study of cellcell signaling and gene regulation. D.
discoideum has a simple and well-defined life cycle in which growth and
development are effectively independent (Fig. 1 .1A). As long as adequate
nutrients are available, cells exist as single, motile amoebae, which proliferate
by binary cell fission. Upon starvation, cells embark on a developmental
pathway which leads to intercellular adhesiveness and the formation of
multicellular aggregates (for reviews, see Loomis, 1975; 1982; Spudich, 1987;
Gross, 1 994; Firtel, 1 995).
Around 5 h of development, some cells begin to secrete CAMP. This
induces chernotactic migration of the surrounding cells, giving rise to multiple
aggregation centers. As the mound foms, specffic cell types are induced to
fom the precursors of cells found in the mature fniiting body. As the aggregates
become more compact, extracellular CAMP levels rise and the differentiated cell
types sort from one another to fom a spatial pattern, with the prestalk cells
moving to the tip of the mound (Williams et aL, 1 989; Esch and Firtel, 1 991 ;
Williams and Jennyn, 1991 ; Fiitel, 1995; Mutzel, 1995; Parent and Devreotes,
1996). The initial pattern of prestalk and prespore cells in the tipped aggregate
and the presence of anterior-like cells (ALCs) are shown in Fig. 1.1 B.
Eariy studies defined three major cell types in the migrating slug: (1)
prestalk cells, which are preferentially located in the antefior 15% of the slug,
and can be selectively stained by neutral r d , (2) prespore cells, which are
Fig. 1.1. The l ik cycle and cell type differentiation of
Dktyostelium discoideum cdls. (A) Life cycle (see text for details;
modified from Siu, 1990). (B) Upper left, the initial pattern of prestalk and
prespore cells in tipped aggregate and the presence of ALCs (small circles) in
the organism. Bottom left, the patterning of the cell types in the slug and the
movement and interconversion of prestalk and ALCs (Abe et al., 1994, for
details). Right, the localization of vanous cell types in the fruting body. (ALC),
derived from anterior like cells. The patterns of expression of marker genes in
the slug and fruiting body are shown inside the brackets (modified from Williams
et al, 1 993; Gross, 1 994; Fiitel, 1 995; Mann et a/., 1 997).
A The life cycle of Dictyostelium discoideum
Hours of devdopment
B Cell type differentiation during late developmental stages
m e Stalk Tub
(@cm& mm Tipped mound
ALC b p O r , PIU -0)
PmtM (ecmA. ocmb, m O )
Migrating rlug Late culminant
located in the posterior 75%, and (3) anterior-like cells (ALCs), a population of
cells (5-10%) scattered within the prespore region and which have some
properties of prestalk cells (Loornis, 1982; Stemfeld and David, 1982; Abe et al.,
1 994).
Recent studies using the lac2 reporter gene driven by the promoters of
cell type specific genes have led to the discovery of several subtypes of prestalk
cells (Fig. 1 1 ) Several classes of prestalk cells have been defined based on
the expression of the prestalk specific genes ecmA and ecmB (Williams et al.,
1993). Early studies showed that at the slug stage prestalk A (PstA) cells
express ecmA, prestalk 6 (PstB) cells and ALC cells express both ecmB and
ecmA, and prestalk O (PstO) cells express neither of these genes (Jemyn et al.,
1989; Williams et al., 1989). More recently, the ecmA gene has been shown to
be expressed in some of the ALCs and in al1 the cells in the prestalk region
(Gaskell et al., 1992). It is, however, more strongly expressed in the anterior
half of the prestalk region (PstA) than in the posterior half (PstO) (Jennyn et al.,
1989; Jemyn and Williams, 1991). Two separate regions within the ecmA
promoter are able to direct expression in<ependently within PstO cells, whereas f
a region proximal to the cap site is necessary for expression in PstA cells (Early
et al., 1993). As the slugs rnigrate, they leave some PstAB cells behind into the
slime trail. To maintain constant proportioning, some prespore cells
redifferentiate into ALCs which further differentiate into anterior prestalk cells.
Within the slugs, there is also movement and interconversion between the
prestalk and ALC cells (Stemfeld, 1992; Abe et al., 1994). The posterior -85%
of the slug expresses prespore-specific genes, such as sp60 (Haberstroh and
Firtel, 1990; Fosnaugh and Loomis, 1993; PowelCCoMnan and Firtel, 1994).
The pseudoplasrnodia or slugs are formed from the tipped mounds, and
they eventually culminate in the formation of fruiting bodies. In mature fruiting
body, a stalk of vacuolated cells derived from prestalk cells supports a spherical
mass of spores derived from prespore cells. The basal disc at the foot of the
stalk and the upper and lower cups (groups of cells which cradle the spore
head) are derived from the ALC cells (Fig. 1 .1 B; Williams et al., 1 993; Firtel,
1 995).
B. Cell Adhesion Systems of Dictyostelium
Multicellularity during Diclyostelium development is maintained by the
expression of cell adhesion molecules (CAMs). In addition to cellcell
adhesion, CAMs can influence signaling processes that regulate cell motility,
aggregate size, gene expression, and cell type differentiation. Cells acquire
two different types of adhesion systems in the early stages of development (for
reviews, see Gerisch, 1980; Siu, 1990; Bonaro and Ponte, 1995; Fontana,
1 995; Siu et al., 1 997).
The EDTAJEGTA-sensitive cell-cell adhesion sites, also known as contact
sites B, are acquired by cells soon after the initiation of development, during the
preaggregation stage (Ganod, 1 QiZ), while expression of the EDTA-resistant
cell-cell adhesion sites or contact sites A coincides with the aggregation stage
of development (Beug et al., 1973). DdCAD-1, a protein of Mr 24,000, mediates
EDTA-sensitive ceIl-cell adhesion by homophilic binding (Knecht et al., 1 987;
Brar and Siu, 1993; Wong et al., 1996). On the other hand, gp80, the contact
site A glycoprotein of Mi 80,000 (gp8O) (Muller and Gerisch, 1978; Brodie et al.,
1 983; Siu et al., 1 985; Noegel et al., 1986), which is encoded by the csaA gene,
mediates cell-cell adhesion by homophilic binding in a ~a2+-independent
mannei (Kam boj et a/., 1 988; 1 989). In postaggregation stages, another
glycoprotein of Mr 150,000 (gpl 50) replaces gp8O to mediate ~ a 2 + -
indepenaent ceiiceii adhesion (Geltosky et a/., 1979; Lam et al., 1981 : Gao et
al., 1992). Recently, another type of cell adhesion, the EDTA-sensitive1EGTA-
resistant cell adhesion mediated by contact sites C (csC), has been identified
(Fontana, 1993). These cell binding sites appear approximately two hours later
than the appearance of contact sites B. Fig. 1.2 summarizes the expression
patterns of the four types of adhesion systems discussed above.
Geneially, a protein mediates cell-cell adhesion by one of two different
mechanisms. Proteins, such as gp80, DdCAD-1, and NCAM mediate
homophilic binding (Kamboj, at al., 1988; 1 989; Brar and Siu, 1993; Rao et al.,
1992), and proteins, such as gp150 mediate heterophilic binding with other cell
surface receptors (Gao, et a/., 1992). In gp80, a stretch of eight amino acids
within the N-terminal globular domain interacts isologously with the same
region of an apposing molecule to mediate cell adhesion (Kamboj et al., 1989).
60th ionic interactions and hydrophobic interactions are proposed to be
involved in gp80 homophilic binding. Similarly, the neural cell adhesion
molecule NCAM utilizes a decapeptide sequence located in the third
immunoglobulin-like domain to mediate homophilic binding (Rao et a/., 1992).
The features of the protein DdCAD-1 will be discussed in Section Fe
O 5 10 15
Time (hr)
Figure 1.2. Expression of the four different cell adhesion
during Dicfyostelium development. The cuwes represent the temporal
expression of the EDTNEGTA-sensitive cell binding sites (e), the EDTA-
sensitivelEGTA-resistant ceIl binding sites (O), the aggregation-stage-specific
EDTA-resistant cell binding sites (A), and the postaggregation-stagespecific
EDTA-resistant cell binding sites (A). (This figure is adapted from Siu et al.,
1 997. For the assay methods, see Lam, el al., 1 981 ).
C. Dictyostelium discoideum as a Model System in Genetic Studies
Dictyoste/ium cells can be grown in large quantities and induced to
undergo synchronous development (Sussman, 1987). In addition, its haploid
genome is srnall, rnaking it amenable to genetic manipulation. It contains 6
chromosomes with a total of -34 Mb of DNA, a multicopy 90 kb
extrachromosomal element that canies the nbosomal RNA genes, and the 55.5
kb mitochondrial genome. Through mutagenic and genetic studies, the total
number of genes present in the genorne is estimated to be around 7000. High
resolution physical maps have recently been constructed for each of these
elements and efforts are underway to sequence the entire genome (for review,
see Parent and Devreotes, 1 996; Loomis and Kuspa, 1997).
(1 ) Classical Genetics
Dictyostelium is found growing in the soif as either haploid or diploid
cells. Heterothallic haploid Dictyostelium strains of opposite mating types will
fuse to form a sexual structure termed a macrocyst. The resulting diploids
engulf surrounding cells to form giant cells (Erdos et al., 1973; Saga and
Yanagisawa, 1 982). Çollowing meiotic divisions, segregant amoebae are
liberated and can grow. However, the frequency of suivival of segregants
generated from pairs of laboratory strains is so low that recombinational
mapping of markers has been impractical (Loomis, 1987). Therefore, other
approaches have to be used for genetic analysis.
When haploid cells are grown or developed together, a few of them fuse
to fomi stable diploids (Loomis, 1987). When populations of cells derived from
genetically dissimilar strains, each canying a recessive selectable marker, are
mixed, heterozygous diploids can be selected and propagated. Once formed,
diploids are quite stable and the developmental phenotype can be scored to
detemine whether a mutation is dominant or recessive to the wildtype allele.
Moreover, two independent mutant strains with identical phenotypes can be
crossed to determine whether or not the mutations complement each other.
When diploid strains are grown in the presence of microtubule destabilizing
agents such as benlate or thiabendazole, they will give rise to haploid progeny.
The resulting haploids can be selected and recognized since they re-express
the recessive phenotypes. Co-segregation of markers during this parasexual
cycle has been used to assign genes to six individual linkage groups (Loomis,
1 987; Newell et al., 1993).
Recently, over 200 genes have been mapped to the six chromosomes by
a combination of linkage to parasexually assigned loci and long range
restriction mapping using restriction fragment length polymorphisms (RFLPs)
generated from random plasrnid integrations along the chromosomes (Kuspa
and Loomis, 1994; Loomis et al., 1995). To increase the resolution of the
resulting physical maps and to provide whole genome coverage in cloned
fragments, a 5-fold redundant library of yeast artificial chromosome (YAC)
clones carrying large inserts of Dictyostellium genomic DNA was generated
(Kuspa et al., 1992). Long, contiguous arrays of overlapping YACs (contigs)
that span the chromosomes have been ordered by using probes that recognize
over 400 loci. These YAC clones together account for over 98% of the genome.
The cadA gene has been mapped to the 4th chromosome and the csaA gene to
the 3rd chromosome (Kuspa and Loomis, 1996; Loomis and Kuspa, 1997).
Over the past decade, powerful moleculai genetic techniques have been
developed to analyze gene function in Dictyostelium. Techniques are now
available to clone, manipulate, complement, and knock-out genes (Kimmel and
Firtel, 1 982; Kuspa and Loomis, 1 994; Loomis et al., 1 994; Kuspa et al., 1 995).
DNA can be introduced into the cells as calcium phosphate precipitates, by
lipofection or electroporation. Transformants that have incorporated a plasmid
vector carrying any one of several dominant selectable genes such as
neomycin resistance (G418R), hygromycin resistance (hygR), blasticidin S
resistance (BsR), or uracil independence (pyfi-6) can then be selected with the
appropriate drugs or media (Manstein et al., 1989; Egelhoff et al., 1989; Adachi
et al., 1994; Kuspa and Loomis, 1994). Reporter genes that mark specific cells
can be integrated into the genome of both wildtype and mutant strains. The
most convenient reporter has been E. coli /3=galactosidase, although
chloramphenicol acetyltransferase, luciferase, and @glucuronidase have also
been used (Early et al., 1988; Jemyn et al., 1989; Haberstroh and Firtel, 1990;
Desbarats et a/., 1992; Fosnaugh and Loomis, 1993). For instance, when lac2
is driven by the promoter/enhancer region of a prespore gene such as cot8, /3=
galactosidase accumulates specifically in prespore cells (Fosnaugh and
Loomis, 1993). Likewise when lac2 is driven by the promoter/enhancer region
of a prestalk gene such as ta@, pgalactosidase accumulates specifically in
prestalk cells (Shaulsky and Loomis, 1996). Strains harboring such reporter
constructs have proven invaluable in the analysis of cell-type propoitioning and
morphogenesis. Also, by placing the gene encoding a cell surface protein
under the control of a cell type-specific promoter and immunologically labeling
the living cells, cell movement within the slug has been analyzed (Abe et al.,
1994). With the establishment of the green fluorescent protein as a fluorescent
in vivo marker (Chalfie et al., 1994), it is now possible to observe protein
movement in a Dictyostelium cell in real time (Hanakam et al., 1 996).
Recently, two powerful methods have been widely used to identify and
analyze the functions of Dictyostelium genes.
(a) Non-homoloaous aene disruption for gene ta-: The Restriction
Enzyme Mediated lntegration (REMI) method significantly increases the
efficiency of transformation. In this method, integrating plasmids are introduced
into cells along with a restriction enzyme (Kuspa and Loomis, 1992). The
restriction enzyme enters the nucleus and facilitates integration at the cognate
restriction sites in the chromosomes. The randomly integ rated plasmid may
inactivate some developmental genes that are dispensable for growth but
important for development. By selecting the required phenotype, many
developrnental genes have been uncovered. Genes of interest can be rapidly
cloned from such mutants by cutting their genomic DNA with a restriction
enzyme which does not cut within the plasmid. Once these genes have been
cloned, their functions and the regulation of their expression can be studied.
Two recent successful examples are the cloning of the cell fate gene stalky
(Chang elal., 1996) and the gene c u d (culmination defective) that leads to the
"slugger" mutant phenotype (Fukuzawa et al., 1997).
(b) ~omologous recombinatior\: Using available sequences, high
frequency homologous recombination makes it very convenient to target genes
in Dictyoste/ium. This technique has allowed the analysis of many different
genes involved in patterning, motility, cell adhesion, signaling, and
differentiation in Dictyostelium. The csaA gene encoding the cell adhesion
molecule gp8O and the gene encoding G-box binding factor (GBF) were
disrupted this way (Hadoff et al., 1989; Schnitzler et al., 1994). Also, by use of
the cadA genomic sequence for homologous recombination, the gene encoding
the cell adhesion molecule DdCAD-1 has been successfully knocked out in our
lab and the phenotype of the cadA nuIl cells is being characterized (Wong et al.,
manuscript in preparation).
O. Regulat ion of Dictyostelium Gene Expression
(1 ) Expression Patterns of Diff erent Dictyor telium Genes
Many Dictyostdium genes have been cloned and characterized. Some
of them are specifically expressed at different stages of cell growth and
development. Based on their developmental expression patterns and
regulation by different factors, these genes can be broadly divided into several
classes (Fig. 1.3; for reviews, see Gerisch, 1987; Firtel et al., 1 989; Firtel, 1 991 ;
Gross, 1 994). lmmediately after starvation, expression of growth phase specif ic
genes decreases and the early developmental genes are transcribed, including
the genes encoding discoidin-1, a-mannosidase, phosphodiesterase (PDE)
inhibitor, and a class of genes called the I genes. These genes are induced by
amino acid deprivation, and secreted factors such as prestawation factor (PSF)
and conditioned medium factor (CMF). Their expression is usually transient
and is repressed by nM levels of CAMP (Alton and Lodish, 1977; Blumberg and
Lodish, 1 980; Cardelli et al., 1 985; Franke et al., 1 991 ).
nM CAMP pM CAMP
starvat ion
eady genes specific genes
spore & W k - specific genes Y-
Fig. 1.3. Schematic drawing showing the expression patterns of
different stage-specitic genw. Early developmental genes are induced
right at the beginning of development and repressed by nM cAMP during the
first few hours of development. Aggregation stage genes are induced by nM
cAMP pulses during the preaggregation and aggregation stages and repressed
by pM cAMP later on. High concentration of cAMP (PM) induce the expression
of prespore- and prestalk genes, while DIF induces the expression of cell type
specific-genes du ring the culmination stage. +, and - represent induction and
repression of transcription, respectively (modified from Firtel, 1995).
Transcripts corresponding to a second class of genes, the aggregation
stage genes, begin to accumulate -4 hr into starvation, including trancripts for
genes encoding cAMP receptors, PDE, gp80, and Ga2. Pulses of cAMP at nM
concentrations accelerate the expression of these genes, whereas constant
levels of cAMP in the FM range repress their expression (with the exception of
the PD€ gene) (Kumagai et al., 1989 ; Faure et al., 1 990; Desbarats, et a/.,
1 992; Louis et al., 1 993).
During later aggregation, a third class of genes, prespore- and prestalk-
specific-genes are expressed. Prespore- and prestalk-specific gene expression
starts as early as 8-10 h, around the aggregate or tipped aggregate stages, and
peaks by the slug and culmination stages, between 18 h and 24 h of
development (Eariy and Williams, 1989; Haberstroh and Fiitel, 1990; Fosnaugh
and Loornis, 1991). Prestalk-specific genes are expressed preferentially in the
anterior prestalk region. They are induced by both nM pulses and pM
continuous concentrations of cAMP but do not require cell-cell contact and other
factors. These genes include those coding for cysteine protease (CP2), one of
the proto-oncogenes (Ddras), and some genes with unknown function (Pears
and Williams, 1987; Hjorth et a/., 1989; Esch et al., 1992).
After the formation of aggregates, expression of aggregation stage genes
declines. Spore- and stalk-specific and nonspecific genes are expressed.
Accumulation of the rnRNAs of most of these genes such as sp60, sp70, and
pspS, ceases when the aggregates are disrupted but can be restored by the
addition of high (PM) amounts of CAMP, suggesting that cell-cell contact and
cAMP are involved in the regulation of their transcription. These genes may
require additional signals that are present only at tight-aggregate or
tipped-aggregate stages. Later du ring development, a few spore-specific
genes are expressed. Their expression is not responsive to extracellular cAMP
or secreted factors (Fosnaugh and Loomis, 1989a; b; 1991 ; Haberstroh and
Firtel; 1 990; PowellCofhnan and Firtel, 1 994). The stalk-specific genes ecmA
and ecmB, and other stalk-specific genes are expressed at the onset of
culmination. The morphogen DIF induces the expression of most of these
genes (Williams et al., 1987; Ceccarelli et al., 1987). Other factors such as
ammonia and adenosine are also involved in the regulation of these genes.
DIF, CAMP, adenosine, and amrnonia have been found to be antagonistic to
each other (Loomis, 1993; Yin et al., 1994). Spatial variations in extracellular
levels of these factors have been hypothesized to control pattern formation in
D. discodeum.
(2) Dictyostelium Gener Utilize Separate Promoter Elements to
Respond to PSF, cAMP and Othei Signala During Growth and at
Diff erent Developmental Stages
Promoter analysis has led to the identification of different &acting
elements that respond to different environmental and autocrine factors (Table
1 .1). For example, the expression of the discoidin-l genes is regulated by the
conceited action of the extracellular factors CAMP, folate, PSF, and CMF (Vauti
et a/., 1 990). In bacterially grown cells, discoidin-l induction occurs in two
sequential steps. The first is a low basal induction which occurs in late log-
phase growth prior to starvation. PSF can induce the basal level,
independently of Ga2. The developmental induction following starvation is
rnuch stronger and is dependent on Ga2 and probably by CMF, which is
secreted at that time (Blush et al., 1995). Also, different pathways are used for
Tabk 1.1 : Modular rbuctums of DictyosteIium promoters
Glycogen phoaphory- lase gene
Two separate promoter regions; one region mediates developmental induction of the discoidin gene and anothei region is responsible for down regulation of the discoidin gene by CAMP (Vauti et al., 1990).
Two separable, overiapplng promoten responsible for the transcription of L and S mRNAs encoding the same protein. The L promoter controls stress induction and expression in vegetative cells, while the S promoter controls expression in devekpment (Maniak and Nellen. 1990).
Eariy promoter for maximal expression at 5h, induced by nM CAMP, repressed by pM CAMP. Late promoter for maximal expression at 10h. induced by pM CAMP. Different splicing of the gene. encoding the same protein (Louis et al., 1 993).
-
Three separate promoter regions for 3 dlfferent sizes of mRNA encoding the same protein. A 1.9 kb transcript specific for vegetative growth , a 2.4 kb transcript spedfic for aggregation stage, and a 2.2 kb transcript specific for late development that is expressed only in prestalk cells (Podgonki et al. 1989; Faure et al., 1 990).
Two independent promoter regions regulate the expression of 3 different transcripts, L, SI, and S2 (Louvkn et al., 1991).
Separate elements able to iespond to CAMP, DIF-1, and direct expression in different sub-types of prestalk cells (Ceccarelli et a/., 1 991 ; Eariy et al., 1993; Harwood et al., 1 993).
This gene contains separate elements responsive to CAMP eariy in development and DIF-1 later on (Yin et aL. 1994).
the down-regulation and induction of these genes. cAMP receptor (CARI) is
required for the CAMP-mediated down-regulation of discoidin-l but not for the
induction of discoidin-l expression during development (Blush et al., 1995).
a) CAMP-responsive elements
In the case of the carA gene (encoding CAR1 ), different promoter
elements respond to different extracellular cAMP levels. CAR1 is the receptor
responsible for the nM cAMP induction of gene expression during eariy
developrnent and is itself induced by cAMP pulses. The 2.0 kb CARl early
transcript is expressed upon starvation (Saxe et al., 1 991 ; Louis et al., 1993).
However, in response to increased concentrations of cAMP as development
progresses, the early promoter is repressed and the level of the eariy 2.0 kb
mRNA decreases. Coordinately, there is an induction mediated by the late
promoter for the expression of the 2.2 kb CARI transcript. This later transcript is
detected at the mound stage and persists throughout developrnent (Louis et al.,
1993). Thus, white pulses of nM cAMP induce the CARI eariy promoter and
promote chemotactic response and cell agg regat ion, a continuous higher cAMP
concentration in the resulting mound leads to the replacement of the CARl
early transcript by the late message forrn.
The carA early cAMP response element has been identified and has
been shown to function in a heterologous, minimal promoter. An -40 kDa
nuclear factor is expressed during early development that fonns ~n2+-
dependent nucleoprotein complexes with the early carA promoter (Rogers et al.,
1997). These cis- and tran~~activation elements may defrie the molecular basis
for the developmental regulation of eady gene expression by CAMP.
18
b) Prestanration factor (PSF)-responsive genes
Dunng vegetative growth in liquid medium, cells secrete PSF which
stimulates the expression of several genes during mid- to late-log growth
ptese. Production of PSF declines at the onset of starvation (Rathi and Clarke,
1992). However, certain of the genes initially induced by PSF are expressed at
even higher levels during early development. For example, the cAMP receptor
CAR1 and the aggregation-specific fonn of cyclic nucleotide phosphodiesterase
(the 2.4-kb PD€ transcript), are expressed at low levels during late exponential
growth in response to PSF, and then at higher levels in stawing cells,
stimulated at hast in part by cAMP pulses (Saxe et al., 1991). Thus, the low
level of expression induced by PSF may render the cells minirnally comptent
for cAMP signaling, such that, upon starvation, a positive feedback loop can be
set in motion by cAMP (Burdine and Clarke, 1995).
c) Differentiation inducing factor (DIF)-responsive genes
The expression of many late genes is influenced by DIF. The promoters
of several DIF responsive genes are atso modular (Table 1 A). For example,
the cAMP phosphodiesterase gene has a promoter elernent conferring cAMP
responsiveness during aggregation and a later prestalk-specific element that is
DIF-responsive (Podgorski et a/., 1 989; Ranke et al., 1 991 ). The ecmA and
ecmB promoters utilire separate elements to respond to CAMP, DIF-1, and
direct expression in different sub-types of prestalk cells (Ceccarelli et al., 1 991 ;
Eariy el a/., 1 993; Hannrood et al., 1993). A G-box binding factor (GBF)-binding
O-box in the -8 promoter affects the expression level, but not cell type
specificity, of ecmB (Ceccarelli et al., 1993). The transcription rates of these two
genes are increased shortly after the addition of DIF (Williams et a/., 1987;
Ceccarelli et a/., 1 987).
DdrasD is a prestalk-specific gene (Reymond et al., 1984). Interestingly,
this gene uses three 5' elements to produce 3 transcripts (Esch and Firtel, 1991 ;
Louvion et al., 1991 ; Esch et al., 1992). All three mRNAs are induced by CAMP,
but, contrary to ecmA and ecm8, DdrasD is not induced by DIF. Deletion
analysis of the DdrasD promoter region revealed a region essential for CAMP-
induction that contains 2 copies of a CA-flch sequence similar to those found in
the spore coat gene cotC (Esch et al., 1992).
(3) O-box binding factor (GBF) and the Regulation of Late Gene
Expression
After starvation, in response to pulsatile cAMP signals, cells start to
aggregate. As the mound forms, there is a concomitant rise in the levels of
extracellular cAMP from nM to pM levels. This increase in cAMP concentration
is accompanied by adaptation of the high affinity cAMP recepton. This initiates
a developrnental switch in which the aggregation-stage pathways are inhibited
and postaggregation gene expression and morphogenesis are initiated
(Schaap and Van Driel, 1 985; Schaap et al., 1 986; Firtel, 1 995). High levels of
cAMP and other signals in the aggregate activate the expression of a variety of
genes involved in later deveioprnent and cellular morphogenesis (for review,
see Kimmel and Firtel, 1 991 ; Williams, 1 991 ). Promoter analysis of
postaggregation and prestalk and prespore-specific genes identified a cornmon
regulatory element, designated a G-box, that contains two GT/CA-rich domains
and interacts with a DNA binding factor, the G-box binding factor (GBF) (Datta
and Firtel, 1988; Pears and Williams, 1988; Haberstroh and Firtel, 1990; Hjorth
et al., 1989; 1990). These GT/CA-rich G-box sequences have been shown to
be essential for late gene activation during development or in response to
CAMP. O-boxes have been found in the promoter regions of the cotC
(Haberstroh and Firtel, 1990; Haberstroh et al., 1 991 ), cotB (Fosnaugh and
Loomis, 1 993), coM (Tasaka et al., 1 WZ), PspS (PowelbCoffman and Firtel,
1 994, ecm8 ( Ceccarelli et al., 1 991 ; 1 992), ecmA (Early et al., 1 993), CP2
(Datta and Firtel, 1988), UDPGP (Pavlovic et al,. 1989), and DdrasD genes
(Esch et a/., 1 992).
Cell type specific gene expression only begins after cells have entered
the aggregates and have started to differentiate into prespore or prestalk cells.
Three genes, coM, cotB, and cotC, which encode the spore coat proteins,
SP96, SP70 and SP60, respectively, have been well characterized (Fosnaugh
and Loomis, 1989a; b; 1991 ; Haberstroh and Firtel, 1990). The three genes are
regulated coordinately and are induced by pM CAMP. Three CA-rich elements
(CAEs) were shown to be essential for proper developmental, cell type specific,
and spatial expression of the cotC gene (Haberstroh and Firtel, 1990). CA-rich
regions, similar to the CAEs of the cotC gene, also exist in the cotA and cotB
genes, and in another prespore-specific gene Dl9 (Early and Williams, 1989;
Fosnaugh and Loomis, 1993). A 20 bp sequence within a CA-rich region of the
cofA gene binds specifically to a developmentally regulated nuclear protein
(Tasaka et al., 1 992).
A G-box binding factor (GBF) has been purified by using cotC CAE-1
affinity chromatography and its gene has been cloned (Schnitzler et al., 1994).
GBF is a developmentally regulated Diclyostelium transcription factor. Its afinity
for a DNA sequence cornlates with the ability of that sequence to confer pM
cAMP inducibility to late gene promoters (Schnitzler et al., 1994). GBF is a
highly basic protein, it contains two Cysq zinc-finger domains, similar to those of
the glucocorticoid rsceptor. Disruption of the GBF gene by homologous
recombination leads to the loss of al1 GBF DNA-binding activity. The mutant
cells anest at the loose aggregate stage, and the induction of late gene during
development or in response to extracellular cAMP is lost. Interestingly,
although late gene expression is blocked in the gbfl mutant, induction of
aggregation-stage gene expression that is mediated by nM cAMP pulses is
normal, suggesting that separate signaling pathways control aggregation and
post-aggregation gene expression. Although GBF seems to be a major
component that functions as the final nuclear effector of pM cAMP responses,
other promoter elements may be required to work in concert with G-boxes for
cell-type specific gene expression (Powell-Coffrnan and Firtel, 1994; Schnitzler
et al., 1994). Current studies with the CAR3 promoter elements suggest that
indeed other elements are necessary for prestalk regulation, but the GBF
element alone is sufficient for prespore expression, suggesting that GBF may
also have primary function in the control of cell-type specific gene expression
(Gollop and Kimmel, 1997).
In cells constitutively expressing GBF, postaggregation genes can be
induced prematurely in response to a high level of cAMP (Schnitzier et al.,
1994; 1995), suggesting that al1 of the cellular components needed for
activation of GBF-responsive genes are already present in vegetative cells.
Analysis of mutations in cAMP receptor-mediated signaling pathways, including
CARS, G proteins, protein kinase A (PM), and ERK2 has been perfomed to
determine the cornponents required for GBF activation (Gaskins et al., 1996;
Schnitzler et al., 1995; Brown et a/., 1997). Although cAMP receptors are
required for induction of gene expression mediateci by GBF, the induction of
GBF target genes is still obsenred in strains lacking Ga2 or Gp, which are
known to couple to CARS and mediate downstream events (Fig. 1.4.).
Therefore, GBF-mediated induction of gene expression is receptor-mediated
but G protein independent. In contrast, aggregation gene expression induced
by nM cAMP is Ga2 dependent. Therefore, independent signaling pathways
are used for aggregation and post-aggregation development, and different
transcription factors other than GBF must be responsible for aggregation gene
expression. On the other hand, since al1 the other cellular components needed
for GBF functioning already exist in vegetative and eady development cells, it
may be very convenient for the two signaling pathways to crosstalk by sharing
some of these components.
(4) Nuclear Proteins Responsible for CeII Type Specific Geno
Exprewion
Nuclear proteins that seem to be responsible for cell type-specific late
gene expression have been reported recently. By the REMI method, based on
the specific mutant phenotype, the gene stalky , that is responsible for the stalky
phenotype (Morrissey and Loomis, 1981) was isolated (Chang et a/., 1996).
stalky encodes a 99 kDa protein (STKA) that has two putative C4 zinc fingers
and is localised in the nucleus. It is strongly expressed in the prespore region
of aggregates but not in the anterior prestalk zone. In stalky mutant cells, the
expression of the terminal spore differentiation marker SPA is completely
blocked. All the cells usually destined to becorne spores switch into the stalk
pathway at culmination, so that the resuîting fruiting bodies are abnomally
elongated structures consisting entirely of stalk cells.
The gene cudA (culmination deficient), which is responsible for the
'slugger' mutant phenotype, has also been isolated (Fukuzawa et al., 1997).
This gene is expresseci by both prespore and prestalk cells, and it also encodes
a nuclear protein. The cudA- mutant is defective in prespore gene expression
and fails to make spore cells, suggesting that the cudA gene product rnay
function as a transcriptional regulator. However, there is no recognizable DNA
binding domain in the protein. Therefore, if the nucleai protein is a
transcriptional regulator, it may either contain a novel structure for DNA binding
or it may function by interacting with other transcription factors.
Cell specif ic gene expression du ring late differentiation stages is
controlled by cornplex pathways. Besides nuclear factors, other intermediate
signaling components are also important. For example, rZlP (Balint-Kurti et al.,
1997), a RING-leucine zipper protein, contains multiple domains that may be
involved in cornplex interactions with other proteins of several regulatory
pathways to determine cell fate. It contains a RING (zinc-binding) dornain, a
leucine zipper, a glutamine repeat, an SH3-binding region, and a concensus
MAP kinase phosphorylation site. This protein can positively regulate prestalk-
specific gene expression as well as decrease prespore-specific gene
expression. Thus rZlP induces prestalk differentiation and inhibits prespore
differentiation (Balint-Kurti et al., 1 997).
(5) The Signaling Pathways by Which cAMP Regulater Expression
of Early Genes
Gprotein-coupled cell-surface receptors have been irnplicated in diverse
and critical transduction pathways that regulate eukaryotic cell function,
differentiation, and gene regulation. These serpentine receptors are
responsible for effecting responses to many extracellular signals, including
peptide hormones, neurotransmitten, pherornones, environmental cues, and
morphogens (Dohlman et al., 1991 ; PeBmon, 1996). In Dictyostelium,
development is also regulated by serpentine, G protein-linked receptors that
bind the primasr extracellular morphogenic signal CAMP. cAMP plays essential
rotes throughout Dictyostelium development to regulate diverse pathways such
as cell motility, aggregation, differentiation, pattern formation and cell type-
specific gene expression (Ginsburg et al., 1 995). Extracellular cAMP pulses
regulate early gene expression by transiently activating the cell surface cAMP
receptor CAR1 (Mann and Firtel 1987). There are four cAMP receptor subtypes,
termed CAR1 4 (Kuspa et al., 1992; Ginsburg et al., 1 995). CARI (encoded by
the gene carA) has high affinity for cAMP and is expressed immediately upon
development. CARI accounts for more than 90% of al1 CAMP-binding activity
during cell aggregation. It is responsible for the nM cAMP induction of gene
expression during early development and is itself induced by cAMP pulses
(Sun et al., 1990; Sun and Devreotes, 1991 ; Van Haastert, 1997). The Ga2
subunit is directly coupled to CAR1 at the aggregation stage and is required for
CAMP-mediated responses (Kumagai et al., 1 991 ). Upon cAMP stimulation,
Ga2 becomes transiently phosphorylated on a serine residue (Gundenen and
Devreotes, 1990). The fgdA mutants that express a defective Gu2 do not
aggregate, show no chemotaxis, and do not respond to extracellular cAMP
(Coukell et al,, 1983; Kumagai et al,, 1989). The paradigm for G-protein
functioning is that the activated receptor induces the exchange of GDP to GTP
in the a& complex leading to the dissociation of the complex into a-GTP and
&y, both of which may transduce the signal to the effector (Van Haastert, 1997).
However, the pathways required for the activation of adenylyl cyclase (ACA) in
Dictyostelium are far more complex (Fig.l.4). The direct activation of ACA in
vivo in response to cAMP stimulation or in vitro in response to GTPyS requires
the Gpy subunl and a cytosolic regulator of adenylyl cyclase (CRAC). ln vivo
stimulation also requires a MAP kinase, ERK2 (Extracecullar Regulated
Kinase). In wildtype cells, cAMP produced through the activation of ACA can
activate PKA. In ACA-nuIl cells (no intracellular CAMP), moderate expression of
the PKA catalytic subunit leads to near-normal development, suggesting that al1
intracellular cAMP signaling is effected through PKA (Wang and Kuspa, 1997).
Constitutive expression of the PKA catalytic subunit bypasses the requirement
for ERK2 for aggregation and late development, indicating that PKA lies
downstream from ERK2 and that ERK2 may mediate downstream responses by
modulating ?KA function (Insall et al*, 1994; Lilly et al*, 1993; Lilly and
Devreotes, 1994; 1995; Segall et al., 1995). Recent results show that nM cAMP
induces tyrosine phosphoiylation of ERK2. The tyrosine-phosphorylation status
of ERK2 induced by extracellular cAMP is closely conelated with the PKA
activw of different cell strains, suggesting that the phosphorylation of ERK2 is
positively modulated by a PKA-regulated step (Kosaka and Pears, 1997).
Although eight different Ga subunits have been identified, Dictyosteliium
cells contain only a single Gfbsubunit, which shows a high similarity at the
amino acid level with Gp-subunits from other organisms (Lilly et al., 1 993).
Fig. 1.4. Model for extracellular cAMP signaling pathways in
DictyosteIium. Extracellular cAMP binds to the cell surface cAMP receptor
CARI which interacts with the heterotrimeric G protein containing Ga2. cAMP
binding leads to the dissociation of Ga2 from G&y. Gpyand CRAC are required
in vivo for cAMP stimulation of adenylyl cyclase A (ACA). In wildtype cells,
cAMP produced through the activation of adenylyl cyclase activates PKA. ERK2
is presumed to be activated through a classic MAP kinase cascade as is
indicated by the MAP kinase kinase (MEK) and the MEK kinase (MEKK) in the
pathway . ERK2 is required for CAMP-st imulated activation of adenylyl cyclase.
CRAC is required for the proper adaptation of ERK2. PKA lies downstream from
ERK2 and ERK2 may mediate downstream responses by modulating PKA
function. The tyrosine-phosphovlation status of ERK2 induced by extracellular
cAMP is positively modulated by a PKA-regulated step (Modified frorn Aubry et
al., 1997; Kosaka and Pears, 1 997 ).
CAMP
I downstream response
Deletion of the gene encoding Gp-subunit blocks signal transduction via al1
heterotrimenc G-proteins. gfl - nuIl cells fail to migrate to any chemoattractant
and tack the activation of adenylyl and guanylyl cyclases by both cAMP and
folic acid (Wu et al*, 1 995). Cells do not aggregate and cAMP pulses have no
effect in these cells. Mutation studies indicate that in vivo G e is essential for
activation of the adenylyl cyclase ACA (Kesbeke et al., 1 988). Inactivation of the
ACA gene leads to the impairment of cell aggregation (Pitt et al., 1992). Cells
still show chemotaxis towards cAMP and extracellular addition of cAMP leads to
the expression of many CAMP-induced genes as well as to the formation of
small fruiting bodies (Reymond et al., 1995). These results suggest that the
main function of ACA is to generate cAMP as a Crst messenger (Van Haastert,
1 997).
The role of the CRAC protein is emerging. It has a pleckstrin homology
domain suggesting that it may transduce signals via protein-protein interaction
(Insall et al., 1994; Lilly and Devreotes, 1994; 1995). In response to receptor
activation, CRAC translocates to the plasma membrane. It is possible that
CRAC forms a sensory bridge between the receptor-activated Gwcomplex and
ACA. Recently, ERK2 has been implicated in the signal transduction pathway
between CARl and ACA (Segall et a/., 1995; Aubry e l al., 1997; Kosaka and
Pears, 1997; Maeda and Firtel, 1997). It is activated by extracellular cAMP via
CARl in a G-protein-independent pathway (Knetsch et al., 1996; Maeda et al.,
1996; Maeda, 1997). The major part of the cAMP produced by ACA during cell
aggregation is secreted into the medium where it diffuses and activates
neighboring cells. During cell aggregation, intracellular cAMP probably does
not play a pronounced role in chemotaxis and eariy development, because the
effects of deletion of genes required for al1 adenylyl cyclase activity can be
rescued by extracellular cAMP pulses (Pitt et al., 1993). Unexpectedly, mutants
of the catalytic or regulatory subunit of PKA reveal that this enzyme is essential
throughout development (Mann and Firtel, 1991 ; Mann et al., 1997 ). The
observations that intracellular cAMP is not essential suggest that PKA may be
activated by CAMP-independent mechanisms (Reymond et al., 1995; Schulkes
and Schaap, 1995; Van Haastert, 1997). Binding of cAMP to Gproteintoupled
receptors leads to the activation of second messenger pathways, including the
activation of adenylyl cyclase, guanylyl cyclase, phospholipase C, and the
opening of plasma membrane ~ a 2 + channels. Other second messenger
systems may exist in Diclyosteliium and remain to be discovered. It is difficult to
constnict one scheme starting from the receptor and ending at the different
effector enzymes. Nevertheless, the mechanisms of how these second
messenger systems are activated are emerging. We know that the activation of
al1 messenger enzymes depends on surface receptors. The only second
messenger response that does not absolutely depend on O-proteins is ~ a * +
uptake. Activation of adenylyl cyclase, guanylyl cyclase and phospholipase C
all depends on G-proteins (Van Haastert, 1995; 1997).
(6) Secreted Factors that Regulate Gene Expression
Cell density is known to coordinate gene expression during
Dictyostelium development. Throughout growth, the cells secrete an autocrine
factor that accumulates in proportion to cell density (Clarke et al., 1987, 1988).
This prestarvation factor (PSF) regulates the expression of genes involved in
aggregation, such as discoidin-1, CARI, lysosomal protein a-mannosidase, and
cell adhesion molecule DdCAD-1 (Schahle et al., 1991; 1992; 1993; Clarke et
al., 1992). PSF does not mach high enough concentrations to activate these
genes until cells are four generations from exiting the exponential growth phase
(Clarke et al., 1 987). Once the cells begin staiving, secretion of PSF declines
rapidly (Rathi et al., 1991). In addition, PSF activity is inhibited by the presence
of bacteria, so that its activity can be modulated by food supplies (Clarke et al.,
1987). Therefore, PSF acts as a factor for regutating aggregation by monitoring
the ratio of cell density to food density in actively growing cells.
Conditioned medium factor (CMF) is an 80-kDa glycoprotein secreted by
starved cells to monitor the local cell density during early development (Yuen et
al., 1 991 ). Gomer et al. (1 991 ) reported that cells secrete CMF at a relatively
constant rate of 12 molecules/celVminute during the first 20 hours of
development but not during vegetative growth. The CMF cDNA sequence
indicates that the CMF polypeptide has a unique sequence with a relative
molecular mass of 62.6 kDa (Jain et al., 1992). The active site of CMF lies in an
88 amino acid region near the N-terminus that binds to a developrnentally
regulated cell surface CMF receptor (Jain and Gomer, 1994). Scatchard plots
indicate that there is only one class of CMF receptor in developing cells (Jain
and Gomer, 1994). Although CMF can induce the expression of discoidin-l in
starved cells, it is distinct from PSF (Clarke et al., 1992, Clarke and Gomer,
1995). Experiments with antibody against CMF indicated that CMF is present in
al1 Dictyostellium cells and is secreted only upon starvation (Jain et al., 1 997).
At the aggregation stage, when CMF induces the expression of eariy genes
such as discoidin-1, pulses of cAMP mediate both chemotaxis and the
expression of a number of other early developmentally regulated genes. Using
CMF antisense transfonnants, Yuen et al. (1995) found that CMÇ controls cAMP
signal transduction at a step after cAMP receptoi and G protein interaction but
before adenylyl cyclase activation. Transformants that overexpress CAR1 show
an increase of both cAMP binding and CMF, whereas disruption of the CARl
gene abolishes both CAMP- and CMF-binding (Van Haastert et a/., 1996). In
cells lacking GB, cAMP induces a loss of CAMP-binding but not CMF-binding,
whereas CMF induces a reduction of CMF-binding without affecting CAMP-
binding, suggesting that CMF and cAMP bind to different receptors and that the
linkage of the CMF receptor and CARl is through a G protein (Jain et al, 1997).
Another factor regulating gene expression is DIF, a chlorinated
hexaphenone produced by devekping Dictyostelium cells. In a monolayer
assay, it can divert cells from prespore differentiation and cause them to
become stalk cells. At least 5 activities have been resolved by HPLC from the
conditioned medium of developing cells. DlFs 1 , 2 and 3 are closely related
chlorinated alkyl phenones, and DIF-1 accounts for more than 95% of al1 the
detectable bioactivities of DIF mixtures (Kay , 1 997). DIF-1 induces transcription
of individual prestalk genes and suppresses transcription of prespore genes
(Williams et al., 1 987; Early and Williams, 1 988).
The mechanisms of DIF-1 functioning are unclear. Since DIF-1 partitions
into hexane, it is expected to cross cellular membranes unaided. A binding
protein that could act as a cytoplasmic receptor of DIF-1 has been detected
(Insall and Kay, 1990). Within 15 min of the addition of DIF, the transcription
rate of the ecmA gene is elevated. The accumulation of the ecmA mRNA is
insensitive to pre-treatment with a protein synthesis inhibitor (Williams, et a/.,
1 987; Williams, 1 997), suggesting that a pre-existing signaling pathway that
induces transcription of the ecmA gene is activated by DIF. Since the ecmA and
ecmB genes can be rapidly switched on by DIF-1, their promoters must contain
the ultimate target sequence for DIF-1 responsa Extensive promoter mapping
has namwed down the response element to a direct repeat of lTGA (Earfy et
a/., 1993; Kawata et al., 1996). A similar sequence, but with the repeats
inverted, is present in the ecmB prornoter, but it represses high-level
expression of ecmB until culmination (Harwood el al, 1993). 60th sequences
appear to be targets for the same protein in band-shift assays and this protein
appears when cells become DIF-responsive (Kawata et al., 1996). Purification
of the DNA-binding protein and cloning of its gene have revealed that it is a
putative mernber of the STAT (Signal Transducer and Activator of Transcription)
family of t ranscriptional activators. In other organisms, STATs are reg ulated by
a Janus kinase (JAK) and mediate cytokine function in mamrnalian cells
(Kawata et al., 1997; Williams, 1997).
Different nuclear proteins are utilized to regulate gene expression in
response to different extracellular signals. So far only the genes for the nuclear
factors responsible for late gene expression have b e n cloned. Unlike early
gene regulation, GBF (O-box binding factor) mediates late gene regulation in a
G-protein independent pathway (Firtel, 1995; Schnitzler et al., 1995). Current
studies suggest that a -40 kDa nuclear factor forms ~n2+-dependent
nucleoprotein complexes with the early promoter of the gene carA (Rogers et
a/., 1997). Mutagenesis and deletion analyses of the CAR1 late promoter
indicate that the general developmental transcription factor GBF controls both
the transcription and cell-type specificity of the carA gene (Gollop and Kimmel,
1997). These cis- and tramactivation elements may define the molecular basis
for both early and late developmental regulation by CAMP and other signals
such as PSF, DIF.
E. Comparison of Transcriptional Regulation by cAMP in Dictyostelium and Mammalian Systems
Although G-protein-coupled-receptor-mediated signaling pathways are
utilized by Dicfyostelium and other organisms, the use of cell surface cAMP
receptors to initiate signal transduction in response to extracellular cAMP is
unique to Dictyostelium. In Dictyoste/ium, cAMP is mainly used as the first
messenger that functions outside of the cell. Although intracellular cAMP is
involved in the PKA activation procedures, it may not be involved in the
regulation of transcription. As described previously, extracellular cAMP binds to
a specific receptor (CAR) coupled to G-proteins which stimulate adenylyl
cyclase (ACA) via CRAC. The extracellular level of cAMP is lowered by a
phosphodiesterase (PD€). In contrast to the mammalian PKA which consists of
two regulatory (R) and two catalytic (C) subunits, the Dictyostelium PKA is
composed of a single R and a single C subunit (De Gunzburg et al., 1984).
Binding of cAMP to the R-subunit dissociates the holaenzyme, liberating the
active C-subunit(Fig. 1.5).
PKA is essential during aggregation and it also plays a central role in the
differentiation of stalk and spore cells (Mann and Firtel, 1 991 ; Mann et al.,
1997). However, many aspects of the role of PKA in development remain
unsolved. At present, 1 is not clear which substrates are phosphorylated by
PKA in Dictyostelium. No CR€ binding protein (CREB) or CR€ modulator
(CREM) equivalent has been isolated from Dictyostelium up to now (for
reviews, see: Lalli and SassoneCorsi, 1993; Sassone-Corsi, 1994; Montminy,
1997). A possible target, however, is GBF. It has recently been shown that GBF
activity is greatly reduced in psA-Rm (PKA regulatory subunit mutant) cells,
suggesting that OBF is either a direct target or that 1 is a downstream target of a
kinase cascade involving PKA (Reymond et al., 1995). Furthemore, it is not
clear how PKA becomes activated. The Dictyostelium adenylyl cyclase might
be expected to provide cAMP for PKA activation. However, although cells
lacking ACA are unable to aggregate autonomously, extracellular cAMP
stimulation can induce them to develop into mature spores and stalk cells. It
therefore appears that ACA is either not the only upstream activator of PKA or
that it may not be involved in intracellular cAMP production. lt is possible that
intracellular cAMP is produced by a currently unknown adenylyl cyclase or,
altematively, PKA could be activated in a CAMP-independent manner
(Reymond et a/., 1995).
In mammalian cells (Fig. 1.6), ligands such as hormones, growth factors
or neurotransmitters stimulate target cells via second rnessenger pathways that
in tum regulate the phosphorylation of specific nuclear factors, leading to
changes in gene expression (for reviews, see Lalli and Sassone-Corsi, 1994;
Sassone-Corsi, 1994; Montminy, 1997). cAMP is a key second messenger and
stimulates target gene expression via a consenred cAMP response element
(CRE), which consists of an eight-base pair palindrome (TGACGTCA) and is
typically found within 100 nucleotides of the TATA box (Comb et al., 1986;
Montminy et al., 1986). Upon the binding of specific receptors to their ligands,
the membrane-associated enzyme adenylyl cyclase (AC) is activated via
coupling with GTP-binding protein, leading to an increased intracellular cAMP
level. CAMP, in tum, binds cooperatively to two sites on the regulatory subunit
of PKA, releasing the active catalybic subunit. The catalytic subunit is then
translocated from its cytoplasmic and Golgi complex anchoring sites into the
nucleus where it phosphorylates its substrat0 CREB. A cDNA encoding CREB
was first cloned from rat cells (Montminy and Bileziknian, 1987) and then in
human cells (Hoeffler et al., 1 988). Now a few subfamilies of CR€-binding
nuclear factors have been characterized. They al1 belong to the bZip
transcription factor class. bZip proteins contain a conserved basic region in the
DNA binding domain and a leucine zipper at the C-teminal region, which is
involveci in protein dimerkation. The phospholylation site of CREB resides in
the kinase inducible dornain (KID). CREB also has two glutaminerich domains
(QI and 02). Q2 appears to stimulate transcription via its association with a
component of the TFllD fraction temed TAF110 (Gill et a/., 1994; Ferreri et al,
1994). CREB binds to a coactivator CBP (CREB binding protein) via the
phosphorylated KID domain. CBP interacts directly wiai the basal transcription
factor TF I ID, resulting in the activation of transcription of CRE-containing genes
(Kee et al., 1996; Kwok et al, 1994; Hagiwara et al., 1993).
I I +
Phospholipase C /.
I CR€ TATA eaily genes G-box TATA late genes
Fig. 1.5. Signaling pathwayo of extracellulai CAMP-induced gene regulation in Dicfyostelium discoideum. Extracellular cAMP binds to a specific receptor (CAR) which is coupled to O-proteins that can stimulate adenylyl cyclase (ACA) via CRAC. The extracellular cAMP is lowered by a phosphodiesterase (PDE). The Dicfyostelium PKA is composed of a single regulatory (R) and a single catalytic (C) subunit. Binding of cAMP to the R-subunit dissociates the holoenzyme, liberating the active C-subunit. At present, it is not clear which substrates are phosphotylated by PKA in Dictyostelium. A possible target is GBF. Resent resutts suggest that it is either a direct target or that it lies at the end of a kinase cascade involving PKA (modified from Reymond et al., 1995).
O 0 ligands
cAMP
POL II
CR€ TATA
Fig. 1.6. Model for CAMP-inducible transcription in mamrnalian cells. Ligands bind to their cell surface receptors which, through the trimeric G- proteins, activate adenylyl cyclase (AC). This leads to an increase in intracellular cAMP which activates PKA. The PKA catalytic subunit enters the nucleus and phosphorylates a CR€-binding protein (CREB) at Sert 33. CREB stimulates transcription of CAMP-responsive genes via constitutive and inducible domains that function synergistically in response to PKA induction. Glutamine-rich constitutive activation domains in CREB (Q) stimulate transcription via interaction with TAF110, a cornponent of the TÇllD fraction. The KID region is phosphorylated. The phospo-serine binds directly to CBP. CBP mediates transcriptional induction via its association with the RNA polymerase II complex (modified from Sassone-Corsi, 1994; Montminy, 1997).
F. DdCAD-1 Functions as a Cell Adhesion Molecule
Dictyostelium discoidem cells express EDTA-sensitive cellcell
adhesion sites soon after development starts (Garrod, 1972). A protein of M
24,000 (gp24) has been implicated in the mediation of EDTA-sensitive
intercellular cohesiveness (Knecht et al., 1 987). In the last decade, extensive
efforts have been made to characterite this type of cell adhesion. The
successful purification of gp24 allowed a highly specific ant iserum to be raised
against the protein (Bar and Siu, 1993). lmmunoscreening of a Dictyostelium
Lgtl 1 expression library with this antibody led to the cloning of the cONA
encoding the gp24 protein (Wong et al., 1 996). Because this protein is a Ca2+-
binding protein and its cell-binding activity is sensitive to both EDTA and EGTA
(Brar and Siu, 1993), the protein was renamed the D.discoideum Ca2+-
dependent cell adhesion molecule-1 or DdCAD-1. DdCAD-1 shows sequence
similarity with members of the cadherin family of cell adhesion molecules
(Wong, et a/., 1996). A Ca2+-binding motif is present in the carboxyl-terminal
region. CeIl-binding activity is dependent on the amino-terminal region. Ca2+-
binding results in changes of the conformation of the protein (Brar and Siu,
1993). This conformational change may play a regulatory role for the cell
binding activity of DdCAD-1.
Regulation of the expression of the gene cadA which encodes DdCAD-1
has been studied (Yang et a/., 1997). Although bacterially grown vegetative
cells accumulate a low level of cadA mRNA, development leads to a rapid
increase of the mRNA level which peaks at 6 h of development. When cell
cohesion was monitored, a rapid increase in the EDTA-sensitive cell cohesion
was observed during the first 4 h of development and maximal cohesion was
reached between 4 and 6 h. Thus, there is a close temporal correlation in the
eariy phase of development between the accumulation of DdCAD-1 and the
appearance of EDTA-sensitive cell adhesion sites (Yang et al., 1 997). Both
cAMP and PSF âra involved in the regulation of cadA expression. It is the first
reported eariy gene whose expression is induced by both cAMP pulses and
PSF in Dictyostelium. As summarized in Fig. 1.7, the cadA gene has a unique
pattern of expression, which displays features of both early genes and
aggregation stage genes. Rapid accumulation of both cadA transcripts and
DdCAD-1 occurs in the preaggregation period, characteristic of early genes.
However, the expression of cadA extends beyond the aggregation stage and a
high level of transcripts persists ir, the postaggregation stages. Similar to other
aggregation stage genes, cadA expression is enhanced by cAMP pulses but
repressed by a constant high level of cAMP (Fig. 1.7).
nM CAMP pM CAMP
aggregation genes starvat ion
O 4 8 12 16 20 24
Hours of development
Fig. 1.7. Cornparison of the expression of cadA with early genes
and aggregation stage genes. Early developmental genes are induced
right at the beginning of development and repressed by nM cAMP during the
first few hours of development. Aggregation stage genes are induced by nM
cAMP pulses during the preaggregation and aggregation stages and repressed
by pM cAMP later on. In contrast, cadA gene has a unique pattern of
expression showing a combination of the early and aggregation stage genes.
Pattern of cadA expression is based on the Northem blot result with bacterially
grown KAX3 cells (Yang et al., 1997). +, and - representing induction and
repression of transcflption, respectively.
G. Objectives of Thesis
Developmental regulation of gene expression has been the subject of
extensive investigations in ment years. De discoideum is a relatively simple
organisrn ideal for the study of these processes. Upon starvation, the
developmental procedures starts and cells begin to express adhesion
molecules that help them to form aggregates. Different types of adhesion
molecules are expressed during different stages of developrnent. DMCAD-1 is
the earliest expressed adhesion molecule which is involved in the recruitment
of cells into the aggregates. Before the start of my MSc. program, I studied the
expression patterns of the cadA gene (encoding DdCAD-1) during growth and
development. The cadA gene has a unique pattern of expression, which
displays features of both early genes and aggregation stage genes. A few
factors such as CAMP, PSF, and different growth conditions are involved in the
regulation of cadA expression. Similar to other early genes, bacterially grown
cells express the cadA gene irnmediately after development starts. In axenically
grown cells, cadA is activated by PSF at mid-exponential growth. In contrast to
other early genes which are generally repressed by cAMP pulses, cadA
transcription is stimulated by nM cAMP pulses, but repressed by a constant high
level of CAMP. This is the first early gene found to be up-regulated by both PSF
and CAMP pulses in Dictyostelium. Thus, study of the regulatory mechanisms of
the cadA gene expression is of interest.
My earîier observations suggest that the cadA gene contains regulatory
elements that are responsive to PSF and cAMP pulses. To test this hypothesis,
I decided to identify these &acting DNA elements in the c a d gene. Work
described in this thesis includes (1) cloning and sequencing of the cad4 gene,
(2) characterization of the promoter region of this gene using deletion
constructs, (3) gel mobility shift assays to demonstrate that the DNA element
can specifically bind nuclear protein(s), and (4) deletion constructs and
heterologous constnids to identify elements responsible for cAMP and PSF
responsiveness. I have inserted putative response elements of the cadA gene
into the almost inert (wîth respect to cAMP or PSF responsiveness) environment
of a heterologous promoter, and the responsiveness of the chimeric genes to
cAMP or PSF was tested.
Chapter 2
MATERIALS AND METHODS
A. CeII Strains and Culture Conditions
During the course of my studies, I used two strains of cells, NC4 and KAX3.
KAX3, but not NC4, can be grown axenically. The wildtype strain NC4 was
cultured on agar plates in association with Klebsiella aerogenes as the food
source. For development in liquid medium, cells were suspended at 2 x I O 7
cellshl in 17 mM Na21K phosphate buffer (pH 6.4), and cultures were shaken at
180 rpm at room temperature (23OC). For development on filters, 1 O8 cells were
plated on a 4.25-cm diameter Whatman no. 50 filter (Sussman, 1987). The fgdA
mutant strain HC85 (Coukell et al., 1983) was cultured and developed as
described for NC4 cells. The axenic strain KAX3 was cultured either in
association with bacteria or in HL-5 axenic medium (Sussman, 1987).
Axenically grown KAX3 cells were collected at 2-3 x IO6 celldml, washed free of
medium, and development was carried out either in liquid medium or on filter
pad. To examine the effects of CAMP, cells were pulsed with CAMP at a final
concentration of 2 x 10gM at 7-min intervals, beginning at 2 h of development.
B. Culture of Transfectants
For the culture of transfectants, cells were grown in tissue culture dishes
in the presence of 6418. Cells were collected from confluent dishes. For
axenic growth, cells were transfered to flasks and grown with HL5 in the
presence of G418. For bacterial growth, cells were spun down at 500 x g for 3
min, rnixed with bacteria, and plated on SM agar plates. Axenically grown
transfectants were collected at a concentration of -5 x IO6 celldml, while
badenally grown cells were collected after 48 h when the plates were paitially
cleared.
C. Southern Blot Analysis
(1) Genomic DNA preparation: Bacterially grown KAX3 cells (log
cells) were collected and bacteria were removed by differential centrifugation.
Cells were reswpended at 2 x 10' cells/ml in 17 mM Na2lK phosphate buffer
(pH 6.4) and developed for 3 h. Cells were collected and washed once with 50
ml of TBS (0.2M NaCI, 2.5 mM KCI, 25 mM Tris-HCI, pH 7.4). Cells were
resuspended in 5 ml of TE (10 mM Tris-HCI, pH 7.4, 1 mM EDTA). Thirty ml of
extraction buffer (10 mM Tris-HCI, pH 8.0,O.l M EDTA, pH 8.0,20 pg/ml
pancreatic RNAase, 0.5% SDS) was added and the cells were incubated for 1
h at 3PC. Proteinase K (20 mglml in H,O) was added (50 pl) and the mixture
was incubated overnight at 37%. Next day, saturated NaCl (30 ml) was added
and the sample was spun at 3,000 rpm for 20 min in a Sorvall SS34 rotor at 4
OC. The supernatant was collected and 2 volumes of absolute ethanol was
added at room temperature. The sample was gently mixed and spun at 10,000
rpm for 15 min in a Sonrall SS34 rotor at room temperature. The DNA-
containing pellet was washed with 75% ethanol, air dried and dissolved in -1
ml TE and stored at -20°C and used foi Southern Mot analysis. Axenically
grown KAX3 cells were used to extract DNA in the same way as described for
genomic DNA library construction.
(2) Digestion and blotting of genomic DNA: Genomic DNA was
dissolved in TE at 4 pg/ml. To cut with EcoRI, the reaction mixture contained 5
pl DNA (20 pg), 16 pl one-phor-al1 buffer (Pharmacia), EcoRl lOOU and H,O
was added to a final volume of 80 pl. The control sample contained 2 pl DNA,
78 pl H20. Samples were incubated at 3PC for 3-5 h. Samples were
separated in a 1 % agarose gel using a vertical gel set (BRL). Gel
electrophoresis was carried out in TBE at 1OOV for -5 h until bromophenol blue
in the sample reached the bottom. The gel was stained in TB€ containing 0.5
pg/ml ethidiurn bromide for 15 min with gentle shaking. Gels were placed on a
UV box and pictures were taken. The agarose gel was denatured with 0.5 M
NaOH, 1 .5 M NaCl for 1 h, tinsed with H,O briefly, and neutralized with 1 M
Tris-HCI (pH 8.0), 1 .S M NaCl for 1 h. The gel was then blotted on to
nitrocellulose membrane ovemight with 10X SSC. Next day, the filter was
soaked in 2X SSC and nnsed in 6X SSC for 5 min. After the filter was dried at
room temperature, it was baked at 80°C for 2 h under vacuum. Filters could be
kept indefinitely at this stage.
(3) DNA-DNA Hybridization: Before prehybridization, the filter was
first immersed in 6X SSC for 2 min, and then put into a sealed bag.
Prehybridization solution (100 pVcmZ of filter) was added and the bag was
incubated for > 4 h at 42°C. The cDNA probe was labeled using the T7 Quick
primeTM Kit (Phannacia) and OC-~'P- dCTP. The labeled probe was added to
the prehybridization solution et 5x1 O5 to 1 x l OB cprn/ml. Hybridization was
carried out ovemight at 42OC. Next day, the filter was washed with 2X SSC
twice at room temperature for 5 min each, 2 x SSC, 0.1% SDS twice at 65OC foi
10 min each, and finally with 0.1% SSC, 0.1% SDS at 65OC for -30 min. The
filter was dried and exposed to X-ray film ovemight at -70°C.
D. Construction and Screening of Genomic Library
Total genomic DNA from axenically grown D. discoideum KAX3 cells was
purified and digested with EcoRI. Southem blot analysis using DdCAD-1 cDNA
as a probe identified the existence of a EcMI band in the Dm discoideum
genorne, with a size of -4 kb. EcoRl digested genomic DNA was then
separated on agarose gel and the DNA fragments migrating between 3-8 kb
were eluted and cloned into LgtlO. The mini-library was screened with the
cDNA probe and several positive clones were selected and amplified with host
bacteria. Eight independent clones were purified and digested with EcoRI. A
positive band at -4 kb was confimed by Southern blot analysis. Three
independent isolates were subcloned into the plasmid pBluescript (PSK).
Partial sequencing of al1 three clones confirmed that they contained the same
genomic sequences. One clone was sequenced completely in both directions.
E. Sequencing of the cadA Gene
One characteristic feature of Dictyostelium genes is their high AT content
(>80%) in the noncoding region. It was difficult to find suitable regions for
primers in the AT-rich region. Therefore, a nest of 5' deletion fragments were
prepared as described (Henikoff, 1984). To create the nested set of fragments,
the EcoRl fragment was subcloned into the EcoRl site of pBluescript to obtain
the construct PSK-El . This construct was first linearized with Apal and Hindlll
and then treated with exonuclease III for 0-8 min. Digested vector DNA was
collected every 0.5 min, treated with S i nuclease and then filled in with the
Klenow fragment. After ligation with T4 DNA ligase, they were separately
transfomied into JM101. Colonies were selected frorn each time point.
Plasmids from 8ach colony were isolated for double stranded DNA sequencing
using the universal p8luescript primers and the T7 Sequencing Kit (Pharmacia).
Whenever possible, oligo primers derived from the 4 kb fragment were also
used for sequencing. The sequences of oligos used are shown in Table 2.1. A
total of 3799 bp were sequenced covering the entire region between the two
EcoRl sites.
l
Table 2.1 : Oligonucleotides u s d for cadA sequencing
PSK reverse primer
PSK forward primer
PSK Ks
F. Mapping the Transcription Start Sites of the cadA Gene
The transcription start sites of the cadA gene were identified by primer
extension. An oligonuleotide SE1 (5'--AATGATTCACCAGTGCAG3)
complementary to the coding sequence between +92 and +IO9 was made.
This oligo was labeled by phosphorylation with bacteriophage T4
polynucleotide kinase using [ y - 3 2 ? ] - ~ ~ ~ (3000 pcilmmol). Total RNA was
extracted. Primer extension was carried out using 2.0 pmole labeled primer
and 50 pg total RNA (Triezenberg, 1992). The mixture was incubated in the
primer extension buffer (0.1 M Tris.CI, pH 8.0, 1 0 mM dithiothreitol, O. 1 M KCI,
10 mM MgCl,, 0.25 mM dNTPs) at 68°C for 10 min to anneal the primer to the
template, and then changed to 42°C for 5 min. 10 U of avian myeloblastoma
virus reverse transcriptase was added and the mixture was incubated for 1 h at
42°C. The cDNA was precipitated with 2 volume of 95% ethanol and 1/10
volume of 3M NaAC. The pellet was resuspended in 10 pl of stop/loading buffer
and loaded on a sequencing gel side &y side with the sequencing samples
which were prepared by annealing the same oligo to the cloned cadA gene.
G. Isolation of Nuclei
NC4 or KAX3 cells were collected at different hours of development and
2 x 1 o8 cells were lysed by diluting cells first in 10 ml of lysis buffer 1 (50 rnM
HEPES, pH 7.5,40 mM MgCl2,20 mM KCI, 5% sucrose, 14 mM
mecaptoeaianol). Nonidet P-40 was added to a final concentration of 2%. The
sample was put on ice for -10 min or until the suspension became cleared.
Nuclei were pelleted at 3000 x g for 5 min at 4OC and then resuspended in 10
ml of lysis buffer 2 (lysis buffer 1 + 10% Percoll). The unbroken cells were
removed by centrifugation at 150 x g for 5 min. The nuclei were tlien pelleted
from the supematant by centrifugation at 3000 x g for 5 min. The nuclei were
washed once in 1 ml of lysis buffer 1. The packed nuclear volume (pnv) was
estimated. For gel mobility shift assays, nuclear extracts were prepared. For
nuclear mn-on assays, nuclei were resuspended in 100 pl of storage buffer (40
mM Tris-HCI, pH 8.0,10 mM MgC12,I mM EDTA, 50% glycerd, 14 mM &
mecaptoethanol), and aliquots of 20 pl were quickly frozen on dry ice and
stored at -70°C.
H. Nuclear Run-on Assay
Nuclear r u n a assays were carried out as described by Nellen et al.
(1987). The standard reaction mixture (100 pl) contained 20 pl 5X reaction
buffer (200 mM Tris-HCI, pH 7.9; 50 mM MgC12; 250 mM KCI; 0.5 mM DTT; 25%
glycerol), 1 pl each of ATP, GTP, and CTP (1 00 mM stock), 5 pl of [a -%Pl-UTP
(10 pCi/~l), 2 pl of RNAase Guard (Phamacia) and 50 pl H20. To start the
reaction, 20 pl of thawed nuclei was added and incubation was perfomed at
room temperature for 30 min. Then 5 pl of RNAase-free DNAase 1 (40 units)
was added and mixed well by pipetting up and down for 10 times and incubated
at room temperature for 20 min. The reaction was teminated by adding 50 pl of
a solution containing 5% SOS, 0.5 M Tris-HCI, pH 7.4, and 0.125 M EDTA. The
mixture was extracted with 150 pl of phenol-chloroform (1:1, vlv), and the
supematant was passed through a Sephadex G-50 1-ml spin column prepared
in a 1-ml syringe. The column was spun at 2000~ g for 5 min and the labeled
RNA was colle~ted and counted. Before hybridization, the RNA samples were
denatured at 85% for 10 min and then placed on ice.
Samples of plasmid DNA (200 pg in 440 pl) containing sequences
corresponding to the respective cDNA probes were linearized using an
appropriate restriction enzyme, followed by the addition of 49 pl of 1 M NaOH.
After incubation for 30 min at 22OC, 4.9 ml of 6X SSC was added to neutralize
the sample on ice. DNA samples (250 pl each, containing -10 pg plasmid
DNA) was applied ont0 Hybond-N nylon membrane (Amersham) using a dot
blot apparatus and each slot was rinsed with 500 pl of 6X SSC. The membrane
was air dried ovemight, baked for 1 h in an 80°C vacuum oven, and then stored
in a desiccator.
Prehybridization was perfomed at 5S°C overnight in a buffer containing
50% formamide, 3X SSC, 120 mM phosphate buffer (14.4 mM NaJiP04,105.6
mM KH,P04), pH 7.2, 0.1% SDS, 3X Denhardt's solution, 20 mM EDTA (pH
7.2), and 0.2% Sarcosyl. Hybridization was performed at 55°C for 36 h using
RNA samples containing equal amounts of rsdioactivity in the same buffer.
Filters were washed once at 37°C for 15 min and then at 65°C for 1 h in 0.W
SSC, 2 mM EDTA (pH 7.2), and 0.2% SDS. The membrane was air dried and
exposed to X-ray film. To estimate the relative rate of transcription,
autoradiograrns were quantified using the NIH Image program and values were
normalized to the intensity of the actin band after background subtraction.
1. Gel Mobility Shift Assay
The gel mobility shift assay was carried out essentially as descnbed by
Chodosh (1 994) and Taylor et. a1 (1 994) with minor modifications. All solutions
were prepared according to the published protocols.
(1) Extraction of the Nuclei: Nuclei were resuspended with 1/2
packed nuclei volume (pnv) of low salt buffer. While stirring the suspension
gently, 112 pnv of high sait buffer was added in a dropwise fashion until the final
concentration of KCI reaches -300 mM. The nuclei were extracted for a further
30 min with continuous gentle mixing and pelleted by spinning at 14,500 rpm
(25,000 x g) foi 30 min in a Beckman JA-20 rotor. The supernatant was saved
as the nuclear extract.
(2) Dialysia and storage of the extract: The nuclear extract was
dialyzed against 50 vol of dialysis buffer for 2 h at 4OC. The extract was
removed from the dialysis bag and centrifuged for 20 min in the JA-20 rotor at
14500 rpm. The supernatant was collected and its protein concentration was
detemined using the BCA Protein Assay Kit (Pierce). Finalty, the extract was
aliquoted into 1.5 ml tubes, rapidly froten by submerging in liquid nitrogen, and
stored at -70°C.
(3) DNA binding reaction: The probes were labeled with Klenow
enzyme and [a-32P]-dCTP (3000 flVmmol). Frozen extracts were thawed on
ice immediately before use. The binding reaction was prepared in an
Eppendorf tube by combining the following reagents in a final volume of 10-1 5
pl: -1 5 pg of protein from the nuclear extract, 10,000 cpm of DNA probe, 2 pg
poiy(d1-dC). poly(d1-dC), 300 pgml BSA (final concentration). The reaction
solution was mixed gently by tapping the bottom of the tube and incubated for
15 min in a water bath at 30°Ce
(4) G d dectrophoresis: A 4% high-ionic-strength native
polyacrylamide gel was prepared with an acrylamide:bisacrylamide ratio of
80:l. A small volume of 1 OX loading buffer was first loaded in one of the wells.
The dyes were allowed to nin into the gel and the well was flushed before
samples were loaded in the other wells. The gel was run with high-ionic-
strength electrophoresis buffer at 35 mA until the bromophenol blue reached
the bottom. The gel was carefully transferred ont0 a Whatman filter paper,
dried, and subjected to autoradiography (Taylor et al., 1 994).
J. RNA Blot Analysis
RNA samples (20 bg each) were pelleted and dissolved in a solution
containing 5.5 pl of sterile water pretreated with 0.2% DEPC, 3.5 pl of 37%
formaldehyde, 10 pl of deionized formamide, and 1 pl of 20X MOPS buffer, pH
7.0 (0.4 M 3-[N-morpholino]propanesulfonic acid, 0.1 M sodium acetate, 0.02 M
EDTA). The samples were heat treated at 6 5 " ~ for 15 min to denature the RNA
and then quickly chilled on ice. Samples were size-fractionated in a 1 %
agarose gel containing 6.7% formaldehyde. These gels were stained with
ethidium bromide. The relative amounts of the two rRNA species in each lane
were recorded using a Gel Print 2000i documentation system (BiofCan
Scientific, Toronto, ON). RNA was transferred ont0 a nylon membrane
(Hybond-N obtained from Amersham) and cross-linked by UV irradiation for 20
min, followed by 1 h of baking at 8 0 " ~ . Prehybridization was camed out at
4 2 " ~ for 6 h in a solution containing 50% deionized formamide, 5X Denhardt
solution (0.1 % F icoll, 0.1 % polyvinylpyrroline, 0.1 % BSA), 6X SSPE (1.1 M
NaCl, 0.6 mM disodium EDTA, 60 mM sodium phosphate, pH 7.4), 0.1% SDS,
and 100 pg/ml of denatured herring sperm DNA. Hybridization was canied out
at 4 2 ' ~ for 12 h in the same buffer containing a [a-32P]dCTP-labeled DdCAD-1
cDNA probe (1 O6 cpmlml) (Wong et aL, 1996). Rie RNA filters were then
washed with two changes of 2X SSC at room temperature, 15 min each,
followed by two changes of 2X SSC-O. 1 % SDS at room temperature, 15 min
each, and then two changes of 0.W SSC-0.1% SOS at 6 5 ' ~ , 5-10 min each.
The filters were air-dried and then exposed to X-ray film. The relative intensities
of specific bands in the autoradiogram were quantified using the NIH Image
program.
K. Deletion Constructs and Subcloning Procedures
(1) Construction of DdGal(g631): Two primers
P-631 and P48 were synthesized and used to do PCR with the cloned cadA
gens as a template. The PCR product was first cut with EcoRl and cloned into
pBluescript which was eut with EcoRl and EcoRV, resulting in the constnict
PSK(-631) (see Fig. 3.8). The insert that contains the cadA sequence starting
from -631 was released from PSK(-631) by digestion with €CORI and BgAl,
purified, and subcloned into the EcoRl and Bglll sites of pDdGal-17Hw (Hatwood
and Drury, 1990), yielding the final construct DdGal(-631).
P-631: 5'tcgaattcTGCAACTTGTTTCAACT3', with an EcoAl site added at its 5'
end followed by a 17 nucleotide sequence corresponding to the coding strand
of cadA gene starting from -631.
P48: S'cgagatctATTTGCATCAACAGACAT3', with a BgRl site added at its 5'
end followed by an 18 nucleotide sequence complementary to the cadA coding
strand started at 48. Uppercase letters refer to sequences derived from the
Dictyoste/ium genome; lowercase letters represent additional sequences that
provide the restriction sites.
(2) Construction of DdGal(œ359): To constrict DdGal(SS9)
containing the cadA sequence starting from -359, primers Pa59 and P48 were
used to perfomi PCR. The PCR product was purified aftei separation on a 2%
agarose gel, and then blunt end ligated into the EcoRV-digested p8luescript.
The insert was released by digestion with Xbal and BgAl and subcloned into the
same sites of pDdGal-1 7H0.
P-359: S1tctagaGTAAGTGGGGTGTGAGAT3' with an Xbal site at its S end
followed by an 18 nucleotide sequence corresponding to the coding strand of
the cadA gene starting from -359.
(3) Construction of DdGal(œ279): To constnict DdGal(œ279) in
which the cadA fragment between nucleotide positions -279 and +48 was
cloned into the transformation vector pDdGal-17H-. The primer P-359 and P48
were used to perfomi PCR. The PCR product was cut with Alul (an intemal Alul
restriction site was present in the cadA gene at position -280) and the fragments
were separated on a 2% agarose gel. The longer fragment (Alu I-P48) was
eluted and cloned into pBluescript (EcoRV digested) to obtain PSU(-279). The
insert was released from PSK (-279) by digestion with EcoRl and
Bgill and cloned into pDdGal-1 7H9 (EcoRI and Bglll cut) leading to the formation
of DdGal(-279).
(4) Construction of DdGaI(-244): To construct DdGal(-244), the
PSK universal fonnrard primer and P48 were used to perfom PCR using the
deletion construct ds(-244), which was previously obtained for DNA
sequencing, as the template. The ds(0244) construct contained the cadA
sequence starting from -244 originally cloned into the EcoRl site of PSK. The
PCR product derivecl from ds(0244) was cloned into PSK (EcoRV cut) by blunt
end ligation to produce PSK-EV(-244). The construct PSU-EV(-244) was cut
with Hindlll and overhanging ends were filled in with Klenow fragment. EcuRl
linkers were added and the insert that contained the cadA sequence from -244
to +48 was released by digestion with BgAl and EcoRI. The fragment was
purified and cloned into the EcoRl and Bgil sites of pDdGaC17H-.
(5) Construction of DdGal(4 94): To construct DdGal(-194), the
primer P-194 and P48 were used to perform PCR. Cloning procedures were
similar to those of DdGal(9631).
P-194: 5'acgaattcAlllCCCAACAGAA3' containing an EcoRl site at its 5' end
followed by a 16-nucleotide sequence starting frorn -1 94 of the cadA coding
strand.
(6) Construction of OdGal(454): Since the construct DdGal(-359)
contained two Xbal sites at -359 and -154, therefore, direct digestion of DdGal(-
359) with Xbal released the intervening fragment. DdGal(454) was obtained
by religation of the plamid DNA.
(7) Construction ot DdGaI(80bp): Two complernentary oligos
corresponding to the sequence from -359 to -279 were synthesized with a
flanking Xbal site at each end, annealed, cut with Xbal, and then cloned into
the Xbal site of the construct DdGal(4 54). For the convenience of selection, the
oligos were designed to include an intemal EcoRl site. The sequence of the
oligo containing the 80 bp fragment is as follows:
5 ' g c t ~ a ( X b e i ) g a a ~ c ( E c 4 R l ) m G T A A G T G G G G
AnGGGCTATGTTGGGGTTGAAAAAAACGGmGGATrAmCA
tctagagc (Xbal) 3.
(8) Construction of DdGal(PRE): two complementary oligos
(PSFE and PSFEc) corresponding to the cadA sequence from -339 to -286 (the
putative PSF element) were synthesized with a flanking Xbal site at each end.
The oligos were annealed, cut with Xbal, and cloned into the Xbal site of the
constnict DdGal(454) (see Fig. 3.13C).
Sequence of PSFE is shown below:
5 'actCta~TCATTGGGCTATG~GGGGT"TGAAAAAAACG~G
GATTA1171CAtctagacaa 3'.
(9) Construction of DdGal(CRE 3X): Complernentary oligos (B4W)
containing 3 copies of the cadA sequence from -360 to -343 (box2 CRE
element) were synthesized with flanking Bglll sites and Mo intemal BamHl
sites. The fragment was cloned into the BamHl site of the heterologous
promoter construct A1 5ABamGal (Ceccarelli et a/., 1 99 1 ) (see Fig. 3.1 4).
(10) Construction of DdGal(CRE 1X): To constnict DdGal(CRE 1X)
containing only one copy of CR€, DdGal(CRE 3X) was cut with BamHl to
release two copies of the CRE sequence and then religated.
Sequence of B4W is shown below:
5'tcagatct(Bgîl i)GTAAGTGGGGTGTGAGATggatcc(BamHI)GTAAGTGGGGTGTG
AGATGTAAGTGGGGTGTGAGATggatcc(BamHl)agatctgc@gd 1).
All final constructs were confimied by DNA sequencing using the primer
S'ATTGCCCGGGATCATCCTGCA3' which conesponded to the complementary
sequence of the restriction sites Pstl and Smal of both vecton DdGall 7-Hœ and
A l SABamGal.
L. Transformation and Selection of Transformants
Transformation was camed out by electroporation using the Ho-Rad
Gene Pulser. KAX3 cells were grown to 3 x 106 celldml in HL-5 medium, spun
d o m at 600 x g for 4 min. and washed once with E buffer (1 0 mM Na2/K
phosphate buffer, pH 6.1, 50 mM sucrose). Cells were resuspended gently in E
buffer to a density of 4-5 X IO' /ml. 0.4 ml of cells were placed in a 0.4 cm Gene
Pulser cuvette (Bio-Rad). 10-30 pg of plasmid DNA was added to the cells and
the cuvette was put on ice for 5 min. Electroporation was then camed out at the
following settings: pFD = 25, Voltage = 0.8 k, resulting Tau - 14-1 5. Cells were
gently removed from cuvette to a plastic tissue culture dish, 4 pl of healing
solution (100 mM CaCI,, 100 mM MgCI,) was added, and the cells were left at
room temperature. After 1 5 min, 1 2 ml HL-5 medium was added, mixed, and
cells were allowed to recover overnight. Next morning, the medium was
changed and 041 8 was added to a final concentration of 2.5 pg/rnl. Medium
was changed every two to three days and the concentration of 6418 was
gradually increased frorn 5 to 20 pgml at No-day intervals. Transfected cells
were transferred to a 15 ml capped tube upon confluence and grown under
shaking conditions in HL05 containing 20 pg/ml G418. When the density
reached -4 x 106/ml, cells were inoculated into 50 ml HL05 medium at -3 x
1 05/ml and allowed to grow to a higher density. Cells were collected at 4-6 x
1 o6 /ml and then prepared for P-galactosidase assay. Cells were also
developed in the presence or absence of CAMP and used to isolate RNA for
Northern blot analysis (Nellen et al., 1987).
M. PGalactosidase Activity Assay
(1) ONPG method: The fl-galactosidase activity in transfected cells
was assayed according to Dingermann et al., (1989). Cells were collected by
spinning at 600 x g for 5 min. Cells were washed in 17 mM phosphate buffer
(pH 6.4), and then resuspended with 17 mM phosphate buffer at 6 x 106
celldml, frozen and thawed 2-3 times. Cells were vortexed briefly and
centrifuged at 15,000 rpm for 15 min at 4%. The supernatant was collected and
protein concentration was determined using the Coomassie Plus Protein Assay
kit (Pierce). The p-galactosidase assay was set up as follows: 1-1 00 pl of
extract ,300 pl of tbuffer, 2 pl p-mecaptoethanol, 200 pl of 4 mglml e
nitrophenyl-B-D-galactoside (ONPG) in 100 mM phosphate buffer (pH 7.0), and
the final volume was adjusted to 600 pl using 17 mM phosphate buffer (pH 6.4).
The reaction mixture was incubated at 22OC for 5-20 min, stopped by adding
400 pl of 1 M N%CO3. 0.0.420 was measured. The arnount of protein extract
was adjusted, so that the 0.0.420 value fell within the range of 0.2 to 1.8, in
order to obtain a linear response of the enzyme activity. Results were
nomalized to protein concentration and to reaction time. Enzyme activities are
expressed as nano mole per min per mg protein (mu) and a unit is defined as
the activity that catalyzes the hydrolysis of 1 pmole of ONPG per min.
(2) CPRG method: The transfectants containing the putative elements
expressed lower levels of P-galactosidase activity. To increase the reaction
sensitivity, another substrate, chlorophenolred-B-O-galactopyranoside (CPRG)
replaced ONPG in B-galactosidase activity assays. CPRG was prepared in 100
mM phosphate buffer (pH7.0) at 8 mgml as a stock. Other reaction solutions
and procedures were the same. The only difference is that the final O.D. value
was measured at 570 nm.
Chapter 3
RESULTS
A. Regulation of cadA Gene Expression During O. discoldeum Development
Exponentially growing Dictyostelium cells secrete a glycoprotein,
referred to as the prestarvation factor (PSF) (Clarke et a/., 1988), which acts as
a regulator of gene expression. Towards the end of exponential growth, a high
concentration of PSF is accumulated in the growth medium, leading to the
activation of agg regation-stage specific genes, such as genes encoding
discoidin-1, the cAMP receptor CARI, lysosornal protein a-mannosidase, and
the cadA gene that encodes cell adhesion rnolecule DdCAD-l/gp24 (Schatzle
et a/., 1991 ; 1992; 1993; Clarke et a/., 1992). This activation is short tenn
because secretion of PSF declines as soon as ceHs are starved. Because
bacteria inhibit the activity of PSF, PSF-responsive genes are not expressed in
bacterially grown cells before starvation. Thus, a gene is referred to as a PSF-
responsive gene if it is expressed at a high level in axenically grown cells that
have reached a high cell density but are not yet starved, and at a very low level
under similar conditions in bacterially grown cells.
cAMP is known to also stimulate the expression of a number of
aggregation stage genes and to repress the expression of some
preaggregation stage genes (see Fig. 1.3). During the earîy phase of
development, some genes such as the csaA gene that encodes the cell
adhesion molecule gp8O (Noegel et al., 1986; Wong and Siu, 1986; Kamboj, et
al., 1988; 1989; Ma and Siu, 1990; Desbarats et al., 1992), are induced in
response to nM cAMP pulses upon the initiation of the cAMP signal-relay
system (Mann et al., 1 987; 1 989; Kumagai et al., 1 989, 1 991 ), while other genes
are repressed (Mann et al., 1989).
To investigate the extent to which the expression of cadA gene is
regulated by PSF and cAMP pulses, KAX3 cells previously cultured either in
liquid medium or on a bacterial lawn were developed by shaking in phosphate
buffer. Cells were treated with exogenous cAMP pulses starting at 2 h of
development and cell samples were taken at different time points for RNA blot
analysis. cAMP stimulated an increase in the expression of the cadA gene in
cells grown under either condition (see Fig. 3.1). In axenically grown cells, a
high level of DdCAD-1 was already present in vegetative cells that had grown to
the late exponential stage, suggesting that PSF is involved in the stimulation of
cadA expression. cAMP pulses stimulated a 4-fold increase in the mRNA level
at 8 h of development. In cells which were previously grown on bacteria, only a
low level of cadA transcripts was detected at O h. This was followed by a rapid
accumulation of the cadA transcripts. cAMP pulses led to a 2-fold increase in
the level of cadA mRNA (Fig. 3.1). These results indicate that both PSF and
cAMP are involved in the regulation of cadA expression.
To investigate whether the stimulation of cadA gene expression by cAMP
pulses is at the transcriptional level, in vitro nuclear runon experiments were
perfomed to examine the effect of cAMP pulses on the rate of transcription of
the cadA gene. NC4 cells were developed in liquid medium with or without
exogenous cAMP and nuclei were isolated from cells at 0, 4 and 8 h. As shown
in Fig. 3.2, only a very low level of cadA transcripts was detected at O h. The
rate of transcription increased 6-fold between O and 4 h and 15-fold by 8 h.
Administration of exogenous cAMP pulses at nanomolar concentrations
resulted in a further 5-fold increase in the transcription rate at 4 h. On the other
hand, a constant high level of cAMP treatment gave rise to a transient
stimulation of cadA transcription at 4 h, followed by a marked decrease. By 8 h,
the relative transcription rate of the cadA gene was reduced to that of O-h cells.
B. Molecular Cloning and Characterization of the cadA Gene
To investigate the regulation of cadA transcription, the cadA gene was
cloned and sequenced. Total genomic DNA of Dictyostelium was digested with
combinations of restriction enzymes and subjected to Southem blot analysis
using cadA cDNA (Wong et al., 1996) as a probe. Southern blot analysis
indicated the presence of only one gene coding for DdCAD-1 (data not shown).
The 32~-labeled cDNA probe hybridized with an EcoRl fragment of -4 kb.
To clone the gene that codes for the DdCAD-1 protein, total genomic
DNA was purified from axenically grown KAX3 cells and digested with EcoRI.
DNA fragments were separated on an agarose gel and those migrating
between 3-8 kb were eluted and cloned into hgtlO. By screening this mini-
library with the DdCAD-1 cDNA probe, eight independent clones were
identified. Purified DNA was digested with EcoRl and subjected to Southem
blot analysis. An -4 kb fragment hybridized with the cadA cDNA (data not
shown). The DNA from three independent isolates was subcloned into the
plasmid pBluescript (PSK). Partial sequencing of al1 three clones confirmed
that they contained the same genomic sequence. One clone was sequenced
completely using a combination of oligo pnmers and a unidirectional deletion
strategy (Fig. 3.3A). By unidirectional digestion wïth exonuclease III (Henikofi,
1984), clones (ds0.5 to 8, Fig. 3.3A) containing different lengais of S
65
untranslated regions were selected. sequencing was perfomed by using the
dideoxynucleotide temination method with the T7 sequencing Kit (Pharmacia)
and the universal primers of PSK. A partial restriction map of the 4 kb EcoRl
fragment containing the caaM gene is shown in Fig. 3.38.
C. Structural Features of the cadA Gene
A total of 3.8 kb of the cadA gene was sequenced covenng the entire
region between the two EcoRl sites (Fig. 3.4A). The cloned EcoRl fragment
contains -2.4 kb 5' of the translation start site and 500 bp 3' of the TAA
translation stop codon of the DdCAD-I coding sequence. By comparison with
the cDNA sequence for DdCAD-1 (Wong et aL, 1996), the cadA gene contains
two short introns of -90 bp, which is typical of slime mold genes. Both of the
intron-exon boundaries defining the splice sites conform to the consensus
sequence of AG at the 3' splice site and GT at the 5' splice site (Fig. 3.48). The
percentage of A + T is 67% in the exons and 93% in the introns. Primer
extension experiments identified three transcription initiation sites (Fig. 3.5).
The first site is an A located 47 bp 5' to the translation start codon ATG and is
denoted +1 (Fig. 3.4). The other two sites are T (+2) and A (+5), and the major
initiation site is at the +2 position (Fig. 3.4). The transcription start sites are
preceded by a T stretch from -1 9 to -2, as is found in most Dictyostelium genes.
Just preceding the T stretch at position -31 is a putative TATA box (TATAAAAA;
Fig. 3.6) which confoms to the slime mold consensus TATA box sequence,
TATAAA(AK)A (Kimmel and Firtel, 1983). The putative TATA box is preceded
by a homopolymer run of 10 As. This nin of As may potentially interact with the
T stretch and form a stem loop structure that would place the TATA box in the
loop. As is found in many slime mold genes, just before the translation start site
ATG, is an A stretch (5 As) in the cact4 gene. An upstream open reading frame
of 324 bp ends at -572. This suggests that the promoter region of the cadA
gene could start around -600 bp from the transcription start site. Similar to most
DictyosteIium genes, the cadA 5'-flanking region is extremely AT rich, having
92% A + T between positions 161 to +47. The content of G + C increases to
20% in the upstream region from -631 to -162 with the G and C residues being
mostly clustered. Analysis of this region (Fig. 3.6) shows the presence of
several G/C-rich elements (Fig. 3.7A). The 23 bp sequence at -267 was
designated boxlc (core sequence: TGGTGTGGT). This sequence was found in
the inverse orientation at -442 (boxl). The C-rich sequence TCACACACT,
designated box4, was found at -166 and at -287. Two other G-rich regions
were located at -354 (GTGGGTGTGA, box2) and at -323 (GITGGGGlTG, box3).
Except for box3, al1 of these GC-rich elernents contain the core CAMP response
sequence (GTGTG, Fig. 3.78) identified in the gene encoding the cell adhesion
molecule gp80 (Desbarats et al., 1992). Also, a 7 bp sequence (GTGTGGT)
present in cadA boxl and boxlc is identical to the gp80 consensus CRE
sequence (Fig. 3.78). Examination of the GC-rich elements of the cadA gene
identified direct repeats in al1 these elements (Fig. 3.7C). This may imply that
nuclear transcription factors bind to these sites using a symmetrical structure.
D. Promoter Analysis of the cadA Gene
(1) Reggulatjon of Expression of the Reporter Gene by cadA
5'- Flanking ONA
As shown in Fig. 3.1 8, at the beginning of development the cadA gene
was expressed at a very low level in bacterially grown KAX3 cells.
Development led to a rapid accumulation of the cadA transcripts. At 8 h, the
level of cadA mRNA was high and cAMP pulses elicited a 2-fold increase. On
the other hand, in axenically grown KAX3 cells, a high level of cadA mRNA was
already present at the beginning of development, and fuither development
without cAMP pulses led to a srnall decrease in the mRNA level. However,
these cells were more sensitive than bacterially grown cells to cAMP treatment.
cAMP pulses led to a 4-fold increase in the level of cadA transcripts (Fig. 3.1A).
These results suggested that bacterially grown KAX3 cells, which do not
express the cadA gene until development starts, should be used to study the
developmental regulation of cadA gene, whereas axenically grown KAX3 cells,
which are very responsive to cAMP pulses, are better for the study of the cAMP
induction of the cadA gene.
As mentioned previously, the promoter region of the cadA gene could
start around -600 bp from the transcription start site. To analyze the cadA
promoter, my first task was to determine whether this region of the cadA DNA
regulates the expression of a reporter gene in the same manner as the
endogenous cacl9 gene. A fragment containing the sequence of the cadA gene
from -631 in the 5'4anking region to +66 in the coding region (Fig. 3.8A) was
obtained by PCR. This fragment was fused in frarne to the IacZreporter gene
contained in the expression vector pDdGal17H- (Fig. 3.88; Hawood and Druiy,
1990; Harwood el al., 1993). The resulting plasmid, which was designated
DdGal(431) (Fig. 3.8), was used for transfection into KAX3 cells. Transfectants
were selected with 6418, pooled, grown either in axenic medium or in
association with bacteria, and then developed in the presence or absence of
cAMP pulses. Expression of the reporfer gene was monitored in these cells by
rneasurements of fbgalactosidase activity or by Northem blot analysis of the
accumulation of lac2 transcripts.
To study the developmental regulation of the reporter gene, bacterially
grown transfected cells were developed in liquid and tested for &galactosidase
activity. In agreement with previous results of the endogenous cadA gene
expression (Yang et a/. , 1 997), Bgalactosidase activity expressed from the
transfected DNA was barely detectable at O h. Development in the absence of
cAMP pulses led to an accumulation of enzyme activity, and cAMP pulses
elicited a fumer 2-fold increase of enzyme activiiy (Fig. 3.9A). Thus, the
reporter gene responded to developmental regulation in the same manner as
the endogenous cadA gene (Fig. 3.1 ; Yang et al., 1997).
Transfectants were also grown axenically, developed in either the
presence or absence of cAMP pulses, and used to prepare total RNA. Northern
blot analysis was performed with the 32P-labeled IacZcDNA probe and the "P-
labeled cadA cDNA (Fig. 3.96). In contrast to the bacterially grown KAX3 cells,
high levels of /&and cadA mRNA had already accumulated in the axenically
grown vegetative cells. Development in the absence of cAMP led to a decreaæ
of mRNA levels. cAMP pulses elicited a dramatic increase in both lac2 and
cadA transcripts. Thus, the reporter gene responded to PSF in a manner
similar to the endogenom caM gene. These results indicate that the reporter
gene responds to developrnental signals, to PSF, and to cAMP in the same
rnanner as endogenous gene. Thus, the -631 DNA fragment contains both PSF
and cAMP response activities and was used to fuither define PSF- and CAMP-
responsive elements. When the result of this study is compared with that shown
in Fig. 3.1 , differences were observed with respect to the level of cadA mRNA at
O h of axenically grown cells. This might be because the cells were collected at
different concentrations (2-3 x 1 O6 celldml in Fig. 3.1 and -5 x 1 o6 cells/ml in
Fig. 3.9). In the latei case, cells secrete a higher level of PSF which stimulate a
higher level of cadA transcription. The purpose of using a higher cell density in
this study is to increase the sensitivity of the reporter gene to PSF induction.
(2) Mapping of the c8dA Sequencr Rsrponrive to PSF
To detenine which region within the -631 fragment is responsible for
conferring PSF activity on the cadA gene, sequential deletions in the -631
fragment were made using either PCR amplification or existing restriction
enzyme sites. The deletion constructs containing cadA 5'-flanking sequences
starting at different positions as shown in Fig. 3.10A were cloned into the
expression vector pDdGal17H- (Fig. 3.88) and used to transfomi KAW cells.
Transfectants were selected with G418, pooled, and assayed for p- galactosidase activity. As the transformation vector pDdGall7H- alone does not
contain a basal promoter, the best available vector is A15ABamGal (Fig. 3.148;
Ceccarelli, et al., 1991) that contains the basal promoter of actin 15 gene. It was
thus used to transfect KAX3 cells and transfectants were used to assay for the
basal activity of fbgalactosidase. All transfectants were grown in HL-5 medium
to a density of -5 x 106 cells/ml under shaking conditions. Vegetative cells
were collected for enzyme activity assays (Fig. 3.1 OB). Deletion from -631 to - 359 leads to a decrease in enzyme activity of -40% (see pagel 17 for
discussion). Further deletion to -279 almost abolished the PSF
responsiveness. Deletion constructs starting from -279 to -1 94 retained only
about 1.5% of the PSF activity of the -631 construct. These results suggested
that the 80 bp (see Fig. 3.13A) between -359 and -280 contained the major PSF
response etement, while the construct DdGal(-154) containing only the basal
promoter maintained a similar level of enzyme activity as obtained with cells
transfected with the basal vector A1 5ABamGal. To further confimi the enzyme
assay results, transfectants were grown axenically and O h cells were collected
for isolation of total RNA. Northem blot analysis was performed using 3 2 ~ -
labeled lacZcDNA as the probe, and 32~-labeled cadA cDNA probe was
hybridized to the same blot as a control (Fig. 3.1 1A). Densitometric scanning of
the lacZmRNA bands were carried out and normalized against that of the cadA
mRNA (Fig. 3.1 18). The pattern obtained was similar to results obtained with
the enzyme assay (see Fig. 3.10). These results suggest that the 80 bp region
between -359 and -280 contains the major PSF activity of the cadA gene.
(3) Mapping of the cadA Sequence Responsive to cAMP
As shown in figure 3.9, the DNA sequence staiting from -631 was able to
confer CAMP responsiveness to the cadA gene. To detemine which segment
within this region is responsible for the cAMP inductive activity, transfectants
containing the deletion constructs shown in figure 3.10A were examined for
their cAMP responsiveness. Stable transfectants were cultured in axenic
medium and collected at -5 x 106 cells/ml and developed for 8 h in the
presence and absence of cAMP pulses. Total RNA was prepared and Northem
blot analyses were perfomed using 32P-labeled lacZcDNA and cadA cDNA as
probes (Fig. 3.12A). Expression of the lac2 reporter gene in response to cAMP
in transfectants containing a construct with a deletion to -359 was 60% less than
in transfectants containing a construct extending to -631 (Figs. 3.128).
Howevei, deletion to position -279 led to a further decrease of the cAMP
responsiveness to < 5% of the -631 construct. Quantitative analysis showed
that the construct containing the -631 fragment exhibited a 48-fold induction,
and deletion to -359 Ied to a 19-fold induction (Fig. 3.128). Since the sequence
between -631 and -359 contains only one GfC-rich element, boxl , these results
suggest that boxl may be a cAMP response element. Deletion to -279 led to a
dramatic decrease in cAMP responsiveness. Expression from construct
containing deletion to -279 was induced only 1.9-fold by CAMP. As expected,
the endogenous cadA gene induction is intact in al1 of these transfectants (Fig.
3.1 2A). These results suggest that the sequence between -359 and -280 (80
bp, Fig. 3.13A) may contain one or more major cAMP responsive elements.
This 80 bp region contains three GfC-rich elements, box2 (GTGGGGTGTGA),
box4 (TCACACA), and box3 (GTTGGGGTTG). Interestingly, both box2 and
box4 contain the core sequence GTGTG found in the gp8O CREs (Desbarats, et
al., 1992), suggesting that they may sewe as the major CREs of the cadA gene.
Since a sequence identical to box4 is located downstream at position -166
(Figs. 3.6 and 3.7), deletion constructs starting from -279, -244, and -1 94 al1
contain this box4. Boxlc is also present in the -279 deletion construct.
However, transfectants of these three constnicts retained only a very low level
of cAMP responsiveness, suggesting that the proximal box4 and boxlc may not
be the major CREs. In transfectants containing the -1 54 deletion construct,
CAMP responsiveness was completely abolished. As a positive control, the
expression of the endogenous cadA mRNA was examined in al1 transfectants
(Fig. 3.12A). The transfectant containing the vector A1 5ABamGal was used as
a negative control. As expected, deletion to
-154 leads to the abolition of IacZexpression although expression of the
endogenous cadA gene was not affected. Taken together, these results
suggest that the sequence between -359 and -280 contains the major cAMP
responsive activity and that box2 may be the major CRE of the cadA gene.
(4) Identification of the major DNA elemento responsible for cAMP
and PSF responsiveness
To further pinpoint the elements within the 80 bp region that respond to
cAMP and PSF inductions, different constructs were designed. Early results
showed that deletion to -154 contained only basal expression of the reporter
gene. To serve as a positive control, 1 first planned to clone the 80 bp DNA into
DdGal(4 54). Two complementary oligonucleotides corresponding to the 80 bp
region were synthesized with a Xbal restriction site at both ends, and also an
interna1 EcoRl site at the 5' end to facilitate the selection of positive clones using
restriction size differences. The two oligos were annealed, and successfully
cloned into the Xbal site of PSK. Unfortunately, further effort to subclone this 80
bp fragment into DdGal(-154) was not successful after three tries. I thus
continued to work with other constructs.
As shown in Fig. 3.1 3A, the 80 bp region contains a box2 element at the
5' end and box4 at the 3' end and both elements may function as CREs. To test
whether the intervening sequence in the 80 bp segment contains the maior PRE
response element, two complementary oligonucleotides corresponding to the
sequence between -338 to -286 (deleting both box2 and box4) were
synthesized with an Xbal site at both ends. The oligos were annealed, and
cloned into the Xbal site of DdGal(4 54) to obtain the construct DdGal(PRE)
(Fig. 3.1 3C). As discussed before, box2 might be the major CRE of the cadA
gene. Therefore, two oligonucleotides containing three copies of the box2
sequerice were synthesized with a BgAl site at both ends and two intemal
Barniil sites. The oligos were annealed and cloned into the BamHl site of the
heterologous vector A15ABamGal to obtain DdGal(CRE 3X) (Fig. 3.14). As
shown in Fig. 3.14A, the oligos contained two intemal BamHl sites, therefore,
digestion of DdGal(CRE 3X) with BamHl resulted in the release of two copies of
box2 element. The remaining longer fragment containing one copy of the box2
element was religated, leading to the formation of DdGal(CRE lx).
The three constructs, DdGal(PRE), DdGal(CRE3X), and DdGal(CRE1 X),
were al1 transfected into KAX3 cells and stable transfectants were selected with
641 8. To assess for PR€ responsiveness, transfectants were grown in axenic
medium and vegetative cells were subjected to p-galactosidase assays using
transfectants containing A l SABamGal and DdGal(-154) as the control for basal
activity (Fig. 3.1 5). Expenments were first performed with ONPG, but al1 the
transfectants showed low activities. In order to increase the sensitivity of the
test, CPRG was used in place of ONPG. Cells transfected with the DdGal(PRE)
construct showed a 15-fold higher f3-galactosidase activity over the control cells.
However, it was unexpected that transfectants containing box2 also showed
responsiveness to PSF. DdGal(CRE 1 X) had an activity of 1 .ô-fold that of the
A1 5ABamGal cells. DdGal(CRE 3X) had a 10-fold increase.
To characterize the CR€ elements, the stable transfectants were grown in
association with bacteria. Cells were developed either in the presence or
absence of cAMP pulses for 8 h. Cell samples were used for 8-galactosidase
activity assays and the the enzyme activity in the presence of cAMP was
compared to that in the absence of cAMP to identify the CR€ activity.
Transfectants containing the vector A1 5ABamGal or DdGal(-154) were used as
basal activity controls (Fig. 3.1 6). As expected, the transfectant containing
DdGal(PRE) does not show any cAMP responsiveness, although a high level of
enzyme activity was obsewed in both unpulsed and pulsed cells. On the other
hand, the constmct containing one copy of box2 is able to confer a cAMP
induction of 1.7-fold. Three copies of box2 leads to an induction of 2.2-fold.
In sumrnaty, the cadA sequence starting from -631 is able to confer PSF
and cAMP responsiveness to the lac2 reporter gene. Deletion analyses proved
that an 80 bp DNA within the -631 region is essential for the PSF and cAMP
activities. A GIC-rich element, box& within this 80 bp region is able to confer
cAMP responsiveness in a heterologous promoter, suggesting that box2 may
be the major CRE of the cadA gene. DNA sequence from -338 to -286 has
been cloned into DdGal(-154). Although it was able to confer PSF
responsiveness, the heterologous promoter containing three copies of box2
also showed PSF responsive activity. Further efforts are therefore needed to
define PRE element(s).
E. Binding of Specific Nuclear Factor($) to the Promoter DNA of the cadA Gene
To determine whether nuclear proteins bind to the promoter region of the
cadA ggee, gel mobility shift assays (Fried and Crothers, 1981 ; Chodosh, 1994)
were perfomed using the DNA fragment of the cadA Sflanking sequence. The
fragment between -359 and 154 (F206) that contains an intemal Alui restriction
site was obtained by PCR. F2û6 was then cut with Ald, and the fragments were
purified. The shorter fragment (S) spanned between -359 to -280 that is
corresponding to the 80 bp fragment, and the longer fragment (L) was from -279
to -154. 60th L and S fragments were then labeled for gel rnobility shift assays.
Nuclear extracts, prepared from NC4 cells that had been developed for 6 h in
the presence of cAMP pulsing, were incubated with the labeled fragments. As
expected, both probes formed a specific band with nuclear factor(s) (Fig. 3. 17).
The shifted nuclear factor(s) was effectively competed away by cold S.
Compared with the assay without specific competitor, less than 10% nuclear
factor was shifted by the labeled probe in the presence of 50X cold S.
Since box2 was thought to be the major element within the fragment S
that could confer cAMP responsiveness to the cadA gene (see results in part D),
it was expected to bind nuclear protein($). Therefore, a gel mobility shift assay
was perfonned using the labeled S fragment and box2 element as a competitor
(Fig. 3.18A). The box2 element effectively competed for binding to the nuclear
protein, 75% of the shifted protein was competed off by a 10-fold excess of
unlabeled box2 and a 50-fold molar excess of unlabeled box2 element almost
completely competed off the bound nuclear protein (Fig. 3.1 88). These results
suggested that box2 alone was able to shift the nuclear protein. To test this
hypothesis, labeled box2 was incubated with the nuclear extract and
competition was carried out using different amounts of unlabeled box2 DNA or
a mutant box2 DNA (Fig. 3.19A). Indeed, box2 alone effectively shifted a
nuclear protein, and this shifted protein was specific for box2 as it was almost
completely competed off by a 50-fold molar excess of unlabeled box2 DNA (Fig.
3.19C). When the box2 cor8 sequence (GTGTG) was mutated to (GTTGA) and
used to compete with the labeled wildtype box2 DNA, the cornpetition activity
was dramatically decreased, and -50% of the nuclear protein remained bound
with the labeled wildtype box2 DNA at 50-fold molar excess of mutant box2
DNA. This experiment not only demonstrated the nuclear protein binding
specificity of box2, but also suggested that the core sequence (GTGTG) in box2
was important in its protein binding activrty. Occasionally, two additional slower
rnigrating bands were obsewed. To detemine whether these bands were also
specific DNA-protein cornplex, a control experiment was perfomed in the
presence of increasing amounts of the non-specific competitor poly(dl-
dC).poly(dl-dC). These two bands were both competed off completely by the
addition of 3 pg of poly(dl-dC).(dl-dC) in the reaction mixture. On the contrary,
the major shifted band was not significantly affected by the addition of extra
non-specific corn petit or (Fig. 3.1 96).
Since the cadA gene is induced by cAMP pulses, it was of interest to
detemine whether the shifted nuclear factor is also affected by cAMP pulses.
NC4 cells were developed in the presence or absence of cAMP pulsing for 6 h
and used for nuclear extract preparation. Gel mobility shift assays (Fig. 3.20A)
were perfomed using labeled probe S. With the cAMP pulses, the nuclear
factor that binds to the cadA sequence was increased by almost 2.5 fold (Fig.
3.208). This suggests that cAMP induction of the cadA gene during
developrnent could in part be through a direct increase in the amount of the
specific trans adivating factor or through activation of DNA-binding function of
such a factor.
The above expenments suggest that box2 may be the major CRE of the
cadA gene. But assays of deletion constructs show that deletion of sequence
from -631 to -359 also leads to 40% decrease of PSF responsiveness and 60%
decrease of CAMP induction. Box1 is the only GC-rich element within this -631
to -359 region. Thus, it was of interest to test if box1 is also able to bind nuclear
protein(s). Complementary oligonucleotides corresponding to the boxl
sequences were annealed, labeled with "P, and used to perfonn gel shift
assays using cold boxl as cornpetitor (Fig. 3.21). No specific band was shifted
by boxl, suggesting that boxl has, at best a lower affinity for the trans activation
factor, and does not function as a major CR€.
A Axenically grown cells
O 4 8 4 8
- CAMP + CAMP
B Bacterially grown cells
O 4 8 4 8
- CAMP + CAMP
Hours of development
Flgure 3.1. Effect of dlfferent growth condltlonr on cAMP Induction of
c8dA expm8lon. Axenically (A) and bacterially (B) grown KAX3 cells
were developed separately in 17 mM phosphate buffer with (+) or without (-)
cAMP pulsing. Total RNA was isolated from cells at 0,4, and 8 h of
development and subjected to Northern Mot analysis. a-32P-labeled
DdCAD-1 cDNA was wed as a probe (Yang et al., 1997).
Figure 3.2. Effects of exogenour cAMP on the transcription rate of
the eadA gene. NC4 cells were collected, washed free of bacteria, and
suspended in 17 mM phosphate buffer, pH 6.4, at a density of 2 x 10' cells/ml.
Cells were divided into 3 containers and development was carried out on a
platforni shaker rotating at 180 rpm. Beginning at 2 h of development, cells in
one container were given CAMP pulses (2 x IO-^ M final concentration) at 7 min
intervals (+, sti@led bar), while cells in a second container were given a single
dose of cAMP at 0.5 mM final concentration at 1 h, followed by an hourly
addition of O. 1 mM of cAMP (++, black bar). Cells in the third container served
as the control (white bar). Cells were collected at 4 h and 8 h and nuclei were
isolated for the nuclear run-on assay as described in Methods. The labeled
transcripts were purified and equal amounts of radioactivity were used to
hybridize with the cloned cadA cDNA, pactin cONA (positive control), and
Bluescript DNA (background control) immobilized on Hybond-N nylon filter.
Each slot contained 10 pg of plasmid DNA linearized with restriction enzyme,
denatured and neutralized before blotting. (A) Autoradiograms of the nuclear
runsn assays. (B) Relative rates of cadA gene transcription estimated by
densitometric scanning of autoradiograms. The values represent results of a
typical experirnent normalized to kactin. Density of the +8 h sample was set as
100. This experirnent was repeated twice with different nuclear preparations.
4 8 +4 +8 ++4 ++8
Hours of development
O 4 8
Hours of development
Figure 3.3. Saquencing strategy and fe~friction map of the cadA
genomic DNA. (A) Sequencing strategy. Clones (dsO-8) starting from
different sites upstream of the cadA coding region were created by
unidirectional digestion with exonuclease 111 (0-8 min) and sequenced with
pBluescript universal forward primer to read frorn 5'03'. Primers (PO to P3, Sel
to Se3, Se4 to Se-4) were also used to sequence different regions in both
directions. Sequencing reactions were done with the T i Sequencing Kit
(Pharmacia Biotech) by the dideoxynucleotide termination method (Sanger et
al., 1977). (8) Restriction map of the cadA g8n8. The black bars represent the
t h e exons. The locations of translational start and temination codons are
also indicated.
EcoRl EcoRl Ava II Xba I Hincll Haelll Mbol
I 1 I I
Figure 3.4. (A) Nucleotide sequenco of the cadA gane. The first
transcriptional start site is labeled +1, and the two additional start sites are shown in
boldface type. The two introns are shown in lower case. The deduced amino acid
sequence of DdCAD-1 is shown in the one letter code. The consensus polyadenylation
signal sequence (AATAAAA) is undedined. The polyadenylation site is mariced by a
triangle. (B) Sequences of the two intronaxon boundaries.
-2425 GAATTCCCATTTAGTTGGAAAAGAT TTAACCATGGTGATCAAATTAAATCAACAGCAACAACAACAACAAGTAGTATTGATTTAA ATCAAAATATTTATCAGACTCAATTAAAACTTAAAACTTTAAAA-CTTTTAAATAATGGTTTAGA ATATGATTTATCAAATCAATTTAATGATTATUMTTTmGmTTTTGTmCTAT ACCATTTGATCAATTGATTTCAATGTCmTATTTAGTTGACATTTTAATATTTTC AAATCTTGATCAT*XCATGGAAAATAATATTACAGTTCTATTATCTWTCATTW TTTAATGAGTTAAATTCGATGATTCATTCAAATTTACCTTGTGAATTTGTAAAGATAATT GAAAGTACCTCCCTCATTTGGTTCCATTTTCCAAATTTCCCAAATWTAGTCTCAAGTTG TAGTATTTTCGATAGATTATATACAGGTATCATTCATGAACCAAAATCTTTAGAACCACA ACATCTTAATAGTAGTATCAAGTCATTGAAAATGAAATMTCTCTACCATCGATAAGAATCCA AATCAACTATTCCCCAATGATTGAAAACAATCTCTGGTATTATTATCACTTGGTTAAACAATT GGCTTTCAGAACAAAAGATTAAATTTTAAAGATTTATC-TAGTTTTATMTTWCU TTGTTTATAATGGTTCAATTAATTTTKCATTAGTCTATACTATmTCTTTAGTAGATCT CTTGTTAAACTATTaACATTACTTCATCTTAAATCTCAACAAGTTTATTATCATCGTGAT TGTTCAAAATATATAGAACCAAAATGGGTTATAAAGTTAAGACCAATTTTACAACAACAA C A A C a A C A A C A A C A A C A A A T T A A T C T T A A A C A A A C T A T T G AATTTTAATTCAGTTCAGCMCCaATAATTACCTCACAATCAATAAAATCTTCTACTAAT ATAACAACACCAATACCACCAACTATaCCTTACCATCAATACCATCTTCATTUCAAC AAAACCAACTGAAATAATACCACCAAAAATAAATAAACCAATAATAGAATCACCTACAAT ACTTAATATTCAAACATTATCATCTCAATAACTAATCATAATAATAATAATAATAATAAT AATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAAT AATAATAATAATAATAATAATAATAATAATAATAATAATAATGGTGATAATAATAATATT AATAATGTTAAAAATAATGATAATCAATTAACAACTAAAATTGAAATTGAAAATGAAATT TCATTAATTATAAAATTTTATATGATAGAGAGMTTTTTATTMTTTTTMTGW AACAZIAATTAACAGTAGAGTTTAAAGAAAGATTTAAAGGAAaAATTAGGTATTGATTGT TTTTCAGTTGTATTAAATTTAAAAAAAGAAGATTTGGACCTCATTMGATGCCATTAGC AAAGAGAAATGAATTGATCAATTTTAACAAAATTAGAGATACCTCmGATATWGAGA ATATCAATTTAACACCAGTGGTMTAATAATTCATCACAGACCTCCAATGTTCAACAACT TTTAAAAACTTTTTAATTGATATTGTTGGTTTTGGAAAATCAAAAACAATTATCAGAGGAA TTAGGTTTCATGTCTTTAATTAGTAGTATTATTCTGATGGTGATGATGGTTATGATGAATTAA TATCAGAATTATTAATAATTTTAAAATCTGCAACTTGTTTCAACTTMTMTCAATTAA AAAGAAATAAAAATAAAATAAAAAAAAAAATAAAAAATATAATGWTWTMT AGAATGACAAAAAAAAAAAAAAAAAAAAAAATTATTG~TAAAAAAT~TTGTAAATGG TATTTTTCATTTTTTTAATTTTTTTTTTTTT?ITTTTTTACCACACCAATGATTTAAATCT CACAAACAAGATAAACTGTTTTTTTTTTTTTGGMTTTTTTTTTTTTTTTTTATTATTTTT TGTAAGTGGGGTGTGAGATTTAAATCATTGGGCTATGTTGGGGTTG~CGGT'TTT TTTGGATTATTTTCACACAAGCTGTTTTTTTTTGGTGTGGTZUWUATT24lWUACTTCT aTTTATGAACGACAAGGGCATGATTAATTGAAAAAAGAGTATATTTTCATTTCCCMCA GAAAATATCATTATCACACACTTAATCTAGATATTAGWTTTATMTTATTTGMTU TAAAAATTATTATATTAATTTTATTATTATTTTmTTmTTTTTTTTTTTTTTTTTTTTTT TTTTTTGTTTTTATCATTAAAAAAAAAACTATAAAAAGAAATTTTTTTTGTTTTCTTTTC
+1 WNATATTTCAAAAGTAAAAGGTATAGTATTAAAAATTAAAAAATGTCTGTTGATG
M S V D CAAATAAAGTAAAATTCTTCTTTGGTAAAAACTGCACTGGTGAATCATTTGAATACJUICA A N K V K F F F G K N C T G E S F E Y N AAGGTGAAACTGTAAGATTCAACAATGGTGATAAATGGAATGATAAATTCATGTCATGTT K G E T V R F N N G D K W N D K F M S C TGGTTGGTTCAAATGTTAGATGTAACATTTGGGAGCATAATGAAATTGgtaagtatttat L V G S N V R C N I W E H N E I aaatattttctatttttataaattataaataatattaataggtttaatttattattatta ttttaattttaaaatatagATACTCCAACTCCAGGAAAATTCCAAGAATn;GCTCAAGGC
D T P T P G K F Q E L A Q G AGTACAAACAATGATTTAACCTCAATAAATWTCTTTCAAAGTTCCAAGTCTTACCAGGA S T N N D L T S I N G L S K F Q V L P G
GCTTTTCAATGGGCAGTTGATGTTAAAATTGTCAACAAAGTTAATTCAACTGCTGGTTCA A F Q W A V D V K I V N K V N S T A G S TATGAAATGACCATTACTCCATACCAAGTTGATAAGGTTGCTTGCAAAGATGGTGATGAC Y E M T I T P Y Q V D K V A C K D G D D
TTTGTTCAATTGCCAATTCCAAAACTTACTCCACCAGATTCTGMTTGTTAGCCATTTA F V Q L P I P K L T P P D S E I V S H L
ACAGTTCGTCAAACACATACACCATATGACTATgtaagtttattattattattattatga T V R Q T H T P Y D Y ttattattaaatatataattaattttctcttttattaatttttaatttttatctttctata aataaaaaagGTTGTAAATGGAAGTGTTTACTTTAAATACTCCCCAACAACTGGCCAAGT
V V N G S V Y F K Y S P T T G Q V TACAGTTATTAAAAAAGATGATGAGACATTCCCMGMTATGACTGTTACACMGATGATM T V I K K D E T F P K N M T V T Q D D N
TACATCTTTCATCTTTAACTTAAACTCTGAAAAATAAAACAATATGTTTTTTTTTCTCTT T S F I F N L N S E K *
TAAGAAAACTTTlVlAT~TTATGAATTTCAGAAAWATTTAGGTCTTATTTTTAT A
TTTATTTTTTTTTTTATTTGTTTCGATATTGGCTTAATTTGTAAATMCTTCATGTACAC C A A C G A T A T G A C A A A T T A A A A T T G G G T C A T T G C G A T G C TCAGGGTTTCTAATTAGAAAATAAATCAGAAGTCAATAAAATTTCTTCAACTGGATCTTG GTGAAACGAAGTGGTCTAATTTAATTATTTTTATTTATTTTTATaMGCmMTATT TTTTTTTTTTTTTTTTTTTTTTTTTATGACCTCAACCAATTAGGCAGTGTCTGAGTTTTA TTTAATTTTATTTTGGTAGTATTTAAAAATTCTTCTTAATTATTTATGTAATTAGTATTGAAT GAACAATAATGAACTAAATGTTCTGGTACATAAGTTCTCATTAATTGTGAATTC
B
lntron 1:
Intronll:
Mapping of transcription start sites of the cadA gene
Primer G A T C extension
Figure i S 8 Mapping al the transcrlptlonal start sites of the cadA gene by uslng prlmet ettenslon. The primer extension lane contains the
extended products analyzed on a sequencing gel. The extended products
were obtained on annealing the primer SEI (5'AATGAlTCACCAGTGCAG31)
with total RNA. SE1 is complementary to the nucleotide sequence between
+92 and +IO9 in aie coding region. Arrows indicate the 3 end of the three
major primer extended products. The G, A, T, C lanes represent aie sequence
of the noncoding strand extenâed from aie same primer.
AAAAAAAAAAAAAAAAATTA=TAaAAaaTAATTGTAAATGGTA-m box1
T T A A ~ A m A c C A C A C ~ T G A T T T A A A T C T C A C A A A C A A G A T A A
AC box3
~ G A m A A A T C A T T G C % C T A T G m ~ C G G - T T A ~ box4 *(-279) boxk ACACAAGCTG-TGTGGTAAAAAA'ITAAAAAq
t (-244) CTTCTCATTTATGAACGAC
AAGGGCATGATTAA-GAGTATA- + (-1 94)
"PITCCCAACAGAAAATATCATTA~ box4 ÇACACACTTAA TAGATATTAGAAaATTTATAATTATTTGAATAATAAATTA'MiATA
Figure 3.6. Characterirticr of the upstream iagion d the wdA gene. The 5'-flanking
sequence of the cadA gene contains several OC-rich boxes (underîined). The consensus
TATA box and the translation start site (ATG) are shown in boldface type. The three
transcription initiation sites are shown in boldface type and undeilined. The vertical arrows
and the nucleotide positions shown in brackets indicate positions of truncation of the 5'-
flanking DNA in subsequent promoter constructs. These sequences are fused to the lacZ
reporter gene at nucleotide position +66 (see Figure 3.8 for details).
box 11-455) TTTTTTAATTTMTACCACAC~ box 1c (-267) TGGTGTGGT-W- box 2(-354) GTGGGGTGTGA box 3(-323) GTTGGGGWG box 4(-287) TCACACA box 4(-166) TCACACACT
boxl/lc TWTGTOGT boxl /lc . box2 GTGGGGTGTaA box3 GTTGGGGT-TQA box2. box4c AGTGTGTGA
box3.
- TGGTGTGGT - - GTGGGGTGTGA -- GTTGGGGTTG - - AGTGTGTGA
Figure 3.7. OC-rich elements present in the upstream sequence of
thecadA gene. (A) Sequences and locations of different boxes. c
means complementary sequence of the corresponding box on the
opposite strand. (B) Alignment of the boxes and cornparison with the
gp80 consensus CRE, the core sequence and nucleotides shared by al1
four boxes are shown in boldtype. (C) Arrows represent repeated
sequences within each box and between different boxes. TGGT is
repeated twice in boxl and box Ic, which also contain the GTGTG
sequence present in box 2, and box4c. Box 3 has a repeat of GITG.
GTGG is present in bo&, box 1 and box Ic.
Figure 3.8. Construction of the plarmid DdGaI(831). Primer p-631
(containing an €CORI site) and primer P48 (containing a Bgrll site) were used in
PCR amplification of the 5I-flanking DNA of cadA gene. The resulting PCR
product contained the cadA DNA 5' sequence from -631 to +66. After digestion
with EcoRl and Bgrll, the PCR product was cloned into the transformation vector
pDdGall7H; resulting in the constnict DdGal(-631), which contained the cadA
promoter sequence from -631 and a short coding sequence (6 aa) fused in
frame to the reporter gene lacZ (A) Schematic drawing of the cadA gene
indicating positions of primers. Thin lines in the arrows denoting primers refer
to EcoRl site (foward primer) or 8gAl site (reverse primer) added 5' on the
sequences. See M & M for exact sequences of primers. (0) Map of the the
expression vector pDdGall7H' into which the cadA 5' sequence fused in frame
to lacZ.
ECORI-
Forward primer (p-631)
TATA ATG
Bglll
Reverse primer (p48)
PCR product clonad into PSK and cut out with €cal + Bglll
, P t erminat or \
pDdGall7H'
8.50 Kb - . -. 2. 2- '.
AcünB
promotor r
Figure 3.9. Expression of the reporter gene of DdGal(-631) In
transtecteâ cells. KAX3 cells were transfected with DdGat(-631)and
transfectants resistant to G418 were pooled. (A) Cells were grown in
association with the bacteria Klebsiella aerogenes. After 3 days, cells were
collected and developed in the presence (+) or absence ( 0 ) of cAMP pulses.
Cell sarnples were collected at O and 8 h and p-galactosidase activity was
measured (see M & M). Experiments were repeated three times. For each
experiment, assays were done on three replicate samples. The fold induction
was comparable each time although the activity of &galactosidase differed.
The results of one experiment are presented here. (6) Transfected cells were
cultured axenically to a cell density of -5 x 10' celldml in the presence of 20
pglmlG418 and developed in the presence (+) or absence (-) of cAMP pulses
for 8 h. RNA samples were extracted from O and 8 h cells for RNA blot analysis
and then probed with [32P]-labeled IacZDNA. As a control, the expression of the
endogenous cadA gene was examined using r2P]-labeled cadA cDNA.
Bacterially grown cells
Axenically grown cells
Ratio ( 8h +/- CAMP)
Hour of development
Units of (mu) p-galactosi- dase act ivity
8-
57.33 8.44
O
* 0.79
8+
122.67 s 18.22
Figure 3.10. B-Galactosidare activity in cells transfected with
different deletion constructs. (A) Schematic drawings showing the
deletion constructs that were cloned into the expression vector pDdGal l7H-.
(8) The relative levels of p-galactosidase activity of different constructs are
shown (black bars) and values represent the mean +/- S.D. of >3 assays of a
representative experirnent. On the right hand side, the relative levels of $-
galactosidase activity are normalized to that of DdGal(-631). Details of the
construction of these vectors are described in Materials and Methods. The
cadA DNA sequence and GC-rich boxes contained in these constructs are
shown in Fig. 6. All constnicts starting at different positions were transfected
into KAX3 cells. G418-resistant transfectants for each construct were pooled
and grown in HL4 medium to a cell density of -5 x 106 celldml in the presence
of 20 pg/rnl 6418. Cells were collected in their vegetative growth phase. The
cell samples were collected and frozen at -20% and al1 the samples were
assayed for f3-galactosidase activity in the same experirnent. For each
constnict, 2 to 3 successful transfections were obtained and enzyme activity
assays were repeated at least twice for each transfectant.
A Starting positions of deletion constiucts
B Relative pgalactosidase activity
-ô31
-359
-279
-244
-194
-154
AlSA
Figure 3.11. Expression Ievelr of the reporter geme in vegetative
cella. Plasmids containing different deletion constructs were transfected into
KAX3 cells and transfectants for each constnict were pooled. Transfectants
were grown in HL-5 medium to a cell density of -5 x 106 cellsJml in the
presence of 20 pg/ml 641 8. Vegetative cells were collected for total RNA
extraction. As a negative control, RNA was extracted from cells transfected with
the vector A1 SABamGal which contains the basal promoter of the actin 15 gene
(Williams et al., 1989). (A) Total RNA was separated in agarose gel and RNA
blots were hybridized to the p-galactosidase cDNA (upper panel) or the cadA
cDNA probe (bottom panel). (6) Northem blots were exposed for various
pefiods of time to ensure lineatity of response. Expression level of the lac2
gene in a representative experiment was determined by densitometric tracing
and al1 signals were normalized to their respective cadA mRNA signal. All
values were then nomalized to that of pcadA(-194)Gal, which was taken to be
1. The numbers on the X-axis represent deletion positions of the constructs
used in cell transfection. The levels of lacZmRNA of constructs DdGat(454)
and A15ABamGal are too low to be detectable.
Figure 3.12. Effects of cAMP on lac2 expression in transfectants
containing different deletion constiuctr. (A) 041 8-resistant
transfectants were cultured in HL-5 and then collected for development in liquid
culture either in the presence (+) or in the absence (-) of cAMP pulses for 8 h.
Northem blots of total RNA extracted from different transfectants were probed
with r2P]-labeled fbgalactosidase cDNA (top panel) and [32P]-labeled cadA
cDNA (middle panel). The bottom panel shows the rRNA levels of each sample.
(B) Quantitative analysis of cAMP induced lac2 expression in the deletion
transfectants. Left, schernatic drawing represents the deletion positions of 5'
cadA DNA sequence inserted into the transformation vector pDdGall7H; All of
these different constmcts were transfected into KAX3 cells and stable
transfectants were selected and used in the Noithem blot analysis shown in (A).
Cells transfected with A1 SABamGal were used as the negative control.
Experiments were repeated three times. Right, expression levels of IacZin a
representative experiment were determined by scanning Northem blots (A)
exposed for various amounts of tirne. Exposures in the linear region of
response were quantified and the fold induction of IacZmRNA by cAMP pulses
was calculated. N.D. = not detectable.
2341c 4 tEaa ATG
-359 m
Figure 3.13. Features of the 80 bp sequence between -359 and
-280. (A) Sequence of the 80 bp DNA. The GC-rich boxes are shown in
boldface type and the two anows indicate the positons and directions of two
putative TTG box-like sequence. Fragment from -338 to -286 represent the
putative PR€ that is cloned as in (C). (B) Comparison of the putative caaM TTG
boxes within the 80 bp region with the Dictyostelium consensus lTG box. The
position of the first nucleotide of each of the mû-containing sequence is
indicated inside the brackets. (C) Cloning strategy of the construct
DdGal(PRE). The final structure of DdGal(PRE) contains the cadA putative ?RE
sequence cloned into the Xbal site of DdGal(4 54). DdGal(-1 54) contains the
cadA 5'- sequence starting from -1 54 which is fused to the lac2 reporter gene.
(-359) GTAAGTGGGGTGTGAGATTTAAATC ATTG box 2 P
P
GGCTATQTTGGGGTTGAAAAAAACGGTTT box 3 (-27)
TTTTGGATTATTTTCACACAAG (-280) box 4
B Putative TTG boxes of the mdA gene
consensus sequence (di8coidin-l y and anrannorldase)
TIY3XTIY3
Figure 3.14. Cloning strategy of the cadA CRE elsment. (A)
Sequence of the synthesized oligonucleotide containing three copies of box2
and four restriction sites. (B) Heterologous transformation vector that contains
the inactive Dictyostelium actin 15 promoter fused with the lac2 reporter gene
and the cloning sites of the synthesized oligonucleotides.
A Synthesized oligonucleotide sequences containing box2 (3x) sequence and restriction sites
Bglll box 2 BamHl
GTAAGTGGGGTGTQAGATGTAAGTGGGGTGTOAGAT box 2
0
box 2 ggatccagatctgc-3'
BamHI Bglll
Vector used for heterologous promoter analysis and cloning strategy of box2 element
DdGal WGaI A1 SA DdGaI MGal (-154) (PR€) BamGal (CRE 1X) (CRE 3X)
Figure 3.1 5. p-galactosidase activities of cells transfected with
constructs containing the putative PSF elements. KAX3 cells were
transfeded with the plasmids DdGal(PRE), DdGal(-l54), DdGal(CRE 3X),
DdGal(CRE 1 X), and A1 5ABamGal Stable transfectants were selected
with 041 8. Transfectants were grown in shaking HL-5 medium in the
presenœ of 50 pgfrnl of 6418. Cells were collected at 4 x 1 0 celldml and
&galadosidase activity was measured. For each transfectants, assays
were repeated three times with separate amples and CPRG was used as
the substrate foi P-galadosidase assay.
Figure 3.16. Enzyme activities of cdls transkctad with constructs
containing the putative CRE element. KAX3 cells were transfected with
the plasmici A1 SABamGel, DdGal(CRE 1 X ), OdGal(CRE 3X), DdGal(PRE), and
DdGal(4 54). Stable transfectants were selected with 0418. To test the CRE
responsiveness, transfectants were grown in association with bacteria on SM
agar plates. After developrnent in shaking phosphate buffer with (+)/without(-)
CAMP pulses, cells were collected and B-galactosidase activity was measured.
For each transfectant, three separate expen'ments were done with different
samples and CPRG was used as the substrate for b-galactosidase assay.
I I I I I I I I I I I I
O 8- 8+ O 8- 8+ O 8- 8+ O 8- 8+ 0 8- 8+ Al5A DdGal Dd Gal DdGal DdGal BamGal (CRE 1X) (CR€ 3X) (-1 54) (PRE)
Probe S robe L
Fig. 3.17. Gel rhift assays uslng Iabeîed probe S or Probe L
DNAs and dlffemnt amounk of cold S 88 competitor. Left
lane, no protein added. Each binding reaction contains 15 pg of
nuciear protein, 10,000 cpm of labeled probe, 2 pg pIy(dl-dC).
poly(dl-dC), 300 CIghl of BSA, and different amounts of cold
competitor (fragment S). Samples were run on a 4% native polyacryiamide
gel which was then subjecteâ to autoradiography.
- -
Probeo s IO 20 50 alone
Fokl cornpetitor Fold competitur
Flgure 3.1 8. Gel moblllty rhift a w y uslng the DNA fragment S
(-359 to -280). (A). The nuclear extract was prepared f rom NC4 cells
developed for 6 h in the presence of CAMP pulses. The reaction mixture was
incubated with the [32~]-labeled DNA fragment in the presence of O to 50-fold of
the unlabeled box 2 oligo (5'-tdagaGfAAGTGGGGTGTGAGAT-3')- A sample
containing probe alone, without nudear extract, was induded as a background
control. (B). Quantitative analysis of the result was carried out by scanning the
autoradiogram and the percentage of bouid DNA relative to that s h b d in the
absence of competitor was calculated.
Figure 3.19. Gel mobility shift assay udng [32P]-labeled box2 DNA
as the probe. (A) The nuclear extract was prepared from NC4 cells
developed for 6 h in the presence of CAMP pulses. The reaction mixture was
incubated with different amounts of unlabeled wildtype or mutant box2 DNA as
competitor. Wildtype box2 5'-tctagaGTAAGTGGGGTÇTQAGAT-3';
mutant box2 5'-tctagaGTAAGTGGGGmGAT-3'. The mutated nucleotides
are underlined. The specifically shifted band is indicated by an amw.
(B) Nuclear extract was incubated with labeled box2 DNA in the presence of
different amounts of the non-specific competitor poly(dl-dC)(dl-dC). (G)
Quantitative analysis of the relative amount of labeled probe bound in the
presence of different cornpetitors.
O 1 0 2 0 3 0 4 0 5 0 ~ Fold cornpetitor
Figure 3.20. Effect of cAMP on the relative amount of DNA
fragment S shifted by nuclear factor. (A) NC4 cells were developed in
the presence or absence of cAMP pulses for 8 h and then collected for nuclear
extract preparation. Samples were incubated with the r2P]-labeled DNA
fragments. The specifically shifted band is indicated by an arrow.
(B) Experiments were repeated twice with different nuclear extracts. Similar
results were obtained. Quantitative analysis was carried out by scanning the
shifted bands of the result shown.
probe O 5 10 20 50 100 alone
Fold cornpetitor
fig. 3.21. Gd dilft amay udng =P t a W boxl as a probe and
dltferent amounts of cdd boxl as compaltor. Expiments were
repeated twiœ with different nudear extra&. Left lane, no protein
added. Each binding reacüon contains 15 pg of nudear protein,
10,ûûû cpm of labeled boxl , 2 pg pdy(dldC).poly(dl-dC), 300 pglhil
of BSA, and different amount of cotd boxl . Samples were run on a 4%
native polyaayiamide gel which was then subjected to autoradiography.
Chapter 4
DISCUSSION
A. Features of the cadA Promoter Region
I have successfully cloned and sequenced the cadA gene, which
encodes the D. discoideum Ca2+-dependent cell adhesion molecule DdCAD-1.
The transcribed region of the gene contains two short introns (Fig. 3.4), and
both introns share consensus intron-exon boundary sequences with other
Dictyostelium genes (Poole and Firtel, 1984). The protein coding regions are in
complete agreement with Our previously reported cDNA sequence (Wong et a/.,
1996). The cadA gene shares many features in common with other
Dictyostelium genes. It contains multiple transcription initiation sites with one
major and two minor sites -50 bp upstream from the translation start site ATG
(the first transcription initiation site designated as +1). The putative TATA box is
located at -31, which is identical to the consensus Dictyostelium sequence
(Kimmel and Firtel, 1983). A typical T-stretch also exists preceding the
transcription initiation sites.
The sequences in the 5'-flanking DNA that confer PSF and CAMP
responsiveness to the cadA gene have been investigated. An interesting
feature of the cadA gene is the presence of several G/C-fich elements in the 5'-
flanking DNA. Several of these repeated elements share homology with the
cell adhesion molecule gp80 sequences that have been implicated in
transcriptional regulation (Desbarats et al., 1 992). Specifically, al1 of the OC-
rich elements (with the exception of box3) contain the core sequence GTGTG
present in the CRE of gp80.
Consistent with other reports that a number of Dictyostelium genes that
are expressed during early development are also activated by PSF during
axenic growai (Rathi et al., 1991 ; Rathi and Clarke, 1 W2), expression of the
cadA gene is highly augmented in axenically grown vegetative cells. In
bacterially grown KAX3 cells, transcription of the cadA gene is developmentally
regulated and is stimulated by exogenous cAMP pulses (Fig. 3.1). Here, I have
shown that the S-flanking region of the cadA gene starting from -631 is capable
of conferring both PSF and CAMP responsiveness on the reporter gene (Figs.
3.8 and 3.9).
Using deletion analysis of this -631 sequence fused to the lac2 reporter
gene, I have demonstrated that the 80 bp sequence between -359 and -280
contains the major PSF and cAMP response activity. This 80 bp region
contains three GIC-rich elements, box2 (GTGGGGTGTGA), box4 (TCACACA),
and box3 (GTTGGGGTTG). Both box2 and box4 contain the core sequence
GTGTG which is found in the gp8O CREs (Desbarats et al., 1992), suggesting
that they could be the major CREs of the cadA gene. Another box4 sequence is
located downstream at position -1 66, and deletion constructs starting from -279,
-244, and -1 94 al1 contained box4. Transfectants of these three constructs
show only a marginal level of cAMP responsiveness, suggesting that box4
alone rnay not be suflicient to confer a high level of cAMP responsiveness, thus
leaving box2 as the only candidate to be the major CRE. Indeed, experiments
with the heterologous conslructs DdGal(CRE 3X and 1 X), containing 3 copies
and 1 copy of box2 respectively, confimi that box2 can function in a
heterologous promoter to confer cAMP induction (Fig . 3.1 6).
This result was also confimed by gel mobility shift assays using the box2
element as the probe. Interestingly, mutation of the box2 sequence
TGGGGTGTGA to TGGGGTTGAA leads to poor nucleer protein binding activity
(Fig. 3.19). And the mutant box2 sequence is almost identical to that of box3,
suggesting that box3 may not function as a CRE. Results of gel mobility shift
assays using both wildtype and mutant foms of box2 also suggest that the
nuclear protein has stnngent nucleotide sequence requirement for binding , and
that the GTGTG core sequence is important in protein-DNA interaction. Further
work using DNA methylation interference assays should help to pinpoint
specific bases that are involved in protein binding.
On the other hand, the fragment L (-279 to -154) of the cadA 5'-sequence
also shifted the nuclear protein (Fig. 3.17). Further deletion from
-279 to -244 and -194 maintains a similar level of -2-fold cAMP induction.
Analysis of the DNA sequence reveals two WC-rich elements, boxlc
(TGGTGTGGT) at position -267 and box4 (TCACACACT) at position -166.
Among these three deletions, only the construct starting from -279 has the
boxlc element, and the other two (-244 and -1 94) contain only the box4
element. This suggests that box4 alone is enough to confer the low level of
cAMP induction in these three constructs. The addition of boxl c to box4 does
not increase the cAMP induction of the reporter gene. Results obtained wlh the
-631 to -359 deletion constructs show that deletion of box1 leads to a 40% and
60% decreases in their PSF and cAMP responsivenesses, respectively. Of
course, other sequences instead of boxl within this reg ion might be responsible
for the decrease. Gel mobility shift assays with boxl oligonucleotides show that
boxl does not bind any nuclear protein (Fig. 3.21), further suggesting that boxl
may not be a real CR€.
The function of box4 was confirmed by a deletion of the 5' DNA to
position -1 54 eliminating box4. cAMP response was completely abolished In
transfectants containing this deletion constnict (Fig 3.12). In some late genes
(see discussion below), the G-boxes that bind to the transcription factor GBF
(Schnitzler et al., 1994) contain two separate GC-rich domains that are both
involved in protein binding (Hjorth et al., 1989; 1990; Datta and Fiitel, 1 987). It
is possible that although box3 alone may not function as an effective CRE, its
proximity with box2 in the 80 bp region facilitates its synergism with the function
of box2 and thus box3 could function as an enhancer of box2 CRE. Also, box4
rnay as well synergize with box2 to confer higher level of cAMP resonsiveness.
On the other hand, cAMP induction of gene expression may also depend
on the availability or activation of trans-acting factors. When cells were
developed in the presence of cAMP pulses, the shifted amount of labeted probe
increased by -2.5-fold. This suggests that cAMP induction of the cadA gene
dunng development may depend on an increase in the amount of the specific
trans-acting nuclear factor that binds to the cadA gene ppromoter, leading to a
higher transcription rate of the cadA gene. Altematively, cAMP may enhance
the binding affinity of pre-existing transcription factor(s) by post translational
modifications, such as protein phosphorylation.
B. The PSF responsive elements in early genes
As shown by the deletion constructs, the 80 bp fragment of the cadA
gene also confers the major PSF responsive activity. It is expected that PSF
responsive element (PRE) lies within this region. A TTG- box, TTGXTTG, has
been proposed to mediate the PSF induction of Discoidin I y (Vauti, et al., 1990).
Indeed, cornparison with the PSF responsive elements of Discoidin-l y, a-
mannosidase, and a-fucosidase genes (Vauti, et al., 1990; Schatzle et aL,
1993; May et aL, 1989; Schatzle et al, 1992) reveals several l'TG box-like
sequences within this 80 bp region (Fig. 4.1). The upstream sequence,
TATGlTG, shows sequence similarity to other ï T G boxes. Therefore, it is
possible that this region contains the major PSF activity, and those T'ïG box-like
sequences could be the PREs. Interestingly, experiments with the transfectants
containing DdGal (PRE), OdGal (CR€ 3X), and DdGal(CRE 1X) show that
although DdGal (PRE) exhibits a high level of PSF response activity, a single
copy of box2 also has PSF responsiveness. Three copies of box2 can also
confer a high level of PSF response activity (Fig. 3.15). These results suggest
that either TG-box can only function in some particular genes or PSF
responsiveness can be confered by different DNA sequences besides the TTG-
box. It may be possible that the PSF response does not require stringent
sequence but rather some type of arrangement of certain WC rich sequences in
the promoter region. The fact that 3 copies of box2 confer > 6-fold higher PSF
responsiveness than the 1 copy suggests that synergism between some
structural element rather than TTG boxes may play a key role in the PSF
response activity. Consistent with this possibility, deletion analysis of the a-
mannosidase 5'-flanking sequence showed that a 145 bp region (-504 to -364)
was responsible for PSF resonsiveness as well as starvation induction of the
gene. This 145 (Fig. 4.2) region is AT-rich and contains no typical TTG box
except two 7bp sequences (CAATAAA and TAAACAA) showing lirnited
sirnilarity with the TTG box-like sequences. On the other hand, a consensus
ïTG box element (TTGGTTG) is lacated at -1 95 to -1 98 and the constnict
containing this box alone did not show any PSF induction (Schatzle et al.,
1993), suggesting that either TTG box is not invohred in a-mannosidase
induction by PSF or other DNA sequences rnay be required. Also, the
sequence requirement for PSF induction rnay not need any particular stringent
sequence specificity, but rather a fragment of -100 bp in length with several
GC-rich or TTG-like sequence regions separated by AT-rich regions as
happened in both cadA and a-mannosidase genes( Fig. 4.2).
The PSF signal transduction pathway is cornplex. PSF has not been
purified, and it is possible that the PSF response rnay involve multiple
components. Since CMF was not required for the PSF induction of the a-
mannosidase gene (Schatzle et al., 1 993), PSF and CMF rnay function
independently. Studies using signal transduction mutants have shown that G-
proteins (both Ga2 and Gp) are not required for the PSF response (8urdine and
Clarke, 1995 ). On the other hand, the inhibitory effects of folate on discoidin-l
production require a heterotrimeric G-protein, suggesting that PSF and folate
rnay function through different signaling pathways. Folate rnay function through
its receptor (Nandini-kishore and Frazier, 1981 ; Greiner et al., 1992) in a G-
protein dependent pathway. PKA rnay regulate the sensitivity of individual cells
to PSF, but in pka- mutants, 3% of total cells were responsive (Burdine and
Clarke, 1995 ). Interestingly, although PKA is important in the PSF response,
intracellular cAMP is not involved, since aca' strain responds to PSF like
wildtype axenic cells. Thus, normal adenylyl cyclase activity is not required for
the function of protein kinase A in the prestanration response (8urdine and
Clarke, 1 995). This result is consistent with several obsewations made in other
laboratories (Mann and Fiitel, 1993; Pitt et al., 1993; lnsall et al., 1994),
suggesting that PKA is capable of acting independently of cAMP in
Dictyostelium cells. This indicates that PKA rnay be activated by some other
means.
So far, neither PSF nor the nuclear factor involved in PSF induction has
b e n identified. Only a few gene promoters have been analyzed by deletion
constnicts for PSF responsivenesses, including discoidin ly, a-fucosidase, and
a-mannosidase. Early studies of the a-mannosidase gene reported two
pathways leading to its transcriptional induction, one induced by PSF during
vegetative growth and the other by starvation (Schatzle et al., 1991). Schatzle
et al. (1 993) found that aithough the PSF-responsive pathway required protein
synt hesis, the starvation induction pat hway did not.
ad4 PSF element (-335): ATCAlTG
(-331R): A m
(-325): TATGTTG
Discoidin I y ï l G box(œ392): TTGATTG
a-mannosidase TTG box (-468R): I l TA lTG
(-390R): n G m A
(-1 92): TTGGTTG
a-fucosidase consensus: ATGATTG
Fig. 4.1. Cornparison of the putative PSF responsive elements in
the cadA gene with PSF responsove elements in other
Dictyostelium genes. The positions of the elements relative to the cap site
are indicated in brackets.
C. cAMP Response Elements in Early Gene Promoters
Although much is known about late gene transcription in Dictyostellium,
the regulation of early gene has not been as widely studied. The first
Dictyostelium cAMP response element (DCRE) that is used for early gene
activation by extracellular cAMP was identified in the a-L-fucosidase (ALF)
gene A1 1 H2 (May et al., 1991). The 22 bp DCRE is able to bind nuclear protein
and confer nM cAMP induction to the A1 1 HZ gene and in the heterologous
promoter of the A1 5ABam vector. Another well-characterized Dictyostelium
CRE is found in the CS& gene encoding the cell adhesion molecule gp80,
which is also induced by nM cAMP pulses early in development (Desbarats et
al., 1992). This element alone is able to shift nuclear protein and confer cAMP
responsiveness on a heterologous promoter.
The sequence of the Dictyostelium CREs does not show any similarities
with CREs in higher eukaryotes which confer regulation by intracellulai cAMP
(Roesler et al., 1988). The synthetic higher eukaryote CRE does not compete
with binding to the DCRE (May et al., 1991). This excludes that the proteins
binding to the DCRE are related to the CREB proteins (Hoeffler et al., 1988;
Gonzales et al., 1989). Interestingly, the A l 1 H2 CR€ element does not
compete for the binding of csaA box1 (Desbarats et al., 1992), suggesting that
different nuclear proteins are involved in the regulation of early genes in
response to extracellular cAMP pulses. Consistent with t his observation,
cornparison of the two elernents does not show any similarity. In contrast, the
cadA gene CREs show a high degree of sequence similarity with those in the
csaA gene, suggesting that the same transcription factor may be used for the
CAMP induction of DcfCAD-1 and gp80 expression (Fig.4.3). Similar to the csaA
CRE, box2 element of the cadA gene can also confer cAMP induction to a
heterologous promoter (Fig. 3.16), suggesting that box2 is indeed a CRE.
D. WC-rich Elements of Late Genes
The genes that are induced eariy during aggregation require a pulsed
signal of cAMP every 6-7 min, whereas the induction of the prestalk, prespore,
and other late genes requires a higher, continuous level of CAMP. A high
concentration of cAMP induces late gene expression through activation of cell-
surface cAMP receptors through an intracellular signal transduction pathway
that does not appear to require a rise in intracellular cAMP or the activation of
CAMP-dependent protein kinase A (Schaap and Van D M 1985; Schaap et al.,
1987; Firtel and Chapman 1990). The structural organization of the upstream
regions of several late cell-type specific genes have been widely studied
(Fig.4.4; Hyjorth et al, 1989; 1990). The best characterized elernent, CP2 GBRE
(G-box regulatory element), consists of 5' and 3' segments that differ only in two
nucleotides within the G-rich core. A full level of expression requires the
presence of both domains at an appropriate spacing (Datta and Firtel 1987,
1988; Pears and Williams 1987; 1988). Methylation interference experiments
show that G/C residues within both half of the DG1743 and CP2 elernents are
protected. Protection of a given G residue in this assay is indicative of that
particular G residue being essential for cornplex formation. Binding of the
nuclear factor to both of these oligonucleotides appean to involve a region -20
bp long. For both of the binding sites, the most strongly protected G residues
are spaced -10 bp apart. In vivo transformation and in vitro binding assays
(Hjorth, 1990) both suggest that the CPI G-rich sequence behaves as a half-
element. A single copy shows negligible binding to the nuclear extract,
whereas a dimer binds very well. The CP2 GBRE has a bipartite structure.
Neither half of the element is capable, itself, of inducing expression in vivo nor
shifting a nuclear factor in vitro, although the cornplete element can shift a
single band. Moreover, methylation interference has revealed that G residues
located within both domains are required for DNA binding. Mutation of these
two Gs reduced significantly the binding affinity of GBF and shows no promoter
activity in CP2A30. This bipartite structure may suggest that the nuclear factor
interacts with these elements as either a homo- or a heterodimer.
Affinity column using the CAE-1 of the SP60 promoter has led to the
purification and cloning of the GBF which also binds the CP2 element very well
(Schnizler et al., 1994). Although disruption of the G8F gene arrests
development at the loose aggregate stage and activation of cell-type-specific
genes is eliminated, expression of genes involved in eariy aggregation such as
gp8O is largely unaffected.
cadA box2 ( -3 5 9 ) : GTAAG-GATT
b0x4R (-166) : A-TGA
csaA box1 ( - 3 0 6 ) : TTAGTGGT-TT.
box4 (-655) : AGTTT-TTAC
A 1 IHS DCRE ( -3 4 4 ) : AACJUGATTGGTTAGATAGATT
Higher eukaryote consensus CRE: TGACGTCA
Fig. 4.3. Comparison of cadA elements with CRE rlementr of other
genes. The positions of the elements relative to the Cap site are indicated.
The A1 1 H2 DCRE is underlined. The core sequence GTGTG is in bold type.
CP 1 (-31 2): AAAGGAATGGGGAITC
(-21 O): AAAGGAATGGGGGITC -- - DG 1 7-B3 (-257): AACACAÇTÇAAACAÇAÇATGAACACAÇAAT
-84 (-1 56): AACTCCACCATACCCCCAA - - UDPGPP (-386): TACACCCCAAATGGGGTAGT - -
SP60 CAE-1: AAATGGGGTAAATTAGTGTGTGGGTGTGTGAAA
Fig. 4.4. Cornparison of GIC rich element sequencer. The positions
of the elements relative to the cap site are indicated. Direct or inverted repeat
structures within a given element are indicated by arrows above the G/C-rich
sequences. The bases that are most protected in methylation interference
assays are underlined. The UDPGPP element has a palindromic structure,
whereas the DG1 7-83 element appears to have a repeated structure.
E. Perspectives
To date, only a few nuclear factors that are involved in regulation of late
and cell-type specific gene expression have been identified in Dictyostelium.
The G-box binding factor GBF is involved in the regulation of late gene
expression in the post-aggregation stages in a Gd-independent manner. The
other factor, a STAT is responsible for the DIF induction of cell differentiation
during late development. No transcription factor has been identified that is
involved in eaily gene expression.
Many extracellular signals, such as PSF, folk acid, CMF, CAMP, and DIF,
affect cell growth, differentiation, and morphorgenesis of Dictyostelium. The
gene encoding the conditioned medium factor CMF has been cloned and
studied. However, the prestatvation factor PSF is only partially characterized.
Both CMF and PSF are involved in early gene regulation, with PSF functioning
before starvation at -4 generation before cells exit exponential growth while
CM F functions imrnediately upon starvation. The other factors are simple
chemicals; while folic acid and cAMP act through cell-surface receptors, DIF can
pass through membrane and possibly act by binding a cytosolic receptor.
The signaling pathways controlling gene expression when Dictyostelium
cells respond to environmental changes are cornplex. Cloning of the nuclear
factors responsive to PSF, CMF and nM cAMP pulses will help to connect these
signaling pathways. Early work in our laboratory to clone the csaA CRE binding
protein was unsuccessful, due to insuffkient protein being made available by
affinity purification. The DIF response factor has been cloned by the method of
nanoelectrospray mass spectrometry (Wilm and Mann, 1996; Wilm et al., 1996).
The application of this extremely sensitive method could help to sirnplify the
cloning of new nuclear factors. Successful cloning of transcripton factors
responsible for early gene should increase our understanding of gene
regulation during early developrnent as well as the communication between
oarly and late signaling pathways.
REFERENCES
Abe, T., Early, A., Siegert, F., Weijer, C., and Williams, J. (1 994) Patterns of cell movement within the Dictyostelium slug revealed by cell type-specific, surface labeling of living cells. Cell 77, 687-699.
Adachi, H., Hasebe, T., Yoshinaga, K., Ohta, T., and Sutoh, K. (1994) Isolation of Dictyostelium discoideum cytokinesis mutants by restriction enzyme mediated integration of the blasticidin S resistance marker. Biochem. Biophys. Res. Commun. 205, 1808-1 81 4.
Alton, f .H., and Lodish, H.F. (197ï) Developmental changes in messenger RNA and protein synthesis in Dictyostelium discoideum, Dev. Biol. 60, 180- 206.
Aubiy, L., Maeda, M., Insall, R., Devreotes, P.N., and Firtel, R.A. (1997) The Dictyosteiium mitogen-activated protein kinase ERK2 is regulated by Ras and CAMP-dependent protein kinase (PKA) and mediates PKA function. J. Biol. Chem. 272, 3883-3886.
Balint-Kurti, P., Ginsburg, Ga, Rivero-Lezcano, O., and Kimmel, A.R. (1 997) rZIP, a RING-leucine zipper protein that regulates cell fate determination during Dictyostelium development. Development 124, 1203-1 21 3.
Beug, Ha, Katz, F., Gedsch, G. (1973) Dynamics of antigenic membrane sites relating to cell aggregation in Dictyosteîhm. J. Cell Biol. 56, 647-658.
Blumberg, D.D., and Lodish, H.F. (1980) Changes in the messenger RNA population during differentiation of Dictyostelium discoideum. Dev. Biol. 78, 285-300.
Blusch J., Alexander S., and Nellen, W. (1995) Multiple signal transduction pathways regulate discoidin 1 gene expression in Dictyostelium discoideum. Differentiation 58, 253-260.
Bouaro, S., and Ponte, E. (1 995) Cell Adhesion in the life cycle of Dictyostelium. Experientia, 51, 1 1 75-1 188.
Brai, S., and Siu, C-H. (1993) Characterization of the cell adhesion molecule gp24 in DicZyostelium discoideum: mediation of cell-cell adhesion via a ~ a 2 + dependent mechanism. JO Biol. Chem. 268,24902-24909.
Brodie, C., Klein, C., and Swierkosz, JO (1 983) Monoclonal antibodies: Use to detect developmentally regulated antigens on D. di&deum. Cell32,
Brown, J. M., Briscoe,C., and Fidel, RA. (1997) Dictyosîe/ium A Model System for Cell and Developmental Biology, Universal Press, Inc., 245-265.
Burdine, V., and Clarke, M. (1995) Genetic and physiologic modulation of the prestawation response in Dictyoste/ium discoideum. Mol. Biol. Cell6, 31 1-325.
Cardelli, J.A., Knecht, D.A., Wunderlich, R., and Oimond, R.L. (1 985) Major changes in gene expression occur dunng at least four stages of development of Dictyoste/ium discoideum. Dev. Biol. 1 1 0, 147-1 56.
Ceccarelli, A., McRobbie, S.J., Jennyn, KA., Duffy, K., Early, A., and Williams, J.O. (1 987) Structural and functional characterization of a Dicfyostelium gene encoding a DIF inducible, prestalk-enriched mRNA sequence. Nuc. Acids Res. 15,7463-7476.
Ceccarelli, A., Mahbubani, H., and Williams, J.G. (1 991) Positively and negatively acting signals regulating stalk cell and anterior-like cell differentiation in Diciyostelium. Cell 65, 983-989.
Ceccarelli, A., Mahbubni, H.J., Insall, R., Schnitzler, G., Firtel, RA., and Willianms, J.G. (1992) A G-rich sequence element common to Dictyoste/ium genes which differ radically in patterns of expression. Dev. Biol. 152, 188-193.
Chang, W-T, Newell, P.C., and Gross, J.D. (1 996) Identification of the cell fate gene stalky in Dictyosîelium. Cell 87,471 -481.
Chalfie, M., Tu., Euskirchen, G., Ward, W.W., and Prasher, D.C., (1994) Green fluorescent protein as a marker for gene expression. Science 263, 802- 805.
Chodosh, LA. (1 994) DNA-proten interactions. In "Current Protocols in Molecular Biology' Supplement 24, 12.0.1 -1 2.2.1 0.
Clarke, M., Kayman, S.C. and Riley, K. (1987) Density-dependent induction of discoidin-l synthesis in exponentially growing cells of Dictyostelum discoideum. Differentiation 34, 79-87.
Clarke, M., Yang, J., and Kayman, S. (1 988) Analysis of the prestawation response in growing cells of Dictyostelium discoideum. Dev. Genetics 9, 31 5-326.
Clarke, M., Dominguez, N., Yuen, I.S., and Gomer, R.H. (1 992) Growing and starving Dityostelium cells produce distinct density-sensing factors. Dev. Biol. 152,403-46.
Clarke, M., and Gomer, R.H. (1995) PSF and CMF, autocrine factors that regulate gene expression during growth and eariy development of Dictyostellium. Experientia 5 1 , 1 1 24-1 1 34.
Comb, M., Bimberg, N.C., Seashoitz, A., Herbert, E., and Goodman, H.M. (1 986) A cyclic AMP- and phorbol ester-inducible DNA element. Nature 323, 353-356.
Coukell, M.B., Appano, S., and Caneron, A.M. (1983) Isolation and characterization of cAMP unresponsive (frigid) agg regation-ûeficient mutants of Dictyostelium discoideum. Devel. Genet. 3, 283-297.
Datta, S., and Fiitel, RA. (1 987). Identification of the sequences controlling cyclic AMP regulation and cd-type-specific expression of a prestalk- specific gene in Dictyostelium discoideum. Mol. Cell. Biol. 7, 149-1 59.
Datta, S., and Firtel, R.A. (1988) An 80-bp cis-acting regulatory region controls cAMP and developmental regulation of a prestalk gene in Dictyostelium. Genes Dev. 2,294-304.
De Gunzburg, J., Part, D., Guiso, Na, and Veron, M. (1984) An unusual adenosine 3',5'-phosphate dependent protein kinase from Dictyostelium discoideum. Biochemist ry 23, 3805-38 1 2.
Desbarats, L., Lam, T.Y., Wong, L.M., and Siu C-H. (1 992). Identification of a unique CAMP-response elernent in the gene encoding the cell adhesion molecule gp80 in Dictyostelium discoideum. J. Biol. Chem. 267, 19655- 19664.
Dingermann Tm, Reindl, N., Werner, Hm, Hildebrandt, M., Nellen, W., Harwood, A., Williams, J., and Nerke, K. (1 989) Optimization and in situ detection of Eschernia coli beta-galactosidase gene expression in Dictyostellium discoideum. Gene 85,353-362.
Dohlman, H.G., Thorner, J., Caron, M.G., and Lefkowitz, R.J. (1991) Mode1 systems for the study of seven-t ransmembrane-segment receptors. Ann. Rev. Biochem. 60, 653-6e8.
Early, A. E., and Williams, J .Ga (1 988) A Dictyostelium prespore-specific gene is transcriptionally repressed by DIF h vitro. Development 103,519-524.
Early A.E., and Williams, J.G. (1 989) ldentification of sequences regulating the transcription of a Diciyostelium gene selectively expressed in prespore cells. Nuc. Acids Res. 17, 64736484.
Early, A.E., Gaskell, M.J., Traynor, D. and Williams, J.O. (1993) Two distinct populations of prestalk cells within the tip of the migratory Dictyostelium slug with differing fates at culmination. Development 1 18, 353-362.
Egelhoff, T.T., Brown, S.S., Manstein, W., and Spudich, J.A. (1989) H yg rom ycin resist ance as a selectable marke r in Dictyostelium discoideum. Mol. Cell. Biol. 9, 19651 968.
Erdos, G.W., Raper, K.B., and Vogen, L.K. (1 973) Mating types and macrocyst formation in Dictyostelium discoideum. Proc. Natl. Acad. Sci. U.S.A. 70, 1 828-1 830.
Esch, R.K., and Firtel, R.A. (1991) CAMP and cell sorting control the spatial expression of a developmentally essential cell-type-specific ras gene in Diciyosfelium . Genes Dev. 5,9-21.
Esch, R.K., Howard, P.K., and Firtel, R.A. (1992) Regulation of aie Dicfyostelium CAMP-induced, prestalk-specific DdrasD gene: identification of cis-acting elements. Nuc. Acids Res. 20, 1325-1 332.
Faure, M., Franke, J., Hall, A.L., Podgorske, G.J., and Kessin, RmHD (1990) The cyclic nucleotide phosphodiesterase gene of Dictyosfelium discoideum contains three promoters specific for growth, aggregation, and late development. Mol. Cell. Biol. 10, 1 92 1-1 930.
Ferreri, K., Gill, G., Montminy, M., (1 994) The CAMP-regulated transcription factor CREB interacts with a component of the TFllD complex. Proc. Natl. Acad. Sci. USA 91, 121 0-1 3.
Firtel , R.A., Van Haastert, P.J.M., Kimmel, A.R., and Devreotes, P.N. (1 989) 6 protein linked signal transduction pathways in development: Dicfyostelium as an expenmental system. Cell58, 235-239.
Firtel, RA., and Chapman, A.L. (1 990) A role for CAMP-dependent protein kinase A in eariy Diclyostellium development. Genes Dev. 4, 18-28.
Firtel, R A . (1 991) Signal transduction pathways controlling multicellular development in Dictyostellium. Trends Genet. 7, 381 -388.
Firtel, RA. (1 995) lntegration of signaling information in controlling cell-fate decisions in Dictyostelium. Genes Dev. 9, 1427-1 444.
Firtel, R.A. (1 996) Interacting signaling pathways controlling multicellular developrnent of Dicfyostelium. Cum. Opin. Genet. Dev. 6,545-554.
Fontana, D.R. (1993) Two distinct adhesion systems are responsible for EDTA- sensitive adhesion in Diclyostellium discoideum. Different iat ion 53, 1 39- t 47.
Fontana Dm R. (1 995) Dictyostelium discoideum cohesion and adhesion. In: Richardson PD, Steiners M (eds): The Principles of Cell Adhesion" CRC Press, Florida, pp. 63-86
Fosnaugh, K.L., and Loomis, W.F. (1989a) Spore coat genes SP60 and Sp70 of Dictyoste/ium discoideum. Mol. Cell. Biol. 9, 521 5-521 8.
Fosnaugh, K.L., and Loomis, W.F. (1989b) Sequence of the Dictyostelium discoideum spore coat gene SP96. Nuc. Acids Res. 17, 9489.
Fosnaugh, K.L., and Loomis, W.F. (1 991) Coordinat0 regulation of the spore coat genes in Dictyostelium discoideum. Dev. Genet. 12, 123-1 32.
Fosnaugh, K.L., and Loomis, W.F. (1 993) Enhancer regions responsible for temporal and cell-type-specific expression of a spore coat gene in Dictyostelium. Dev. Biol. 157,3848.
Franke, J., Faure, M., Wu, Lm, Hall, A.L., Podgorski, G.J., and Kessin, R.G. (1 991) Cyclic nucleotide phosphodiesterase of Dictyostelium discoideum and its glycoprotein inhibitor: structure and expression of their genes. Dev. Genet. 12, 104-1 12.
Fried, M., and Crothers, D.M. (1 981) Equilibria and kinetics of lac repressor- operator interactions by polyacrylamide gel electrophoresis. Nucl. Acids R ~ s . 9, 6505-6525.
Fukuzawa, M., Hopper, Ne, and Williams, Je (1997) cudA: a Dictyostelium gene with pleiotropic effects on cellular differentiation and slug behavior. Development 1 24, 271 9-1 728.
Gao E., Shier P., Siu, C-H. (1992) Purification and partial characterization of a cell adhesion molecule (gp150) involved in postaggregation stage cell- cell binding in Dic~ostelium discoideum. Je Biol. Chem. 267,9409-941 5.
Garrod, Dm (1972) Acquisition of cohesiveness by slime mold cells prior to morphogenesis. Exp. Cell Res. 72,588-591.
Gaskell,M., Watts, D., Treffry, T., Jemyn, K.A., and Williams, J.G. (1 992) lmmuno-localization and separation of multiple prestalk cell types in Dictyoste/ium. Differentiation 51 , 1 il -1 76.
Gaskins, C., Clark, A.M., Aubry, Lm, Segall, J.E. and Firtel, RA. (1 996) The Dictyostelium MAP kinase ERK2 regulates multiple, independent developmental pathways. Genes Dev. 10, 1 18-1 28.
Geltosky, J., Weseman, J., Bakke, A., Lemer, R.A. (1979) Identification of a cell surface glycoprotein involved in cell aggregation in Dictyostelium discoideum du ring development. Cell 1 8, 391 -368.
Gerisch, G. (1980) Univalent antibody fragments as tools for the analysis of cell interactions in Dictyostelium. Cun: Top. Dev. Biol. 14, 243-270.
Gerisch, G. (1 987) Cyclic AMP and other signals controlling cell development and differentiation in Diciyoselium. Annu. Rev. Biochem. 56, 583-879.
Gill, O., Pascal, E., Tseng, Z.H., and Tjian, R. (1 994) A glutamine-rich hydrophobic patch in transcription factor Spl contacts the dTAFII 1 10 component of the Orosophila TFllD cornplex and mediates transcriptional activation. Proc. Natl. Acad. Sci. USA 91 , 1 92-1 96.
Ginsburg, G.T., Gollop, R., Yu, Y., Louis, J.M., Saxe, C.L., and Kirnmel, A.R. (1 995) The regulation of Dictyostelium development by transmembrane signaling. J. Euk. Micribiol. 42, 200-205.
Gollop, R., and Kimmel, A. R. (1997) Control of cell-type specific gene expression in Dictyostelium by the general transcription factor GBF. Development 124, 3395-3405.
Gomer, RH., Yuen, I.S., and Firtel, R.A. (1991) A secreted 80x103 Mr protein mediates sensing of cell density and the onset of development in Dictyostelium. Development 1 1 2, 269-278.
Gonzalez, GA., and Montminy, M.R. (1 989) Cyclic AMP stimulates somatostain gene transcription by phosphorylation of CREB at sering 133. Cell 59, 675-680.
Gonzatez, &A., Yamanoto, K.K., Ficher, W.H., Karr, D., Menzel, Ra, Biggs, III, W., Vale, W.W., and Montminy, M.R. (1 989) A cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its sequence. Nature 337, 749-752.
Greiner, R.A., Jacobs-Krahnen, D., Mutzel, Re, Malchow, O., and Wurster, B. (1 992) A 138-kDa glycoprotein from Dictyoste/ium membranes with folate deaminase and folate binding activity. J. Biol. Chem. 267, 5096-5101.
Gross, J. (1 994) Developrnental decisions in Dictyostellium discoideum. Microbiol. Rev. 58,330-35 1.
Gundersen, R.E., and Devreotes, P.N. (1 990) ln vivo receptor-mediated phosphorylation of a G-protein in Dictyoste/ium. Science 248, 591 -593.
Haberstroh, L., and Firtel, R.A. (1990) A spatial gradient of expression of a CAMP-regulated prespore cell-type-specific gene in Dictyoste/ium. Genes Dev. 4, 596-61 2.
Haberstroh, L., Galindo, J. and Firtel, R.A. (1991) Developmental and spatial regu lat ion of a Dictyostelium prespore gene: cis-acting elements and a
CAMP-induced, developmentally regulated DNA binding activity. Development 1 13, 947-958.
Hagiwara, M., Brindle, P., Harootunian, A., Armstrong, R., Rivier, J., Vale, W., Tsien, R., Montminy, M.R. (1993) Coupling of hormonal stimulation and transcription via the cyclic AMP-responsive factor CREB is rate limited by nuclear entry of protein kinase A. Mol. Cel. Biol. 13, 4852-59.
Hanakam, F., AlbrecM, Fm, Eckerskom, C., Matmer, M., and Gerisch, O. (1996) Myristoylated and non-myristoylated forms of the pH sensor protein hisactophilin II: intracellular shuttling to plasma membrane and nucleus monitored in real time by a fusion with green fluorescent protein. EMBO J. 15, 2935-2943.
Harloff, Cm, Gerisch, G., and Noegel, A., (1 989) Selective elimination of the contact site A protein of Dictyostdiurn discoideum by gene disruption. Genes Dev. 3,201 1 -201 9.
Harwood, A.J., and Dniry, L. (1990) New vectors for expression of the Ecoli l a d gene in Dic~yostdium. N ucleic Acids Research 1 8, 4292.
Harwood, A.F., Early, A., and Williams, J.G. (1 993) A repressor controls the timing and spatial localization of stalk celbspecific gene expression in Dictyostelium. Development 1 1 8, 1 041 -1 048.
Henikoff, S. (1984) Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28, 351 -359.
Hiorth, A.L., Khanna, N.C., and Firtel, R A . (1989) A transacting factor required for CAMP-induced gene expression in Dictyostelium is regulated developmentally and induced by CAMP. Genes Dev. 3, 747-759.
Hiorth, A.L., Pears, C., Williams, J.O. and Firtel, R.A. (1 990). A developmentally regulated tramacting factor recognizes dissimilar WC-rich elements controlling a class of CAMP-inducible Dktyostelium genes. Genes Dev. 4, 41 9-432.
Hoeffler, J.P., Meyer, T.E., Yun, Y., Jameson, J.L., and Habener, I.F. (1 988) Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental &NA. Science, 242, 1430-1 433.
Insall, R., and Kay, R.R. (1990) A specific OIF binding protein in Dictyostelium. EMJO J. 9,3323-3328.
Insall, R., Kuspa, A., Lilly, P.J., Shaulski, G., Levin, L.R., Loomis, W.F., and Devreotes, P.N. (1994) CRAC, a cytosolic protein containing a pleckstrin homology domain, is required for receptor and G proteinmediated
activation of adenylyl cyclase in Dictyostelium. J. Cell Biol. 1 26, 1537- 1 545.
Jain, R., Yuen, I.S., Taphouse, C.R., and Gomer, RH. (1 992) A density-sensing factor controls devekpment in Dictyostelium. Genes Dev. 6, 390- 400.
Jain, R. and Gomer, R.H. (1994) A developmentally regulated cell surface receptor for a density-sensing factor in Dictyostelium. J. Biol. Chem. 269, 9 1 28-9 1 36.
Jain, K., Brazill, D.T. , Cardelli, J.A., Bush, J., and Gomer, R.H. (1997) Autocrine factors controlling early development. In: DictyosteliumA Model System for Cell and Developmental Biology (Maeda, M., Inouye, K, and Takeuchi, I., eds), Universal Press, Inc., 21 9-234.
Jennyn, K.A., Duffy, K.T., and Williams, J.G. (1989) A new anatomy of the prestalk zone in Dictyostelium. Nature 340, 1 44-1 46.
Jennyn, K.A., and Williams, J.G. (1 991 ). An analysis of culmination in Dictyostelium using prestalk and stalk-specific cell autonomous markers. Development 1 1 1, 779-787.
Kamboj, R., Wong, L.M., Lam, T.Y., Siu, C-H. (1 988) Mapping of a cell-binding domain in the cell adhesion rnolecule gp8O of Dictyostelium discoideum. J. Cell Biol. 1 07,1835-1 843.
Kamboj, R.K., Gariepy, Je, Siu, C-H. (1 989) Identification of an octapeptide involved in hornophilic interaction of the cell adhesion rnolecule gp80 of Dictyostelium discoideum. Cell59,6 1 5-625.
Kawata, Te, Steel, J.B.. and Williams, J.O. (1 996) RNGB: a Dicfyostelium Ring finger protein that is specifically located in maturing spore cells. FEBS Lett. 386, 103-109.
Kawata, Te, Shevchenko, A., Fukuzawa, M., Jeimyn, K.A., Totty, N.F., Zhukovskaya, N.V., Sterling, A., Mann, M., and Williams, J.G. (1997) SH2 signaling in a lower eukaryote: a STAT protein that regulates stalk cell differentiation in Dictyostelium. Cell 89, 909-916.
Kay R.R. (1 997) DIF signaling. In: DiclyosteliumA Model System for Cell and Developmental Biology (Maeda, M., Inouye, K, and Takeuchi, I., eds), Universal Press, Inc., 279-292.
Km, B.L., Arias, J., Montminy, M.R. (1996) Adaptor-mediated recnritment of RNA polymerase II to a signal-dependent activater. J. Biol. Chem. 271 ,2373- 2375.
Kesbeke, F., SnaarJagalske, BE., and Van Haastert, P.J.M. (1988) Signal transduction in Dictyostelium fgd A mutants with a defective interaction between sudace cAMP receptors and a GTP-binding regulatory protein. J. Cell Biol., 107, 521-528.
Kimmel, A R , and Firtel, R.A. (1 982) In m e development of Dictyostelium discoideumn (Loomis, ed.) ?P. 234-324. Academic Press, New York.
Kimmel, AR., and Firtel, R.A. (1 983) Sequence organization in Dictyostelium: unique structure at the 5'-ends of protein coding genes. Nucleic Acids Research 1 1, 541 -542.
Kimmel, A.R., and Firtel, R.A. (1991) cAMP signal transduction pathways regulating development of Dictyostelium discoideum. Curr. Opin. Genet. Dûv. 1,383-390.
Knecht, D.A., Fuller, D.L., Loomis, W.F. (1987) Surface glycoprotein, gp24, involved in early adhesion of Dictyostelium discoideum. Dev. Biol. 1 21,277-283.
Knetsch, M.L.W., Epskamp, S.J.P., Schenk, P.W., Wang, Y., Segall, J.E., and Snaar-Jagalska, B.E. (1996) Dual role of cAMP and involvement of both G-proteins and Ras in regulation of ERK2 in DictyosteIium discoideum. EMBO J. 15,3361-3368.
Kosaka, Cm, and Pears, C. J. (1 997) Chernoattractants induce tyrosine phosp hory lat ion of ERK2 in Dictyostelium discoideum b y diverse signaling pathways. Biochem. J. 324, 347-352.
Kumagai, A., Pupillo, M., Gundersen, R., Miake-Lye, R., Devreotes, P.N., and Firtel, R A . (1989) Regulation and function of Ga protein subunits in Di~ly~~teliium. Cell57,265-275.
Kumagai, A., Hadwiger, J.A., Pupillo, M., and Firtel, RmAm (1 991) Molecular genetic analysis of two Ga protein subunits in Dicfyostellium. J. Biol. Chem. 266, 1220-1228.
Kuspa, A., Maghakian, O., Berge&, P., and Loomis, W.F. (1992) Physical mapping of genes to specific chromosome in Dictyostelium discoideum. Genomics 1 3,49961.
Kuspa, A., and Loomis, W.F. (1 992) Tagging developmental genes in Diciyostelium by restriction enzyme-mediated integration of plasmid DNA. Proc. Natl. Acad. Sci. USA 89,8803-8807.
Kuspa, A., and Loomis, W.F., (1 994) REMI-RFLP mapping in the Dictyostelium genome. Genetics 138, 665-674.
Kuspa, A., Dingermann, 1. and Nellen, W. (1995) Analysis of gene function in Oictyostelium. Experientia, 51, 1 1 1 6-1 1 23.
Kuspa, A., and Loomis, W.F. (1 996) Ordered yeast artificial chromosome clones representing the Dictyostelium discoideum genorne. PNAS, 93, 5562- 5566.
Kwok, R.P.S., Lundblad, J.R., Chrivia, J.C., Richards, J.P., Bachinger, H.P., Brennan, R.G., Roberts, S.G., Green, M.R., Goodman, R.H. (1994) Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370, 223-26.
Lalli, E., and Sassone-Corsi, P. (1994) Signal transduction and gene regulation: the nuclear response to CAMP. J. Biol. Chern. 269, 17359- 17362.
Lam, TeYs, Pickering, O., Geltosky, J., Siu, C-Hm (1981) Differential cell cohesiveness expressed by prespore and prestalk cells of Dictyostelium discoideum. Differentiation 30,22-28.
Lilly, P., Wu, Lm, Welker, D.L., and Devreotes, P.N. (1 993) A G-protein beta- subunit is essential for DiCtyostelium development. Genes Dev. 7, 986-
995. Lilly, P.J., and Devreotes, P.N. (1 994) Identification of CRAC, a cytosolic
regulator required for guanine nucleoüde stimulation of adenylyl cyclase in Dictyostelium. J. Biol. Chem. 269, 141 23-1 41 29.
Lilly, P.J., and Devreotes, P.N. (1995) Chemoattractant and GTP gamma S- mediated stimulation of adenylyl cyclase in Dictyostelium requires translocation of CRAC to membranes. J. Cell Biol. 129, 1659-1 665.
Loomis, W.F. (1 975) Dictyostelium discoideum. A Developmental System. Academic Press, New York.
Loomis, W.F. (ed.), (1 982) The development of Dictyostelium discddeum, Academic Press, New York.
Loomis, W.F. (1 987) Genetic tools for Dictyostelium discoideum. MMet Cell Biol. 28, 31-65.
Loomis, W.F. (1 993) Lateral inhibition and pattern fornation in Dictyostelium. Curr. Topics Dev. Biol. 28, 1-46.
Loomis, W.F., Kuspa, A., and Shaulsky, G. (1994) Gene discovery in OictyosteNum. Genetic Engin. 16, 49-64.
Loomis, W.F., Welker D., Hughes J., Maghakian O., Kuspa A. (1 995) lntegrated maps of the chromosomes in Dictyostelium discoideum. Genetics 141, 1 47-1 57.
Loomis, W.F., and Kuspa A. (1 997) DictyostelhA Model System for Cell and Developmental Biology, Universal Press, Inc., 15-30.
Louis, J.M., Sax III, CL., and Kimmel, A.R. (1 993) Two transmembrane signaling mechanisrns control expression of the cAMP receptor gene CAR1 during Dictyostelium development. Proc. Natl. Acad. Sci. USA 90, 5969- 5973.
Louvion, J-F., Scholder, J-C., Pinaud, S. and Reymond, C.D. (1991) Two independent promoters as well as S'untranslated regions regulate Dd ras expression in Dictyostelium. Nucleic Acids Research 1 9, 6 1 33-6 1 38.
Ma, P.C.C., and Siu, C-H. (1990) A pharmacologically distinct cyclic AMP receptor is responsible for the regulation of gp80 expression in Dictyostelium discoideum. Mol. Cell. Biol. 10, 3297-3306.
Maeda, M., Aubry, L., Insall, Re, Gaskins, Cm, Devreotes, P.N., and Firtel, R A . (1 996) Seven helix chemoattractant receptors transiently stimulate mitogen-activated protein kinase in Dictyostelium. Role of heterotrimeric G proteins. J. Biol. Chem. 271,3351 -3354.
Maeda, M. (1 997) DicfyosteliumA Model System for Cell and Developmental Bio togy, Universal Press, Inc., 1 93-203.
Maeda, M., and Firtel, R.A. (1 997) Activation of the rnitogen-activated protein kinase ERK2 by chemoattractant folic acid in Dictyostelium. J. Biol. Chem. 272,23690-23695.
Maniak, M., and Nellen, W. (1990) Two separable promoters control different aspects of expression of a Dictyostelium gene. Nucleic Acids Research 18, 321 1-3217.
Mann, S.K.O., and Firtel, R.A. (1987) cAMP regulation of early gene expression in Dictyostelium discoideum: mediation via the cell surface cyclic AMP receptor. Mol. Cell. Biol. 7,458-469.
Mann, S.K.O., and Firtel, R.A. (1 989) Two-phase regulatory pathway controls cAMP receptor-mediated expression of early genes in Dictyostelium. Proc. Natl. Acad. Sci. USA. 86, 1924-1928.
Mann, S.K.O., and Firtel, R.A. (1991) A devekpmentally regulated, putative serinehhreonine pretein kinase is essential for development in Dictyostelium. Mech., Dev. 35,899102.
Mann, S.K.O., and Firtel, R.A. (1 993) CAMP-dependent protein kinase differentially regulates prestalk and prespore differentiation during Dictyostelium development. Development 1 1 9, 135-1 46.
Mann, S.K.O., Brown. J.M., Bnscoe, Ce, Parent, Ce, Pitt, O., Oevreotes. P.N., and Firtel, RA. (1997) Role of CAMP-dependent protein kinase in controlling aggregation and postaggregative development in Dictyostelium. Dev. Biol. 183, 208-221.
Manstein, DeJm, Titus, M.A., De Lozanne, A., and Spudich, J.A. (1 989) Gene replacement in Dictyoste/ium: generation of myosin mull mutants. EMBO Je 8, 923-932.
May, Te, Kem, He, Muller-Taubenberger, A., and Nellen, W. (1989) Identification of a cis-acting element controlling induction of early gene expression in Dictyostelium discoideum. Mol. Cell Biol. 9, 653-4659.
May, Te, Blusch, J., Sachse, A., and Nellen, W. (4991 ) A cis-acting element responsible for early gene induction by extracellular CAMP in Dictyostelium discoideum. Mech. Dev. 33, 1 47-1 56.
Montminy, M.R., Sevarino, K.A., Wagner, J.A., Mandel, Ge, and Goodman, R.H. (1 986) Identification of a cyclic-AMP-responsive element within the rat somatostatin gene. Proc. Natl. Acad. Sci. USA 83,6682-6686.
Montminy, M.R., and Bilezikjian, L.M. (1 987) Binding of a nuclear protein to the cyclic-AMP response element of the somatostatin gene. Nature 328, 175-1 78.
Montminy, M. (1 997) Transcriptional regulation by cyclic AMP. Annu. Rev. Biochem. 66, 807-22.
Morrissey, J.H., and Loomis, W. (1 981) Parasexual genetic-analysis of cell proportioning mutants of Dictyostelium discoideum. Genetics 99, 183- 196.
Muller, K., and Gerisch, Ge (1978) A specific glycoprotein as the target site of adhesion blocking Fab in aggregating Dictyosfelium discoideum. Nature 274,445-449.
Murray, B.A., Niman, H.L., and Loomis, W.F. (1983) Monoclonal antibody recognizing gp80, a membrane glycoprotein implicated in intercellular adhesion of Dictyostelium discoideum. Mol. Cell Biol. 3,863-870.
Mutzel, Re (1 995) Molecular biology, growai and development of the cellular slime mold Dictyostelium discoideum. Experientia 51 , 1 1 03- 1 1 09.
Nandini-Kishore, S.G., and Frazier, W.A. (1 981 ) (3H) methotrexate as a ligand for folate receptor of Dictyostelium discoideum. Proc. Nat 1. Acad. Sci. U.S.A. 78, 7299-7303.
Nellen, W., Datta, S., Remond, C., Sivertsen, A., Mann, S., Crowley, T., and Fiitel, R.A. (1 987) Molecular Biology in DECiyostelium: tools and applications. Methods in Cell Biology 28, 67-1 00.
Newell, P.C., Williams, K.L., Kuspa, A., and Loomi, W.F. (1 993) In "Genetic maps: Locus maps of complex genomes (6th edition)."(O'Brien, ed.) PP. 3.1-3.10. CSH Lab. Press, Cold Spring Harbor.
Noegel, A, Gerisch, G., Stadler, J., Westphal, M. (1986) Complete sequence and transcnpt of a cell adhesion protein fiom aggregating Dictyostelium cells. EMBO J. 5,1473-1476.
Parent, C.A., and Devreotes, P.N. (1996) Molecular genetics of signal transduction in Dictyostelium. Annu. Rev. Biochem. 65, 41 1 -440.
Pavlovic, J., Haribabu, B., and Dottin, R.P. (1 989) ldentification of a signal transduction response element necessary for induction of a Dictyostelium discoideum gene by extracellualr cyclic AMP. Mol. Cell. Biol. 9, 4660- 4669.
Pears, C.J., and Williams, J.G. (1 987) Identification of a DNA sequence element required for efficient expression of a developmentally regulated and CAMP-inducible gene of DicZyostelium discoideum. EMBO J. 6, 195-200.
Pears, C.J., and Williams, J.G. (1988) Multiple copies of a G-rich element upstream of a CAMP-inducible Dictyostelium gene are necessary but not suff icient for efficient gene expression. Nuc. Acids Res. 1 6, 8467-8486.
Perrimon, N. (1996) Serpentine proteins slither into the wingless and hedgehog fields. Cell 86, 51 3-516.
Pitt, G.S., Milona, N., Borteis, J., Lin, K.C., Reed, R.R. and Devreotes, P.N. (1 992) Structurally distinct and stage-specific adenylyl cyclase genes play different roles in Dictyostellium development. Cell69, 305-315.
Pitt, G.S., Brandt, R., Lin, K.C., Devreotes, P.N. and Schaap, P. (1993) Extracellular CAMP is sufficient to restore developmental gene expression and morphogenesis in Dictyostelium cells lacking the aggregation adenylyl cyclase (ACA). Genes Dev. 7, 2172-2180.
Podgorski, G.J., Franke, J.M., Faure, M., and Kessin, R.H. (1989) The cyclic nucleotide phosphodiesterase gene of Dictyostelium discoideum utilizes
altemate promoters and splicing for the synthesis of mulüple mRNAs. Mol. Cell. Biol. 9, 3938-3950.
Poole, S. J., and Firtel, R A . (1984) Conserved structural features are found upstream from the three CO-ordinately regulated Discoidin I genes of Dictyostelium discoideum. J . Mol. Biol. 1 72, 204-221 .
Powell-Coffrnan, J.A., and Firtel, R.A. (1994) Characterization of a novel DictyosteIium discoideum prespore-specific gene, PspB, reveals consewed regulatory sequences. Development 120,1601 -1 1.
Rao, Y., Wu, X.-Fe, Gariepy, J., Rutishause, U., and Siu, C.-H. (1992) Identification of a peptide sequence involved in homophilic binding in the neural cell adhesion molecule NCAM. J. Cell Biol. 11 8, 937-949.
Rathi, A., Kayman, S.C., and Clarke, M., (1 991) Induction of gene expression in Dictyostelium by prestarvation factor, a factor secreted by growing cells. Dev. Genetics 12, 82-87.
Rathi, A., and Clarke, M. (1992) Expression of eariy developmental genes in Dictyostelium discoideum is stimulated during exponential growth by an autocrinedependent mechanism. Mechanisms of Development 36, 173-1 82.
Reymond, C.D., Gomer, R.H., Mehdy, M., and Firtel, R A . (1984) Developmental regulation of a Dictyoste/ium gene encoding a protein homologous to mammalian ras protein. Cell39, 141 -1 49.
Reymond, CD., Schaap, P., Veron, M., and Williams, J.G. (1995) Dual role of CAMP during DiciyosteIium development. Experientia 51, 1 166-1 174.
Roesler, W.J., Vandenbark, G.R., and Hanson R.W. (1 988) Cyclic AMP and the induction of eukaryotic gene transcription. J. Biol. Chem. 263, 9063- 9066.
Rogers, K. C., et al, (1 997) Dictyoste/ium A Model System foi Cell and Developmental Biology, Universal Press, Inc., 1 63-1 72.
Saga, Y. and Yanagisawa, K. (1 982) Macrocyst development in Dictyostelim discoideum. 1. lnduction of synchronous development by giant cells and biochemical anaiysis. J. Cell Sci. 55, 341-352 .
Sanger, F., Nicklen, S., and Coulson, A R . (1977) DNA sequencing with chain- terminating inhibiton. Proc. Natl. Acad. Sci. U.S.A. 74,5463.
Sassone-Corsoi, P. (1 994) Goals for signal transduction pathways: linking up with t ranscriptional regulation. EMBO J. 1 3,471 7-4728.
Saxe, C. L. III, Johnson, R.L., Devreotes, P.N., and Kimmel, A.R. (1991) Expression of a cAMP receptor gene of Dictyostelium and evidence for a multigene family. Genes Dev. 5, 1-8.
Schaap, P., and Van Driel, R. (1 985) Induction of postaggregative differentiation in Dictyostelium discoideum by CAMP. Evidence of involvement of the cell surface cAMP receptor. Exp. Cell. Res. 1 59, 388-398.
Schaap, P., Van Lookeren Campagne, M.M., Van Driel, R., Spek, W., Van Haastert, P. J.M., and Pinas, J. (1 986). Postaggregative differentiation induction by cyclic AMP in Dictyostelium: intracellular transduction pathway and requirement for addlional stimuli. Dev. Biol. 1 18, 52-63.
Schaap, P., M., Van Lookeren Campagne, M., Van DM, R.V., Spek, W., Van Haastert, P.J.M., and Pinas, J. (1987) Postaggregative differentiation induction by cAMP in Dictyostelium: l ntracellular transduction pathway and requirement for additional stimuli. Dev. Biol. 1 1 8, 52-63.
Schazle, J., Rathi, A., Clarke, M., and Cardelli, J. (1 991) Developmental regulation of the a-mannosidase gene in Dictyostelium : Control is at the level of transcription and is affected by cell density. Mol. Cell. Biol. 1 1, 333903347.
Schatzle, J., Bush, JO, and Cardelli, J. (1 992) Molecular cloning and characterization of the structural gene coding for the developmentally regulated lysosomal enzyme, alpha-mannosidase, in Dictyostelium discoideum. J. Biol. Chem. 267, 40004007.
Schatzle, J., Bush, J., Dharrnawardhane, S., Firtel, R.A., Gomer, R.H. and Cardelli, J. (1 993) Characterization of the signal transduction pathways and cis-acting DNA sequence responsible for the transcriptional induction during growth and development of the lysosomal a-
Mannosidase gene in Dictyostelium discoideum. J. Biol. Chem. 278, 1 9632-1 9639.
Schinitzler, G. R., Fischer, W.H., and Firtel, R.A. (1 994). Cloning and characterization of the G-box binding factor, an essential component of the developmental switch between early and late development in Dicfyostelium. Genes Dev. 8,502-514.
Schnitzler, G.R., Briscoe, C., Brown, J.M., and F M , R.A. (1995) Serpentine cAMP receptors may act through a G protein-independent pathway to induce post aggregative development in Dictyostelium. Cell81, 737- 745.
Schulkes, Cm, and Schaap, P. (1 995) CAMP-dependent protein kinase activity is essential for preaggregative gene expression in Dictyostelium. FEBS Lûtt. 368,381 -384.
Segall, JE., Kuspa, A., Shaulsky, G., Ecke, M., Maeda, M., Gaskins, C., Firtel, RA., and Loomis, W.F. (1995) A MAP kinase necessary for receptor- mediated activation of adenylyl cyclase in Dictyostelium. J. Cell biol. 128,405413.
Shaulsky, G. and Loomis, W.F. (1996) Initial cell type divergence in Dictyostelium is independent of DIF-1. Dev. biol. 174,214-21 0.
Siu, C-H., Lam, T.Y., and Choi, A.H.C. (1 985) Inhibition of cell-cell binding at the aggregation stage of Dicfyostelium by monoclonal antibodies directed against the contact site A glycoprotein. J. Biol. Chem. 260,16030-1 6036.
Siu, C-H., Lam, T.Y., and Wong, L.M. (1988) Expression of the contact site A g lycoprotein in Dictyostelium discoideum: quant itat ion and developmental regulation. Biochim. Biophys. Acta 968, 283-290.
Siu, C-Hm (1 990) Cell adhesion molecules in Dictyostelium* BioEssays 1 2,357- 362
Siu, C-Hm, Harris, T J.C., Wong, E.F.S., Yang, C., Sesaki, H., and Wang, J. (1997) Cell adhesion molecules in Dictyostelium. In: DictyosteliumA Model System for Cell and Developmental Biology (Maeda, Y. et al., eds), Universal Press, Inc., 11 1-121.
Spudich, J.A. (ed.), (1 987) Dictyostelium discoideum: Molecular approaches to cell biology. Meth. Cell Biol. 28.
Stemfeld, J., and David, C.N. (1982) Fate and regulation of anterior-like cells in Dictyostelium slugs. D ~ v . Biol. 93, 111-1 18.
Sun, T.J., Van Haastert, P.J.M., and Devreotes, P.N., (1990) Surface cAMP receptors mediate multiple responses during development in Dictyostelium: evidenced by antisense mutagenesis. J. cell Biol. 1 10, 1 549-1 554.
Sun, T.J., and Devreotes, P.N. (1991) Gene targeting of the aggregation stage cAMP receptor CAR1 in Dictyostelium. Genes Dev. 5, 572-582.
Sussman, M. (1 987) Cultivation and synchronous rnorphogenesis of Dictyostelium under controlled experimental conditions. Meth. Cell Biol. 28, 9-29.
Tasaka, M., Hasegawa, M., Nakata, M., Orii, H., Otaki, T., and Takeuchio, 1. (1 992) Protein binding and DNasel-hypersensitive sites in the cis-acting
regulatory region of the spore-coat SP96 gene of Dictycmtelium. Mech. D ~ v . 36, 105-1 15.
Taylor, J. D., Ackroyd, A. J., and Halford, S.E. (1994) DNA-Protein Interactions: Principles and Protocols. Methods in Molecular Biology, 30, 263-279. (Kneale, G.G. ed), Humana Press Inc., Totowa, NJ.
Triezenberg, S.J. (1992) Primer exptention. In "Current Protocols in Molecular Biology' Supplement 20, 4.8.1-4.8.5.
Van Haastert, P.J.M., Bishop, J.D., and Gomer, R.H. (1996) The cell density factor CMF regulates the chemoattractant receptor CAR1 in Dictyoste/ium. J . Cell Biol. 1 34, 1543-1 549.
Van Haastert, P.J.M. (1 995) Transduction of the chemotactic cAMP signal across the plasma membrane of Dictyostelium cells. Experientia 51 , 1 144-1 154.
Van Haastert, P. J. M. (1997) Transduction of the chemotactic cAMP signal across the plasma membrane. In: DicfyoseIiumA Model System foi Cell and Developmental Biology (Maeda, M., Inouye, K, and Takeuchi, I., eds), Universal Press, Inc., 1 73-1 91.
Vauti, F., Morandini, P., Blusch, J., Sachse, A. and Nellen, W. (1990) Regulation of the Discoidin I y gene in Dicfyostelium discoideum: Identification of individual promoter elements mediating induction of transcription and repression by cyclic AMP. Mol. Cell. Biol. 10, 4080- 4088.
Wang, B., and Kuspa, A. (1997) Dictyostelium development in the absence of CAMP. Science, 277,2510254.
Williams, J.G., Ceccarelli, A., McRobbie, S., Mahbubani, H., Kay, R.R., Early, A., Berks, M. and Jermyn, K.A. (1987) Direct induction of Dicfyostelium prestalk gene expression by DIF provides evidence that DIF is a morphogen. Cell49, 1 85-1 92.
Williams, J.G., Duffy, K.T., Lane, D.P., McRobbie, S.J., Harwood, A.J., Traynor, O., Kay, R.R., and Jermyn, K.A. (1989) Origins of the prestalk-prespore pattern in Dicfyostelium development. Cell59, 1 157-1 163.
Williams, J.G., and Jermyn, K.A. (1 991) Cell sorthg and positional differentiation during Dictyostelium morphogenesis. Cell-cell interactions in early development, 261 -272. Wiley-Liss, New York.
Williams, J.G. (1991) Regulation of cellular differentiation during Dictyoste/lium morphogenesis. Curr. Opin. Genet. Dev. 1,358-362.
Williams, J., Hopper, N., Eatly, A., Traynor, Dm, Hamrood, A., Abe, Tm, Simon, M., and Veron, M. (1 993) Interacting signaling pathways regulating prestalk cell differentiation and movement during the morphogenesis of Dictyostelium. Development (su ppl) 1 -7.
Williams, J., (1 997) Prestalk and stalk cell heterogeneity in Diclyostelium. In: DicfyosteliumA Model System for Cell and Developmental Biology (Maeda, M., Inouye, K, and Takeuchi, I., eds), Universal Press, Inc., 293- 304.
Wilm, M., and Mann, M. (1996) Analytical properties of the nanoelectrospray ion source. Anal. Chern. 68, 1-8.
Wilm, M., Schevchenko, A., Houthaeve, T., Bretit, S., Schweiger, L., Fotsis, T., and Mann, M. (1996) Femtomole sequencing of proteins from polyacrylamide gels by nano-elect rospray mass spectrometry . Nature 379, 466-469.
Wong, L.M., and Siu, C-H. (1 986) Cloning of cDNA for the contact site A g lycoprotein of Dictyostelium discoideum. ?roc. Nat 1. Acad. Sci . USA 83, 4248-4252.
Wong, E.F.S., Brar, S.K., Sesaki, H., Yang, Cm, and Siu C-H. (1996) Molecular cloning and characterization of DdCAD-1, a ~a2+-dependent cell-cell adhesion molecule, in Didyostelium discoideum. J . Biol. Chem. 271 ,16399-1 6408.
Wu, L., Valkena, R., Van Haastert, P.J.M. and Devreotes, P.N. (1 995) The G protein beta subunit is essential for multiple responses to chemoattractants in Dictyostelium. J. Cell Biol. 1 29, 1 665-1 675.
Yang, C., Brar, S.K., Desbarats, L., and Siu, C-H. (1 997) Synthesis of the Ca2+- dependent cell adhesion molecule DdCAD-1 is regulated by multiple factors du ring Dictyostelium development . Differentiat ion 6 1 , 275-284.
Yin, Y., Rogers, P.V. and Ruthe~ord, C.L. (1994) Dual regulation of the glycogen phosphorylase 2 gene in Dictyostelium discoideum: the effects of DIF-1, CAMP, NH3 and adenosine. Development 120, 1 169-1 1 78.
Yuen, I.S., Taphouse, C., Halfant, K.A., and Gomer, RH. (1991) Regulation and processing of a secreted protein that mediates sensing of cell density in Dictyostelium. Development 1 1 3, 1 375-1 385.
Yuen, 1. S., and Gomer, RA. (1994) Cell density-sensing in Dictyostelium by means of the accumulation rate, diffusion coefficient and activity
threshold of a protein secreted by starved cells. J. Theol. Bio. 167, 273-282.
Yuen, 1. S., Jain, R., Bishop, J.D., Lindsey, D.F., Deery, W.J., Van Haastert, P.J., and Gomer, R.H. (1 995) A density-sensing factor regulates signal transduction in Dictyostelium. J. Cell Biol. 129, 1251 -1 262.
Top Related