Soft Tissue and Bone Pathology: curious, enigmatic and gorgeous
bone and soft tissue lesions
Case 3
Carlos E. de Andrea, MD, PhD
HEY1-NCOA2 Fusion
NCOA2 R: CTATCATCCCTTGATTACHEY1 F: CGAGGTGGAGAAGGAGAGTG
Wang, L. Genes Chromosomes Cancer. 2012;51: 127–139
HEY1-NCOA2 Fusion
Reverse Transcription - Polymerase Chain Reaction (RT-PCR)/Gel Electrophoresis (Roche Molecular Systems, Inc.)
119bp
Mesenchymal Chondrosarcoma: Clinical
- Generally found in young adults
- Occurs in unusual locations:Jawbones and ribs
- Extraosseous locations:Meninges included
- Highly malignant
- Prolonged course with late metastases(survival 21-67%)
Frezza AM, el al. Eur J Cancer. 2015(3):374-81
Mesenchymal Chondrosarcoma: Pathology
Biphasic appearance:Undifferentiated small blue cells or spindle
cellsWell-differentiated cartilage
Other features:Hemangiopericytoma appearanceFoci of chondroid ossificationMyxoid areas
Mesenchymal Chondrosarcoma: IHC
Sox9: positive in round cells and chondrocytesβ-catenin: negative in round cells, positive at cartilage interfaceOsteocalcin: negative in round cells, positive in bony matrixS100: positive in only occasional cases in round cells; usually positive in cartilageEMA (30%) and desmin (50%) can be positiveFLI1 negative; CD99 can be positive
Small Round Cell Tumours
- Alveolar rhabdomyosarcomaDesmin, myogenin, PAX3-FOXO1 fusion (+PCR)- Desmoplastic round cell tumourWT1, EMA, CK, desmin, NSE, CD56, EWSR1 (+PCR)- Ewing sarcomaCD99, FLI1, ERG, CK, desmin, EWSR1 (+PCR)- CIC-DUX4 tumoursCD99, ERG, MUC4, CIC-DUCX4 fusion- Synovial sarcomaTLE1, EMA, CK, CD99, CD56, bcl-2, SSX-SS18 fusion- Mesenchymal chondrosarcomaSOX9, CD99, HEY1-NCOA2 fusion- Small cell neuroendocrine carcinomaTTF1, CK, CD56, CG
Top Related