December 2012 Vol 27 No 10
10 16 BhutanCSR Showcasing Modern Portfolio Theory13
A 2020 Vision for A 2020 Vision for Hong Kong’s Offi ce MarketHong Kong’s Offi ce Market
Not For Sale
www.bri tcham.com
HONG KONGBritainIN
CSR Showcasing10
Lifestyle: Bhutan16
Contents
3 Chairman’s Message
4 A 2020 Vision for Hong Kong’s Offi ce Market
6 Reverse Logistics
8 Hong Kong Business Optimism Ticks Up
10 CSR Showcasing
13 Modern Portfolio Theory
16 Lifestyle: Bhutan
18 The Jardine Matheson Group & British Chamber YNetwork Scottish Ceilidh
20 Member Discounts
22 Member Get Member 2012
24 Sterling Member Announcement & News
25 New Appointments
26 New Members & Upcoming Events
27 Shaken Not Stirred
A 2020 Vision for Hong Kong’s Offi ce Market4
EditorSam Powney
DesignWinnie LiLilian YuSteve MokKen Ng
Advertising ContactCharles Zimmerman
Project ManagementVincent Foe
Jointly Published by Speedfl ex Medianet Ltd andThe British Chamber ofCommerce in Hong Kong1/F, Hua Qin International Building340 Queen’s Road Central, Hong KongTel: 2542 2780Fax: 2542 3733Email: info@speedfl ex.com.hkEditorial: sam.powney@speedfl ex.com.hk Advertising: charles@speedfl ex.com.hk
British Chamber of Commerce SecretariatExecutive DirectorCJA Hammerbeck CB, CBE
General ManagerCynthia Wang
Marketing and Communications ManagerEmily Ferrary
Special Events ManagerBecky Roberts
Events ExecutiveMandy Cheng
Business Development ManagerPhillippa Cook
Membership ExecutiveLucy Jenkins
AccountantMichelle Cheung
Executive AssistantJessie Yip
SecretaryYammie Yuen
Offi ce AssistantSam Chan
© All published material is copyright protected. Permission in writing from the Publishers must be obtained for the reproduction of the contents, whole or in part. The opinions expressed in this publication are
not necessarily the opinions of the Publishers. The Publishers assume no responsibility for investment or legal advice contained herein.
Room 1201, Emperor Group Centre, 288 Hennessy Road, WanchaiTel: 2824 2211Fax: 2824 1333Website: www.britcham.com
Britain in Hong Kong
Nick Sallnow-Smith
In the middle of November, Christopher Hammerbeck and I travelled to London for the annual
“Hong Kong week” group of meetings. This is scheduled around a number of events arranged
by the Hong Kong TDC and the London-based Hong Kong Association and are attended by
just about any London based business person, retired or active, with connections with Hong
Kong. Carrie Lam was the principal offi cial leading the Hong Kong delegation.
There were two clear takeaways. First, as is to be expected, London views of the situation
in Hong Kong are heavily infl uenced by the media’s perspective. “Illegal structures”, national
education and the activities of the ICAC were inevitably at the front of many minds. It was
therefore very useful for the official delegation and others from Hong Kong to put these
headlines into better perspective. Indeed, it highlighted the need for all of us in the international
business community in Hong Kong to play our part in this respect throughout the year, as we
travel not only to the UK but elsewhere. Distorted viewpoints on Hong Kong’s progress are inevitable from a foreign vantage
point, just as no doubt our ideas of events in the US or Europe are also unbalanced. So if overseas markets are to have this
corrected, we have a small part to play.
My second takeaway from the trip, particularly from the calls on government, was the lack of obsession with what was
happening in Europe (and it was notable that, as is so often the case when the British refer to Europe, by this they meant “the
continent” excluding the UK) and a determined focus on orienting UK trade and foreign affairs more fi rmly on the rest of the
world to reduce the UK’s reliance on EU traffi c.
This is evidenced by the shrinking of FCO staffi ng on the continent and expanding it in, for example, China. It is important
that we appreciate this in Hong Kong and continue to emphasise the crucial part our city can play in this rebalancing.
Under the present UK administration, we are pushing at an open door in this respect, with Hugo Swire and Lord Green
in key ministerial posts and the Chancellor enthusiastic about Hong Kong. Nevertheless, when offi cial or business visitors
come through Hong Kong, we all have a part to play in explaining, at the level of our individual businesses, how Hong Kong
continues to play its historic role as “the pivot” (to borrow from our American cousins) into and out of Mainland China for
business and trade.
By the time you are reading this, the holiday season will be almost upon us. I hope you manage to attend some of the social
events that the Chamber arranges during the period. The winter solstice of 2012 has been a long time coming. According
to the Maya, we have been waiting 5,126 years for this moment. If my next letter ever sees the light of day, we will know that
we have survived the end of this cycle of the Mayan long count and are safely into the thirteenth “B’ak’tun”! Let’s hope so
and Happy Christmas!
Britain in Hong Kong 3
Chairs of Specialist Committees
Business Angel ProgrammeNeil OrvayAsia Spa & Wellness Limited
Business Policy UnitTim Peirson-SmithExecutive Counsel
China CommitteeTim Summers
Construction Industry GroupDerek SmythGammon Construction
Education CommitteeStephen EnoBaker & McKenzie
Environment CommitteeAnne KerrMott MacDonald Hong Kong Limited
Financial Services Interest GroupRichard WinterQuam Limited
HR Advisory GroupBrian RenwickBoyden Search Global Executive
ICT IT CommitteeCraig ArmstrongStandard Chartered
Logistics CommitteeMark MillarM Power Associates
Marketing & Communications CommitteeAdam O’ConorOgilvy & Mather Group
Real Estate CommitteeJeremy SheldonJones Lang LaSalle
Scottish Business GroupJohn BruceHill & Associates
Small & Medium Enterprises CommitteeKate KellyK2PR
Strategic Supply Chain ForumDominic JephcottVendigital Limited
Women in Business CommitteeSheila DickinsonThe Fry Group
YNetwork CommitteeAlison Asome
MessageChairman’s
2
We live in turbulent times.
F inanc ia l and bank ing
sector d i ff icu l t ies have
been well documented and
the eurozone continues
to struggle with the bond
issue. Ma in land Ch ina
i s a lso exper ienc ing a
s lowdown in economic
growth, a l though most
major nations would happily accept China’s lower
growth rates. All this is not lost on Hong Kong, which
is of course affected due to the open nature of its
economy and the presence of international firms.
Indeed, a survey completed by CBRE shows that Hong
Kong tops the list of preferred destinations for global
offi ce occupiers.
In Hong Kong, off ice demand has undoubtedly
weakened over the last 18 months and net absorption
has fallen to about half of the long term average. Offi ce
occupiers have become more cost conscious and high
rents in the top buildings are diffi cult to justify for some
sectors. Many larger banking and finance companies
have adopted alternative strategies by shifting their
footprint to decentralized areas and/or adopting a
split office structure. While it is true that there are
companies in this sector which are still expanding,
they are generally niche operations with smaller space
requirements. This explains the success of some
smaller fl oorplate buildings in Central in leasing space at
higher rents.
Despite muted demand in general, some sectors
continue to expand and seek more office space.
The brisk retail trade in Hong Kong not only leads to
higher rents for shop units but also feeds through to
greater demand for warehouse facilities and office
space. Product sourcing is another area which
continues to grow. However, the insurance sector is
perhaps most active in terms of expansion activity.
Much of this activity is focused on decentralised
locations, particularly in Kowloon East, due to the
lower margin nature of the business. However, fi nding
suitable locations is proving a major headache for
some companies.
The central submarket has suffered the brunt of weaker
office demand and a shift in occupier focus. The
A 2020 Vision
for Hong Kong’s
OFFICEMARKET
Edward Farrelly
CBRE’s Head of research,
Hong Kong, Macau and Taiwan
C ove r S t o r y
vacancy rate for the area has risen
from a low of 2.7% at the beginning
of 2011 to 5.6% by the end of
October. However, th is upward
trend is not common to all sub-
markets. In fact, over the same time
period the overall vacancy rate for
Grade-A offi ce space in Hong Kong
has fallen from 5.6% down to 3.2%.
Essentially, the much commented
increase in vacant office space is
unique to Central. Unsurprisingly, the
story is the similar in regard to rental
growth. Rents peaked in Central in
July 2011 and have since fallen by 18%. The overall
rental decline was only 3% during that time, while
average rents beyond Hong Kong Island rose by 15%.
This fi gure rises to 18% if one just considers Kowloon
East.
There is essentially a mis-match at present in the offi ce
market. Space is available in the more expensive core
CBD locations but occupiers seek more cost effective
solutions. The lack of options is even more acute for
larger occupiers. There is currently only one Grade-A
building in Hong Kong with more than 25,000 sq ft of
vacant space at a rent below HKD 50 sq ft / month.
Looking ahead, the situation is unlikely to improve a
great deal, and in fact the challenges facing occupiers
may intensify. In a recent report titled “A 2020 Vision
for Hong Kong’s Offi ce Market” CBRE teamed up with
Daiwa Capital Markets to investigate what could lie in
store. The approach taken was essentially to gauge
how much office space is needed if Hong Kong is to
maintain its position as a “World City”, using economic
and business sector growth as a measure of demand.
Essentially, the city needs an additional 17 million sq ft
of offi ce space through to the end of the decade if this
goal is to be met. However, CBRE expects the volume
of new completions to reach only 8 million sq ft through
to the end of 2020 so Hong Kong could be faced with
a shortfall of 9 million sq ft of offi ce space. Under any
circumstances this would be a cause for concern, but
given the current acute lack of options for occupiers it
seems clear that urgent action is needed.
Any action taken now to alleviate the shortage of
available space will not lead to an immediate increase
in supply. However, it can still lead to
short term benefi ts. Giving occupiers
clarity on the delivery of space in
the mid to long term allows them to
plan ahead with a greater degree
of confidence. As such, companies
can structure their requirements
and lease expiries over the coming
years in order to take advantage of
expected new supply when it does
become available.
A key feature of the CBRE / Daiwa
report is that Hong Kong can in fact
resolve its supply issues. While it is often said that Hong
Kong suffers from a lack of land, the reality is that the
problem is not a scarcity of land but that land is either
mis-used or underutilized. The report outlines a list
of government plots that could, and should, be fast-
tracked through the disposal and development process
to ensure delivery of 6 million sq ft of offi ce space this
decade. CBRE has also identifi ed private development
projects not scheduled for completion pre-2020 that,
if they were to go ahead, could supply 3 million sq ft
of additional office space. Given the tight vacancy in
the market and the weak supply profi le, one imagines
that developers would be eager to push ahead with
developments.
Some commentators will point to the CBD2 project in
Kowloon East as the solution for the supply issue and
therefore claim that no further action is needed. While
we are very supportive of the project, and applaud the
positive work already carried out by the Energising
Kowloon East offi ce (EKEO), we expect the project will
take considerably longer to complete than the timeframe
initially announced. Indeed, just a cursory look at some
of the major urban regeneration or revitalization projects
completed in cities around the globe would suggest
that a project of this magnititude would take decades to
complete.
We expect that the maximum volume of offi ce space that
we can expect to be supplied from the CBD2 project
through to the end of 2020 is 3 million sq ft. However,
together with fast-tracked developments in West
Kowloon, which could add a further 3 million sq ft, this
would be suffi cient to tackle the supply shortage. Key to
this is political backing. The time for action is now.
Britain in Hong Kong 54
Reverse Logist ics is
complex and disjointed but
represents big opportunities
for value creation. It includes
the key processes involved
i n mov i ng p roduc t back
through the supply chain to
accommodate overstocks,
returns, defects and recalls,
and is defined by the Center
for Logistics Management at
University of Nevada as “the process of moving goods
from their typical final destination for the purpose of
capturing value, or proper disposal”.
For product returns, Accenture
report that on average it takes
12 times as many steps to
process returns as it does to
manage outbound logistics.
The additional steps include
activities such as assessing,
r e p a i r i n g , r e p a c k a g i n g ,
relabeling, restocking, reselling,
recycl ing and refurbishing,
which can result in the cost
of reverse logistics being four
to five times those of forward
logistics.
H o w e v e r, b e s t - i n - c l a s s
p rac t i t i oners can d i rec t l y
correlate their reverse logistics expertise and systems
to positive impacts on Customer Satisfaction, Brand
Equity, Competitive Differentiation and Profi tability.
Reverse logistics is big business — in the USA it is
estimated that manufacturers and retailers are now
dealing with $100 billion of products being returned
on an annual basis. Here in Asia, product returns are
destined to expand exponentially, driven by two rapidly
accelerating consumer trends — online shopping and
the proliferation of electronic gadgets.
Why are products being returned?
According to the Reverse Logistics Association,
products are returned for numerous reasons:
ever
se Lo
gisti
csR
Mark Millar,
Logistics Committee Chairman
B u s i n e s s
What is interesting about these reasons for returns, is how
by improving processes within the forward supply chain,
companies could surely eliminate many of these returns —
for example Late Delivery, Missing Parts, Damaged, Not
Functioning — representing some 46% of returns.
Furthermore, one could argue that additional diligence
during the sales and customer service processes may
further reduce the volume of products that are returned
due to No Reason, Different than Expected, Not Satisfi ed
with Performance, Did not want Product and Found
better competitive product — another 39% of all returns.
In practice however, companies do need to balance
their acceptance of product returns in line with their
philosophies and policies for their brand, warranties and
customer service.
The complexity of reverse logistics involves many more
transactions than the forward supply chain and the
various activities relating to product returns will span
across many functional departments — sales, customer
service, fi nance, warehouse, repairs and transportation.
For the majority of these functions, product returns are
likely seen as much more of an annoyance rather than
a priority. However, with effective returns management
providing tangible opportunities for businesses to reduce
costs, recover value and improve customer service,
appointing one senior leader to be responsible for all
aspects of product returns will focus attention and
harness the resources to capitalise on the opportunities.
Five Critical Success Factors
For best in class reverse logistics, recommendation is for
businesses to concentrate on these fi ve key aspects that
will enable success in capitalising on the opportunities:
• Visibility — leverage a common technology platform
across and throughout your reverse logist ics
ecosystem, providing one single view of each
returned product’s journey throughout the whole
process. Adopt the Control Tower model to facilitate
centralised information management that enables
end to end visibility. Collaboration involves an open
approach to information sharing.
• Ownership — ensure responsibility for all aspects
of reverse logistics is concentrated within one clearly
defined point of leadership, which has the authority
to manage across all the internal silos within your
organisation and who is the central control point for
all the external partners in the reverse logistics eco
system.
• Value — continually seek opportunities for value
creation — both for your customers and for your
company. Well managed reverse logistics operations,
with disciplined processes and committed customer
service, will engender customer loyalty and strengthen
brand equity. Effective and effi cient reverse logistics
operations, together with a diligent approach to asset
recovery will capture value within your organisation
that can drive profi tability and competitive advantage.
• Customer Service — the trigger that activates
reverse logistics activities is when the customer
experiences a problem with your product. Ensure
you have well trained customer service personnel
and robust complaints handling processes in order
to minimize pain and inconvenience for the customer.
Furthermore, persistent but polite probing of the
problem early during the customer complaint interface
can often result in successful resolution, without
needing to return the product — minimising down
time, enhancing customer experience and reducing
the amount of costly returns that are no-fault-found.
• Forward Fundamentals — consistently be aware
that meticulous attention to detail across key
activities in the forward supply chain can reduce the
burden on reverse logistics by substantially reducing
unnecessary returns.
Customer Service
As both a key element and a critical success factor, the
Customer Service component can often become the
key differentiator within your reverse logistics ecosystem.
Customer service can make-or-break successful value
creation and hence companies must deploy due diligence
to the human capital dimension. This results in a rising
demand for traditional customer service personnel to
have increased breadth and depth of knowledge about
the supply chain and logistics functions — combining
technical expertise with soft skills. Organisations therefore
need to adjust their talent acquisition and retention
strategies accordingly, to ensure they are attracting
candidates with the appropriate soft skills, in many cases
from other industry sectors, and then rapidly training
them on the technical aspects of reverse logistics.
Conclusion:
Reverse Logistics may indeed be complex, but the
opportunities outweigh the challenges — persevere
with overcoming the challenges! Concentrated efforts
on developing the soft skills in parallel with enabling
the infrastructure, transportation and technology
platforms will empower value creation through customer
satisfaction and fi nancial results.
Industry thought leader Mark Millar has been engaged
by clients as Speaker, MC, Moderator or Conference
Chairman at more than 250 events in 20 countries
and is recognised by the Global Institute of Logistics
as “One of the most Progressive People in World
Logistics”. Mark serves as Chairman of the Logistics
Committee at the British Chamber of Commerce in
Hong Kong. [email protected]
Britain in Hong Kong 76
Grant Thornton Hong Kong
Optimism falling globally
Globally, business optimism has fallen from 23% to 8%
in Q3, so Hong Kong’s sentiment is a rare exception.
Drops in confidence across the world’s three largest
economies have been equally pronounced. In the
US, optimism for the next 12 months fell from 50%
to 19%. In China confi dence fell from 33% to 11% as
the marked slowdown, particularly in exports, hits the
economy. And optimism across the EU fell from -2% to
-13%.
Daniel Lin, managing partner at Grant Thornton Hong
Kong, described the scene further, “Despite modest
improvements in Hong Kong’s business optimism,
there remains a general market malaise about the
long-term strength of the global recovery. This is being
weighed down by continued weakness coming out of
the eurozone and some uncertainty as the US moves
past the presidential election cycle and approaches the
so-called fiscal cliff. Moreover, the Chinese economy
recently posted its seventh quarterly decline in GDP
growth. The economic uncertainty means businesses
continue their ‘wait and see’ approach.”
Globally businesses seeking greater government stimulus
Despite attempts to encourage investment, the majority
of businesses say that they will maintain or increase
their cash reserves — building on the $4trill ion of
cash already sitting on company balance sheets. This
conservative approach seems to be highly prevalent
in Hong Kong, where 88% of businesses say they will
either increase or maintain their level of cash reserves.
Hong Kong Business Optimism Bucks the Trend, Hong Kong Business Optimism Bucks the Trend, but Demands on the Government Continuebut Demands on the Government Continue
Business optimism in Hong Kong was up in the third quarter of 2012, according to the latest
Grant Thornton International Business Report (IBR). The increase, marks the second consecutive
quarter for which Hong Kong businesses are feeling more confi dent about the overall economy.
The survey also reveals that support for fi scal measures and improvements in education rank
highly among the areas Hong Kong businesses would like the government to focus on to
stimulate the economy.
Business Optimism Declines SharplyNet percentage of businesses optimistic about the outlook for their economy
Source: Grant Thornton IBR 2012
B u s i n e s s
Hong Kong also holds the distinction of ranking highest
among all economies polled in businesses (74%) who
say they currently hold cash reserves of more than 10%
of revenues.
To get their economies moving, the majority of the
3,050 businesses interviewed want their governments
to increase fiscal activity — something which might
boost investment. The IBR reveals that businesses
are looking for greater fi scal stimulus in the way of tax
incentives and an increase in government spending and
investment, as opposed to further monetary measures.
In Hong Kong, 72% of businesses called both for more
tax cuts and breaks and an increase in government
spending and investment. In addition, a large majority
of businesses (86%) would like the government to
focus on improving education in order to stimulate the
economy.
Daniel Lin added, “Hong Kong’s Chief Executive
Leung Chun-ying recently stated that he believes the
government can do more to boost the economy. It
seems Hong Kong businesses overwhelmingly agree,
although the preferred policy approaches to get there
may not be perfectly aligned. An area of common
ground though is clearly on the education front, even
though the benefi ts are likely to be longer term.”
Salary fi gures continue to fl uctuate
Globally, businesses seem to be drawing back a little
in regards to their plans to increase salaries for their
employees — 64% plan to offer pay rises in the next
12 months, compared with 68% in Q2. In Hong Kong
specifi cally, the quarter to quarter comparison declined,
with 74% of employers expecting to give pay rises in
the next 12 months compared to 90% level in Q2-2012.
All in all, Hong Kong is demonstrating an almost
uniquely robust financial optimism, but businesses
are indicating that there is plenty more work for the
government to do. In the wider world, the general
sentiment is not so rosy.
For more information, please contact Daniel Lin (T +852
3987 1300, E [email protected]), Kitty Cheung
(T +852 3987 1222, E [email protected]), or
Charlene Leung (T + 852 3141 8080, E Charlene.
About Grant Thornton International Business Report
The Grant Thornton International Business
Report (IBR) provides insight into the views and
expectations of more than 12,000 businesses per
year across 41 economies. This unique survey
draws upon 20 years of trend data for most
European participants and 10 years for many
non-European economies. For more information,
please visit: www.internationalbusinessreport.
com
Data collection
Data collection is managed by Grant Thornton
International’s core research partner -Experian.
Quest ionna i res a re t rans la ted in to loca l
languages with each part icipating country
having the option to ask a small number of
country specific questions in addition to the
core questionnaire. Fieldwork is undertaken on
a quarterly basis. The research is carried out
primarily by telephone.
Sample
IBR is a survey of both listed and privately held
businesses. The data for this release are drawn
from interviews with 3,050 businesses from all
industry sectors across the globe conducted in
August/September 2012. The target respondents
are chief executive offi cers, managing directors,
chairmen or other senior executives.
About Grant Thornton Hong Kong Limited
Grant Thornton Hong Kong Limited is a member
firm of Grant Thornton International Ltd (Grant
Thornton International). The fi rm is fully integrated
with Grant Thornton China and be part of a
network of 17 offi ces providing seamless access
to 120 partners and over 2,400 professionals
across mainland China and Hong Kong. For
more information visit www.grantthornton.cn
Grant Thornton is one of the world’s leading
organisations of independent assurance, tax
and advisory firms. These firms help dynamic
organisations unlock their potential for growth by
providing meaningful, actionable advice through
a broad range of services. Proactive teams,
led by approachable partners in these firms,
use insights, experience and instinct to solve
complex issues for privately owned, publicly
listed and public sector clients. Over 31,000
Grant Thornton people, across 100 countries,
are focused on making a difference to clients,
colleagues and the communities in which we live
and work. For more information visit www.gti.org1. Hogan Lovells research into total cash on the balance sheets
of the world’s top 500 non-financial companies: http://www.
hoganlovellsevolution.com/evolution-heatmaps-cash-on-balance-
sheet
Britain in Hong Kong 98
Showcasing Corporate Social Responsibility (CSR)in Hong Kong
“For corporate social responsibility to be genuine — that is for it to mean the responsibility a corporation
owes to the society within which it trades — it must permeate everything a business does. The way it
sources; the way it manufactures; the way it treats its employees; the way it deals with business partners; all
these activities should refl ect the need to sustain, and not damage, the viability of the community it serves.
Minimising pollution and using energy efficiently are examples of these principles but they are the tip of
the iceberg. Every aspect of our businesses needs to be conducted against the same test of sustaining our
society.
If we conduct these activities honestly and with attention to the impact they have on the community around
us, business can be seen to be a positive and vital part of community life, not parasitic upon it.
The British Chamber’s approach to CSR needs to be built around this broad interpretation of business
purpose. A great deal is at stake, since it affects the perception of business across the community. And if we
are thoughtful about how we conduct our business, a great deal can be achieved”.
Nick Sallnow-Smith,
Chair of the British Chamber of Commerce in Hong Kong
Across the globe, businesses of various sizes, in different sectors, are at varying stages of their CSR ‘journey’.
Some have yet to be convinced that they should embark on the journey at all; some may have already set off. And
then there are those — further ahead of the others — who have their MD or CEO in the driving seat…
Essentially, companies are at different stages of maturity when it comes to responsible business practises. ‘CSR
maturity’ refers to how embedded and integrated responsible business practice is within a company’s operations.
Those with a more mature approach consider CSR strategically, link it to their business objectives, and make it part of
their day-to-day activities and decision-making. It is these companies, where CSR is part of the DNA, that are reaping
the greatest benefi ts.
This article showcases a range of best practice from different businesses in Hong Kong, all of different sizes and
undertaking CSR in different ways, but all generating a range of business benefi ts as a result.
Sarah Powell, CSR Manager,
Gammon Construction
B u s i n e s s
‘RICHFORM HOLDINGS LTD’http://www.everpurewater.com.hk/eng/index.php
Richform Holdings is the exclusive, authorised agent of USA
‘Everpure’ Drinking Water Systems in HK and Macau. It employs 30
people in Hong Kong, and has an impressive commitment to CSR,
driven by CEO Dr. Jimmy Lau Fu-Shing. “We are not a charity —
we are a small company and we have to make profi ts. But we
have found that CSR can be competitive and advantageous
if you tie it to key business strategies”.
The company’s commitment has resulted in numerous awards and
certifi cates of appreciation, including:
• ‘Caring Company 5yrs+’ award in 2011.
• HSBC Living Business People Caring Award 2011 — Gold
Award
• HSBC Living Business Green Achievement Award 2011 — Gold
Award
• HKCSS Total Caring Award 2011
• HSBC Living Business Community Engagement Award 2010 —
Gold Award
• HKACE Award — SME Category, Top 10 SME Customer
Service Excellence Award 2009/10.
CSR in action:
The company treats its ‘associates’,
(employees), well. It invests substantially
in Training and Development, providing
study leave, as well as a range of ‘perks’
for staff. This includes longer lunch-
breaks; free fruit each day; free herbal
soup and traditional Chinese medicine
consultations; and a head and shoulder massage quarterly. It has
family friendly practises in place, including flexi-time; Paternity,
Emergency and Birthday leave; ‘parents gratitude’ allowance, and
offers summer job placements for the children of its associates.
While the company’s fi rst priority is to ensure their product is good,
and is true to its’ marketing promises, happy staff are the next
priority. The CEO knows that ‘happy and satisfied associates’
translates into ‘happy and satisfied customers. “We operate in a
competitive environment, so happy associates are crucial”, he says.
In addition to a strong environmental commitment there is also
substantial investment in the community, and the company
encourages staff to undertake voluntary community service work.
It has a successful partnership with HKCS, (Hong Kong Christian
Service), offering work experience placements to less privileged
groups. This helps to develop the ‘softer skills’ of employees, and
one permanent associate has joined the company through this
partnership.
Business benefi ts:
• Very low turnover of staff, with high levels of productivity, staff
morale and retention. The company has a high level of customer
satisfaction, and has sustained an average growth rate of 20%
over the past fi ve years.
• Helps enhance brand and reputation, which creates
differentiation, and helps to attract staff. For example, many
people ring to enquire about job vacancies whenever the
company receives press coverage about its’ CSR activity.
The single best thing done as a company? “We have
differentiated our company by caring for stakeholders”
‘TREE’www.tree.com.hk
TREE is a boutique furniture retailer, employing
45 employees in Hong Kong, with a strong ‘Profi ts
with Principles’ philosophy and commitment.
The MD, Kate Babington, says: “At TREE we
like to go above and beyond our branch
of influence wherever possible, and do as
much as we can to give something back”.
CSR in action:
The company undertakes
responsible sourcing, (both
ethical and environmental).
It uses reclaimed wood or
responsibly sourced teak wood
that is either certified by the
Forest Stewardship Council
(FSC) or directly supported
th rough the Trees4Trees
Foundation. To date, TREE
has planted 40,000 trees in
Thailand and Indonesia, where most of its pieces
are sourced. It practises good supply chain
management, and treats suppliers respectfully, as
partners, in turn helping to develop its suppliers
operations. This results in suppliers working with
TREE collaboratively, helping the company to
source new products.
TREE supports the local communities where
its raw materials are sourced; purchasing
through women’s co-operatives, and providing
sponsorship and donations to not-for-profit
organisations throughout Asia.
The company is proud to be a multi-cultural and
diverse business. “I treat employees in the way I
would like to be treated”, says the MD. “As our
frontline staff, it is essential they are engaged”.
Employees are consulted on the development
of new company products, and are provided
with various socializing, team-building and
volunteering opportunities.
Business benefi ts:
The MD believes the company philosophy, (which
forms part of the interview process for staff),
enhances their brand; satisfi es and creates loyal
customers; and helps create motivated, engaged
and loyal staff. There is low turnover of staff, and
most stay for many years.
For the MD, the success of TREE so far is proof
that you can be successful while caring. “No
company is perfect but it’s important that
we try. We always ask — how can we do this
better?” says Babington.
The single best thing done as a company?
“Invest in your staff. We teach English and pay
for courses — CAD design for example — which
means that individuals grow within the business
but also contribute more”.
Britain in Hong Kong 1110
‘BARCLAYS’http://group.barclays.com/about-barclays/citizenship
Barclays, with around 11,000 employees in Asia,
including 1,200 employees in Hong Kong, sees the
value of addressing LGBT (Lesbian, Gay, Bi-Sexual or
Transgendered) issues to attract and retain top talent.
In today’s climate, it wants to foster an open and
inclusive workplace where all employees can succeed.
To this end, Barclays launched its Asia LGBT network,
Spectrum, which started in Tokyo before hitting
Singapore and Hong Kong in 2011.
The British charity, Stonewall, estimates that employees
who feel unable to bring “their whole selves” to work —
if to hide their sexual orientation - are up to 30% less
productive than those who are. In a global organisation
of 140,000 people, of which 10% or 14,000 can identify
themselves as LGBT, that 30% drop off in productivity
is the equivalent losing 4,200 people. In the financial
services industry that equates to tens of millions of
pounds lost each year.
Key Successes:
• Inroads made to increase
s u p p o r t f o r t h e L G B T
community and related issues,
not just within Barclays, but
within Hong Kong’s financial
sector.
• Co-sponsorship of a landmark ‘LGBT Climate Study
2011-2012’ with Community Business. Barclays
is a key member of the LGBT Interbank forum and
was the first large corporate to sponsor the ‘Pink
Dot’ initiative in Singapore.
• As a recognised leader in diversity and inclusion,
Spectrum’s work has set industry benchmarks.
Fellow fi nancial institutions have consulted Barclays
on ways to establish LGBT networks within their
organisation.
• Additionally, there has been significant increase in
LGBT candidates making Barclays their employer
of choice, further enhancing its brand across Asia.
The single best thing done as a company? “LGBT
Mentoring. The Spectrum Mentoring Programme
has been one of our most successful initiatives. The
programme, originated in Asia, established a number
of mentoring relationships between senior leaders
and LGBT employees. For Mentees, it helps them to
further develop their professional skills. For Mentors,
it exposes them to the challenges faced by our LGBT
colleagues, enhancing their own capabilities to lead in a
fully inclusive environment”.
‘PENTLAND’www.pentland.com
Pentland is an international brand management
company that owns or licenses brands in sports,
outdoors and fashion, with 130 employees in Hong
Kong. Corporate Responsibility (CR) is a core part of
its’ business strategy, which includes a commitment
to the env i ronment . I t i den t i f i e s emp loyee
engagement, staff attraction and retention, as some
of the business benefits from its’ commitment to
CSR.
CSR in action:
Pent land was ab le to
put i ts’ Environmental
Policy into practice when
renovating and refurbishing
its’ Hong Kong office this
year, by undertaking the
following actions:
• Undertook research around best pract ice
in sustainable use of resources for an office
environment, and used this research as part of the
decision-making process.
• Engaged WWF and Community Business as
advisors for the process.
• Installed sensor taps and electric hand dryers in the
washrooms.
• Made better use of natural light in design to
illuminate the offi ce.
• Identifi ed local charities that could accept donations
of old offi ce equipment and furniture, including old
printers and box files. Beneficiaries included: The
Children’s Heart Foundation; The Salvation Army,
Youth Outreach, and Cheung Sha Wan Kai Fong
Welfare Association Ltd.
Business benefi ts:
These actions have already reduced — and will
continue to reduce — the impact on the environment
by the company. Water and paper towel use will be
reduced, reducing waste, resource use and cost. It has
recycled more, and reduced the amount of waste sent
to landfill during the refurbishment. Its use of natural
lighting will be better for employees’ health, and result in
lower running costs for the offi ce. It has also developed
its community partnerships in Hong Kong through the
process.
The single best thing done as a company?
“Pentland has made CR how we do business”.
The CSR Steering Group is organising a panel discussion on 17th January 2013 on the Business Benefi ts of CSR
featuring speakers from these companies. For more info, see www.britcham.com/csr.
We will be showcasing other examples of good practice from HK in the future; through this magazine, at events,
and on-line. So if you would like us to showcase your best practice, please contact Sarah Powell at Gammon
Construction, via: [email protected]
Logo supplied by
Community Business
B u s i n e s s
Modern Portfolio TheoryNot rocket science, but quite clever
A friend of mine recently received his annual bonus.
It was a healthy sum of 200,000 HKD and I asked him
how he was going to invest it. He told me he’d put it
with a Chinese bank on a five year deposit at 4%. I
was initially impressed at such an excellent interest rate
considering that our friendly local banks are only offering
0.01% but on further clarifi cation he explained that he
would receive 80,000 HKD at the end of the fi ve years.
An interest rate of less than 1% annually — not so great
after all.
Given that inflation is tracking around a notional 3% I
reminded him that he needed to be aiming for higher
returns on his investments. As fi nancial advisors friends
like to remind us, cash evaporates like water if you just
leave it in a bank account.
Safe as Houses
There are some banks about town that are offering
attractive interest rates on cash deposits. Banks
raise deposit rates to attract fresh funds for various
reasons, normally because they believe that there is
an opportunity to use those fresh funds to increase
profi tability or address some other strategic requirement.
Lloyds TSB for example were recently offering 2.6% on
the Pound Sterling, probably to reach certain balance
sheet targets set by the UK government. Obviously if
you intend to deposit cash with a bank it is a good idea
to check their Tier 1 capital ratio which indicates the
solidity of the bank’s fi nancial position.
More Adventurous Than a Bank Account
I suggested to my f r iend that i f he wanted h is
investments to outperform infl ation he should be looking
at owning some equities. He was concerned that
this would be risky. Certainly it is an accepted rule of
investing that higher returns come with higher risk but
there are some approaches, such as Modern Portfolio
Theory (MPT), that can improve the ratios.
Christopher Riley,
Managing Director of Sercura
Britain in Hong Kong 1312
What is interesting about the Asian approach to stock
investing is an obsession with trading. The average
investor buys and sells hoping to make a profi t when a
stock goes up. In order to do this they need to identify
through various means (analyzing underlying data,
insider information or following the herd) when a stock is
undervalued and liable to go up. Timing the market is as
precarious an occupation as playing the roulette wheel.
A buy and hold strategy with the right type of equities
has worked very well for Warren Buffett but of course it
is not as exciting as checking your smart-phone every
five minutes and watching Bloomberg secretly during
office hours. Mostly it is the banks that make the real
profi t from their commissions on your trades.
Reducing Risk with the Right Portfolio
The concept behind MPT is classic textbook stuff. The
theory was invented in the 1950s by Harry Markowitz
who was later awarded a Nobel Prize. The mathematics
is forbidding but for a lay-person the following illustration
(borrowed from Professor Malkiel) should make it clear.
Assume a tropical island economy has only two
businesses. The first is a large resort with beaches
and a golf course. The second is a manufacturer of
umbrellas. Weather affects the fortunes of both. During
sunny weather the resort does booming business and
umbrella sales are down. During rainy weather the resort
owner does poorly, while the umbrella maker enjoys
high sales and profi ts. Suppose on average one half of
the seasons are sunny and the other half are rainy.
An investor who bought stock in either business would
fi nd that half the time he earned a 50% return and half
the time he lost 25% of his investment. On average he
would earn a return of 12.5%, but it would be a risky
investment since there could be several sunny or rainy
seasons in a row.
Suppose that instead of buying only one security, an
investor with two dollars diversified and put half his
money with the umbrella maker and half in the resort
owner’s business. In sunny seasons, a one dollar
investment in the resort would produce a 50 cent return,
whereas a one-dollar investment in the umbrella maker
would lose 25 cents. The investor’s total return would
be 25 cents which is 12.5% of his total investment of
two dollars.
So whatever happens to the weather and thus to the
island economy, by diversifying investments over both
the fi rms, an investor is sure of making a 12.5% return
each year.
Cutting to the Chase
Of course in real life this perfect situation of ‘negative
covariance’ — where the companies’ fortunes balance
each other out — is much harder to fi nd. One way of
getting close to this situation is to choose a suitably
diversified basket of between 20-30 solid blue chip
global companies with good underlying fundamentals,
to hold their stock with a long-term view and get
the returns on their annual dividends and capital
appreciation. These should be off-
set with other types of investments
such as f ixed income (bonds or
money market). If you had done that
for the last twenty years you could
have averaged returns of about 8%
a year (rather better than what my
friend was getting from his bank).
Christopher Riley is the founder
and Managing Director of Sercura,
a global quality and compliance
company that provides product
inspect ions and factory audi t
serv ices to reta i lers and their
suppliers worldwide. Sercura is
now part of the TÜV SÜD Group,
a German industry leader. www.
sercura.com
B u s i n e s s
Baker Tilly Hong Kong Business Angel Programme
Take your businessto
new heights
The Baker Tilly Hong Kong Business Angels Programme is gearing up for the next round in the New Year! If you’re an
entrepreneur looking for investment, a potential investor who would like to see what’s on offer, or someone just looking for more
information about the programme, please visit the dedicated website, angel.britcham.com. There you can get a full picture of
the programme and even register as an angel investor or an entrepreneur looking for investment.
The British Chamber of Commerce’s Business Angel Programme, sponsored by Baker Tilly Hong Kong was launched in late
2007 and was the fi rst such initiative to be launched in Hong Kong. The programme was introduced to create a platform to
bring together entrepreneurs and investors to create exciting new partnerships. After 5 years of operation, the British Chamber’s
Angel Investment Committee is a well respected and leading source of advice and conduit to funding for young Hong Kong
enterprises looking for initial or growth investment from our ever growing network of Angel investors. Since its inception, the
committee has reviewed applications from hundreds of enthusiastic Hong Kong entrepreneurs, introducing many of them to a
wealth of Angel Investors and Professional Advisors.
Building upon the success of previous events, the British Chamber is pleased to announce the details for the next event.
It will be taking place at the Hong Kong Club on Tuesday 19th March 2013 and the deadline for applications is Friday 15th
February 2013.
Applicants, who do not need to be members of the British Chamber of Commerce, should be seeking to raise between
USD100,000 to USD2,000,000. Short-listed applicants will be given advice and assistance by a sub-committee of experienced
professionals.
If you’re an SME or an entrepreneur looking for investment and would like more information about the programme, please visit
angel.britcham.com or email [email protected]
Sponsored by:
Bhutan: A Travel DiaryA travel buff by both nature and profession, Lightfoot Travel Director Lucy Jackson ventured into the
Himalayan Kingdom of Bhutan earlier this year. Known as the Land of the Thunder Dragon, Bhutan has until
recently kept itself shrouded in mystery, strictly regulating the number of foreigners into the country. In
recent years however, control has eased considerably and the landlocked nation has fl ung its doors open to
tourism — building new hotels and improving its previously nonexistent infrastructure. But with a minimum
spend of $250 a day, it remains one of the most expensive countries in the world to travel to. This has kept
the hordes of backpackers at bay and enabled the country to tiptoe the edge of full blown modernisation.
Here are the notes and musings of a self-confessed travel junkie.
FlFlFlFlyiyiyiyiyiyingnngngngnn lllowwwowowow o ooooovevevevever rrr r ththththththe e e e ee hihihihhih lllllllls s s s s ththththataaa surroooununnnd ddd d d
BhBhhBhBhhututututuutananananan’s’ssss I IIntntntntntererererererrnananananananaatitititititiiononononono alalalalalall A A A AA Airiririririrpopopopoppoportrtrtrt, , , , II I I II grgrgrgrgrgrippppppeped the
ararararmsmsmsms oooo oof f ff f f f mymymymmy sss sseaeaeaeaeae t t t t t a a a aaa liililittttttttttlelelelelee t ttt ttigigigigigighththththththterererererere a a a aaas sss s ss ththththe e ee e e nanannannarrrrrrr owowowowo
lalalalalalandndndndnddndininininini g gg ststststririrr p ppp smsmsmsmsmacacaccacack kk kkkk babababababangngnggngng i i iin nn n n thththhthththe e e e e e mmimimimmiddddddddddddleelelelee o oo oooffffff thththththththe ee eee
vavavavavavalllllllllllleyeyeyyey c c c camamamamme e e ininntotototo v vv vvieieieieii w.w.ww. CC CCConnonono sisissidedededeed rerereerered d d d d d ononononononne e e ee e ofofofoffof t t tthehehehehehe
wowowowowowow rlrlrlrldd’’d’d sssss s s omomomomostststtststst cccc chahahahahallllllllllllenenenene gigiggingnggng a aaairiririrrpopopoportttrtrts,s,s,sss, l lll lanananaanaa dididdididid ngngngngngggg i iiii iis ss ss s
nonononootototototototot riririririririououououououououslslslslslslsls y yyyy y y dididididididd ffiffiffiffiffiffiffic ccc ccculuululululuu t t ttt anananananaand d ddd bebebebebeststststs p p pp praraarararactctcttcttcticiciciciciceededededd dddddurururu ininiini g g g gg
daddadadadadayylyllyligigigigigigighththththh h h hhhhhououououououoursrsrsrsrsrs. ThThThThThThatatatatatat ssssaiaiaaid,d,d,d, ttttheheheherererr i is s s sososoomemememethhthininnnng ggggg
sososososososo d d ddanananannanangegegegerororooususususususlylylylylyly rrrrr romomomomomomananantititiititit cc c c c abababababababououououououo tttt smsmsmmsmsmalalalalalalllllll aiaiaiaiaiaircrcrcrcrccrarar ftft, , ,,
shshshshshsshorororort t tt rurururuunwnwnwnwnwnwayayayayayayays s s s s anannananand ddd d d fafafafafafarrr rr r flfflflf ununuunuuu g ggg g momomomomomoununuununuuntatataatatainininininnnnouououououououous sssssss
rerererereregigigigigigigionononononoo ss.ss.
OOuOuOurr gugugg ididee ToTTobgbgayay ((‘T‘Toopgun’ tto ooooo maaanyyy o oof ff hihihhis ss clc ient )s)) ggggggrerereetetettededededdd uuuuuuuss at thee a aaairiririrrrrrpopopp rtrtt aaa andndd f foro tthehee r rememememmmaiaiaiaiaiaindndnderer o off
the trripipp wwasas aan n abbsossolutee legegggenee d.dd. MMMMMManananany yy y ofofofof mm mmy yy innsissighhghhtsssssst iii ntntntnto the cocoocoununtrtrry y y cacacaaamememe fff ffrororoororommm mm hihim m brbrbbrbrbrbrbrbrininini gigingngg hhisistotototooryryryryry
llaaalaalivviviveee e eee wiwiwiwiwiwi hththththth h hhisisiss llll l ititiiti tltltlee e ananana ececdododdotees s anand d fofofolklklklkkkklolooolooorererererere.
TThThThTThThimimmimimimmpupupuu
Located in west central Bhutantan, T TTTT, TThimhimhhhh pupupu uuuuup is sisisiss thethethethethethehethehe co coc cocococo c coc c co ountuntuntuntuntuuu ry’ry’s cs capapiapiapitataltataltalaatalaallalll an ananananan an an ananana and id id id id id id iidd itststtttts tsststtststststs lararlara gesgesgesgesgesgesgegeesgg st t tt
city. A hA highighhligight waswasasas vivi v sitsititingingingg th th the le lee lle locaocaocaocaocaocaocaocao l Ml Ml Ml Ml Ml Ml Ml MMMemoemoememememmoememmeme riariaairiariariariarial Cll Cl Cl Cl Cl Cl Cl Cl CChorhororororhororohorrttenttetententententte in inininin rererer rememmemmemmemmemmememmemmeememmemeemmbrabrabrabrabrabbrabrabrabb nnnncncencen of ofofffffoofoo th thhhthee e eee
third rd KinKinKing, g, g,g, andandandand s sese seeineineineining pg pg pg ppg ppeopeopeopeopeopeopeopeo lele le engengengeennnngenggageageagegegea d idd id id id n mn mmmmn mmmmmornornrnooornornnnninginginginggg pr pr prprp prprprppprayeayeayeayeayeayeayeayeyyyayy r br bbr bbbr bbr bbefoefoefoefefoefoefoefoe re rerererrrre worworwoworwoworwooorwowo k. k. kkkkkkk TheThTheTheeThee
weeweeweeweeeeeeeeeeekenkekenkenkenkenkeend md mmmd md markarkrkrarkarrket etet teeeet waswaswwaswawasww al aalalalalaalaal a soso oo sosososo a fa fa fa fa fa fa faaaa ffaaa unun un ununnuuu plaplaplaplaplapp ce cece ce eeccee e toto to to totoo taktaktaktaktakaktakaataat e pe ppe pe pe pe pe pparartartartartart in ini in iniinin inin no no nono no no nonnoisyisyisyisyisyisysy ba bababbargagargagagagaaaaainiiininiininn ngng,g,g,g,g bu bubububububu bu bub y yyy y y
colcolccoocc ourouruourourouroururrfulfulfulfulfulfulfulfulfu te te tete tetete teeeteteeexxxxxtixxtxx leslesesleele , aa, aaaa, aannnndnd d dnnddndnnnnd expexpexexpxpexpexpexpxpxppperierierierierierierrr encencenencncencencnnncencence te te ttte tee ttte hehhehehe hhehe heh humumhumummhummmmumhumhumhumdrudrudrudrudrudruddrudruurd um om om om om om om omm of df df df df ddf df df df dailailailllaailailailaily lyy ly lly ly lyyy y ifeifeififeifeifefeeee. T. T. Therherhehheh e ie ie iee s as as as as la lalalalalala lalargergergergergegergergerge
BudBudB dBudBudBBudB dBudBudBu dhadhahahaahaaaahaa atat ata atatat atatat atat at tht thththth th th thh thhe te te tee te te ttttte te te top op op opopop opopop op opopp ofof of ofofofof oooofo thethethethethethetthetheheeetth VaVaVaVaVaVaVa VaVaVaVaVVaVaV llelelel ellellllell eey ty ty tty ty ttty yy hathathathathahathhathhahata ba babba ba bba ba baba babarerereresresreesererre aaa a aaaa strstrstrstsstsstst ongongongonggonggononono rer reeererereresemsemsemsememsemsemsemssesesses blablablablaaablaalancencencencence to to to t to ttotoooooo th thhhthe Be Be Bee Be Be BBBBBBBig ig igig ggggiggig
BudBudBudududududududddhadhadhadhadddhaddhdhdha on onononooooo HoH Ho HoHoHooHooHHoHHH ng ngng ng ng gg KonKonKonKonKonnKKonKonng’sg’sg’sg’sg’sg’sg’sg’ssssg s LLa La La LLaLaaa LLaLaLantantantantntantaantatt u Iu Iu u slaslaslaslaslaaslaslaslaslaslandndndndndddnnd.ddndndnd H HoHHHHoHoooHoHooooooowewevwevwevwevwevevwevwevwewwewevwwwww ver erereeeee to to o bebbe be be honhononononoonnnestesteeestesteeeststst, tt, t, t, t, tt, tt,, he hee eeeee besbesbesssst vt vt vt vt viewiewiewiewiewiewieieeweiie s s ss
of of of of fof thethetheethethethee vvavava va va vallllelleellelelley ay ay ay ay ay ay ay are rerere re re re re sssseeseese n bn bn yy wy wy wy wy wy wy wy wwalkalkalkkalkalkalkalkalkkks os os oos os os oos os os on tn tn tn tn tn tn tn ttn n tn n he he he hehe he hehe e litlililitllitlitlitttttletletletletletleletle pa pa papapapapapapapap thsthsthsthsthsthsthsthshsthhs tht th th ththththththat at atat atatatatat wwinwinwinwinwinwinwinwinwinww nwwind td td td td td td ttd tdd hrohhrohrohhrohrohrohroooohroughughughughughuughughghughughughghugugh ththth thththt t t ttt e he he he he he he e hillllillls as as as as as aaaaaaand nd nd ndnd ddddnd nd ndnd
taktakakakakakakkkke ye yee ye ye yye yyeee ouououoou ou ouoouu to totototo to t sevsevsevsevvevssevsevseveraeraeraeraeraeraeral lll ll l ocaocaocaocaocaocaococac l mmml ml mll mmonaonaoonaonaonaonaaonaonastestes rieiieriei s. ss BypBypBypByBypBypppBypBypByByyy asassassassassassasassasss th th th th ththt e Be ee Be Be Be e BBe uddudduddudddddduddudduddddddddha ha hahaha hahahaaa haaaha enteneneneentnteeneneeen ireireirererereirerereely!lylyly!ly!lyly!l !lyly!lylylyyThThaThaThaThaThaThahat eet et et et t venvenvennvenv nnve inginginginggg we wewewee we st st stayeayeayeayeyeyeayeyey d ad ad ad aad at ttt ttt tt ttt he he he hehe he hee h TajTajTaTajTajTajjTajTajTajaj Ta Ta TTTa TaTaTaTassshshisshis wh wh whwhwhwhhwhhicichichichchchichichchich isii is is isisisis isi th thththhh t e be be be be bbe bbbbestestestestesttes ho ho hoo hoho hohoteltetelteltelt lt inin inin ini inini th ththththth th thtthht e ae ae ae ae ae aaaaee rrrereaearrererrere wiwi w th th h
larlarlalalalaalaa ge gegege ggege e roorooror orroooms,ms,ms,ms,msmsss, a a a a hughughughughughughughugu e gge ggge ge ge ge gym ym myyyyym andandandandandandandanda dd he he heh hehe h ateatateateateteeed id iid idd indondondondondondondooooor ooroo swiswswiwiwiswwiswimmmmmmimmimmmimmimmmmmmmmmmming ng ng ng gng ng nnngg poopoopoopoooopoopoop ll. lll I ddI ddddI ddI ddononon’onon’n’n’on’noo t qt qtt qt qt qt qt quuuiuituituuuuuuu e ke ke e nnononownownow
whawhawhawhawhawhwhwwh t et et eeet et et xcixcixcixcixcixcxcix tededtededddttedd u ususssssss mo mmmomomo m mmom sst ts aboabout ut utututut thethethehetthethethethehe T TaT Ta TaTaTaaTa TaaTajj, j, jjjjjjj bumbumbbumumbubumbumbumbumbu pinpinpinpininpininnnpinping iigg ig iig igg ntontontontonnnn E EmE EmEmEmEmmEmmama maama ma amaa a StoStoStoStotooS nene nen andandandandandddandan An An AnAnAnAn AnAnnAndredrereedredreeew wwwwww
GarGarGGarGararGarGarGarfiefieiefifieff ld dddld ldddd ((ak(ak(a(ak(a(a(ak(akaka a tta a ta tthe heheheheehe eheheh newnewewnewewewnnn Sp SpSp SpSpS ideidedeedidededdedermarrmarmamrmmaam n),n)n),n),n)n),n),n), o or orrr o oror th thhhhh thee Ke KKe Ke Ke Ke Keee inginginginging an an anananannnd Qd Qd Qd Qd QQd d Qd Qd ueeueeueeueeueeueeueeueeeeueeen on on on on on on on of Bf Bf f Bf Bf Bf Bf Bf Bhuhuthututhhuttututthuhuuthutan annanan ananannaaaaaaaan whwhhhhohohohohohohowhwhwh
stostostostoostosstostotostoppeppeppeppeppeppeppeppepeedd bd bd bd bbd bbbd by fy fy fy ffy fffyy or or or ooor oor oror aa qa qaaa qa qaaa quicuicuicuuiccuick dk dk k dkk dk ddk ddk drinirinrinrink! kk! k!kkkkkA fA A fA fA fA fAA fAA funun unun unununn actactactacactctctctaccta iviiviviiviviiviivitttyty tyty ty ty t thathathathathathathahathh tttt cct cccanan annnn nn bbebebee beee e oorgorgorgrgo go gganianianiananann sedsededsedseds d ata ata th thtt e he hoteoteeeototel l il ill iill s ds ds ds ds dds ss ds ds dresresresresrereereeressinsinsininsinsinnsinng ug ug ugg ug uuup ip ip ip ip ippp ip ip ippp ip ip ip n tn tn tn n tn tn tn ttnnnn radradradradadadradradaadra itiitiiitiiiitiitiitiitioonaonaaaoo l BBBl BBBBBBll l Bhuthututhuthuthuthuthutaneaaneananeaneaneaneaneessese se eessese seesesee ddrdredredrdreddredrddredd ss.sss.ss ItItIt Itt wwawawa wwawwawas qs qs qqs s s uituituitituituittttui e he he he he he he hee he he hiilalalilailailaailaii riorioriorioiorioriorioiorioous us us uusus sus totototototo otto tto seeseeseeseeseeseeeee
colcolcolcolololcolc lealelelelealealee guegueguueueg egugugu s wsss ws ws ws ws ws ws weareareearearreaaree ingingingingninngininininng ‘G‘G hoshosssss’ ’ ’ oo’ or r wwwr wr wwwrr www ahathathattatat caccac n on onlynlyyy be bebebbe dede descrscrscrsscrscrscribeibebebbeibeeedd ad ad d aad ad addd s Ss SSSSSss SSSScccocotototcottcotottoo tististististtististtiisi h dh dddddrerereresesrerr sinsinng gg ggg gg ggg gg ggg ggownownooownownownownownwnowoowno s –ssss –s –s –s – ch ch ch chheckeckeckecckecked eded ed knekneknekneknee-le-le-le-ll-le-le-le-e engengengengengengengengengggnn ththth thth hht robrobrobrobrrobobobobes eses es eseses ees witwitwitwitwitwitwittwitth ah ah aah ah ahh ah ah ah ahhh a
poupoupoupooupoupoupoupouuch chchchcc onoonon oonnn ththethethethethethethe in in ininninnsidsidsssidsidss dddde te tte te te teeeee to co co co co ararrrrrrarra rrrrrrry my my my my my mmy yyy oneoneneneonneneeeeeneeyy ayyy ay ay ay ayyyy ndndnd nd ndnd nddddd snasnasnasnaasnasnasnannanasnasnananaacksckckss..
L i f e s t y l e
Bespoke travel company Lightfoot Travel (www.lightfoottravel.com) is an Asia-based tour operator specializing in tailor-made holidays, honeymoons, short breaks, boutique accommodation and private villas in Asia and beyond. For more information please call +852 2815 0068 or email [email protected]
Travel Notes & Tips:• A minimum spend of $250 per day — all inclusive for
accommodation, transfers, tour guides and food.
• Visas: All nationalities (except Indian passport holders) require
visas, which cost $40. Best to leave a week for visa process time.
• Children are welcome everywhere but do not receive many
discounts.
• Spring is the peak traveling season for Bhutan, but it really is
a great destination year-round. The winter snows make for
exceptionally stunning views.
Punakha
About three hours’ drd ive from ThiTh mpu, PPunakha is thhe fe formor er capcapitaital and nd lielies is in an a va valleey ty thathat is is fa famoumous for
farming both red aand whwhite ricrice. e LifL e was s defiefi nitele y aa few pw paceaces ss lowower er herhere ae and nd I fI founouno d md yses lf f thithinkinking ng “Th“This is is is
the Bhutan thatat I imaimagingined.ed.””
One thing tht at wilwill il invanvariariaablybly st stickick in in th the me mindinds os of af anyonyone n tratravelvelve inging th throuough gh thetheh countn ry ry is the phphalla ic icc artartworwork tk thathat
adorns the ddooroors os of mf mostost ho houseusess. PaiPaintent d fd for or googood ld luckuck, t, theiheir or origrigin in goegoes bs backa tototoo ththhe ‘‘e DivDDivDivineinee Ma MaMMadmadmad n’n’ ’’ whowhowhowho
adopted ad momost s unuunusuasual ml methet od od of ofoo driid vining dg demoemons ns awaaway wy wy wwithithh a a cercertaitain bn bodyody pappapart rt notot no normallyy usused ed in batba tletle. We vissiteited td the he ChiChiC miLmiLhakhakhanhanhanhang Mg Mg Mg Mooonaonastestests ry,ry, wh whw ichichhh wa was bs bleslessedsedsedsed by by by by th thththe De De De Diviiviivivine ne ne ne MadMadMadMa manmaman, aand dn whiw ch ch legend claims
stimulateates ps pregeggnannancy cy cy cy in in in in ththothothose se se se unaununn bleblee to to toto co co co concncencec iveveiveive. L. L.. ocaocaooc ls ls claclaclaclaim imim im thathahaat at at at a vi vi vivisitsitsitsit to to to to th thhhe me me onastery ry hasa helped many whho had a previoviouslu y been unsucsucucucucucucsucsuccescescecescescescessfufusfufusfusfsf l.l.l.
Thaat evenveninging wewee st ststs ayeayeayeayed ad ad ad at Ut Ut UUmma ma a PunPunPunPunakhakhakhak a, a, aa a sa sa sa stuntuntunnnninninn g hg hg hg hoteoteoteot l locaac teded onn o a a aa hilh lsisiidede de oveoveov rloooking the Punakna ha a valleyl . Bird’s-eye viv ews across ts tss s he brbribb ibrightghtgghtgghhg grgreeneeneenn
tererracraced ed fi efi eeldsdsldsld sp sppsprearearearead od od od outut tut belbbelow,owow,o gr grgrg aduadduatiatiiaa ngng nng dowddowdown tn tttowaowaowo ardsrdrdsrdsd a a a a dradradramatmattmatic icic benbebend id n tn tn he h Mo Mo ChuCCC River.
PaParoro
ParPParo io io s os one nee ofof f BhuBhuB tantan’s ’s s mosmosmost bt bt eaueauautiful valvalleyleyyys a as aaand ndnd nd lielieies as aaalonnlonlolong tg tg tggg thehe hhe
patpatp h oh of ttwo wo of o the most t impmpimpmportortantantanan hi hihh stostos ricccc trtradeaade roro routetes ts tto To TTTo TTTibeibeibeibeibeib t. tt. t.
OneOOne ofof myy faavouvouritrite ae actctictivitiv iesiess w was ass attettettempmptmptmpptingingininingin to to to le le lele arnarnarnarn a a a bitbitbitbitb of ofo
arcarcrcherrheryy. RecRecognogniseis dd ad as ts ts ts he heeehe coucouountrntrtntrntry’sy’sy sy na naanaatitiottt nal sportt, i, i, it t i bs bs bbby yyyy
farfaff the mmostst popopoopulpulp ar arar ppaspastimtimtime. e. WWe WeWWWe We werwerwerwerww ee le le uucku y to catcatch oh oh oh one nene ne of ofof o
thethetht ma mamam jorjorjor co co countuntun rywywrywidededded to tournurnurnurnnameameamememenntsntsn th th ththhat a offereed a car as the
gragragragragragragranndnd nn priprizeze e — —— t— the he highighighighi hhheshesesh tt st sst st symbymbmbmyymbolol oooo of o powowpo er e in Bhutanan wh ereer
thethehhthehethethe m mamamaa ma majorjorjorjorityityi yy ff ofof of of ththth th th the pe pe pe pe pe peopeopeopeople lele le stistitit llll trtravelee byby fooofoot.ot Despite the intense
comcomcomcomcocomcompetpetpetpetpetepp itiitiitiitiononon on on on eveeveeveeveeveeverytrytrytryrytrythinhinhinhinhing wg wg wggggg as as in ininin googooood hd d hd umomour, and if anyone got a
bulbulbbbull’sl’sl sl -ey-ey-eyeyyeyeeee, e, e, e, hishihishishishihh op op opopponpoponponnentntentente s ws ws ws ws woulouloulouloulou d dd dd dd o ao a l lil ttle ddance in cceleelebrabr tion. n
NowNowNow th that’at’s ws wws whathathathathah I I I I lcallcalcala l ggl gl gl ggoodoodoodooood sp ssp s ortortortrtsmasmasmamasmasmansnshnsnshnshipip!ip!p!
TreTreeTrekkikkikk ng ng ngn aroaroaroar undundun th ththe Pe Paroaroararo vavava vallellellelley iy iy is es es xceptionaonaonao l al al and ndddd oneonennoneneone ofof ofoff of thththth the eee
besbesbe t wtt waysaysss to to to exex exexperperp ienience ce ceee BhuBhuBhuBh tantantanesees life by by by by wanwanananw ndederdedderderingingngg ofoof oo f tf the heee
tratrailsilils ininto t remremoteotetete vivivillalallaggesgesgeses TT. TTT. T. Thehehe hhh TakTakTaTT tsaang ng ng g PalPalPaPaPalPalalphuphuphuphug MMg Mg Mg Monaononaonaonastestetstestestery ryyry y – o– ooothethethetheh rwirwrwiise se ss kknknoknooown wn as as as asass thehhthethethth TiT gergerr’s ’s NesNesNesNesNesNesestt, t, tt, waswawwaswasswassasw cc cece ce ce cec rtartaaartartartainlinlinlnlininin y y ty ty ty tyyyy he heeehe hee mosmosmososmoosmomoom t it t t iiiiiit t imprmprmprmprmprmprmprmprprp essessessessessessesess iveveiveiveiveveeeee p pi pipinnannannannannnnan cleclcllecleclelelecleleleeccleclcle of of ofof ofoo
ananyany tr trek ek ekek we wewwe w diddiddiddid. A. AAccccccocococcordirdirdirding ngng ng to toto to tooo leglegleglegegendenenenendendend thth th th thhe ne ne nnne e estestesteste is is is is he hehe held ldld ld to to to theheheethethethe ss sisis de de dede de of of of of thethetheethe mo mo mommmomountuntuntuuntuntainainainaain by b y ananangelgelgeelgel ha ha ha hahhhaiirsirsrsi , a, aaaaaand nd nd dndndndddnd aasas as yououyououou wiwwiwiw nd nd ndd ndndd youuuuyouyouyouyouyouyy r wr wr wwr wr wr wwwwway ay ay ay ay ay ayyyyaay yaay totototo ooooottotot thethethethethethethethetheetheheee to to to toto to ot t p wp p wp wp ithhhth pprrr prprrrr rayaaayayayeayeyeayeayeaaayea eeeyer rr rr r
flafl afl afl gs gs gss fl ufl ufl ttetteteeteterinrinrrinring ag ag ag rouround nd ndn iinin in n nn thethetheehe wiwiwiwiw nd,dndndnd,n ititititt trtrtr tr trt ulyulylylulyulyulyly is is is isisis qu qu quququ quiteeiteiteiteitee a a a a magmamagmagmagmaggicaicaicacaicaicaicall el ell el el expexpexpexpep rieirierieeieeeencecncencenncen e... .
OneOnOneOne fof of of thth th the oe oee ooe thehtheehethethethether hr hr hr highghighighhhgg lligligggggli htshtsstshtss ooo of of ofo ou ouou our tr tttr tr tt ipiiripriprrr wa wawawawaaawwawas vs vs vs vs vs vs visisiisiisiisitintintintinnnnng Tg Tg Tg Tg Tgg obgobgobgobgobgobgobgbbgob ay’aay’ay’aya s fs fs fs fs armarmarmarmarmmmmr houhouhouhouuh se.se.sese.se Th ThThTTT e se se siitttinginginggngng rorooro roro oom om om omom omomom omo waswaswaswaswaswasawaswaswaa pspsps psps pspspsycychychychchhchyc edeedeedeededeeededeedeeeeddeellicliclicliclicic oro angangangangngngnggee ae ae ae ae aaandnd nd ndndndddnd nd ndnnd I sI ssI sI sI sI ssI ssatatatat at at aat atata ininnnininin n in a tta tta ta ta taa a taa ranranranranrananrananraranara cececececececce cecececece cee eeateateaeaeaatee ingingnnggngi dr drr drriediediede
ricricricccricricrricricrricrice (e (e (e e ((aan annan an anna ltaltaltaltaltaltalteererernernernrne atiatiatatiative ve ve ve v to tootototo cricricricriric spsspsspsspsppp ) a) a) aaandndnd nd nd ndndd sipssipsipsipsippinpinpinpinpinpinpinppinpp g tg tg tg tg tg tg ttg g he hehehehehhe potpotpotpotpotpopo ententententententent ‘A‘A‘A‘A‘A AAra’ra’rara’rara , a, aa, a, a, a, a tr trtrrtradiadiadadiaditiotiotiotiottionalnalnaln al al alalala cocohohcohcocohcohhoh lololi bbbbc bbc bc bc bc beveeveeveeveeveveveeveeeveevv ragragragragragragragrarage meeeee mme mmmadeadeadeadeeeeeee fr frrfrfrf frrffffffffromommmmmom om mmom om o ffferferferfeerf mmmmenmenmemem ted ririce cecece cecececececccccce ooror oooooooooo maima ze.ze.e.eee Ou O Ou Ou OuOu OuuOuOu Our ddr r dr ddr ddr r inninnnnninniiinnnner eeeer ee thathathahathahaat t t
eveeveeveeveninninninning wg wwwg wg wwg wwwas asasas as as asssa a da da da da da dddaa dddelielielielililiciociociocciociooc us us s s usus s ususu curcurcurcurcurcurcuucurcuru ry ryry rry ry ry heaeaheaheaavilvivvvily ly ly ly ly laceaceaceaceaceacececceea ed wd wdd wd wd wd wdd withithithhithithith c chch c cc ililill , wwwwwwwwhichichichichichichh h h h ih ih ih is os os os oooos nnnne ne ne ne oofof of of thethethethe ke ke kekee kekeeeek y cy cy cyyyyy ompompomppponeoneoneonnonononeoneooo tntsntsntsnntsntstss inin in innnn momomo most ttstst st BhuBBhuBBhuBhuBhuBBBB antantantantantanannantanesesseeseeseeseeee cucucuuuuisisissss ne.e.e. II I I I III lovlovovlovovovlovvovooooooo ed eddddded ed ed edee tthath t tttttthehee he ee heehee prprapraprapraprayeyereeyeryeye rororor om omomom mmmmmm
waswasawaswasa alaal alalal al almosmosmosmosmmosmosmmo t tt tt tt ttt ttt thhhehehe hehe hhe lalalalalarararlarlaargesgesgesegegesgesesesse tt rt rt rtt rt rroomoomoomoom inin ininn th th ththe he he he housousousouse see se se showhowwhohowhowingingginggg ju ju ju j st ttsttst howhowhowhowhowo mumuu mumuuuch chch ch cch impimpimpimportortortrtancancanccancnancancancccee ie e ie ieeeee s s ps ps ps placlaclacacccl ed ed ededed onon on onon BudBudBudBudBudBuddhdhidhidhdhd sm sm mmm in in in n niininnn thethethetheththeheeh cocooooooountuntuntuntuntuntununtntunuunttn ry.ry.ryry.yryryry
SomSomSomSommethetheethethingingngngnggnng I’I’ d hd hd hhhhhearearearearearaa d ad ad lolot at at bouboub t bbbt befoefoefoefofore rere re ee arrararrarriviiviivingng ng g in in in BhuBhuhuutantantantan w wa wa was ts ts heiheiheeeir nr nnnnnnnootototiotiottttiotooottiononon on on of fof ofo ‘GrGG‘GGrGG ossossossossoss NaNaNa NaNaN tiotiotiotitionalnalnalnal H H HaHa HHappipppppipppppinenenenenesesness’ s’ s — a— a— a— a— a— a— a— — a— a— a— — te te te tete teete teteteeerrrmrm m rm mmmm coicoicccccoicoicoicccoio nedneddnedddnedddnne b bybb bybybybybyybyyyyy BhBh Bh Bh BBBBhBBBBhutautauutautatataaautaaataau an’sn’sn’sn’snn sn fo fofofo fofofoourturturtrtthhhhhh hh
DDraDraDraDDDDragongongogo KiKiKingng ng in n thethethethethe eaea e rlyr yyyyy 70700 7070707070s ss ss s ss s ignignalial ng ngngnn hishisisshish cc cococ mmimmm tmetmeeent nnt to tooooooo buibuibuibu ldildildinng ng ananan na eeeeecoecocococooe nomnonomnomnomo y by bby by by baseaseasesed od od odd ooon Bn BBBuddudddduddddddudddddd hishishishish ssstt vt vt vt valualula es.eeses.es.eees.es.sees Th ThThThh Th Thh ThThisisis is is s sisis isss spspispispispispispipipipip ritrittritritritritritritritittualualualuuuu gu guggu guidaidddadaaaidadd ncenceccecceeeeeceece is isiiissis isiss is isi iniin ininni herhererehhh ententntententt in inin inn in
BhuBBBhuBhuhutantananaana eseeseeseee d dadadaadadailyilyilyllyilyilyi yy lilililife.fefffefee. FoFoFFoooooo For or or or orr or or ururur urrur entententententententntireireireireireireree ststayay ay ay ay notototnotthhhinhinihinhinhing wg wwas s tootoo mmuuumu ch ccch trororotrot ublublubluble, e,e,e, aanandandandandanaaa wew wewew cococoouldulduldulddddn’tn’tn’n’t’tt ha haahhahahaaave vevevee beebeebeebeeeeeeeen mn mn mn mmnn nn adeadadeadeadededeeededede t t to tooto fefeffefffef el eel el eleleeeel el l mormormomormormormormormormormormormmmmmo e we we we we we we we wwwwe we elceelcelcelelcelcelceelceelcelccelcelceellcclcomeomeomomeoommomoo ..
Britain in Hong Kong 1716
The Aberdeen Marina Club played host once again to
our Young Executives Scottish Ceilidh!
The evening included a performance from the brilliant
pipe band and highland dancers, as well as the
incredible Haggis Address led by John Bruce. The
night then followed with the delicious fare and of
course the whisky, accompanied by Irn-Bru this year,
wonderfully Scottish! After the food came what all the
guests had been waiting for, the dancing! A huge thank
you must go to Iain Carmichael and his band were, as
who ever, outstanding.
Jardine Matheson Group were our title sponsors
this year, so another big thank you to them for all of
their support and cooperation, the night was a huge
success and we couldn’t have done it without them.
Special thanks must also go to Edrington Hong Kong
who sponsored a bottle of The Glenrothes whisky per
table, which was very well received by all the guests!
Other special thanks must go to all those who donated
prizes for the lucky draw; Hong Kong Yachting for
donating tickets to the Saturday afternoon Adventure
Sail and the Sunset Cruise; Jack Wills, for donating a
duvet and pillow case set; Geodhuis & Co for donating
two bottles of Janisson & Fils Cuvee Tradition, and to
DotCod for a generous dining voucher at their Seafood
Restaurant and Oyster Bar.
Finally, and most importantly, thank you to all the
guests for donating so generously. We managed to
raise HK$22,178.70 for MINDSET, which is greatly
appreciated. Thanks to everyone again for making this
year’s Ceilidh another fantastic success and we look
forward to seeing you all next year!
For more information about the event or any upcoming
YNetwork events please contact [email protected].
The Jardine Matheson Group & British Chamber YNetwork
Scottish Ceilidh
E ve n t s
Britain in Hong Kong 1918
Member DiscountsFood and Beverage and Accommodation
Accor | Members will receive 10% discount on top of the lowest rates that Accor’s
Asian hotels are offering on the day. This applies to over 1600 Sofi tel, Pullman, MGallery,
Novotel, Mercure, Thalassa & Orbis hotels worldwide. You will also receive 5% discount
on top of the best unrestricted rates for hotels including ibis (in specifi c countries), All
Seasons & Hôtel Barrière. For more information please contact Regina Yip on 2868
1171 or email [email protected]
Alfie’s | Members of the British Chamber of Commerce can benefit from a 10%
discount at this chic restaurant in Hong Kong. To make a reservation please call 2530
4422 or email booking.alfi [email protected]
Berry Bros. & Rudd | Members can benefi t from a 10% discount on all retail prices as
well as receiving invitations to free tastings and other wine events during promotional
period. For more information please call 2907 2112
Courtyard by Marriott Hong Kong | Members will receive a 10% discount on food
only in MoMo Café. To make a reservation please call 3717 8888
Dot Cod | All members of the British Chamber of Commerce of Hong Kong will receive
a 10% discount on the bill. For more information please call 2810 6988 or email
Grand Hyatt Hong Kong | 15% discount on food and beverage at The Grill and
10% discount on treatments upon spending HK$1,000 at Plateau Spa. To make a
reservation please contact The Grill on 2584 7722 or the Plateau Spa on 2584 7688
Hyatt Regency Hong Kong, Tsim Sha Tsui | 10% discount at The Chinese
Restaurant, Hugo’s, Cafe and Chin Chin Bar (except during happy hour). To make a
reservation please call 2311 1234
JW Marriott Hotel Hong Kong | Members will receive a 10% discount on the total
bill at Man Ho Chinese Restaurant, JW’s California, Marriott Cafe, The Lounge, Riedel
Room @ Q88, and the Fish Bar & Grill. To make a reservation please call 2810 8366
Le Méridien Cyberport | Members can book a Smart Room at the special rate of
HKD1,600 including a daily eye-opening buffet breakfast (subject to availability). You
will also receive 20% discount at 5 of the hip restaurants and bars that the hotel has to
offer. Furthermore, when you book the 21-day long room package at HKD23,100 you
will receive a ‘Round Trip Limousine Service’. For more details please call 2980 7785
Hong Kong Skycity Marriott Hotel | Members will receive a 10% discount on the total
bill at Man Ho Chinese Restaurant, SkyCity Bistro, Velocity Bar & Grill, and The Lounge
(Promotion does not apply to alcoholic beverages). To make a reservation please call
3969 1888
Renaissance Harbour View Hotel | Members will receive a 10% discount on the total
bill at Michelin Star Dynasty Chinese Restaurant, all day dining at Cafe Renaissance, Scala
Italian Restaurant and the Lobby Lounge. To make a reservation please call 2802 8888
The Mira Hong Kong | Members will be given special room rates, a complimentary
upgrade and fantastic discounted rates on the Spa suite package (subject to availability).
For more information please contact Connie Kwan on 2315 5666 or email connie.
W Hong Kong | Members will receive fantastic offers at Kitchen and Sing Ying. Dine at
either of these restaurants and receive complimentary discount vouchers to use at your
next meal. For more information or to make a reservation please call 3717 2222
There are many great benefits of being a member of The British Chamber of Commerce. One of those is the
Member Discounts programme which is an exclusive package of discounts that range from discounted car rental,
reduced hotel accommodation, airfares and even relocation costs.
Every six months we invite members to prepare a tailor made offer to all the members of the British Chamber. You
can fi nd these benefi ts listed below and for more details please visit our website www.britcham.com
Home
Allied Pickfords Hong Kong | Allied Pickfords will extend a free local move for any Home Search completed by SIRVA Real Estate. For more information please call 2823 2089 or email [email protected]
Bowers & Wilkins | B & W are offering members a 10% discount on all listed price items in the B&W Showrooms in Tsim Sha Tsui and Central. For more information please call 3472 9388 or 2869 9916
Colourliving | As a member of the British Chamber of Commerce, you can enjoy a 10% discount on all normal price merchandise when shopping at Colourliving in Wanchai. Please call 2510 2666 or visit www.colourliving.com
Travel & others
Avis | Members can receive up to 20% discount off standard rates on car rental bookings. To make a booking please call 2882 2927 or visit www.avis.com.hk
British Airways | As a member of the British Chamber of Commerce you can enjoy an exclusive offer of 7% discount from British Airways. To make a booking please visit www.britcham.com/memberdiscount/british-airways
Compass Offi ces | Compass Offi ces, Hong Kong’s largest Serviced Offi ce provider, offers members a 10% year round discount on meeting rooms, a free one hour Telepresence or Video Conferencing session and a 3 month complimentary Virtual Offi ce package. For more information please call 3796 7188 or email hksales@compassoffi ces.com
Flight Centre | Members will receive HKD150 off the fi rst booking made as well as a complimentary Airport Express ticket per booking. For all holiday and fl ight enquiries please call Paul Jeffels on 2830 2793 or email paul.jeffels@fl ightcentre.com.hk
Lightfoot Travel | British Chamber members will receive 5% off all holidays booked with Lightfoot Travel. Please call +852 2815 0068 or visit www.lightfoottravel.com for further details
Regus | Britcham members will receive a complimentary six-month Businessworld Gold card that gets you access to 1,200 business lounges in prime central city business locations in Asia and around the world. For more information or to accept this offer please visit www.regus.hk/localpartnership and enter the activation code APHKBCC in the Promotional Code box.
sense of touch | Britcham members will receive 20% off all treatments on their fi rst visit upon a total spend of $1,000, 10% off facials and massages in all subsequent visit as well as a $1,000 treatment coupon when purchasing a $10,000 cash package. For more information please call 2201 4547
The Hive | The Hive is offering one additional month’s membership at no extra charge for any member who signs up for 6 months. For further details, please visit www.thehive.com.hk
Virgin Atlantic Airways | Special offers to London are available exclusively for members of the British Chamber of Commerce. Please call 2532 6060 for more details or to make a reservation
VisitBritain | British Chamber members can get 5% on all purchases from VisitBritain’s online shop by entering the code TR7DE67! at the checkout. Please visit www.visitbritaindirect.com/world for further details.
Terms and Conditions apply. All member discounts are subject to availability. If you are interested in providing a tailored
offer to our members or for more information please contact Emily Ferrary on 2824 1972 or email [email protected]
Britain in Hong Kong 2120
To enter:• Consider who among your contacts might be interested in joining the Chamber
• Email [email protected] with the name and contact details of your suggested company
• If appropriate, contact your suggested company and let them know that the Chamber will be in touch
• The Chamber will follow up with each suggestion directly
• If your referral is successful, the Chamber will contact you with details of how to book your dinner. Your name will also go into
the prize draw which will be drawn in March 2013.
Make a successful referral to the
British Chamber of Commerce
and enjoy a fantastic meal for two!
AND if you happen to refer the most new members to the Chamber, you are in for a real
treat for you and your friends! A complimentary dinner for four at Sakesan, the newest
Robatayakibar, courtesy of Cafe Deco Group.
SakesanSakesan is the newest Robatayakibar in the heart of the bustling Soho area. It offers a range of
exquisite dishes fresh from their robata grill, as well as other Japanese culinary delights, all rendered
with a modern twist. Designed by Fiona Bagaman and Mirei Lim, Sakesan uses different wood
and stone tones with fl ashes of black and gold to create a serene, relaxed and cool space. Funky,
colourful sake barrels wrap the bar
area and frame the individual dining
booths and an illuminated Japanese urban scene gives the bar a warm
glow as well as striking visuals. Signature dishes include homemade
steamed tofu, salmon miso, lobster dumplings and SAKESAN black
cod. There is also a cool bar featuring a top range of sakes, shochus
and awamoris with a superb range of cocktails made with these classic
Japanese ingredients. To compliment this they also offer a selection of
some of the fi nest, most thirst quenching beers to emerge from Japan.
The British Chamber is delighted to announce that the
Member Get Member 2012 campaign is well underway! If
you successfully introduce a company that results in them
becoming a member of the Chamber, you will receive a
fantastic dinner for two courtesy of one of our top member
restaurants in Hong Kong.
Not only that, all referring members will be entered into a
prize draw to win a $2,000 voucher to go towards your holiday
provided by Flight Centre!
MEMBER GETMEMBER 2012
Terms & Conditions• You must be a member of the British Chamber to be eligible for this offer
• The dining vouchers will only be provided if your referral results in a new member for the Chamber
• This offer is valid for all members whose referral results in a new Corporate, Overseas or Startup member of the Chamber. It
does not apply to Additional members or additional YNetwork members
• The Chamber will allocate the restaurant vouchers. Members will not be able to choose which restaurant they visit and must
adhere to the terms and conditions
The Bostonian, The Langham, Hong KongThis well-established restaurant has been a Hong Kong favourite
for well over a decade. Located at the lower lobby level of
The Langham, Hong Kong, The Bostonian has an excellent
reputation for its superb steaks, and more recently its fully sustainable seafood menu. Featured
by one of Hong Kong’s infl uential restaurant bibles, “The Hong Kong Best Restaurant Guide”
since 2000 and recommended by The Michelin guide, the Bostonian is a hallmark for impeccable
service and exceptional food. Guests can indulge in a tantalising array of fresh seafood from
around the world at the “Raw Bar”, including home-made smoked salmon, prawns, crabs and
freshly shucked oysters. The enticing menu also includes gourmet favourites such as maine
crab cakes, sautéed foie gras, clam chowder, as well as separate menus for the restaurant’s
specialties – the Boston lobster galore, seafood sharing platters and Bostonian grill.
KITCHEN, W Hong KongKitchen is a modern bistro with a capacity of 200,
reflective of W’s signature stylish and fun design. Upon arrival to KITCHEN, the
mad hatter’s tea party in “Alice in Wonderland” brings guests to a world of fantasy.
Cats play and jump around the stacks of plates, inviting guests to join their games
too. KITCHEN’s modern interpretation of timeless classics and equally innovative
original masterpieces fi ll a menu that’s designed to tantalize and satisfy even the
most discerning gourmands. Guest can indulge in the fun world of kitchen, while relaxing in the pleasant and interactive dining
experience, sampling the delicate cuisine on offer from all over the world.
Lobby Lounge, Conrad Hong KongFeatu r ing the spectacu la r v iews
of the Hong Kong skyl ine and l ive
entertainment, the Lobby Lounge is the ideal venue for private
meetings or relaxed gatherings with friends. From salad bar to noodle
station, and delectable hot dishes to exquisite desserts, the Southeast
Asian themed supper buffet showcases an impressive range of more
than 50 scrumptious all-time favourites.
So what are you waiting for? Spread the word throughout your network to enjoy a complimentary meal for two at one of these fantastic member restaurants:
cafe TOO, Island Shangri-La, Hong KongThe innovative cafe TOO brings casual dining
to a higher level of creativity. Their ten cooking
theatres, each featuring a different culinary style, are
showcases for the best of international cuisine as well as stages for their
chefs' engaging performances.
T
Café Renaissance, Renaissance Harbour View Hotel Hong KongCafé Renaissance is the perfect place for all day dining. Located on the
Mezzanine fl oor, the 210-seat all-day dining café serves a wide variety
of dishes from all over the world. Café Renaissance serves wholesome
breakfasts, chef crafted lunches and dinner buffets plus à la carte menu daily and brunch
on weekends, in a warm and welcoming atmosphere. In addition to the great array of fresh
seafood delights using the freshest ingredients, guests can also enjoy a tantalizing array of
international favourites and local specialties from live cooking stations.
Britain in Hong Kong 2322
The Women’s Foundation launches Scholarship Scheme to send Hong Kong students to the
University of Cambridge
The Women’s Foundation, a leading Hong Kong non-profi t organisation dedicated to the advancement of women, announced the launch of a Scholarship Scheme to send Hong Kong students to the University of Cambridge to pursue the MPhil in Multi-disciplinary Gender Studies.
The scholarship is a critical step in developing and equipping a talented pool of individuals from Hong Kong with the knowledge, skills and resources to further gender studies and gender research for the greater good of society.
The Women’s Foundation Scholarship will cover all university and college fees, enabling the recipients to pursue their studies regardless of fi nancial capability. All graduates from a Hong Kong university or tertiary institute holding an upper second-class degree or equivalent are eligible to have their application considered, having been accepted onto the MPhil through the University of Cambridge’s standard admission procedure. The fi rst of the scholarship students will start their studies in Cambridge in Autumn 2013.
The Women’s Foundation will be offering a series of Information Sessions on the Scholarship Scheme at leading universities and other tertiary institutions in Hong Kong. For more information on the Scholarship Scheme and the Information Sessions, please visit www.thewomensfoundationhk.org.
Family businesses are ‘unsung heroes’ of the global economy, with increased sales and
aggressive growth plans, says PwC
Two thirds of family fi rms around the world have grown their sales in the past year, and even more are confi dent that their ambitious growth targets for the next fi ve years will be met. Recruitment of skilled staff and the perennial problem of planning for succession are two of the key challenges facing family businesses.
These are just some of the fi ndings of the PwC Family Business Survey 2012, which surveyed 1,952 family business executives in more than 30 countries worldwide, including Hong Kong and Singapore.
Family businesses are thriving globally, with 65% having grown sales in the past year, compared to less than half in 2010 when PwC last conducted the survey. This sales growth has been particularly strong in Eastern Europe, Latin America and the Middle East. Only 19% saw a reduction in sales over the last year, compared to 34% two years ago. Family fi rms are very ambitious for the future, with 81% anticipating steady or quick and aggressive growth in the next fi ve years. Of those who aim to grow, 93% are ‘confi dent’ about their company’s growth prospects.
In Hong Kong, family businesses have performed reasonably well over the last year, although a lower proportion have experienced growth than in some markets. Only 48% have grown sales in the last 12 months. But family businesses in Hong Kong are confi dent in predicting steady growth in future with 76% are aiming to grow over the next fi ve years.
International Montessori School Approved by Accrediation Board
We are delighted to share some fantastic news with you. IMS has been unanimously approved by the IMC Accreditation Board to be an IMC accredited Montessori School. IMS is the fi rst accredited Montessori Primary School in Greater China. IMS is one of the largest Montessori schools in the world, and its growth has raised awareness of Montessori in Hong Kong,
Passport Offi ce Closed Over Winter Holiday Period
The Passport Offi ce will be closed to the public from Monday 24 December 2012 to Tuesday 1 January 2013 inclusive. Anyone wishing to submit a passport application during this period can leave the completed form, together with all necessary supporting documentation and Credit Card Authorisation Form in the drop box located inside the public entrance to the Consulate General.
Ernst & Young become Sterling Members
The British Chamber of Commerce is delighted to announce that Ernst & Young have become their newest Sterling Member.
Sterling membership is a premium package of benefi ts for companies who wish to increase their profi le and add value to
their membership by supporting the Chamber at a higher level. This high value package includes additional memberships,
more profi ling and a range of other benefi ts. For more information on Sterling Membership please email Phillippa Cook,
News
Sterling Member Announcement
InfraRed Capital Partners makes Senior Advisor appointment
InfraRed Capital Partners has appointed David Watt as Senior Advisor to focus on the further development of their real estate fund business in Asia.
David was previously Chairman, North Asia, and Head of Business Development and Client Services, Asia-Pacifi c, at DTZ. He will remain based in
Hong Kong.
Stuart Jackson, InfraRed’s Head of Real Estate, said, “David has a long standing relationship with InfraRed and we are delighted that he has joined to
assist us in further growing our Asian real estate business. David brings an in-depth knowledge of markets across the region, long term experience
in shopping centre development and a deep network of contacts and relationships.”
InfraRed, formerly HSBC Specialist Investments, are infrastructure and real estate fund specialists with offi ces in London, New York and Hong Kong. To date in Asia,
they have raised and invested real estate funds in China and Vietnam and, amongst their PPP infrastructure projects, are leading the development of the Singapore
Sports Hub, Asia’s largest PPP project and the New Royal Adelaide Hospital in South Australia.
Howse Williams Bowers announces new partners
Howse Williams Bowers has announced that Katherine Chuang, Lynn Lee, Lisa Nabou and Oonagh Toner will become Partners of the fi rm with effect from January
2013. All four solicitors previously worked at Reed Smith Richards Butler in Hong Kong and moved with the founding partners on 1st January 2012. The company has
also expanded its corporate practice with the addition of new partner Brian Ho and expanded its shipping practice with the addition of new partner David Coogans.
Katherine Chuang specializes in corporate fi nance, mergers and acquisitions, direct investment, corporate restructurings and reorganisations and
general commercial matters. She previously worked for an international law fi rm, held an in-house position at an international investment bank and
spent a period on secondment at a Hong Kong telecommunications listed company.
Lynn Lee’s primary area of practice is in complex, multi-jurisdictional commercial litigation and dispute resolution with focus upon
insurance, property, insolvency and shareholder disputes. She also has experience in debt recovery, sale of goods, trade fi nance,
media law, commercial fraud, injunction, jurisdictional challenges, judicial reviews, defamation and related litigation.
Lisa Nabou is a healthcare and disciplinary lawyer who has worked extensively with Medical Protection Society in London and
across Asia. She has advised healthcare professionals, hospitals, prison healthcare units and various health companies on a wide
range of medical and regulatory law issues such as negligence claims, disciplinary tribunals and inquests.
Oonagh Toner specialises in dispute resolution and commercial and professional negligence litigation. She also handles clinical
negligence claims advising healthcare professionals on a range of contractual, regulatory and criminal matters.
Brian Ho joins Howse Williams Bowers from Standard Chartered Bank, Hong Kong where he was a Director in the Corporate Advisory & Finance
Group and acted as one of its responsible offi cers for the Hong Kong IPO execution team. He previously practised in the corporate and securities
department of various leading local and international law fi rms in Hong Kong.
David Coogans, joins Howse Williams Bowers from Holman Fenwick & Willan where he was Head of the Sydney offi ce. He is a shipping lawyer with particular expertise
in collision and salvage work in addition to dry shipping cases. David is admitted to practice law in Australia, Hong Kong and England and Wales and has over 25 years
experience in shipping and international trade law.
Thank you for your continued support
The British Chamber’s Sterling Members
Britain in Hong Kong 2524
New Appointments
STARTUPBiotechnology Holdings International LtdPhilip StubbingsChairmanTel 2114 [email protected] A, 5/F, Wing Hong Factory Building, 777-779 Yu Chau West Street, Kowloon, Hong KongEnvironmental Services
Asia Energy ConsultingStephen O’SullivanPrincipalTel 6053 [email protected]/F, 68 Mount Davis Road, Pokfulam, Hong KongConsultancy
Sandler Training Hong Kong (JR Global Training Limited)Ken TashimaGeneral ManagerTel 9674 [email protected], Tower 3, Banyan Garden, 863 Lai Chi Kok Road, Kowloon, Hong KongConsultancy
Hong Kong Institute of Etiquette LimitedKristine StewartDirectorTel 3622 [email protected]/F, Yue Hing Building, 103 Hennessy Road, Wan Chai, Hong KongConsultancy
CORPORATEStanley Gibbons (Asia) LimitedMarco KasterInvestment Director, Hong Kong & AsiaTel 3975 [email protected]/F, Central Building, 1-3 Pedder Street, Central, Hong KongFinancial Services
Jardine Airport Services LtdDavid WalkerCheif ExecutiveTel 2216 [email protected]/F, CNAC House, 12 Tung Fai Road, Lantau, Hong KongAviation & Aerospace
rogenSi LimitedMark Weston Regional Client Director AsiaTel 9725 [email protected]/F, Wincome Centre, 39 Des Voeux Road, Central, Hong KongConsultancy
STARTUPADDITIONALBiotechnology Holdings International LtdPeter Reid CEOTel 2114 [email protected] A, 5/F, Wing Hong Factory Building, 777-779 Yu Chau West Street, KowloonHong KongEnvironmental Services
INDIVIDUALChristopher MillarTel 2158 [email protected] 2401-3, 24/F, 181, Queen’s Road Central, Hong Kong
OVERSEASGrant Property Solutions LtdPeter GrantCEOTel +44777 62034 [email protected] Coates Crescent, Edinburgh, EH3 7AF, United KingdomProperty Asset Management
YNETWORKStanley Gibbons (Asia) LimitedSophia NazerInvestment Portfolio ManagerTel 3975 [email protected]/F, Central Building, 1-3 Pedder Street, Central, Hong KongFinancial Services
Jardine Matheson GroupAlexander HarmanJardine Executive TraineeTel 9539 [email protected] Floor, Jardine House, Central, Hong KongConglomerate/Holding Company
DLA Piper Hong Kong Services LimitedNaveen QureshiAssociateTel 2013 [email protected], Edinburgh Tower, The Landmark, 15 Queen’s Road, Central, Hong KongLegal
Business Benefi ts of CSR — Is there Gold at the end of the Rainbow?Event date: 17 Jan 2013 - 17:00 - 19:00
Is CSR just a marketing exercise for businesses? Is there any more required than making a donation to charity, or organising a team event every so often to help the community? How can we demonstrate to our senior management and shareholders that there are tangible benefi ts to CSR? What are those benefi ts in fi nancial terms, and when do the benefi ts of embedding CSR in an organisation justify the costs involved?
Joint Business Community Luncheon with CY Leung, Chief Executive of the HKSAREvent date: 23 Jan 2013 - 12:15 - 14:00
The Hong Kong business community has invited Mr CY Leung to speak at a luncheon on Wednesday, 23 January 2013. It is a good opportunity to hear directly from the Chief Executive on how the SAR government plans to lead Hong Kong in the year ahead, and also his views on such key issues as housing, old age benefi ts, air quality and Hong Kong’s competitiveness.
Dining Etiquette — Protocol for Successful First ImpressionsEvent date: 28 Jan 2013 - 12:00 - 14:00
Learn how to make the best first impression during a social or business meal through attentive hosting, facilitated conversation, and essential dining protocol. This presentation provides participants with a summary of the necessary components for smoothly run formal and casual meals including duties of the host and guests; making conversation; restaurant protocol and essential table manners that one must have.
New Members
Upcoming Events We Collect and deliver your carFREE OF CHARGE
(subject to distance)We provide good, quick repair service at
reasonable prices
ALL REPAIRS WITH THREE MONTHS GUARANTEE
Our Business Hours8am-6pm, Mon-Sat & Public Holiday
Our 24hrs. Emergency Towing Agent“Firstone Towing Services” 8203 3411
Please call us at 2565 6166 or Fax: 2856 1047E-mail Address: [email protected]
Our competitive Labour charges: From
Lubrication Service $ 110
Tune Up Engine $ 220
Engine Decoke & Grind Valves $ 1,500
Engine Overhaul $ 4,000
Brake System Overhaul $ 900
Clutch Mechanical Overhaul $ 1,000
Air Condition Freon Recharge $ 400
Alternator Overhaul $ 400
Starter Motor Overhaul $ 400
FOOKIE MOTORS CO. LTD.Shop 7, G/F, Paramount Bldg.,12 Ka Yip Street, Chai Wan, Hong Kong.
Sponsored By
Oct 25 2012, Waterside Terrace, Island Shangri-La Hong Kong
Houleye Gory (evobilis), Bingo Woo (AIA) Michelle Woo (TMF Group), Kevin Moore (Agile8 Consulting), Peter Hodges (Standard Chartered Bank)
Annabelle Baker (Lush), Charmaine Holland
Stephen Sheppard (PTS Consulting), Craig Armstrong (Standard Chartered Bank), Iain Reed (Enhanced Data Group)
Winston Hammill (Concise Media), Thomas Ng (Crowne Plaza Hong Kong Kowloon East)
John Handley (BT), Anne LeBourgeois (Hamilton Advisors)
Fraser Murray (Rock the Boat Consulting), Tracy McLeod (Rock the Boat Consulting)
Gary Beadle (The Store House), Dominic Masterton-Smith (Human Communications)
Mark Evans (JP Morgan), Maria Gomez (Terra Firma), Clive Lindley (The Henley Group), Claus Madsen (ISS Greater China Ltd.)
Jose Reboredo (BT), Rob England (en world), Ken Owiti (hunterPac)
Devyani Patel (iEdge Consulting Limited), Mathew Bate (Private Capital)
Cédric Thiry (SEED), David Hubbard (deVere Partners)
Janet Law (FDM), Christopher Lloyd, Chanthala Sengnouanchanh (Concise Media), Chris Thomas (Leodan)
Natalie Chan (Crown Relocations), Claus Nestmann (TC Treasury Advisors)
Salima Debouba (Willow Blu), Lina Yu (SEED)
Richard Ireland, Liz Hammerton (Secretarial Offi ce Services)
Britain in Hong Kong 2726
Shaken Not Stirred
Top Related