Biotechnology Toolbox for Synthetic Biology Basic Molecular Biology and Genetics
Presenter: Damon Tighe
Outline:1. History of biology and biotechnology (highly abbreviated)
2. Crash Course in Molecular Biology
1. Central Dogma of Molecular Biology
2. DNA
3. Replication, Transcription, Translation
4. Protein
3. Basic Tools of Biotechnology
1. DNA Extraction (Lab)
2. Restriction Enzymes
3. Electrophoresis/Chromatography
4. PCR
5. DNA Sequencing
6. Synthetically building DNA
7. Protein technologies
8. Tying them all together - Insulin
15 min break
History of biology and biotechnology (highly abbreviated)
Thales of Melitus
Father of Philosophy
Olive Press fortune
624-546BCAristotle
384-322BC
Battle of Halys
Father of Biology
Categorical –Observation
Ethics
Sumerian Beer Recipe 3000BC
Kyui and Kimchi 6000BC
Wine in Armenia 6000BC
Teleology
History of biology and biotechnology (highly abbreviated)
Charles DarwinAnton van Leeuwenhoek
Robert Koch
Louis Pasteur Alfred Russel Wallace
Gregor Mendel
Birth of Microbiology Natural Selection Molecular Biology
Fridrich Miescher
Frederick Griffith et al.
Watson, Crick, Franklin
~1650s – 1850s ~1850s – 1900s ~1900s – 1950s
History of biology and biotechnology (highly abbreviated)
Ari PatrinosKary Mullis
Francis Collins
Craig Venter
PCR Human Genome Project Semi-Synthetic Life
Craig Venter
Synthetic Genome used to
re-boot/reprogram an existing cell
19831990-2003 2010
Target and amplify specific regions of
DNA
Central Dogma of Molecular BiologyFlow of information
DNAmacromolecule of information
DNAStructure/functionDNA
Structure/function
-
-
DNAStructure/function – Eukaryotic packing
DNAReplication
5’ to 3’
DNA -> RNA
RNAStructure/function
mRNA – messenger RNA
tRNA – transfer RNA
polyA
5’cap
DNATranscription and Translation
The Protein Code ( Translation of RNA to Amino Acids)
DNATranscription and Translation
Protein Structure/function
Protein Structure/function
Sickle Cell Anemia
Single nucleotide mutation changes protein code, changes protein shape and function
Protein function
Enzymes – catalyze reactions by lowering activation energy
Structural- collagen, keratin, etc
Storage – act as a reservoir of amino acids – ovalalbumin
Antibodies – immune system ability to pin point antigens
Hormones – signaling molecules that travel long distance in the body
Contractile – myosin, muscle fibers
Form defines Function:
Protein function
Protein Enzymatic Pathways
Carbs, fats, proteins
DNA Technology – Extraction/Isolation
Scale to fit your application
Ethanol Extraction – quick/crude, damaged DNA, but can work with it
Phenol-Chloroform – laborious, but high quality DNA
Animation of Fugu Fish Extraction
Spin Columns – quick and easy, use resin to isolate DNA
DNA Technology - Extraction
2ml
DNA Technology – Restriction Enzymes
Endonucleases
Palindrome
Restriction site
DNA Technology - Chromatography
DNA Technology - Amplification
PCR Animation
Polymerase Chain Reaction (PCR)
DNA Technology - Cloning
Restriction Enzyme PCR Product
DNA Technology - Sequencing
Capillary Electrophoresis
Illumina – highly parallelIon Torrent
DNA Technology - SequencingPacific Biosciences Oxford Nanopore
Protein Technology – Production
Bovine Growth Hormone $14
Gold* $53
Insulin $60
Human Growth Hormone $227,000
Granulocyte Colony Stimulating Factor
$1,357,000
Price Per Gram
Prices in US Dollars* As of 4/4/2012
Protein Technology – Production
PROTEIN: USED IN THE TREATMENT OF:
Cell Production
Insulin Diabetes E. coli
Human growth hormone Growth disorders E. coli
Granulocyte colony stimulating factor
Cancers E. Coli
Erythropoietin Anemia CHO cells
Tissue plasminogen activator Heart attack CHO cells
Hepatitis B virus vaccine Vaccination Yeast
Human papillomavirus vaccine Vaccination Yeast
Production is constrained by the organism we use to produce the protein in. We are constrained in part by the choices of history and the momentum of technology.
Protein Technology – Chromatography
•Ion Exchange (protein charge)
•Size Exclusion (separates on size)
•Hydrophobic Interaction (hydrophobicity)
•Affinity:•Protein A tail of Antibodies•His-tagged metal complexes (Ni)•Glutathione-s-transferase glutathione
DNA -> Protein -> consumer product
Insulin – protein used to treat Diabetes Melitus
Thales of Melitus Eli Lilly (Indianapolis)
Insulin Olive Oil Insulin
Genentech
DNA -> Protein -> consumer product
Extract DNA
PCR Insulin
Clone into plasmid
Transform E.coli
Grow E.coli
Induce E.coli
Harvest E.coli
Proteins
Purify Insulin via Chromatography
Selective pressure
DNA Technology – Chemical DNA Synthesis
oligonucleotide
ligase
ligase
GGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGC
Synthetic Biology
Top Related