RESEARCH
Anatomical and Physiological Differences and DifferentiallyExpressed Genes Between the Green and Yellow Leaf Tissuein a Variegated Chrysanthemum Variety
Qingshan Chang • Sumei Chen • Yu Chen •
Yanming Deng • Fadi Chen • Fei Zhang •
Shuwei Wang
� Springer Science+Business Media, LLC 2012
Abstract The leaves of the chrysanthemum variety
‘NAU04-1-31-1’ are variegated with distinct green and
yellow sectors. The chlorophyll content of the yellow leaf
tissue is less than that in the green one. The chloroplasts in
the yellow leaf tissue were vacuolated, lacked thylakoid
membrane structure and contained clusters of plastoglobuli
with few or no starch grains. The yellow leaf tissue was
more sensitive to photo-inhibition than the green leaf tis-
sue. Suppression subtractive hybridization (SSHs) libraries
were constructed to identify genes which were differen-
tially transcribed in the two tissue types. The sequencing of
339 SSH clones identified 150 unigenes (93 singletons and
57 contigs), of which 85 were differentially transcribed in
the green leaf tissue and 65 in the yellow leaf tissue.
Unigenes associated with photosynthesis were particularly
frequent, and many of these genes were up-regulated in the
yellow leaf tissue. Both CmChlH which encodes the large
subunit of Mg-chelatase and CmFtsH (ATP-dependent
metalloprotease) were up-regulated in the yellow leaf tis-
sue, and their transcription was regulated by light.
Keywords Chrysanthemum � Suppression subtractive
hybridization � Real-time quantitative RT-PCR �Semi-quantitative RT-PCR
Introduction
Chlorophyll deficient mutants are widespread throughout
the plant kingdom [1–3] and have been divided into various
classes based on their leaf colour [4]. A deficiency in
chlorophyll can be due to a failure in its synthesis or an
enhanced rate of its degradation [5], both associated with
aberrant chloroplasts [6, 7]. Chlorophyll synthesis can be
disrupted by the blockage of any of the enzymes respon-
sible for the conversion of 5-aminolevulinic acid to chlo-
rophyllide, a pathway which comprises 15 enzymes
encoded by 27 genes [3, 8–11]. In Antirrhinum majus, loss-
of-function of the gene ChlH, which encodes the large
subunit of Mg-chelatase, leads to the chlorotic leaves [12],
while a T-DNA insertion into the rice homologue generates
a chlorina phenotype [13]. Mutations in the genes involved
in the chloroplast development can also affect leaf colour.
In Arabidopsis thaliana, the arrested differentiation of
chloroplasts is caused by comprising FtsH (ATP-dependent
peptidase/ATPase/metallopeptidase), which results in leaf
variegation [14, 15]. In the wild type plant, FtsH partici-
pates in the light-induced turnover of photosystem II (PSII)
D1 protein within the thylakoid membrane.
The T-DNA insertion technique has proven to be a
powerful means of characterizing gene function, and has
been widely used in model plant species [13], while the
Qingshan Chang and Sumei Chen contributed equally to this work
reported here.
Q. Chang � S. Chen � Y. Chen � Y. Deng � F. Chen (&) �F. Zhang
College of Horticulture, Nanjing Agricultural University,
Nanjing 210095, China
e-mail: [email protected]
Q. Chang
College of Forestry, Henan University of Science
and Technology, Luoyang 471003, Henan, China
Y. Deng
Jiangsu Academy of Agricultural Sciences,
Nanjing 210014, Jiangsu, China
S. Wang
Shanghai Oe Biotech Co., Ltd, No. 1, Cailun Road 720,
ZhangJiang Area, Shanghai 201210, China
Mol Biotechnol
DOI 10.1007/s12033-012-9578-8
molecular basis of a growing number of genes has been
revealed by comparisons between the transcriptomes of
wild type and mutant individuals [7, 16, 17]. In some cases,
gene discovery has been accelerated by applying suppres-
sion subtractive hybridization (SSH) in the mutants of
Brassica napus [7], rose [18] and Epipremnum aureum
[19].
The chrysanthemum (Chrysanthemum morifolium
Ramat.) is a major ornamental species [20], and the variety
‘NAU04-1-31-1’ is of substantial commercial value owing
to its yellow–green leaf colour. Little is known regarding
the molecular basis of this leaf phenotype. Here, we
describe a detailed characterization of ‘NAU04-1-31-1’,
and in particular contrast the transcriptomic and bio-
chemical differences between yellow and green leaf tissue.
Two genes (CmChlH and CmFtsH) screened from the SSH
library, putatively related to the observed anatomical fea-
tures have also been characterized. We believe that the
outcome of this investigation will have relevance for the
directed improvement of pigmented leaf-type chrysanthe-
mum varieties.
Materials and Methods
Plant Materials
Chrysanthemum morifolium Ramat. ‘NAU04-1-31-1’
(Fig. 1a) was used in this study. It was a variegated variety
with leaves comprised of yellow and green sectors; such
variegation pattern was stable throughout its life cycle. The
plants were grown and maintained under natural light with
a day/night temperature of 25/18 �C and a relative
humidity of 70 % at the Chrysanthemum Germplasm
Resource Preserving Center, Nanjing Agricultural Univer-
sity, China. The green and yellow leaf tissues from yellow–
green leaf were selected for chlorophyll determination,
SSH analysis and gene expression assays. The seedlings
were at eight-leaf stage.
Determination of Chlorophyll Content
and Ultrastructure Analysis
The chlorophyll content of the leaf samples was deter-
mined spectrophotometrically following Zhang and Fan
[21]. Each assay of green and yellow leaf sectors was
replicated at least three times. The observation of trans-
verse and longitudinal leaf sections were performed in the
developing leaves. Transverse leaf sections were prepared
as described elsewhere [22]. Transverse and longitudinal
leaf sections were imaged by confocal laser-scanning
microscopy (LSM 700, Carl Zeiss, Jena, Germany), in
which the chlorophyll auto-fluorescence could be detected
using an emission filter set (LP 580 nm). For electron
microscopy, the green and yellow leaf tissue was fixed
independently for 6 h at 4 �C in 2 % (w/v) glutaraldehyde
and 1 % (v/v) formaldehyde in a 0.1 M phosphate buffer
(pH 7.4), followed by an overnight fixation at 4 �C in 1 %
(w/v) osmium tetroxide. The fixed tissue was dehydrated
through an ethanol series, followed by two changes of
propylene oxide, embedded in Spurr’s resin, sectioned, and
stained in 1 % (w/v) aqueous uranyl acetate and lead
citrate.
Analysis of Chlorophyll Fluorescence
Chlorophyll fluorescence was assayed as described else-
where [23]. Representative leaves harvested from the same
node of five different plants were kept in the dark for
18 min in leaf clips, and their chlorophyll fluorescence (Fv/
Fm) was measured using a portable fluorometer (Plant
Efficiency Analyzer, Hansatech, Norfolk, UK). To monitor
recovery following exposure to strong light, the leaves
were mounted on moist filter paper under a glass plate,
illuminated with a halogen light source giving
850 lmol m-2 s-1 light for 2 h and then transferred to dim
light (15 lmol m-2 s-1) for 20 h. Fv/Fm values were
recorded at 5, 20 and 50 min, and then at 2, 3.5, 7, 16 and
20 h.
RNA Extraction and SSH Library Construction
RNA was extracted and purified using an RNAplant (Qia-
gen) and an RNeasy Mini kit (Qiagen). Its integrity was
checked by agarose gel electrophoresis, and was quantified
spectrophotometrically. Poly(A) mRNA was purified from
the total RNA preparation using an Oligotex mRNA Mini kit
(Qiagen). SSH libraries were constructed using a PCR-Select
cDNA Subtraction kit (Clontech, Palo Alto, CA, USA),
based on the method described by Diatchenko et al. [24].
Double-stranded cDNA was synthesized from *2 lg
poly(A) mRNA obtained from each of the green and yellow
leaf sectors. For the forward library process, yellow leaf
cDNA was used as the driver, while for the reverse sub-
traction, green leaf cDNA was the driver. The tester and
driver cDNA were both digested with RsaI, and the tester
pool divided into two halves, one of which was ligated to
adaptor 1 and the other to adaptor 2R (Table 1). Each was
then hybridized with an excess of driver cDNA at 68 �C for
8 h, and the two primary hybridization samples were then
mixed in the presence of fresh driver cDNA and held over-
night at 68 �C. Putative differentially transcribed cDNAs
were then PCR amplified in two reactions. The amplification
regime comprised an initial denaturation (94 �C/25 s) and 27
cycles of 94 �C/30 s, 66 �C/30 s and 72 �C/90 s, and this
was followed by a nested PCR (12 cycles of 94 �C/30 s,
Mol Biotechnol
68 �C/30 s and 72 �C/90 s). The products were ligated to the
T/A cloning vector pMD18-T (TaKaRa, Japan) and then
transferred into DH-5a E.coli cells. The resulting two SSH
libraries were plated on Luria–Bertani (LB) medium
containing 50 lg ml-1 ampicillin (Amresco, Solon, OH,
USA), 1 mM iso-propyl- b-D-thiogalactopyranoside and
80 lg ml-1 5-bromo-4-chloro-3-indolyl-b-D-galactopyran-
oside. Recombinant colonies were manually picked and
transferred to LB medium containing 50 lg ml-1 ampicil-
lin. Recombinant colonies were amplified directly using a
PCR based on nested primers 1 and 2R (Table 1), with a PCR
regime consisting of an initial denaturation (94 �C/5 min),
followed by 35 cycles of 94 �C/30 s, 68 �C/30 s, 72 �C/30 s
and ending with a final extension of 72 �C/7 min. The
resulting PCR products were spotted onto a nylon mem-
brane. 32P-labelled probes were prepared from the cDNA
using a Strip-EZ DNA kit (Ambion, USA) and hybridized
with the corresponding membrane (INYC00010, Millipore).
Dot blot hybridization and washing followed the Strip-EZ
DNA kit protocol. After washing, the membranes were
exposed to X-ray film (Wlm X-Omat, Kodak) at -80 �C.
Differentially transcribed sequences were identified using
both the non-subtracted driver cDNA and the tester cDNA as
probes. Positive selections from the two SSH libraries were
screened, and those reliably showing differential expression
were cloned into the PMD18-T vector (TaKaRa, Japan) for
sequencing.
Sequence Analysis
Raw sequence was trimmed to remove vector and adaptor/
primer sequence using the cross-match procedure (www.
phrap.org/phredphrapconsed.html). Poor quality sequence
and stretches shorter than 100 bp were discarded. Candi-
date sequences were used as BLAST queries against the
GenBank database, and those producing a BLAST score of
[45 bits (homologous stretch [50 bp) were designated as
having ‘‘similarity’’ to an existing GenBank entry. Those
with an E value\e-5 were considered to show a significant
level of homology. The predicted peptide sequences were
categorized on the basis of the COG database (www.
ncbi.nlm.nih.gov/COG).
Fig. 1 Phenotype of the chrysanthemum variety ‘NAU04-1-31-1’.
a Variegated leaf. b, c Chlorophyll auto-fluorescence, as visualized by
confocal laser-scanning microscopy, of a longitudinal (b) and a
transverse (c) leaf section. LV leaf vein. d, e Chloroplast ultrastructure
in green (d) and yellow (e) leaf tissue. f Detailed ultrastructure of an
abnormal yellow leaf chloroplast. GL green leaf sector, YL yellow leaf
sector, CH chloroplast, S starch grain, G grana layer, P plastoglobule
and M mitochondrion. Scale bars: b 50 lm, c 10 lm, d, e 2 lm and
f 0.5 lm
Mol Biotechnol
Quantitative and Semi-quantitative RT-PCR
The transcription of selected sequences putatively up-reg-
ulated in the yellow leaf tissue was tested using quantita-
tive real time PCR (qRT-PCR). RNA was extracted as
above from the leaves of greenhouse-grown plants exposed
to 10, 75, 150, 350, 450 or 600 lmol m-2 s-1 for 12 h, or
kept in the dark for 5, 12, 24 or 48 h. Three independent
plants were sampled for each treatment. The transcription
of CmChlH and CmFtsH was tested separately for the
yellow and green leaf tissue. PCR primers were designed
from the target sequences using Primer 5.0 software (Pri-
mer-E Ltd., Plymouth, UK) (Table 1). All amplicons were
initially monitored by agarose gel electrophoresis to ensure
Table 1 Primer sequences employed to generate amplicons
Primer Sequence(50–30) Usage
Adaptor1 50- CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGG
GCAGGT-30
30- GGCCCGTCCA-50
SSH
Adaptor2 50-CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT-30
30- GCCGGCTCCA -50
Nested primer 1 TCGAGCGGCCGCCCGGGCAGGT
Nested primer 2R AGCGTGGTCGCGGCCGAGGT
DPF-ChlH CCGCCAAGCAGTGCAACytngayaarga Degenerated PCR for
ChlHDPR-ChlH GTACATGTCCTGCAGCTGCTTytcrtcrttcc
DPF-FtsH GCNGTNAARAARGGNAARGT Degenerated PCR for
FtsHDPR-FtsH GCRTTYTTYTTYTCNGGNCCNGC
Oligo(dT)primer GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT 30Race
dT-AP GACTCGAGTCGACATCGA
CmChlH-30 TGAGAAGAGGCTCACCAACACA
CmFtsH-30 ATGGCTACTGCCGATATTGTG
GeneRacerTM RNA Oligo
Sequence
CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA 50Race
GeneRacer 50 Primer CGACTGGAGCACGAGGACACTGA
GeneRacerTM 50 Nested Primer GGACACTGACATGGACTGAAGGAGTA
CmChlH-50 GCGATGTTGACCAAAGTCGCAACAG
CmFtsH-50 CAACAGCGTTTTTCTTCTCTG
ORFF-ChlH TCACCCATTTTGACCCATTT ORF amplification
ORFR-ChlH AACCTTGATGAAACAGAGACGA
ORFF-FtsH CAAACAAACCATCCATCCATC
ORFR-FtsH TCCAGAAGGTTGTAACCTCAACT
Actin-F ACATGCTATCTTGCGTTTGG qRT-PCR and sqRT-PCR
Actin-R CTCTCACAATTTCCCGTTCA
CmPsbP-F TGATGCTGCTTATGGTGA 164 bp
CmPsbP-R CAAAGTTGTCCTCGTATGT
CmLhcb1-F TGAGGTTGTTGACCCACT 185 bp
CmLhcb1-R CAGCCAAGTTCTCCAAAG
CmRbcS-F TCTTTCATACCTACCACCA 132 bp
CmRbcS-R GAGCGATTGTTCTCACGG
CmPsaD-F CCTAGCCAACTTCAACAA 116 bp
CmPsaD-R AGGTGGAAGAGTTCTATGTCA
CmCP29-F CCGAGGAAGCCAACCAT 123 bp
CmCP29-R AAAGAGGCTCTACCCTGGTG
CmChlH-F TATCGAAAAGTTAAGGCAGTTATAC 163 bp
CmChlH-R CTAGAAAACTACAAAATACGTTGAG
CmFtsH-F ATATGAGAGAGCAACAACTATAATCA 161 bp
CmFtsH-R ATATGAAGTGTGAAATCTAGGATATG
Mol Biotechnol
that they contained a single amplified fragment and were
then sequenced. Total RNA was treated with DNase I
(TaKaRa, Japan) and reverse-transcribed using Oligo dT18.
Each 25 ll RT-PCR comprised 1 ll cDNA, 12.5 ll
2 9 SYBR Green Master Mix (TOYOBO, Japan) and 1 ll
each of both forward and reverse primer (10 lM). Relative
transcript abundance was detected by ABI 7300 Sequence
Detection System software (PE Applied Biosystems, Foster
City, CA, USA). The amplification programme comprised
an initial denaturation (94 �C/60 s), followed by 40 cycles
of 94 �C/15 s, 60 �C/15 s and 72 �C/45 s. A melting curve
analysis was performed to verify the specificity of the
amplified product. The efficiency of amplification was
determined using the LinRegPCR program [25]. The rel-
ative level of transcript abundance was calculated using the
DCt method [26], normalized against the transcription level
of chrysanthemum actin (GenBank accession no.
AB205087), following Ohmiya et al. [27]. The mean level
of transcript accumulation was expressed as a proportion of
CmPsbP in the green leaf sector. Each experiment com-
prised three biological replicates.
For the semi-quantitative RT-PCR (sqRT-PCR) analy-
sis, the chrysanthemum actin gene (see above) was also
used as the reference. The cDNA first strand was reverse-
transcribed from 1 lg total RNA using 1 ll Superscript II
enzyme (Invitrogen, California, USA), according to the
manufacturer’s instructions. The same gene-specific prim-
ers mentioned above were employed (see Table 1). Each
25 ll PCR contained 1 ll cDNA product as template, and
was subjected to an initial denaturation of 94 �C/5 min,
followed by 31 cycles of 94 �C/30 s, 60 �C/30 s and
72 �C/45 s. Each sqRT-PCR experiment was performed
with three biological replicates. The PCR products were
electrophoresed through 1.5 % agarose gels and visualized
by ethidium bromide staining.
Cloning of CmFtsH and CmChlH Full-length cDNA
An 1 lg sample of RNA was reverse-transcribed using
Reverse Transcriptase M-MLV (TaKaRa, Japan), CmChlH
homologue was amplified using the degenerate PCR
primers DPF-/DPR-ChlH which were designed from rele-
vant sequences of several homologues using the CodeHop
server (blocks.fhcrc.org/blocks/codehop.html). CmFtsH
homologue was amplified using the degenerate PCR
primers DPF-/DPR-FtsH, which were designed from
relevant sequences of some homologues using the Primer
5.0 software (Primer-E Ltd., Plymouth, UK). The 50- and
30- ends of both the CmFtsH and CmChlH cDNAs were
obtained using the primers ORFF-/ORFR-ChlH and
ORFF-/ORFR-FtsH RACE-PCR, based on the GeneRacer
Table 2 Pigment content (mg/g fresh weight) in the yellow and green leaf tissue of the chrysanthemum variety ‘NAU04-1-31-1’
Type of leaf Total Chl Chla Chlb Chla/b Ratio
Green tissue of the mutant 1.56 ± 0.02a 1.06 ± 0.01a 0.50 ± 0.01a 2.11 ± 0.04a
Yellow tissue of the mutant 0.15 ± 0.02b 0.10 ± 0.02b 0.04 ± 0.01b 2.28 ± 0.03a
Note: Letters in lower case in the same column mean significant difference at 5 % by LSD0.05
Fig. 2 PSII efficiency, as measured by the chlorophyll fluorescence
ratio Fv/Fm. At least five representative leaves were exposed to
850 lmol m-2 s-1 light for 2 h (indicated by a bar), and then
transferred to 15 lmol m-2 s-1 light for recovery
Fig. 3 Dot blot hybridization screen of SSH cDNA clones. a, b SSH
clones selected from the yellow leaf sector hybridized against total
yellow (a) and green (b) leaf tissue transcript. c, d SSH clones
selected from the green leaf sector hybridized against total yellow
(c) and green (d) leaf tissue transcript
Mol Biotechnol
Table 3 Putative functions of selected SSH cDNA clones induced in green leaf tissue
GenBank
Accession
No.of
Clone
BlastX E-value
Homology protein [species and accession number]
Energy production and conversion
FS940861 1 Alcohol dehydrogenase 1 [Zea mays, AAA74638] 4e-75
FS940882 2 Glutamate binding [A. thaliana, NP_171806] 1e-21
FS940892 4 Alcohol dehydrogenase [Ricinus communis, XP_002526167] 8e-122
FS940916 1 12-oxophytodienoate reductase [A. thaliana, NP_177794] 1e-97
FS940921 1 Rubisco small subunit rbcs3 [Glycine max, AAG24884] 8e-11
FS940863 4 Non-symbiotic haemoglobinclass 1 [Malus x domestica, AAP57676] 3e-39
FS940887 2 Glutathione s-transferase [Solanum tuberosum, ABQ96853] 7e-42
Amino acid transport and metabolism
FS940874 2 Otu-like cysteine protease [A. thaliana, NP_195953] 3e-30
FS940886 3 NADH-dependent glutamate synthase [Medicago sativa, AAB41904] 1e-15
FS940906 1 Heavy-metal-associated domain-containing protein [A.thaliana, NP_200888] 2e-26
FS940907 1 Serine/threonine protein [A. thaliana, NP_189231] 8e-45
FS940928 1 Putative ABC transporter [A. thaliana, AAF98206] 1e-37
FS940933 1 Threonine dehydratase [Oryza sativa, ABF98530] 1e-24
FS940855 4 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase [Vitis vinifera,ACM45080] 9e-59
FS940860 2 Shikimate kinase [A. thaliana, NP_179785] 4e-31
Carbohydrate transport and metabolism
FS940872 2 Enolase [Glycine max,AAS18240] 1e-102
FS940875 2 Udp-glucosyltransferase [Ricinus communis, XP_002529822] 6e-36
FS940877 2 Glucose-6-phosphate dehydrogenase [Nicotiana tabacum, CAA04992] 2e-57
FS940903 1 Pyrophosphate-fructose 6-phosphate 1-phosphotransferase beta-subunit [Solanum tuberosum, AAA63452] 5e-55
FS940870 2 N-acetylornithine deacetylase-like protein [A. thaliana, CAA17126] 5e-59
FS940864 3 Glyceraldehyde-3-phosphate dehydrogenase [Nicotiana tabacum, CAB39974] 3e-135
Secondary metabolites biosynthesis, transport and catabolism
FS940876 2 Late embryogenesis abundant protein lea14-a [Ricinus communis, XP_002533345] 2e-93
FS940888 3 Late embryogenesis abundant protein 5 [Populus suaveolens, ABF29697] 1e-09
FS940896 1 Cinnamate 4-hydroxylase cyp73 [Citrus sinensis, AAF66065] 1e-43
FS940901 1 Cinnamate-4-hydroxylase [Canarium album, ACR10242] 5e-31
FS940911 1 Bti1 (virb2-interacting protein 1) [A. thaliana, NP_194094] 6e-70
FS940935 1 Allene oxide synthase [Glycine max, ABB91776] 4e-15
FS940857 6 Thaumatin-like protein [Pyrus pyrifolia, ACN97417] 2e-74
Posttranslational modification, protein turnover, chaperones
FS940873 2 Peptidyl-prolyl cis–trans isomerase ppic-type family protein [A. thaliana, NP_564250] 9e-47
FS940878 2 Ubq10 (polyubiquitin 10) [A. thaliana, NP_849299] 5e-66
FS940909 1 Skp1, putative [Ricinus communis, XP_002510577] 9e-34
FS940858 5 Glutathione peroxidase 6 [A. thaliana, NP_192897] 3e-45
FS940927 1 Maturation-associated protein [Glycine max, AAA33992] 5e-18
General function prediction only
FS940868 2 Atard1 (acireductone dioxygenase 1) [A. thaliana, NP_567443] 4e-87
FS940871 2 Adp ribosylation factor 002 [Elaeis guineensis, acf06458] 1e-49
FS940879 2 Putative ring zinc finger ankyrin protein [A. thaliana, AAK49587] 5e-40
FS940880 2 50-adenylylsulfate reductase [A. thaliana, BAD94133] 6e-38
FS940890 3 CBS domain-containing protein [A. thaliana, NP_196647] 3e-36
FS940923 1 ACC oxidase [Cucumis melo, bai39989] 2e-71
FS940905 1 Protein phosphatase 2c, putative/pp2c [A. Thaliana, NP_567808] 1e-38
FS940936 1 IAA-amino acid hydrolase ilr1 [Zea mays, NP_001148528] 4e-39
Mol Biotechnol
Table 3 continued
GenBank
Accession
No.of
Clone
BlastX E-value
Homology protein [species and accession number]
Cytoskeleton
FS940854 8 Expansin-like a1 [A. thaliana, NP_190183] 7e-41
Cell wall/membrane/envelope biogenesis
FS940881 2 Sucrose synthase [Vigna angularis, BAH56282] 2e-78
FS940883 2 Membrane steroid-binding protein 1 [Zea mays, NP_001150181] 1e-36
Chromatin structure and dynamics
–
Coenzyme transport and metabolism
FS940893 1 Phytanoyl-coa dioxygenase [A. thaliana, NP_565262] 4e-33
FS940897 1 Serine palmitoyltransferase [Nicotiana benthamiana, BAG68298] 2e-36
Inorganic ion transport and metabolism
FS940924 1 Cu/Zn superoxide dismutase [Gossypium arboreum, ACI46676] 2e-69
Signal transduction mechanisms
FS940919 1 Cam5 (calmodulin 5) [A. thaliana, NP_850097] 3e-78
Lipid transport and metabolism
FS940912 1 Lipoxygenase [Prunus dulcis, CAD10779] 2e-41
FS940914 1 Lipoxygenase [Momordica charantia, CAP59449] 8e-64
Translation, ribosomal structure and biogenesis
FS940859 1 60 s Ribosomal protein l7a [Zea mays, NP_001147139] 8e-107
FS940862 1 60 s Ribosomal protein L7a [A. thaliana, NP_191846] 7e-110
FS940865 2 Ribosomal protein s26 [Pisum sativum, AAD47346] 4e-26
FS940884 3 Eukaryotic translation initiation factor 5a isoform i [Hevea brasiliensis, AAQ08191] 1e-31
FS940889 3 Ribosomal protein L5 [Ricinus communis, XP_002524859] 3e-91
FS940898 1 40 s ribosomal protein S5 [Ricinus communis, XP_002534312] 9e-48
FS940900 1 Mitochondrial ribosomal protein S18c [Macaca mulatta, XP_001104605] 3e-32
FS940904 1 Elongation factor 1-alpha [Ricinus communis, XP_002528020] 5e-57
FS940908 1 Ribosome inactivating protein precursor [Sambucus nigra, AAC15886] 9e-43
FS940929 1 Translational initiation factor eif1 [Elaeis guineensis, ACF06581] 4e-20
FS940930 1 40 s ribosomal protein sa [Ricinus communis, XP_002529989] 3e-109
FS940931 1 40 s ribosomal protein S17 (rps17d) [A. thaliana, NP_196100] 8e-48
FS940856 3 60 s ribosomal protein L13a (rpl13ab) [A. thaliana, NP_189127] 2e-64
FS940885 2 Ribosomal protein L3b [Nicotiana tabacum, AAQ96336] 1e-44
Not found
FS940926 1 – –
Unknown
FS940918 1 Olfactory receptor 599[Rhinolophus ferrumequinum, ACC62062.1] 7.9
FS940902 1 CRG16 [Cucumis sativus, BAA08394.1] 7.9
FS940869 2 Exostosin-like glycosyltransferase [Chlamydomonas reinhardtii, XP_001694987.1] 8.2
FS940867 2 Hypothetical protein [Vitis vinifera, CAN62374] 2e-22
FS940894 1 Unknown [Glycine max, ACU18552] 2e-66
FS940895 1 Unknown [A. thaliana, AAM66124] 6e-63
FS940910 1 Unknown protein [A. thaliana, NP_201223] 6e-49
FS940913 1 Unknown [A. thaliana, AAM63875] 3e-63
FS940915 1 Unknown protein [A. thaliana, NP_176877] 2e-45
FS940920 1 Hypothetical protein [Vitis vinifera, CAN67283] 1e-41
FS940922 1 Unknown [Glycine max, ACU19497] 5e-12
FS940925 1 Predicted protein [Populus trichocarpa, XP_002310227] 3e-05
Mol Biotechnol
kit (Invitrogen, USA). All the primers above were listed in
the Table 1. The ChloroP (genome.cbs.dtu.dk/services/
ChloroP/) and PFAM domain prediction (smart.embl-hei-
delberg.de) software packages were used to predict the
structure of the predicted polypeptide products.
Results
The Yellow Leaf Tissue was Deficient for Chlorophyll,
and its Chloroplasts were Aberrant
The chlorophyll a and chlorophyll b content of the yellow
leaf tissue was just 9.5 and 8.0 %, respectively, of that in the
green leaf tissue (Table 2), but the chlorophyll a/b ratio was
similar in both leaf types. No chlorophyll auto-fluorescence
was generated from the yellow leaf tissue chloroplasts
(Fig. 1b, c), which were smaller and less numerous than in
the green leaf tissue. The structure of the yellow leaf tissue
chloroplasts appeared abnormal, reminiscent of those in the
A. thaliana var1 (FtsH5) and var2 (FtsH2) mutants [15, 23].
The thylakoids and granal stacks in the green leaf tissue were
normal in appearance and contained numerous plump starch
grains with only a few dispersed plastoglobuli; in contrast, in
the yellow leaf tissue chloroplasts, the internal membranes
appeared diffuse, and contained dilated lamellae system
along with clusters of plastoglobuli and no well-defined
starch grains (Fig. 1d–f). Thus, consistent with their lower
chlorophyll content, both the granum and the stroma lamellar
systems of these chloroplasts were abnormal.
The Yellow Leaf Tissue is Highly Sensitive
to Photodamage
When the peak PSII photochemical efficiency was asses-
sed, the initial Fv/Fm ratios in the green and yellow leaf
tissue were, respectively, 0.84 and 0.57 (Fig. 2). Following
exposure to strong light and subsequent recovery under dim
light, this ratio declined by 0.11 in the green leaf tissue, but
by 0.45 in the yellow leaf tissue, indicating that the latter
was much more sensitive to photodamage than the former.
The green leaf tissue was able to recover its steady state Fv/
Fm ratio after an overnight exposure to dim light, but the
Fv/Fm ratio in the yellow leaf tissue continued to fall up
even after a 20 h exposure to dim light. Thus, the yellow
leaf tissue was more sensitive not only to photodamage, but
the damage was also irreversible.
Differential Gene Transcription in the Yellow
and Green Tissue Revealed by SSH
SSH was used in an attempt to identify a set of genes which
were differentially transcribed in the green and yellow leaf
tissue. Overall, 768 SSH clones were taken forward for the
dot blot hybridization assay (Fig. 3), following which 339
clones (157 from the yellow leaf tissue library and 182 from
the green one) were sequenced. Of the 293 to which a
putative function could be assigned, 93 were singletons,
while the others clustered into 57 contigs. This led to the
identification of 150 unigenes (65 from the yellow leaf tissue
library and 85 from the green one). The annotation of these
unigenes (sequences deposited in DDBJ (www.ddbj.nig.
ac.jp) as accession numbers FS940788-FS940937) is given
in Tables 3, 4. A BlastX homology search allowed the
putative function of 64 of the 85 green sector unigenes to be
assigned into one of 13 classes, while 20 matched genes of
unknown function and one had no match in GenBank. The
corresponding numbers in the yellow leaf tissue were,
respectively, 43, 14 and 8 (Fig. 4a, b). In the green leaf tissue,
14 of the 85 genes were involved in translation, ribosomal
structure and biogenesis; eight in both amino acid transport/
metabolism and general function prediction only; seven in
both energy production/conversion and secondary metabo-
lite biosynthesis, transport and catabolism. Among the 65
genes differentially transcribed in the yellow leaf tissue, 17
Table 3 continued
GenBank
Accession
No.of
Clone
BlastX E-value
Homology protein [species and accession number]
FS940934 1 Hypothetical protein [Zea mays, ACG25663] 7e-20
FS940891 3 Hypothetical protein [Vitis vinifera, CAN75015] 1e-15
FS940917 1 Unnamed protein product [Vitis vinifera, CAO64450] 1e-10
FS940853 23 Hypothetical protein [Hordeum vulgare, BAF03218] 5e-14
FS940899 1 Hypothetical protein [Sorghum bicolour, XP_002459314] 1e-16
FS940866 6 Hypothetical protein [Sorghum bicolour, XP_002459314] 1e-16
FS940932 1 Glyceraldehyde 3-phosphate dehydrogenase [Sus scrofa, AAB94053] 1.6
FS940937 1 Fructose-bisphosphate aldolase [Zea mays, NP_001152410] 0.53
Note:– represent the absence of corresponding clones or homologue
Mol Biotechnol
Table 4 Putative functions of selected SSH cDNA clones induced in yellow leaf tissue
GenBank
Accession
No.of
Clone
BlastX E-value
Homology protein [Species and accession number]
Energy production and conversion
FS940796 2 Rubisco activase [Solenostemon scutellarioides, ACN94267] 1e-07
FS940798 2 Rubisco activase [Flaveria bidentis, ABW80752] 2e-29
FS940805 5 Rubisco small subunit [Chrysanthemum x morifolium, AAO25119] 4e-44
FS940806 1 Rubisco activase [Ricinus Communis, XP_002524206] 2e-46
FS940812 1 Chloroplast pigment-binding protein cp29 [Nicotiana tabacum, ABG73415] 7e-31
FS940822 1 Rubisco activase alpha 2 [Gossypium hirsutum, ABB20913] 2e-78
FS940832 1 Peroxisomal glycolate oxidase [Glycine max, BAG09373] 4e-21
FS940835 1 PsbP (23kda polypeptide of photosystem II) [Sonneratia ovata, ABQ41911] 5e-36
FS940842 1 PhotosystemII 10 kDa protein [Xerophyta humilis, AAN60205] 1e-46
FS940843 1 NADH dehydrogenase [Ricinus communis, XP_002518172] 2e-58
FS940844 1 Rubisco activase [Oryza sativa, ABR26165] 5e-34
FS940789 10 Chlorophyll-a/b binding protein Lhcb1 [Pisum Sativum, AAW31511] 2e-73
FS940791 4 Chlorophyll a/b-binding protein cp29 [A. thaliana, AAK43851] 1e-20
FS940801 4 Rubisco small subunit [Chrysanthemum x morifolium, AAO25119] 2e-10
FS940849 2 Rieske FeS protein [A. thaliana, CAC03598] 2e-52
FS940850 4 Chlorophyll a/b-binding protein cp26 [Brassica juncea, CAA65042] 3e-49
FS940852 2 PsaD (photosystemIsubunit D-2) [A. thaliana, NP_171812] 8e-32
Amino acid transport and metabolism
FS940851 2 Serine-glyoxylate aminotransferase [Spirodela polyrrhiza, ABA00460] 1e-113
Carbohydrate transport and metabolism
FS940810 1 Plasma membrane intrinsic protein pip3 [A. thaliana, AAB36949] 9e-23
FS940811 1 Plasma membrane intrinsic protein pip3 [A. thaliana, AAB36949] 4e-15
FS940817 1 Carbonic anhydrase precursor [Noccaea caerulescens, AAS65454] 3e-27
FS940821 1 Phosphoglycolate phosphatase [A. thaliana, NP_198495] 2e-83
FS940825 1 Fructose-bisphosphate aldolase [Ricinus communis, XP_002512993] 4e-121
Secondary metabolites biosynthesis, transport and catabolism
FS940809 1 Dehydration-responsive protein [A. thaliana, NP_201208] 3e-30
FS940814 1 Peroxidase [A. thaliana, NP_196291] 2e-44
FS940818 1 Cytochrome p450 [Ricinus communis, XP_002511297] 2e-23
FS940834 1 Cytochrome p450 [Ricinus communis, XP_002510500] 4e-35
Posttranslational modification, protein turnover, chaperones
FS940819 1 Cyclophilin [Citrus sinensis, gb|ACX37092.1|] 2e-43
FS940846 1 FstH5 (VAR1); ATP-dependent peptidase/atpase/metallopeptidase [A. thaliana, NP_568604] 1e-35
FS940837 1 Ethylene-responsive transcription factor 1a [Medicago truncatula, ABO40237] 3e-07
Signal transduction mechanisms
– – – –
General function prediction only
– – – –
Cytoskeleton
FS940838 1 Actin [Nicotiana tabacum, ACH69153] 2e-20
Cell wall/membrane/envelope biogenesis
FS940808 1 Nad-dependent epimerase/dehydratase [Zea mays, NP_001148959] 5e-58
Coenzyme transport and metabolism
FS940840 1 ChlH (Gun5), magnesium chelatase [A. thaliana, NP_196867] 3e-43
Inorganic ion transport and metabolism
FS940827 1 Oep37; ion channel [A. thaliana, NP_566003] 6e-18
Mol Biotechnol
were involved in energy production/conversion; seven in
translation, ribosomal structure and biogenesis; and five in
carbohydrate transport/metabolism (7.7 %).
Validation of Differential Transcription Using
qRT-PCR and sqRT-PCR
qRT-PCR was employed to assess the level of transcrip-
tion of CmPsbP (encoding a PSII 23 kDa protein),
CmLhcb1 (chlorophyll a/b-binding protein), CmRbcS
(rubisco small subunit), CmPsaD (PSI subunit D2),
CmCP29 (chloroplast pigment-binding protein CP29),
CmChlH (Mg-chelatase large subunit) and CmFtsH (ATP-
dependent metalloprotease). This analysis showed that the
transcript abundance of all of these genes was higher in
the yellow than in the green leaf tissue, consistent with
the outcome of the SSH procedure (Fig. 5). The higher
level of transcription of both CmChlH and CmFtsH in the
yellow leaf tissue was confirmed by sqRT-PCR analysis
(Fig. 6).
Table 4 continued
GenBank
Accession
No.of
Clone
BlastX E-value
Homology protein [Species and accession number]
Lipid transport and metabolism
FS940803 3 Acyl carrier protein [Solanum lycopersicum, AAU03358] 9e-34
Chromatin structure and dynamics
FS940845 1 Histone H3.2 [Arabidopsis thaliana, NP_001078516.1] 1e-22
Translation, ribosomal structure and biogenesis
FS940792 1 Translation initiation factor b04 [Helianthus annuus, AAM77753] 1e-53
FS940799 2 Translation elongation factor ef-g [Glycine max, CAA50573] 2e-50
FS940823 1 Translation elongation factor G [Ricinus communis, XP_002509581] 5e-59
FS940829 1 Putative ribosomal protein S9 [A. thaliana, AAG51916] 2e-16
FS940839 1 40 s ribosomal protein S11 [Ricinus communis, XP_002532505] 1e-20
FS940847 1 Ribosomal protein L29 family protein [A. thaliana, NP_201325] 1e-42
FS940790 15 Putative senescence-associated protein [Pisum sativum, BAB33421] 1e-54
Not found
FS940793 2 – –
FS940795 2 – –
FS940807 1 – –
FS940813 1 – –
FS940820 1 – –
FS940836 1 – –
FS940804 4 – –
FS940802 3 – –
Unknown
FS940833 2 Unnamed protein [Vitis vinifera, CBI20065.1] 7.9
FS940831 1 VER2 [Triticum aestivum, BAA32786.3] 0.96
FS940815 1 Hypothetical protein [Vitis vinifera, XP_002270456.1] 1.6
FS940794 2 GfV [Glypta fumiferanae ichnovirus, YP_001029424.1] 6.1
FS940828 1 Unknown [Medicago truncatula, ACJ85881] 1e-40
FS940830 1 Haem-binding protein, putative [Ricinus communis, XP_002530132] 0.31
FS940788 1 Hypothetical protein [Vitis vinifera, CAN60153] 2e-44
FS940797 2 Conserved hypothetical protein [Ricinus communis, XP_002526523] 6e-03
FS940800 2 Metallothionein-like type 1 protein [Ipomoea batatas, BAD95644] 2.9e-02
FS940824 1 Tuber agglutinin [Helianthus tuberosus, AAL84817] 0.7
FS940826 1 Predicted: hypothetical protein [Vitis vinifera, XP_002275043] 2e-32
FS940841 1 ATP synthase gamma chain [A. thaliana, CAB52365] 4e-04
FS940848 1 Hypothetical protein [Hordeum vulgare, BAF03218] 7e-14
FS940816 1 Unknown protein [A. thaliana, NP_192768] 3e-19
Note:– represent the absence of corresponding clones or homologue
Mol Biotechnol
Isolation of the Full-length CmChlH and CmFtsH
cDNAs
The alignment of the full-length cDNA sequence of
CmChlH (GenBank accession no. AB543917) obtained
using RACE PCR revealed that it shared a high level of
homology with AtChlH (GenBank accession no.
NP_196867.1), which encodes the large subunit of Mg-
chelatase (Fig. 7a). The sequence length was 4,451 bp,
including a 4,149 bp open reading frame. The pI and
molecular weight MW of the predicted 1,383 residue
CmChlH polypeptide were, respectively, 5.95 and
154 kDa. ChloroP prediction software suggested that the
gene included a pre-sequence of 51 N-terminal residues,
and that it is targeted to the chloroplast. According to
PFAM domain prediction software, the region between
residues 245 and 1,365 forms the CobN/Mg chelatase
domain. At the peptide level, CmChlH was homologous to
A. thaliana AtChlH (85 %) and with other ChlH homo-
logues in various organisms (Fig. 7a). The three histidine
residues (H666, H670 and H815) present in AtChlH are also
present in CmChlH. A phylogeny of eukaryotic ChlHs
showed that the most closely related sequences to CmChlH
are those from tobacco (89 %) and Antirrhinum majus
(88 %), followed by homologues from monocotyledonous
plants, and then by green algal ones (Fig. 7b).
A similar alignment based on the CmFtsH sequence
(GenBank accession no. AB542716) revealed a high level
of homology with AtFtsH1 (GenBank accession no.
NP_564563) and AtFtsH5 (GenBank accession no.
NP_568604) (Fig. 8a). The 2,272 bp full-length CmFtsH
cDNA comprised a 2,094 bp open reading frame, encoding a
698-residue polypeptide with a predicted pI of 5.99 and a
predicted molecular weight of 75 kDa. Its 57 N-terminal
residue pre-sequence is targeted to the chloroplast. CmFtsH
is homologous with AtFtsH1/5 and with other FtsH proteins
in eukaryotes and Prokaryotes (Fig. 8a). The CmFtsH
polypeptide included a domain containing Walker-type
ATPase and metalloprotease motifs A and B (I, II), a second
region of homology (SRH, III), and a zinc-binding domain
(IV) (Fig. 8a). The eukaryotic phylogeny identified four
pairs of closely related gene products: AtFtsH1 and AtFtsH5/
var1, AtFtsH2/var2 and AtFtsH8, AtFtsH3 and AtFtsH10
and AtFtsH7 and AtFtsH9. CmFtsH matched the AtFtsH1/
AtFtsH5 pair most closely and also clustered with its Medi-
cago sativa homologue MsFtsH (Fig. 8b). The deduced
peptide sequence of CmFtsH shared 84, 82 % similarity
with, respectively, A. thaliana AtFtsH5 (P_568604) and
AtFtsH1 (NP_564563). The AtFtsH5 protein has been
identified as a protease involved in the repair of photo-
damaged D1 protein in the thylakoid membrane, and its loss-
of-function mutant produces variegated leaves [23].
Fig. 4 Putative function of 150
differentially expressed SSH
unigenes, as inferred from
sequence homology with genes
of known function. a Genes
induced in the green leaf tissue.
b Genes induced in the yellow
leaf tissue
Mol Biotechnol
Light Dependence of CmFtsH and CmChlH
Transcription
CmChlH transcription was sensitive to variation in the light
intensity (Fig. 9a). In the green leaf tissue, the CmChlH
transcription level increased gradually as the intensity was
raised from 10 to 150 lmol m-2 s-1 and then increased
rapidly between 150 and 350 lmol m-2 s-1, peaking at
450 lmol m-2 s-1. In the yellow leaf tissue, transcript
abundance also increased steadily as the intensity was raised
from 10 to 450 lmol m-2 s-1, but then continued to increase
up to 600 lmol m-2 s-1. At 450 lmol m-2 s-1, transcript
abundance was 2.9-fold that in the green leaf tissue, and at
600 lmol m-2 s-1, the difference was 4.7-fold. Thus, the
transcription of CmChlH in the green leaf tissue was induced
by intermediate light intensity, but was suppressed by high
intensity light, while no such suppression affected the yellow
leaf tissue. When light was withheld, CmChlH transcription
was rapidly down-regulated in both tissue types, and was
maintained at a low level for[40 h (Fig. 9b). During the dark
period, the transcript abundance in the yellow leaf tissue was
threefold to fourfold greater than in the green leaf tissue.
CmFtsH transcription in the green leaf tissue also
increased slowly as the light intensity was raised from 10 to
450 lmol m-2 s-1, where it peaked (Fig. 9c). In the yel-
low leaf tissue, transcription peaked at 600 lmol m-2 s-1.
Transcript abundance was at 450 and 600 lmol m-2 s-1,
respectively, 1.4- and 3.1-fold higher than in the green leaf
tissue. Transcription decreased when light was withheld
(Fig. 9d), falling by *50 % after 5 h of darkness in both
tissue types, and falling even further in the period between
12 and 48 h, by which time only a trace of transcription
remained detectable. Transcript abundance in the yellow
leaf tissue after five, 12, 24 and 48 h of darkness was,
respectively, 1.8-, 2.0-, 4.5- and 5.8-fold higher than in the
green leaf tissue.
Discussion
Physiological and Anatomical Characteristics
of the Yellow Green Leaf
Physiological and anatomical characterization of the yel-
low–green leaf showed that this chrysanthemum variety has
a novel variegation type. The structural characteristics,
abnormal chloroplast and dilated lamellae system, in the
yellow leaf sector are reminiscent of variegated yellow-
green leaves of A. thaliana var1 mutant [14, 23]. Chlorophyll
content in the yellow leaf sector of this chrysanthemum was
less than that in the green sector, which concurred with the
findings in A. thaliana var1 mutant where the chlorophyll
content of the yellow leaf tissue was lower than that of the
green tissue [28]. These results were propitious for further
characterization of variegated chrysanthemum and other
variegated plant species.
Fig. 5 The transcript abundance of CmPsbP (PSII 23 kDa protein,
FS940835), CmLhcb1 (light harvesting CAB protein, FS940789),
CmRbcS (small subunit of rubisco, FS940921), CmPsaD (PSI subunit
D2, FS940852), CmCP29 (chloroplast pigment-binding protein,
FS940791), CmChlH (the large subunit of Mg-chelatase, FS940840)
and CmFtsH (ATP-dependent metalloprotease, FS940846), all as
assessed by qRT-PCR (chrysanthemum actin used as a reference).
Asterisk indicates significantly different transcript abundance in
yellow and green tissue (P \ 0.05). Mean levels of transcript
abundance expressed as a proportion of the abundance of CmPsbPtranscript in green tissue
Fig. 6 sqRT-PCR analysis of CmChlH and CmFtsH transcription in
the green and yellow leaf tissue of ‘NAU04-1-31-1’. Chrysanthemum
actin was used as a reference. G green leaf tissue, Y yellow leaf tissue
Fig. 7 Phylogeny of CmChlH. a Clustal X multiple alignment of the
deduced peptide sequences of ChlH products. The chrysanthemum
CmChlH (AB543917) sequence (boxed) compared to its homologues
from Arabidopsis thaliana (AtChlH, NP_196867.1), rice (OsChlH,
ABF95686), Nostoc punctiforme (NpChlH, YP_001866414) and
Heliobacterium modesticaldum (HmChlH, YP_001679881). The
three conserved histidine residues are marked with an asterisk, and
the CobN/Mg chelatase domain is shown underlined. b MEGA-
derived ChlH phylogeny based on deduced polypeptide sequences.
Chrysanthemum CmChlH (AB543917) compared to its homologues
from Antirrhinum majus (AmChlH, CAA51664), tobacco (NtChlH,
AAB97152), castor (RcChlH, XP_002532078), soybean (GmChlH,
CAA04526), peach (PpChlH, ACO57443), strawberry (FaChlH,
ACS94977), A. thaliana (AtChlH, NP_196867.1), barley (HvChlH,
AAK72401), rice (OsChlH, ABF95686), N. punctiforme (NpChlH,
YP_001866414) and Arthrospira platensis (ApChlH, ABF61892).
Bootstrap values shown at each node
c
Mol Biotechnol
Mol Biotechnol
A number of chlorophyll mutants were checked for their
correlation with the genes emerging from the SSH library.
An A. thaliana mutant in which no Lhcb1 protein (a light-
harvesting chlorophyll a/b-binding protein, normally
deposited in the thylakoid) [29] is produced from pale
green leaves. While its chlorophyll content is only two-
thirds that of the wild type, the grana appears normal [30].
RbcS is a member of a small nuclear multigene family
responsible for production of the small subunit of rubisco, a
key enzyme in photosynthesis pathway [31]. In the RbcS
silenced tobacco mutants, the Chl a/Chl b ratio was rela-
tively normal in these mutants, and their plastid ultra-
structure remained largely unaltered [32]. An A. thaliana
mutant unable to make PsbP grew very poorly and pro-
duced pale green leaves [33]. The level of chlorophyll in
the leaf of the A. thaliana psad2 mutant was similar to that
in the wild type [34]. Finally, CP29 antisense lines in
A. thaliana were indistinguishable from the wild type with
respect to their growth rate, morphology and leaf pig-
mentation [35]. However, none of the above mutants
mimics the phenotype of the yellow leaf tissue of the
chrysanthemum variety ‘NAU04-1-31-1’. The phenotype
of the chrysanthemum variety ‘NAU04-1-31-1’ is very
similar to that of the ChlH mutant of Antirrhinum majus
[12] and VAR1 mutant of A. thaliana [14].
A Number of Genes Involved in Energy Production
and Conversion were Induced in Yellow Leaf Sector
It was noted that many of the genes differentially transcribed
in the yellow leaf sectors of ‘NAU04-1-31-1’ were involved
in energy production and conversion. Many such genes were
required for the light harvesting complex to operate properly
in order to stabilize the pigments associated with the thyla-
koid membrane [36]. Such results indicated the transcript
level of genes including energy production and conversion
were highly responsive to the physiological and anatomical
characteristics in the yellow leaf tissue. An example of such a
gene from the SSH screen is the one encoding the Rieske FeS
protein (a subunit of the cytochrome b6/f complex, the
accession no. FS940849), an indispensable component of the
photosynthetic electron transport chain [37]; a second from
the SSH screen is the gene encoding chloroplast NAD(P)H
dehydrogenase (the accession no. FS940843), a component
of PSI cyclic electron transport, which is essential for effi-
cient photosynthesis [38]. Many of the 150 unigenes
emerging from the SSH screen were associated with the
Calvin cycle. The genes represented were responsible for
producing the rubisco small subunit and rubisco activase.
Rubisco, the most abundant plant protein, is a catalyst in the
first step of photosynthetic CO2 assimilation, and is inti-
mately involved in photorespiratory carbon oxidation [39].
The disrupted structure of the thylakoid membrane in the
yellow leaf sector implied a deficiency in assimilate supply,
and a consequent increase in amino acid catabolism and
proteolytic activity [40]. However, the genes encoding sev-
eral Calvin cycle enzymes were induced in the yellow leaf
tissue, suggesting the existence of compensatory mecha-
nisms to maintain the supply of carbohydrate. The disrupted
plastids in the yellow leaf sector, along with the enhanced
level of transcription of genes related to PSI and PSII,
demonstrated that the plants were able to sense the levels of
key proteins in the chloroplast and to transmit a relevant
signal to the nucleus, allowing for the local deficiency of
particular proteins to be relieved [41, 42]. The differential
expression of genes involved in energy production and
conversion might be a compensatory mechanism to maintain
the supply of carbohydrate in the yellow sector.
None of the known homologues to the down-regulated
genes obtained in present study has been shown to be related
to leaf colour variation. Therefore, those down-regulated
genes in chrysanthemum have not been included in present
study. In order to detect the possible correlation of differ-
entially expressed genes with leaf colour variegation in
chrysanthemum, CmPsbP, CmLhcb1, CmRbcS, CmPsaD
and CmCP29, CmChlH, CmFtsH were checked, because the
known homologues to these genes in A. thaliana, tobacco
and rice are related to leaf colour directly or indirectly [13,
Fig. 7 continued
Fig. 8 Phylogeny of CmFtsH. a Clustal X multiple alignment of the
deduced peptide sequences of FtsH products. The chrysanthemum
CmFtsH (AB542716) sequence (boxed) compared to its homologues
from Arabidopsis thaliana (AtFtsH1 [NP_564563], AtFtsH5
[NP_568604]), tobacco (NtFtsH, AAD17230) and Escherichia coli(EcFtsH, P28691). The boxes represent two regions of the ATP binding
motif (I, II), a second region of homology (III), and a Zn2?-binding
motif (IV). b MEGA-derived FtsH phylogeny based on deduced
polypeptide sequences. Chrysanthemum CmFtsH (AB542716) com-
pared to its homologues from A. thaliana (AtFtsH1-H12, NP_564563,
_850156, _850129, _565616, _568604, _568311, _566889, _563766,
_568892, _172231, _568787 and _565212), Medicago sativa (MsFtsH,
AAK15322), tobacco (NtFtsH, AAD17230), tomato (LeFtsH,
BAD99306), ea (PsFtsH, AAK77908) and brewers’ yeast (ScFtsH,
CAA56953). Bootstrap values shown at each node
c
Mol Biotechnol
Mol Biotechnol
14, 23, 30–35], of which CmChlH and CmFtsH are putatively
related to the observed phenotype and anatomical features,
both genes were analysed emphatically here.
In Brassica napus, ChlP encoding geranyl–geranyl
reductase has been reported to both underlie leaf variega-
tion and to be one of the factors behind the reduction in
frequency and size of the chloroplast grana [7]. Unex-
pectedly, ChlP was not among those down-regulated in the
yellow leaf tissue of chrysanthemum. One possibility is
that differentially expressed genes obtained in present
study were mainly resulted from phenotype change, several
differentially expressed genes involved in the grana bio-
genesis might not be detected in this study system.
Sequence Homology and Transcription Profiles
of CmChlH and CmFtsH
The analysis of sequence homology showed the chrysan-
themum ChlH and FtsH protein were highly homologous to
ChlH and FtsH from various other species, respectively.
Transcription profiles of CmChlH and CmFtsH were reg-
ulated by light. The CmChlH sequence includes the three
conserved histidine residues (H666, H670 and H815) required
to form the nitrogenous base-Mg2? porphyrin complex
needed to catalyse the insertion of Mg2? into protopor-
phyrin IX (PROTO) [43]. It also possesses the CobN/Mg
chelatase domain diagnostic for both the CobN proteins
[13, 44, 45] and the Mg protoporphyrin chelatases [12].
Thus, the gene probably encodes the large subunit of Mg-
chelatase. Similarly, the CmFtsH protein includes con-
served Walker-type ATPase and metalloprotease motifs,
which indicates that it encodes a FtsH protease. The ChlH
protein participates in the synthesis of chlorophyll [12], and
its disruption is generally associated with the chlorina
phenotype [13, 46]. FtsH participates in the chloroplast
differentiation process [15], and a common result of its
non-expression is leaf variegation [23]. The transcription
response to variation in the light regime showed that both
Fig. 9 The effect of light regime on the transcription of CmChlH a,
b and CmFtsH c d, as measured by qRT-PCR. a, c Variation in the
light intensity. Mean relative levels of transcript accumulation based
on the level produced by green leaf tissue exposed to 12 h of
10 lmol m-2 s-1 light. b, d Variation in the time. Leaves grown
under 75 lmol m-2 s-1 light were then deprived of light. Mean
relative levels of transcript accumulation based on the level produced
by yellow leaf tissue not exposed to darkness. Asterisk indicates
significantly different transcript abundance in yellow and green tissue
(P \ 0.05). Black bars green leaf tissue, grey bars: yellow leaf tissue
Mol Biotechnol
CmChlH and CmFtsH were light inducible, as are also rice
OsChlH and A. thaliana FtsH5(VAR1) [13, 23].
In the chl1 mutant of rice (a mis-sense mutation in
ChlD), the transcript abundance of ChlH, ChlD, ChlI and
LhcpII is approximately twice that in the wild type [47]. In
the A. thaliana var2–5 mutant, FtsH transcription is com-
parable in level to that occurring in the wild type [48]. The
compensatory up-regulation of genes in the absence of
functional chloroplasts has suggested a process which is
largely co-regulated with the transcription of key genes
involved in plastid-to-nucleus signalling [40, 47]. Both
CmChlH and CmFtsH were induced in the yellow leaf
sector, which may reflect the ability of the plant to detect
the altered physiological status of the chloroplasts and to
react by up-regulating compensatory genes [41, 49].
Whether or not the induction of CmChlH and CmFtsH
transcription in the yellow leaf tissue infers plastid-to-
nucleus signalling remains to be investigated.
Chlorophyll deficient mutants producing a yellow-green
coloured leaf are common in the plant kingdom [3, 50, 51].
In addition to their lower chlorophyll content, these
mutants frequently are also defective with respect to their
chloroplast ultrastructure and composition [50, 51]. The
compromised accumulation of chlorophyll precursors may
stem from defective chloroplast development [51]. In the
ygl1 rice mutant, chloroplast development is hampered by
a fall in chlorophyll availability resulting from a blockage
in chlorophyll synthesis [3]. In OsChlH mutants, chloro-
phyll content is reduced, and the chloroplast thylakoid
membranes do not develop fully [13], suggested that
chlorophyll synthesis and chloroplast development are
interdependent [12, 50]. Here, we have seen that the
chlorophyll deficiency in the yellow leaf sectors of chry-
santhemum variety ‘NAU04-1-31-1’ was accompanied by
arrested chloroplast development. These pleiotropic effects
make it difficult to clearly elucidate whether a particular
chlorophyll-deficient mutant reflects blockage in chloro-
phyll synthesis or a deficiency in chloroplast biogenesis
and function, similar findings have been previously stated
[51]. The mechanistic basis of chlorophyll deficiency
requires a systematic analysis of the physiological, ana-
tomical and genetic differences between a mutant and a
wild type [7, 19]. In present study, we compared the
physiological, anatomical and genetic differences between
the yellow and green leaf sector of the variegated chry-
santhemum. The present data have given but a glimpse into
the molecular basis of the leaf variegation of the chrysan-
themum variety ‘NAU04-1-31-1’.
Acknowledgments This work was supported by the National Nat-
ural Science Foundation of China (Grant No. 30872064, 31071820,
31071825), the Program for New Century Excellent Talents in Uni-
versity of Chinese Ministry of Education (Grant No. NCET-10-0492),
Non-profit Industry Financial Program of the Ministry of Science and
Technology of the People’s Republic of China (200903020) and the
Fundamental Research Funds for the Central Universities (KYJ
200907, KYZ201112).
References
1. Falbel, T. G., Meehl, J. B., & Staehelin, L. A. (1996). Severity of
mutant phenotype in a series of chlorophyll-deficient wheat
mutants depends on light intensity and the severity of the block in
chlorophyll synthesis. Plant Physiology, 112, 821–832.
2. Killough, D. T., & Horlacher, W. R. (1933). The inheritance of
virescent yellow and red plant colors in cotton. Genetics, 18,
329–333.
3. Wu, Z. M., Zhang, X., He, B., Diao, L. P., Sheng, S. L., Wang, J.
L., et al. (2007). A chlorophyll-deficient rice mutant with
impaired chlorophyllide esterification in chlorophyll biosynthesis.
Plant Physiology, 145, 29–40.
4. Gustafsson, A. (1940). The mutation system of the chlorophyll
apparatus. Lunds University Arsskrift, 36, 1–40.
5. He, B., Liu, L. L., Zhang, W. W., & Wan, J. M. (2006). Plant leaf
color mutants. Plant Physiology Communications, 42, 1–8.
6. Guo, J. W., Guo, J. K., Zhao, Y., & Du, L. F. (2007). Changes of
photosystem II electron transport in the chlorophyll-deficient
oilseed rape mutant studied by chlorophyll fluorescence and
thermoluminescence. Journal of Integrative Plant Biology, 49,
698–705.
7. Wang, H. Y., Hu, Y. H., Liu, Y., Zhou, Y. T., Wang, M. L., &
Zhao, Y. (2008). Suppression subtractive hybridization identifies
differentially expressed genes in Brassica napus chlorophyll-
reduced mutant. Biologia Plantarum, 52, 486–492.
8. Masuda, T., Tanaka, A., & Melis, A. (2003). Chlorophyll antenna
size adjustments by irradiance in Dunaliella salina involve
coordinate regulation of chlorophyll a oxygenase (CAO) and
Lhcb gene expression. Plant Molecular Biology, 51, 757–771.
9. Nagata, N., Tanaka, R., Satoh, S., & Tanaka, A. (2005). Identi-
fication of a vinyl reductase gene for chlorophyll synthesis in
Arabidopsis thaliana and implications for the evolution of pro-
chlorococcus species. Plant Cell, 17, 233–240.
10. Nakayashiki, T., Nishimura, K., & Inokuchi, H. (1995). Cloning
and sequencing of a previously unidentified gene that is involved
in the biosynthesis of haem in Escherichia coli. Gene, 153,
67–70.
11. Suzuki, J. Y., Bollivar, D. W., & Bauer, C. E. (1997). Genetic
analysis of chlorophyll biosynthesis. Annual Review of Genetics,31, 61–89.
12. Hudson, A., Carpenter, R., Doyle, S., & Coen, E. S. (1993).
Olive: a key gene required for chlorophyll biosynthesis in
Antirrhinum majus. EMBO Journal, 12, 3711–3719.
13. Jung, K. H., Hur, J., Ryu, C. H., Choi, Y., Chung, Y. Y., Miyao,
A., et al. (2003). Characterization of a rice chlorophyll-deficient
mutant using the T-DNA gene-trap system. Plant and CellPhysiology, 44, 463–472.
14. Sakamoto, W., Zaltsman, A., Adam, Z., & Takahashi, Y. (2003).
Coordinated regulation and complex formation of yellow varie-
gated1 and yellow variegated2, chloroplastic FtsH metallopro-
teases involved in the repair cycle of photosystem II in
Arabidopsis thylakoid membranes. Plant Cell, 15, 2843–2855.
15. Takechi, K., Sodmergen, Murata, M., Motoyoshi, F., & Sakam-
oto, W. (2000). The YELLOW VARIEGATED (VAR2) locus
encodes a homologue of FtsH, an ATP-dependent protease in
Arabidopsis. Plant and Cell Physiology, 41, 1334–1346.
16. Degenhardt, J., Al-Masri, A. N., Kurkcuoglu, S., Szankowski, I.,
& Gau, A. E. (2005). Characterization by suppression subtractive
hybridization of transcripts that are differentially expressed in
Mol Biotechnol
leaves of apple scab-resistant and susceptible cultivars of Malusdomestica. Molecular Genetics and Genomics, 273, 326–335.
17. Tsuwamoto, R., Fukuoka, H., & Takahata, Y. (2007). Identifi-
cation and characterization of genes expressed in early embryo-
genesis from microspores of Brassica napus. Planta, 225,
641–652.
18. Xie, J. R., Liang, G. L., Tang, K. X., Zhang, H., Cheng, Z. Q., &
Huang, X. Q. (2007). Construction and analyses of SSH cDNA
libraries of rose foral color and scent mutant. Acta HorticulturaeSinica, 34, 688–694.
19. Hung, C. Y., Sun, Y. H., Chen, J. J., Darlington, D. E., Williams,
A. L., Burkey, K. O., et al. (2010). Identification of a Mg-pro-
toporphyrin IX monomethyl ester cyclase homologue, EaZIP,
differentially expressed in variegated Epipremnum aureum‘Golden Pothos’ is achieved through a unique method of com-
parative study using tissue regenerated plants. Journal ofExperimental Botany, 61, 1483–1493.
20. Chen, S. M., Miao, H. B., Chen, F. D., Jiang, B. B., Lu, J. G., &
Fang, W. M. (2009). Analysis of expressed sequence tags (ESTs)
collected from the inflorescence of chrysanthemum. PlantMolecular Biology Reporter, 27, 503–510.
21. Zhang, L. J., & Fan, J. J. (2007). Plant physiology experimentcourse. Beijing: China Agricultural University Press.
22. Li, Z. L. (1996). Technology of plant production. Beijing: Peking
University Press.
23. Sakamoto, W., Tamura, T., Hanba-Tomita, Y., & Murata, M.
(2002). The VAR1 locus of Arabidopsis encodes a chloroplastic
FtsH and is responsible for leaf variegation in the mutant alleles.
Genes to Cells, 7, 769–780.
24. Diatchenko, L., Lau, Y. F., Campbell, A. P., Chenchik, A.,
Moqadam, F., Huang, B., et al. (1996). Suppression subtractive
hybridization: a method for generating differentially regulated or
tissue-specific cDNA probes and libraries. Proceedings of theNational Academy of Sciences of the United States of America,93, 6025–6030.
25. Ramakers, C., Ruijter, J. M., Deprez, R. H. L., & Moorman, A.
F. M. (2003). Assumption-free analysis of quantitative real-time
polymerase chain reaction (PCR) data. Neuroscience Letters,339, 62–66.
26. Pfaffl, M. W. (2001). A new mathematical model for relative
quantification in real-time RT-PCR. Nucleic Acids Research, 29,
2002–2007.
27. Ohmiya, A., Kishimoto, S., Aida, R., Yoshioka, S., & Sumitomo,
K. (2006). Carotenoid cleavage dioxygenase (CmCCD4a) con-
tributes to white color formation in chrysanthemum petals. PlantPhysiology, 142, 1193–1201.
28. Zaltsman, A., Ori, N., & Adam, Z. (2005). Two types of FtsH
protease subunits are required for chloroplast biogenesis and
photosystem II repair in Arabidopsis. Plant Cell, 17, 2782–2790.
29. Bossmann, B., Knoetzel, J., & Jansson, S. (1997). Screening of
chlorina mutants of barley (Hordeum vulgare L.) with antibodies
against light-harvesting proteins of PS I and PS II: absence of
specific antenna proteins. Photosynthesis Research, 52, 127–136.
30. Andersson, J., Wentworth, M., Walters, R. G., Howard, C. A.,
Ruban, A. V., Horton, P., et al. (2003). Absence of the Lhcb1 and
Lhcb2 proteins of the light-harvesting complex of photosystem of
the light-harvesting complex of photosystem II-effects on photo-
synthesis, grana stacking and fitness. Plant Journal, 35, 350–361.
31. Jiang, C. Z., & Rodermel, S. R. (1995). Regulation of photo-
synthesis during leaf development in RbcS antisense DNA
mutants of tobacco. Plant Physiology, 107, 215–224.
32. Schoefs, B., Darkoa, E., & Rodermel, S. (2001). Photosynthetic
pigments, photosynthesis and plastid ultrastructure in RbcS anti-
sense DNA mutants of tobacco (Nicotiana tabacum). Zeitschriftfuer Naturforschung, C Biosciences, 56, 1067–1074.
33. Ifuku, K., Yamamoto, Y., Ono, T., Ishihara, S., & Sato, F. (2005).
PsbP protein, but not PsbQ protein, is essential for the regulation
and stabilization of photosystem II in higher plants. Plant Phys-iology, 139, 1175–1184.
34. Ihnatowicz, A., Pesaresi, P., Varotto, C., Richly, E., Schneider,
A., Jahns, P., et al. (2004). Mutants for photosystem I subunit D
of Arabidopsis thaliana: effects on photosynthesis, photosystem I
stability and expression of nuclear genes for chloroplast func-
tions. Plant Journal, 37, 839–852.
35. Andersson, J., Walters, R. G., Horton, P., & Jansson, S. (2001).
Antisense inhibition of the photosynthetic antenna proteins CP29
and CP26: implications for the mechanism of protective energy
dissipation. Plant Cell, 13, 1193–1204.
36. Bellemare, G., Bartlett, S. G., & Chua, N. H. (1982). Biosynthesis
of chlorophyll a/b-binding polypeptides in wild type and the
chlorina f2 mutant of barley. Journal of Biological Chemistry,257, 7762–7767.
37. Molik, S., Karnauchov, I., Weidlich, C., Herrmann, R. G., & Kl
sgen, R. B. (2001). The rieske Fe/S protein of the cytochromeb
6/f complex in chloroplasts. Journal of Biological Chemistry,276, 42761–42766.
38. Shikanai, T. (2007). Cyclic electron transport around photosys-
tem I: genetic approaches. Annual Review of Plant Biology, 58,
199–217.
39. Outchkourov, N. S., Peters, J., De Jong, J., Rademakers, W., &
Jongsma, M. A. (2003). The promoter-terminator of chrysanthe-
mum rbcS1 directs very high expression levels in plants. Planta,216, 1003–1012.
40. Campoli, C., Caffarri, S., Svensson, J. T., Bassi, R., Stanca, A.
M., Cattivelli, L., et al. (2009). Parallel pigment and transcrip-
tomic analysis of four barley Albina and Xantha mutants reveals
the complex network of the chloroplast-dependent metabolism.
Plant Molecular Biology, 71, 173–191.
41. Leister, D. (2003). Chloroplast research in the genomic age.
Trends in Genetics, 19, 47–56.
42. Murray, D. L., & Kohorn, B. D. (1991). Chloroplasts of Ara-bidopsis thaliana homozygous for the ch-1 locus lack chlorophyll
b, lack stable LHCPII and have stacked thylakoids. PlantMolecular Biology, 16, 71–79.
43. Chekounova, E., Voronetskaya, V., Papenbrock, J., Grimm, B., &
Beck, C. (2001). Characterization of Chlamydomonas mutants
defective in the H subunit of Mg-chelatase. Molecular Geneticsand Genomics, 266, 363–373.
44. Crouzet, J., Levy-Schil, S., Cameron, B., Cauchois, L., Rigault,
S., Rouyez, M. C., et al. (1991). Nucleotide sequence and genetic
analysis of a 13.1-kilobase-pair Pseudomonas denitrificans DNA
fragment containing five cob genes and identification of structural
genes encoding Cob (I) alamin adenosyltransferase, cobyric acid
synthase, and bifunctional cobinamide kinase-cobinamide phos-
phate guanylyltransferase. Journal of Bacteriology, 173,
6074–6087.
45. Nakayama, M., Masuda, T., Bando, T., Yamagata, H., Ohta, H.,
& Takamiya, K. (1998). Cloning and expression of the soybean
chlH gene encoding a subunit of Mg-chelatase and localization of
the Mg2? concentration-dependent chlH protein within the
chloroplast. Plant and Cell Physiology, 39, 275–284.
46. Jensen, P. E., Petersen, B. L., Stummann, B. M., Henningsen, K.
W., Willows, R. D., Vothknecht, U. C., et al. (1996). Structural
genes for Mg-chelatase subunits in barley: xantha-f,-g and-
h. Molecular and General Genetics, 250, 383–394.
47. Zhang, H. T., Li, J. J., Yoo, J. H., Yoo, S. C., Cho, S. H., Koh, H.
J., et al. (2006). Rice Chlorina-1 and Chlorina-9 encode ChlD
and ChlI subunits of Mg-chelatase, a key enzyme for chlorophyll
synthesis and chloroplast development. Plant Molecular Biology,62, 325–337.
Mol Biotechnol
48. Chen, M., Choi, Y. D., Voytas, D. F., & Rodermel, S. (2000).
Mutations in the Arabidopsis VAR2 locus cause leaf variegation
due to the loss of a chloroplast FtsH protease. Plant Journal, 22,
303–313.
49. Kakizaki, T., Matsumura, H., Nakayama, K., Che, F. S., Terau-
chi, R., & Inaba, T. (2009). Coordination of plastid protein import
and nuclear gene expression by plastid-to-nucleus retrograde
signaling. Plant Physiology, 151, 1339–1353.
50. Von Wettstein, D., Gough, S., & Kannangara, C. G. (1995).
Chlorophyll biosynthesis. Plant Cell, 7, 1039–1057.
51. Sundberg, E., Slagter, J. G., Fridborg, I., Cleary, S. P., Robinson,
C., & Coupland, G. (1997). ALBIN03, an Arabidopsis nuclear
gene essential for chloroplast differentiation, encodes a chloro-
plast protein that shows homology to proteins present in bacterial
membranes and yeast mitochondria. Plant Cell, 9, 717–730.
Mol Biotechnol
Top Related