Download - ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Transcript
Page 1: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

©2011 MFMER | slide-1

Practical Challenges in Clinomics: A Mayo Perspective

Eric D. Wieben, Ph.D.August 4, 2012

Page 2: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Disclosure Statement Disclosure Statement of Financial Interestof Financial Interest

• I, Eric Wieben,I, Eric Wieben,

DO NOT DO NOT have a financial have a financial interest/arrangement or affiliation with one interest/arrangement or affiliation with one

or more organizations that could be or more organizations that could be perceived as a real or apparent conflict of perceived as a real or apparent conflict of interest in the context of the subject of this interest in the context of the subject of this

presentation. presentation.

Page 3: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

From Wikipedia (so it must be real)

Clinomics is the study of -omics data along with its associated clinical data.

Page 4: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

©2011 MFMER | slide-4©2011 MFMER | slide-4

Translational ProgramClinomics

Overall Objective

The objective of the Clinomics Program is to create value from genome sequence information

Page 5: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

We can now sequence an entire set of protein coding genes from individual patients, or even entire genomes.

Should we?What are the possible benefits?What are the risks?

Page 6: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

AGATAAGGAGTTCCAAACTGTGCTTTCTTATTTGTTATTTTAAAAAACAAGTTTTTATTTGCTAATTCTCTATGGCCCTGCAAATCCTTTATTGGAAATAACCTTGGTCTCACTGCTGTCTTTCTGTCCTTTGTACTGCGTAATGGGGCTTGAGGATTAGTGTGCTGATATTTGTGCATGTAAATGCTTCTGTATATGCATGTGCCTTCTGAAAACTTTTTTAGGTTTGGAGCTGAATTTTGGATTATTGATCATTCTCTTTTGCCTGGTCTTCCCTGTGACTGTTTTGCATGATGTTGGGTAAAATAATAGTGTGGGTGAGCATGTCACAGTGCTTCTCAGTGTGTTAGAGAGGTGTGCTGTGTACCTTATACCTGTTGTATTTTTTAAATCCTAACAAGAACCTAATGAGATGCAAGGATTACTACTATCCTGTATTCATAGCTGAGGAAACAGAGACAGATGTTAAACAACTGGATCTTAAGGCAGCCAATAATGAAATTAGGTTTTAACCTCAGGTTTGTCTAGCTCAAAGTCCTGAGTTCTATACACACACACACACACACACACACACACACACACACATCAGACAGCTCATTTTTGCAAGATTATATAGGCAAACAGTGTGATATTGAGGCTTCGCACGAAATGCTATCTGTGATCTTTAGGGTAGATAGCATTTTTAAAAATGTGTCTAATGTTGTAATGATGTCAACCATATCCATTATTTTTCCCGCCTTTGTATCCAAATAAACTACCCTTCCAATTTATGACAGATATCAATGTGACTAAATATGTCTTTCTCATATCTTTATTAGTTTTACTAAGAAAATACAGTAGATATTTTAAAAGTTGTGCTTTCATTCTGTTGTAAGTTGATAGTCTACATGGATGCCAATGAAAACATGTTTTTATGTAGCTAATCAATTCAGAATTTGAGGTAACCAAGCCTGATGTATTAATATGTAAAAAAATAAGGATCTCCTGTCTTTAAATATAAAAAAGTTTTGCAGTTCGTTGTTAGATCTTTGAAACTTAATATTCAAGAACAATACCCTCAATTCTATCTGCATCACTAAAATAAGCAGTTTTGAAGGTTTGATATGTCTGTTACCAGACATGTGCTTAAAATGTTACATT

And it doesn’t come neatly labeled and interpreted

Page 7: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Molecular Anatomy

•Exons make up only about 1.5% of total genome

Page 8: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Current estimate= 29,567 protein coding genes*(up from 28,259 #)

29, 567 x 1500 coding/gene= 44 million

Just over 1% of the genome codes for protein—1 inch of 6 feet

http://www.ncbi.nlm.nih.gov/projects/CCDS/CcdsBrowse.cgi?REQUEST=SHOW_STATISTICS#Current_Homo_sapiens_36_3

Page 9: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Compared to the reference sequence, Venter has:

•3,213,401 single nucleotide polymorphisms (SNPs)•53,823 block substitutions (2–206 bp) •559,473 homozygous indels (1–82,711 bp)•62 CNVs•292,102 heterozygous insertion/deletion events (indels)(1–571 bp) •90 inversions

Levy et al., PLoS Biol. 2007 October; 5(10): e254

Page 10: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Korean

AfricanChinese

3775

55092373

3511

9039 nsSNPs 11251 nsSNPs

10162 nsSNPs

Adapted from J-I Kim et al. Nature 000, 1-5 (2009) doi:10.1038/nature08211

So what is the right reference genome?

Page 11: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

•M. N. Bainbridge, W. Wiszniewski, D. R. Murdock, J. Friedman, C. Gonzaga-Jauregui, I. Newsham, J. G. Reid, J. K. Fink, M. B. Morgan, M.-C. Gingras, D. M. Muzny, L. D. Hoang, S. Yousaf, J. R. Lupski, R. A. Gibbs, Whole-Genome Sequencing for Optimized Patient Management. Sci. Transl. Med. 3, 87re3 (2011).

Whole genome sequencing is leading to “cures”—dopa responsive dystonia

Noah and Alexis Beeryhttp://www.youtube.com/watch?v=yUQFHecs8EQ

Page 12: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

From http://myasthenickids.org/

Ellen was not diagnosed with CMS until 18 months old, there although was obviously 'something wrong' from birth as she was unable to feed and maintain her weight and suffered inexplicable weakness and fatigue.

Diagnosed with Congenital Myasthenic Syndrome at the Evelina Children's Hospital at Guys and St Thomas, Ellen is now on pyridostigmine every three hours. She attends mainstream school with support. Her gene fault is currently unknown.

Congenital Myasthenic Syndrome

Page 13: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

A few Mayo CMS pedigrees

Selcen et al., Annals of Neurology 64: 71

Page 14: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

The Concept

Patient inquiry

DNA Sequencing

Mutation Discovery

Improved Treatment

Page 15: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

AZ Patient with Liver Cancer

Fails Conventional Therapy

Inquires about WGS

Potential to Help?

Stop

Business Office

- Est. of Cost- Deposit?- What is Billable?*Ethics

*Genetics

Individualized Medicine

Clinic

Genome Savvy MedOnc

BioethicistMedical Geneticist / Genetics Counselor

Potential to Help?

Stop

Patient Desire to Proceed?

Stop

IM Clinic Review Board

Approve?

Stop

Research Consent(s)Run Test(s)

Subscription?

Store Data andOffer Copy to

Patient

Ongoing Interaction

Share Results- MedOnc- Medical

Geneticist- Subspecialist?

Druggable Target?

Stop

Research Consent

Off Label Use

Monitor and Track Results

NN N

NN

Y Y

Y

Y

Y

Y

N

The Practicality--Individualized Medicine Clinic

Page 16: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

The Issues•Ethical challenges

• What are the risks?• What are the potential benefits?

•Scientific challenges• Data generation, accuracy,

interpretation and management•Administrative/Legal challenges•Clinical challenges

• Will it change treatment?

Page 17: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

The pilot project—Driven by Ethics and Medical Genetics Staff

•Sequence genomes exomes from ten members of the Center for Individualized Medicine leadership•Pick participants by lottery•Engage in counseling•Provide opportunity to opt out•Determine what information each person wants•Proceed with sequencing, etc•Survey attitudes before and after

Page 18: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Ethical challenges• What are the risks?

• Most genetic “news” is bad• Incidental findings• VUS issue

• Effect of bad news extends beyond the patient in the office

• Insurance risk? • What are the potential benefits?

• For THIS patient• What constitutes informed consent?

Page 19: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Scientific challenges• Data generation, interpretation and

management

NGS instruments

Data Storage Compute/Analysis

Consultant Workbench

Interpretive Report to LIS

Interpretive Report and Discrete Data

to EMR(s)

Page 20: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Scientific/Technical challenges

•Accuracy (85% perfect reads)• Requires orthogonal validation

•Alignment • What is the most appropriate

reference sequence? • What about repetitive regions?

•Too much data• 10,000 missense changes per

sample (80 nonsense)• Storage?

Page 21: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

• Over 200 million reads per sample—100 bp each (>250x coverage)

• 70,000 SNVs in coding region per sample

• 70-80 Nonsense mutations• 10,000 missense mutations• 8000 indels in coding region*

Run 2 per lane

Exome sequencing statistics for newest 72Mb capture set

Page 22: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

©2011 MFMER | slide-22

What’s the problem?

Note 62,000 rows!

Page 23: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

©2011 MFMER | slide-23

What’s the problem?

HBB

What’s going on outside the exome?There ARE disease causing mutations here!

Page 24: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

©2011 MFMER | slide-24

What’s the problem?

Even in exons, coverage is not even.So what are we missing?

HBZ

Page 25: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Mismapped repetitive sequences

Page 26: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Scientific/Technical Challenges

After all the other problems are “solved” and technical conclusions are validated, there are still mysteries to be considered•VUS (Variants of Uncertain Significance)—generally private mutations that may or may not constitute risk alleles

• Do change the structure of important proteins• Functional consequences?• Reportable back to patient?

Page 27: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

From Ashley et al. Clinical Assessment incorporating a personal genome, Lancet. 2010 May 1; 375(9725): 1525–1535

Challenges remain in the application of whole genome data to the practice

Page 28: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Administrative/Legal Challenges

•Cost—What is billable? Reimbursable?•What goes into the EMR? How?•What about proprietary genes and tests?

Page 29: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

Clinical challenges

•Will it change treatment? For the better?•Will it inform future discovery efforts that could lead to better treatment?•Will it inform genetic counseling?

A New Treatment’s Tantalizing Promise Brings Heartbreaking Ups and DownsBy GINA KOLATA, New York Times, July 8, 2012

Page 30: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

So why bother?

Finding new mutations in a number of genetic diseases, including CMSThese give insights into fundamental disease process, allow for better counseling and (sometimes) suggest new therapies

From http://myasthenickids.org/

Page 31: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

©2011 MFMER | slide-31

“Individualized Medicine Clinic” to open September 30, 2012

• Advanced cancer patients• “Diagnostic odyssey” patients

•Issues being considered• Expectations, pre-counseling and informed

consent• Unexpected results• VUS interpretation?• Implications for family

members

Page 32: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

New Frontiers in Individualized Medicine

Environment, including microbiome

If the child looks like the father, it’s geneticIf the child looks like the neighbor, it’s environmental

Page 33: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

MyGenome—Available NOW in the iTunes AppStore

Page 34: ©2011 MFMER | slide-1 Practical Challenges in Clinomics: A Mayo Perspective Eric D. Wieben, Ph.D. August 4, 2012.

©2011 MFMER | slide-34