Download - 14 9-11 slideshare crispr gene-editing for everyone

Transcript
Page 1: 14 9-11 slideshare crispr gene-editing for everyone

GENASSIST™ CRISPR: Gene editing for everyone.

Join the Program Now!Visit www.horizondiscovery.com/guidebook

FREE CRISPR Reagents for Knockout Generation

Page 2: 14 9-11 slideshare crispr gene-editing for everyone

2

Horizon Discovery Ltd. 7100 Cambridge Research Park, UK

Our mission

“to translate the human genome and accelerate the discovery of personalised medicines”

Tailoring the right drugs...to the right patients...at the right time

Page 3: 14 9-11 slideshare crispr gene-editing for everyone

The opportunity: translating genetic information into personalised medicines

Information is no longer a bottleneck, emphasis is shifting to the ‘what does it all mean’

Genome editing is enabling the promise of the genomic era to be realized in the form of novel therapeutics and diagnostics

It involves the capability to efficiently introduce targeted alterations into any specific gene in living cells

3

Page 4: 14 9-11 slideshare crispr gene-editing for everyone

GENESIS™: Comprehensive genome editing

rAAV• High precision / low thru-put• Any locus, wide cell tropism• Well validated, KI focus

Zinc Fingers • Med precision / med thru-put• Good genome coverage• Well validated / KO Focus

CRISPR • New but high potential• Capable of multi-gene targeting• Simple RNA-directed cleavage• Combinable with AAV

4

Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined

Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project

Page 5: 14 9-11 slideshare crispr gene-editing for everyone

Table of Contents

The CRISPR/Cas9 gene editing system

Using CRISPR to generate knock-outs and knock-ins

• Case study: Knock-out of MAPK3 in A375 cells• Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells

Key considerations for CRISPR gene editing

Other CRISPR applications

• Case study: sgRNA library screening

CRISPR at developments at Horizon Discovery and beyond

Page 6: 14 9-11 slideshare crispr gene-editing for everyone

RNA-guided platform to introduce either a cut at a specified location in the genome.

Short ‘guide’ RNAs with homology to target loci direct a generic nuclease (Cas9)

Guide RNA + Cas9 are delivered into the cell

Cas9 cleavage is repaired by either NHEJ, or HDR in tandem with a donor

High efficiencies of knockout or knock-in

The CRISPR/Cas9 System

Page 7: 14 9-11 slideshare crispr gene-editing for everyone

Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA

The CRISPR/Cas9 System

Page 8: 14 9-11 slideshare crispr gene-editing for everyone

The CRISPR/Cas9 System

AGCTGGGATCAACTATAGCG CGGgRNA target sequence PAM

Page 9: 14 9-11 slideshare crispr gene-editing for everyone

Cas9 wild-type or Cas9 nickase?

Cas9 Wild type Cas9 Nickase (Cas9n)

Induces double strand break Only “nicks” a single strand

Only requires single gRNA Requires two guide RNAs for reasonable activity

Concerns about off-target specificity Reduced likelihood of off-target events

High efficiency of cleavage Especially good for random indels (= KO)

Guide efficiency dictated by efficiency of the weakest gRNA

Nishimasu et al Cell

Page 10: 14 9-11 slideshare crispr gene-editing for everyone

Designing a guide RNA

Cas9 wild-type: The cut site occurs 3 bp 5’ of the PAM sequence

Cas9n (D10a): the single strand nick occurs on the opposite strand

AGCTGGGATCAACTATAGCG CGGTCGACCCTAGTTGATATCGC GCC

gRNA target sequence PAM

AGCTGGGATCAACTATAGCG CGGTCGACCCTAGTTGATATCGC GCC

gRNA target sequence PAM

Page 11: 14 9-11 slideshare crispr gene-editing for everyone

Designing a guide RNA

Ran et al Cell 2014

Page 12: 14 9-11 slideshare crispr gene-editing for everyone

Table of Contents

The CRISPR/Cas9 gene editing system

Using CRISPR to generate knock-outs and knock-ins

• Case study: Knock-out of MAPK3 in A375 cells• Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells

Key considerations for CRISPR gene editing

Other CRISPR applications

• Case study: sgRNA library screening

CRISPR at developments at Horizon Discovery and beyond

Page 13: 14 9-11 slideshare crispr gene-editing for everyone

Using CRISPR to Generate Gene KOs and KIs

Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3)

96 Clones Screened

28 Positive for cutting

7 Clones Sequenced

3 Clones with indels on all three alleles

Conserved exon 3 targeted

ENSEMBL

Page 14: 14 9-11 slideshare crispr gene-editing for everyone

1

2

3

Parental

Allele 1Allele 2Allele 3

Using CRISPR to Generate Gene KOs and KIs

Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3)

Page 15: 14 9-11 slideshare crispr gene-editing for everyone

Using CRISPR to Generate Gene KOs and KIs

Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitutive expression

1 2 3 4 THUMPD3

Plasmid donor Cas9n

SV40 NLS

BGH PolyA

hROSA26 locus

635 bp 571 bp

Page 16: 14 9-11 slideshare crispr gene-editing for everyone

Using CRISPR to Generate Gene KOs and KIs

Neg

ative

con

trol

gRN

A 1

only

gRN

A 2

only

gRN

A 1

and

2

gRN

A 1

and

2 +

Cas9

n

100bp

200bp

300bp400bp500bp600bp

Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitutive expression

Clones Screened

10% Positive for integration

All positives contained only a single insertion

All positives contained indels in second allele

Page 17: 14 9-11 slideshare crispr gene-editing for everyone

On the surface genome editing with CRISPR appears as simple as:

... HOWEVER …

Identifying a gRNA target sequence

Ordering an oligo with the target sequence and cloning it into a gRNA vector

Transfecting cells with the gRNA + Cas9

Page 18: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

Page 19: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

Normal human karyotype

HeLa cell karyotype

Gene copy number Number and nature of modified alleles Effect of modification on growth

Page 20: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

Transfection/electroporation Single-cell dilution Optimal growth conditions

Page 21: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

Sequence source Off-target potential Guide proximity Wild-type Cas9 or mutant nickase

Page 22: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

Number of gRNAs gRNA activity measurement

NTCas9 wt

only4uncut 1 52 3

gRNA

200

300

400

500

100

600

+ve

700

200

300

400

500

100

600700

Page 23: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

Donor sequence modifications Modification effects on expression or splicing Donor size Type of donor (AAV, oligo, plasmid) Selection based strategies

Cas9 Cut Site

Genomic Sequence

Donor Sequence containing mutation

Page 24: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

Donor sequence modifications Modification effects on expression or splicing Donor size Type of donor (AAV, oligo, plasmid) Selection based strategies

(+/+)

(+/-)

(-/-)

(KI/-)

(KI/+)(KI/KI)

Page 25: 14 9-11 slideshare crispr gene-editing for everyone

Limiting re-cutting by the gRNA can improve the odds (… greatly)

Page 26: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

Number of cells to screen Screening strategy Modifications on different alleles Homozygous or heterozygous

modifications versus mixed cultures

% cells targeted

Page 27: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

Confirmatory genotyping strategies Off-target site analysis Genetic drift/stability Modification expression Contamination

Heterozygous knock-in

Wild type

Page 28: 14 9-11 slideshare crispr gene-editing for everyone

Key Considerations For CRISPR Gene Editing

Gene Target Specifics

Cell Line

gRNA Design

gRNA Activity

Donor Design

Screening

Validation

How many copies?

Is it suitable?

What’s my goal? (Precision vs Efficiency)

Does my guide cut?

Have I minimised re-cutting?

How many clones to find a positive?

Is my engineering as expected?

Page 29: 14 9-11 slideshare crispr gene-editing for everyone

Table of Contents

The CRISPR/Cas9 gene editing system

Using CRISPR to generate knock-outs and knock-ins

• Case study: Knock-out of MAPK3 in A375 cells• Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells

Key considerations for CRISPR gene editing

Other CRISPR applications

• Case study: sgRNA library screening

CRISPR at developments at Horizon Discovery and beyond

Page 30: 14 9-11 slideshare crispr gene-editing for everyone

Other applications of the CRISPR platform

(A) Nuclease or Nickase

(B) Two nickase complexes can mimic targeted DSBs via cooperative nicks

(C) Expression of all components from one plasmid

(D) Purified Cas9 protein and in vitro transcribed gRNA can be microinjected into fertilized zygotes

(E) Viral vectors encoding CRISPR reagents can be transduced into tissues or cells of interest.

(F) Genome-scale functional screening can be facilitated by mass synthesis and delivery of guide RNA libraries.

(G) Catalytically dead Cas9 can be fused to functional effectors such as transcriptional activators or epigenetic enzymes.

(H) Cas9 coupled to fluorescent reporters facilitates live imaging of DNA loci

(I) Inducible reconstituting split fragments of Cas9 confers temporal control of dynamic cellular processes.

Hsu et al. Cell. 2014

Page 31: 14 9-11 slideshare crispr gene-editing for everyone

Lentivirally delivered sgRNA can drive efficient cleavage of target genomic

sequences for use in whole genome screens

Use massively-parallel next-gen sequencing to assess results

Possible addition/replacement to RNAi screens

sgRNA Screening

Page 32: 14 9-11 slideshare crispr gene-editing for everyone

32

sgRNA Screening

Shalem et al Science 2014

Page 33: 14 9-11 slideshare crispr gene-editing for everyone

Cas9/sgRNA suppresses gene expression far more effectively than shRNA

Shalem et al Science 2014

Page 34: 14 9-11 slideshare crispr gene-editing for everyone

34

Synthetic Lethality sgRNA Screening

We are integrating CRISPR-based Synthetic Lethality Screens into our platform

sgRNA technology will be transformational for both Target ID and early-stage

Target Validation

Page 35: 14 9-11 slideshare crispr gene-editing for everyone

LentiCRISPR v2 reagents and GeCKO v2 library

Due to large vector size, only low titers were achievable with version 1 vectors→ large-scale v1 library virus production (and concentration)

By vector element clean-up and optimization, v2 vectors produce ~10-fold higher titers

Additional two-vector lentiviral system now available for hard-to-infect cell lines

Sanjana et al. Nature Methods 2014

Page 36: 14 9-11 slideshare crispr gene-editing for everyone

LentiCRISPR v2 reagents and GeCKO v2 library

~120,000 guideRNAs against ~19,000 genes

6 guides vs. each gene in two half-libraries (3 guides/gene in Library A or B)

1000 non-targeting sgRNAs

Sanjana et al. Nature Methods 2014

Page 37: 14 9-11 slideshare crispr gene-editing for everyone

LentiCRISPR v2 reagents and GeCKO v2 library

GeCKO v2 library has now arrivedLibrary amplification + QCLentivirus production• Determine MOI for GeCKO v2 library lentivirus

Two-vector v2 lentiCRISPR system upgraded to include fluorescent tags for rapid hit validation by dual-colour co-culture experiments

GFP

P2A

lentiGuide-Puro_P2A_tGFP

RFP

P2A

lentiGuide-Puro_P2A_tRFP

Page 38: 14 9-11 slideshare crispr gene-editing for everyone

Table of Contents

The CRISPR/Cas9 gene editing system

Using CRISPR to generate knock-outs and knock-ins

• Case study: Knock-out of MAPK3 in A375 cells• Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells

Key considerations for CRISPR gene editing

Other CRISPR applications

• Case study: sgRNA library screening

CRISPR at developments at Horizon Discovery and beyond

Page 39: 14 9-11 slideshare crispr gene-editing for everyone

Horizons CRISPR developments: Combining rAAV + CRISPR

Can we combine technologies for improved efficiency?

Tested using a reporter cell-line harbouring an inactivating mutation in GFP

Correction donor-vector supplied either as dsPlasmid, ssDNA oligos, or ssDNA rAAV

rAAV = the most efficient donor vector (50 fold)

% G

reen

cel

ls (F

ACs)

Page 40: 14 9-11 slideshare crispr gene-editing for everyone

Open to all academic researchers

Free guide design using gUIDEbook, Horizon’s in silico guide design software

Free cloning 5 guides cloned into all-in-one plasmids that express Cas9

Must let Horizon know when your guide has been used to generate a cell line (feedback on which guide or guides worked)

Must license that cell line back to Horizon in return for a royalty

Only pay cost of shipping

Horizon would like to license your cell lines!

Horizons CRISPR developments: Free CRISPR Reagents for Knock-Outs

Strengthen

Academic Links

Expand Cell Line

Repository

Improve gRNA

Design Platform

What? Free? WHY?!

Page 41: 14 9-11 slideshare crispr gene-editing for everyone

GENASSIST: CRISPR and rAAV enabled gene editing

Cas9 Vectors• Wild type and nickase• Separate or combined with guide

Guide RNA• Single or double guides• Available OTS for in-lab cloning• Custom guide generation available with validation

Donors• Available OTS for in-lab cloning• Plasmid or rAAV format• Custom donor generation available

Cell Lines• CRISPR-ready cell lines• 550+ OTS cell line menu available for further gene editing

Services• Viral encapsulation of rAAV donor• Project design support• On-going expert scientific support

Page 42: 14 9-11 slideshare crispr gene-editing for everyone

CRISPR and rAAV Intellectual property

It is Horizon's intent to ensure that our customers have a risk free environment to perform and benefit from CRISPR gene editing now and in the future.

We bring to our customers the widest breadth of IP available from any commercial source:

We currently have either already taken a license to or are in late-stage negotiations to access multiple separate CRISPR IP patent estates

Horizon is the only company with access to rAAV as a precise gene editing or DNA/plasmid delivery platform, we are the only company able to offer hybrid rAAV/CRISPR systems that draw from the best aspects of both approaches for far superior gene editing efficiencies.

Page 43: 14 9-11 slideshare crispr gene-editing for everyone

Your Horizon Contact:

Horizon Discovery Ltd, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom

Tel: +44 (0) 1223 655 580 (Reception / Front desk) Fax: +44 (0) 1223 655 581 Email: [email protected] Web:

www.horizondiscovery.com

Chris Thorne PhDGene Editing Community [email protected] +44 1223 204799

Page 44: 14 9-11 slideshare crispr gene-editing for everyone

Useful Resources

From Horizon

Free gRNAs in Cas9 wild type vector – www.horizondiscovery.com/guidebook

Technical manuals for working with CRISPR - http://www.horizondiscovery.com/talk-to-us/technical-manuals

In the Literature

Exploring the importance of offset and overhand for nickase - http://www.cell.com/cell/abstract/S0092-8674(13)01015-5

sgRNA whole genome screening:• Shalem et al - http://www.sciencemag.org/content/343/6166/84.short• Wang et al - http://www.sciencemag.org/content/343/6166/80.abstract

On the web

Feng Zhang on Game Changing Therapeutic Technology (Link to Feng’s Video)

Guide design - http://crispr.mit.edu/

CRISPR Google Group - https://groups.google.com/forum/#!forum/crispr