Interaction of NPR1 with basic leucine zipper protein

transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene

YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG

By Di Wu and Brian Kahnamelli

Introduction◦ What is SAR?◦ What did we know about NPR1 Before This Paper?◦ What did we want to learn about NPR1?

Yeast Two-Hybrid Screen◦ Mechanism of Action◦ Limitations of YTH

Why in Tomato? Experiments

◦ Yeast Two-Hybrid Screens◦ In Vitro Binding Affinity◦ Gel Shift Assays

Presentation Outline

Basic Leucine Zipper Transcription Factors (bZIP)

Summary of Results Impact and Implications Future Research

Presentation Outline

Do you know…How many potential diseases are there during the growth period of Rice?

More than 70!

Rice Blast

Rice Bacterial Blight

Rice false smut

Why SAR is fascinating?

1, Broad-spectrum resistance2, Relatively long-term resistance3, “healthy” resistance

What is SAR?

Systemic Acquired Resistance

How to study SAR genetically?

Forward genetic screen.

NPR1 BackgroundGroup Screens Mutants

obtained The year when finished

Screening strategy

Ryals, Novartis

Non-immunity (NIM)

nim1-1 to nim1-6

1995 Infection assay after SAR elicitor treatment

Dong, Duke No PR-gene expression (NPR)

npr1-1 1994 BGL2::GUS reporter system

In 1997, NPR1 gene was mapped and the protein sequence was examined.

Question Break

What do you know about NPR1 protein?

**Wonderful time to improve your Participation Grade**

Structural features of NPR1

593 amino acids, 67 kD Two protein-protein interaction domains:

BTB/POZ and Ankyrin repeats Contains NLS Multiple phosphorylation sites Multiple conserved cysteine residues No DNA binding domain

npr 1-1

BTB ARD

S S

NLSnpr 1-2 nim 1-2

Proposals to dissect NPR1 function in SAR signal pathway

SA receptor?◦ No SA binding activity

Subcellular localization? ◦ Accumulation in nucleus after SAR induction

Transcription factor?◦ No bona fide DNA binding domain

Screen for NPR1-interacting proteins (NIPs)

Purpose◦ To test protein-protein interactions

Requirements◦ Reporter construct of interest in yeast◦ cDNA prey library with spliced activating domain

Activating domain interacts with RNA pol to transcribe the reporter gene

◦ cDNA bait construct with spliced Yeast DNA binding domain (BD) Binding domain interacts with promoter region of the reporter

gene Preparation

◦ Transfect yeast cells with both plasmids and grow on medium complementary to your reporter assay

Yeast Two-Hybrid Screen

Yeast Two-Hybrid Screen

Bait Construct:•Plasmid Vector•cDNA sequence of interest•Binding domain

Prey Construct:•Plasmid Vector•cDNA sequence of interest•Activating domain

Yeast Two-Hybrid Screen

Reporter GeneBD

ADPrey

Bait

RNA Pol

Can you think of any limitations of the Yeast Two-Hybrid experiment?

Question Break

False Positive Results◦ A) Bait already possess an Activating Domain◦ B) Means of selection is error prone◦ C) Prey possess a yeast binding domain – highly

unlikely False Negative Results

◦ A) Post Translational Modifications Ex. Phosphorylation

◦ B) Scaffold protein interaction◦ C) Internal Yeast Error

Protein Folding or Transcription error occurs

Limitations of the YTH Screen

Tomato Library was better characterized than Arabidopsis Library

Tomato Library possessed a positive control◦ PTO-PTI◦ Remove some possibility of False Negative

The quality of a yeast two-hybrid experiment hinges on the quality of a library◦ Is what you’re finding legitimate??◦ Is what you’re not finding legitimate?

Tomato Library

Experimentation

Perform Yeast Two-Hybrid Experiment with known Tomato homologue of NPR1◦ Referred to as TomNPR1

Use NPR1 homologue of NPR1as bait◦ Transfect Yeast with gene, spliced to DNA binding

domain (BD) Screen cDNA Library for potential binding (Prey)

◦ Transfect the same yeast with gene Use of Leucine Drop out Plates

◦ Reporter genes allow yeast to produce Leucine and grow

Experiment 1 – Screen in Tomato Library

Yeast Two-Hybrid Screen

Leucine or β-gal ActivityBD

ADPrey

TomNPR1

RNA Pol

Researchers found NIF1 gene led to positive Y2H result◦ Leucine production, β-gal activity and colony

survival

Results

Results – Figure 1a

Results – Figure 1a

Test each component alone to test for individual activity◦ None found alone

Sequence and Characterize NIF1◦ Search Genebank for homologous structures in

Arabidopsis◦ NIF1 codes for last 2/3 of a bZIP Transcription

Factor Found Three candidates: AHBP-1b (TGA2),

TGA6, and OBF5(TGA2)◦ All are bZIP Transcription Factors

Experiment 2 – Looking into Arabidopsis

Experiment 2 – Looking into Arabidopsis

Figure 2. Sequence similarity between NIF1 and associated homologues

Perform same experimentation in Arabidopsis to confirm that Tomato homologues respond under similar conditions

Only considering 3 possible candidates (bZIP proteins)◦ AHBP-1b, TGA-6, and OBF5 as prey◦ NPR1 as Bait

Experiment 2 – Looking into Arabidoposis

All three bZIP proteins were capable of stimulating a Leucine and β-gal activity indicating protein-protein interaction

Results

Results – Figure 1a

Results – Figure 1a

Results – Figure 1b

Conclude: All three TFs show increased function when compared to the negative control. NPR1 can potentially interact with all of these TFs.

Because Yeast Two-Hybrid is error prone, confirmation by means of other experimentation is required

Researchers aimed to confirm results by performing an in vitro binding test◦ Ni-NTA Resin Pull down Assay (Co-Purification)

Experiment 3 – In Vitro Binding

Experiment 3 – Protocol for pull-down assay

Poly-histidine Tag

NTAScaffold

Ni-NTA resin

Poly-histidine Tag

NTAScaffold

Ni-NTA resinHis-tagged TGANPR1

Experiment 3 – Protocol for pull-down assay

Results – Figure 3

NPR1 & AHBP-1b

Crude Extract

of NPR1

NPR1 & O

BF5

NPR1 & AHBP-1b

(alternate preparatio

n)

NPR1 & Resin

alone

(Neg. C

ontrol)

Experiment 4 – Truncated NPR1 Aim to find regions of NPR1 involved in TGA

binding Create truncated NPR1 gene constructs Perform Yeast Two-Hybrid Screens with AHBP-1b

(TGA2) prey expressed along with truncated NPR1 bait◦ 1-177aa – amino term, 1st exon◦ 1-432aa – amino term, 1st exon, ankyrin repeat domain◦ 178-593aa – ankyrin repeat domain, carboxyl term◦ 1-593aa – Total Protein

Truncations along exon/intron boundries

Active regions appear to be amino end in combination with ankyrin domains◦ 1-432 segment shows activity equal to WT◦ N-terminus alone shows little activity◦ Ankyrin Repeat alone shows little activity

Results

Results – Figure 4a

Figure 4a. Specific regions of NPR1 appear to be more important in regards to binding affinity

Introduce point mutations into highly conserved amino acids within the Ankyrin repeat domains ◦ npr1-1 – histidine 334 to tyrosine◦ npr1-2 – cysteine 150 to tyrosine

Perform Yeast Two Hybrid Screens with these mutants and observe activity

Experiment 5 – Introducing Point Mutations

Base Switches:

Experiment 5 – Introducing Point Mutations

CysteineHistadine Tyrosine

Mutations into conserved amino acids lead to complete abolishment of activity

Results

Results – Figure 4b and 4c

Figure 4b. X-gal and Leucine drop out plates showing loss of activity in npr1-1 and npr1-2 mutants

Figure 4c. Immunoblot of NPR1 protein expression levels in WT and mutant constructs

Basic leucine zipper (bZIP) transcription factors

Marc Jakoby et al. 2002

Primary structure of bZIP domain

Hydrophobic interaction surface of the helices

O'Shea et al. 1991

Leucine Zipper TFs

Marc Jakoby et al. 2002

Binding DNA sequences with an ACGT core.

http://www.bmb.psu.edu/faculty/tan/lab/gallery_protdna.html

MADS-box TFs

Recognizing the CArG-box

Basics about TGA familyPlant bZIP transcription factors are classified into 10 groups

Group D/ TGA/OBF family

Clade II (TGA2/AHBP-1b, OBF5/ TGA5, TGA6)

TGA2

Question: What phenotypes would you expect if the construct 35S::TGA2CT is introduced into col-0 background?

NT: N-terminal region

bZIP: required for DNA binding

CT: responsible for NPR1 binding

TGA factors bind specifically to variants of the palindrome TGACGTCA. Two of these sequences separated by 4 bps are called an activation sequence-1 (as-1).

Aimed to characterize the function of AHBP-1b

PR-1 promoter region has as-1-like element◦ Known to interact with bZIP proteins

Test binding affinity of AHBP-1b to PR-1 promoter ◦ Radio-labeled promoter region◦ Non-labeled promoter region◦ Non-labeled as-1-like sequence

Experiment 6 – AHBP-1b analysis

Electrophoretic mobility shift assay (EMSA)

Question: How is TGA binding to PR1 promoter sequence possible even without NPR1?

as-1-like element: CTCTACGTCACTATTTTACTTACGTCATAGATG

Mutated version: CTCTAttctACTATTTTACTTAttctATAGATG

Results: Figure 5

Band shift observed when AHBP-1b was present

Competitive binding seen between labeled and non-labeled promoter region

Non-competitive binding seen between labeled promoter region and mutated as-1-like element

AHBP-1b can specifically bind the PR-1 promoter region in vitro

Results

Summary – What Have We Shown?

TomNPR interacts with NIF1 NPR1 interacts with TGA transcription

factors via Ankyrin repeat and N-terminus domain◦ Binding is specific and altered by single amino

acid changes TGA transcription factors interact with the

binding domains of PR genes◦ TGA2 binds to promoter region of PR1 specifically

Research helped to further connect SA to SAR by connecting another link in the pathway◦ Showed potential for redundancy as seen in three

bZIPs capable of binding to NPR1 Added to body of knowledge regarding

NPR1

Impact and Implications

Examine bZIP and NPR1 in vivo Loss of function and gain of function

mutants◦ Look at mutants lacking specific TGA TFs alone

and in combination◦ What else can NPR1 and TGAs activate?

Regulation◦ How is NPR1 activity regulated?

What else would you be interested in knowing?

Future Research

TGA 2,5, and 6 have essential, redundant, and overlapping roles

TGA 5 over expression is sufficient to stimulate SAR

NPR1 regulation sensitive to redox changes

Future Research

Future Research

How to further confirm the physical interaction between TGA factors and NPR1 in vivo?

Co-immunoprecipitation

In vivo protein fragment complementation assay (PCA)◦ Bimolecular fluorescence complementation (BiFC)◦ Restoration of dihydrofolate reductase (DHFR) acitivity

Protein fragment Complementation Assay (PCA) using DHFR enzyme

No interaction

interaction

I’m a protoplast.

Subramaniam et al. 2001 Nat. Biotechnol.

Subramaniam et al. 2001 Nat. Biotechnol.

Protein fragment Complementation Assay (PCA) using DHFR enzyme

Questions?