Y-DNA Haplogroup G
Transcript of Y-DNA Haplogroup G
Y-DNA Haplogroup GInhuman genetics,Haplogroup G(M201) is aY-chromosomehaplogroup. It is a branch ofHaplogroup F(M89). Haplogroup G has an overall low frequency in most populations but is widely distributed within many ethnic groups of theOld WorldinEurope(especially in alpine regions),Caucasus,South Asia,westernandcentral Asia, andnorthern Africa.OriginsVarious estimated dates and locations have been proposed for the origin of Haplogroup G. TheNational Geographic Societyplaces haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of theNeolithicTwo scholarly papers have also suggested an origin in the Middle East, while differing on the date. Semino et al. (2000) suggested 17,000 years ago.Cinnioglu et al. (2004) suggested the mutation took place only 9,500 years ago.Prehistoric presenceHaplogroup G2a(SNP P15+) has been identified in neolithic human remains in Europe dating between 5000-3000BC. Furthermore, the majority of all the male skeletons from theEuropean Neolithicperiod have so far yielded Y-DNA belonging to this haplogroup. The oldest skeletons confirmed byancient DNAtesting as carrying haplogroup G2a were five found in theAvellaner caveburial site for farmers in northeasternSpainand were dated byradiocarbon datingto about 7000 years ago.At the Neolithic cemetery of Derenburg Meerenstieg II, north centralGermany, with burial artifacts belonging to theLinear Pottery culture, known in German as Linearbandkeramik (LBK). This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. The most detailed SNP mutation identified was S126 (L30), which defines G2a3.G2a was found also in 20 out of 22 samples of ancient Y-DNA fromTreilles, the type-site of a Late Neolithic group of farmers in the South ofFrance, dated to about 5000 years ago.The fourth site also from the same period is the tztal of theItalian Alpswhere the mummified remains oftzi the Icemanwere discovered. Preliminary word is that the Iceman belongs to haplogroup G2a2b(earlier called G2a4).Haplogroup G2a2b is a rare group today in Europe. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of theirshort tandem repeat(STR) markers.Historic presenceTwo men found in a high-status burial atErgoldingin present-dayBavaria, southern Germany, of theMerovingian dynastyperiod (7th century),were found to belong to haplogroup G2a (P15+).Genetic findingsM201 SNP mutationThe M201 SNP mutation that characterizes haplogroup G was identified atStanford Universityand was first reported in 2001.The technical specifications of M201 are given as: refSNPid is rs2032636.....Y chromosome location of 13536923....forward primer is tatgcatttgttgagtatatgtc.....reverse primer is gttctgaatgaaagttcaaacg.....the mutation involves a change from G to T.Equivalent SNP mutationsA number ofSNPshave been identified with seemingly the same coverage in the population as M201. Because M201 was identified first, it is the standard SNP test used when testing for G persons. In order to determine if one of these alternative SNPs represents a subgroup of M201, the alternative SNPs must be tested in G persons who are negative for the known subgroups of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201.The following SNPs are so far are identified as M201 equivents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. P257 was first reported in 2008.L240 was identified in 2009.The "U" SNPs were identified in 2006 but not published until 2009.In addition, there are multiple other SNPs thought to have the same coverage as M201. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. No labs have yet assigned them shorthand names.Subgroup tree listing.............corresponding SNP IDs listed in parenthesesG* G1 (M285, M342) G1* - G1a (P20.1, P20.2, P20.3) G1a* - G1a1 (L201, L202, L203) G1b (L830, L831, L832, L834, L835) G2 (P287) G2* - G2a (P15, U5, L31/S149, L149) G2a* - G2a1 (L293^) G2a1* - G2a1a (P16.1, P16.2) G2a1a* - G2a1a1 (P18.1, P18.2, P18.3) G2a2 (L223^) G2a2* - G2a2a (M286) G2a2b (L91) G2a2b* - G2a2b1 (L166, L167) G2a3 (L30/S126, L32/S148, L190/M485) G2a3* - G2a3a (M406) G2a3a* - G2a3a1 (L14/Page57/S130/U16, L90/S133) G2a3a2 (L645) G2a3b (L141.1) G2a3b* - G2a3b1 (P303/S135) G2a3b1* - G2a3b1a (L140) G2a3b1a* - G2a3b1a1 (U1) G2a3b1a1* - G2a3b1a1a (L13/S131/U13, L78/M527) G2a3b1a1a* - G2a3b1a1a1 (L1263^) G2a3b1a1b (L1266^) G2a3b1a1b* - G2a3b1a1b1 (L1264^, L1265^, L1268^) G2a3b1a2 (L497, L353.1^,L353.2^) G2a3b1a2* - G2a3b1a2a (Z725^) G2a3b1a2a* G2a3b1a2a1 (L43/S147) G2a3b1a2a1* G2a3b1a2a1a (L42/S146) G2a3b1a3 (Z1903^) G2a3b1a3* - G2a3b1a3a (Z724^) G2a3b1a3a* - G2a3b1a3a1 (L640) G2a3b1a4 (L660, L662) G2a3b1b (L694) G2a3b2 (L177.1, L177.2, L177.3) G2b (M377, L72, L183) G2b* - G2b1 (M283)The^indicates newly identified in 2012. The * indicates negativity for subgroups of that categoryThe eight most commonly occurring subgroups of haplogroup G in existing data with their correspondingSNPsin parentheses are: G1 (M285), G2a1 (P16) G2a3a (M406), G2a3b1a (L140), G2a3b1a2 (L497), G2a3b1a1a (L13/S131/U13), G2a3b1a3 (Z1903) and G2b (M377).Categories here conform to the clearinghouse for Y-DNA SNP categories at ISOGG.[1]In August, 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming.Characteristics of Haplogroup G subgroupsThe International Society of Genetic Genealogy (ISOGG)maintains the most up-to-date consensus version of haplogroup categories. These classifications are based on shared SNP mutations. The discovery of newSNPscan result in assignment of new names to haplogroup categories. There were only a few G categories until 2008 when major revisions to categories were made. Even more G SNPs were identified in 2009 to 2012 leading to more changes. Until 2008, new G SNPs were reported from labs at theUniversity of Arizona(P designations),Stanford University(M designations) or theUniversity of Central Florida(U designations). Beginning in 2008, additional G SNPs were identified atFamily Tree DNA(L designations) and Ethnoancestry (S designations). These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at23andMeto provide new L or S-designated SNP tests. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. In 2012, SNPs with the Z designation as first identified by citizen researchers from1000 Genomes Projectdata began to appear.Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. Categories have alternating letters and numbers. But unusual values or unusual value combinations found atshort tandem repeatmarkers (STRs) can also provide the basis of additional subgrouping. The identification of a new SNP can necessitate renaming of one or more categories.G1 (M285+ or M342+) and its subgroupsMain article:Haplogroup G1 (Y-DNA)Almost all haplogroup G1 persons have the value of 12 atshort tandem repeat(STR) marker DYS392 and all will have the M285 or M342SNPmutation which characterizes this group. This value of 12 is uncommon in other G categories other than G1.Subgroups of G1a, G1a1, G1b exist.The highest reported concentration of G1 and its subgroups in a single country is inIran, with next most frequent concentrations in neighboring countries to the west.There are distinctiveAshkenaziJewish andKazakhsubgroups based on STR marker value combinations.G2 (P287+)Men who belong to this group but are negative for all G2 subgroups represent a small number of haplogroup G men. P287 was identified at theUniversity of Arizonaand became widely known in late 2007. Its identification caused considerable renaming of G categories.G2a (P15+)Haplogroup G men who belong to this group, but are negative for all G2a subgroups, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. P15 was identified at theUniversity of Arizonaand became widely known by 2002. Its chromosome location listed as 21653414. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding,Bavaria, Germany, but G2a subgroups were not tested.There are multiple SNPs which so far have the same coverage as P15. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category.G2a1 (L293+) and its subgroupsMain article:Haplogroup G2a1 (Y-DNA)Haplogroup G2a1 and its subgroups represent the majority of haplogroup G samples in some parts of theCaucasus Mountainsarea. They are found only in tiny numbers elsewhere. So far all G2a1 persons have a value of 10 atSTRmarker DYS392. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons.The North Ossetians in the mid northern Caucasus area ofRussiabelong overwhelmingly to the G2a1 subgroup based on available samples. The South Ossetians andSvansgenerally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided.The presence of the SNP P18 mutation characterizes G2a1a's only subgroup, G2a1a. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined.AshkenaziJewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters.G2a2 (L223+) and its subgroupsThis group is charactized by having the L223 mutation. L223 is found on the Y chromosome at rs13304806 and 6405148 with a mutation from C to G. L223 was first identified in samples at23andMein 2009 but proved problematical as an individual test, the first successful results being reported atFamily Tree DNAin late 2011 under its assigned L223 label. It was then learned that three subgroups as follows belong under L223:The G2a2a subgroup (M286) is tiny. Samples indicating British Isles and Turkish ancestry have been identified. The British samples have inconsistent double values for STR marker DYS19 in many cases. M286 was first identified atStanford Universityat chromosome position 21151187, and is a mutation from G to A.The L91 SNP that characterizes the G2a2b group was identified in spring 2009 at Family Tree DNA. G2a2b would seem to encompass a significant group of G persons. L91 is found so far in scattered parts of Europe and North Africa and inArmenia. Included within G2a2b are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not G2a2b. The double 19 value situation is not seen in the G2a1 and G2a3 subgroups. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The mutation involves a change from C to T.[16] L223 is found on the Y chromosome at rs13304806.The L293 SNP that characterizes the G2a2c subgroup was identified in June 2010 at Family Tree DNA. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. The mutation is found on the Y chromosome at 10595022 and is a change from G to C.G2a3 (L30+, S126+, U8+)Men who belong to this group but are negative for all its subgroups represent a small number today. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of theLinear Pottery culture, known in German as Linearbandkeramik (LBK),but was not tested for G2a3 subgroups.G2a3a (M406+) and its subgroupsMain article:Haplogroup G2a3a (Y-DNA)G2a3a and its several subgroups seem most commonly found inTurkeyand the coastal areas of the eastern Mediterranean where it can constitute up to 50% of haplogroup G samples. G2a3a is more common in southern Europe than northern Europe. In Europeexcept inItalyG2a3a constitutes less than 20% of G samples. G2a3a so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and inIran.A relatively high percentage of G2a3a persons have a value of 21 at STR marker DYS390. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a3a persons, and DYS392 is almost always 11. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a3a.G2a3a has two known subgroups. Both are relatively common among G2a3a persons.G2a3b (L141+)The SNP that defines this group was identified only in mid-2009 atFamily Tree DNA. Almost all L141+ men belong to L141 subgroups. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. L141+ persons who do not belong to any L141 subgroup so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. The L141 mutation is found on the Y chromosome at 2948607. The L141 mutation involves an insertion.G2a3b1 (P303+ or S135+) and its subgroupsMain article:Haplogroup G2a3b1 (Y-DNA)The G2a3b1 definable subgroups are heavily concentrated throughout Europe west of theBlack SeaandRussiawhere G2a3b1 is often in the majority among G persons. Small percentages of G2a3b1 are found primarily in the area encompassed by Turkey, the Caucasus countries, Iran and the Middle East where the G2a3b1 SNP may have originated. G2a3b1 is also found in India. The great majority of P303+ men belong to one of its subgroups.The largest G2a3b1 subgroup based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. The L497 SNP (G2a3b1a2) encompasses these men, but most men L497 men belong to its subgroup Z725. There are additional subgroups of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities.The next largest G2a3b1 subgroup is characterized by the presence of the U1 mutation (G2a3b1a1) But a high percentage of U1+ men belong to its two subgroups, L13/S13 (G2a3b1a1a)and Z1266 (G2a3b1a1b). The L13 subgroup is most common in north central Europe, and Z1266 is most common in the western Caucasus Mountains.The final major subgroup is characterized by presence of the Z1903 SNP and so far by the value of 9 at marker DYS568. A high percentage of Z1903+ men belong to its subgroup, Z724. The Z724 subgroup contains a further large subgroup consisting overwhelmingly ofAshkenazi Jews.The highest percentage of G2a3b1 persons in a discrete population so far described is on the island ofIbizaoff the eastern Spanish coast.G2a3b2 (L177+)This G2a3b2 group is certainly smaller in numbers of men included than G2a3b1, but only a small amount of testing has occurred for the L177 mutations. So far the men positive for this have listed Irish, English, Dutch, Lebanese and Turkish (Armenian surname) ancestry. Several L177 subgroups based on shared STR marker oddities exist.The number of STR marker values separating men in this group suggest G2a3b2 is a relatively old group despite the small number of men involved.The mutations involved are complicated and difficult to interpret. The L177.1 component is found at Y chromosome position 23397163; L177.2 at 25030912; L177.3 at 25750264.This SNP was first identified atFamily Tree DNAin 2009.G2b (M377+) and its subgroupMain article:Haplogroup G2b (Y-DNA)Until August, 2012, this subgroup was designated G2c. A clade of closely relatedAshkenazi Jewsrepresent virtually allG2bpersons, with just three other G2b haplotypes having been reported so far: oneTurkfromKarsin northeast Turkey near Armenia, onePashtun, and oneBurushoin Pakistan. The extreme rarity of G2b in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both theAchaemenid Persian Empire, conquered byAlexander the Great, and then formed a part of theGreco-Bactrian Kingdom). These two reported Pakistani G2c haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. The Turkish G2b is somewhat closer, but not identical. It remains to be seen if testing will reveal G2b haplotypes in other populations this is some indication that G2b occurs at low levels in the Near East. All G2b men tested so far have a rare null value for theDYS425marker, (a missing "T" allele of the DYS371 palindromicSTR), the result of aRecLOHevent, a finding not yet seen among most other G haplotypes. Among Jews in Israel drawn from many areas of the world, G2b constituted 3.7% in one study.Haplogroup G2b has been found at a frequency of 60% out of a smaple of 5 Pastuns in the Wardak region of Afghanistan. This is likely due to a local founder effect.[2].Geographical distributionMain article:Haplogroup G (Y-DNA) Country by CountryKnowing the distribution of haplogroup G in general is not as useful as that of the distribution of its subgroups. The subgroups likely spread to new areas of the world in different time periods and to different locations. All available G samples derive from studies or collections that do not meet criteria forrandom sampling, and conclusions based on them are only rough approximations of what is seen in populations.InEuropewest of theBlack SeaHaplogroup G is found at about 5% of the population on average throughout most of the continent.The concentration of G falls below this average inScandinavia, the westernmost formerSovietrepublics andPoland, as well as inIcelandand theBritish Isles. There are seeming pockets of unusual concentrations within Europe. InWales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. In westernAustria, in theTirol(Tyrol) the G percentage can reach 8% or more (Otzialso had it). In the northern and highland areas of the island ofSardiniaoff westernItaly, G percentages reach 11% of the population in one studyand reached 21% in the town ofTempioin another study. In the Greek island ofCrete, approximately 7%to 11%of males belong to haplogroup G. In north-easternCroatia, in the town ofOsijek, G was found in 14% of the males.The city is on the banks of the riverDrava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G.InRussia, the Ukraine and central Asia, the G percentage is around 1% or less. The northern slope of theCaucasus Mountainsrepresents a major exception where concentrations in theKabardinianandOssetianpopulations are noted. InDigora, North Ossetia the highest known concentration of G in a single town in the world is reached where 74% of the tested men were G.TheMadzharsof centralKazakhstan, a Kazakh sub-ethnic group, were found to be 87% G1. Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs.InTurkey, the southern Caucasus region and Iran, haplogroup G reaches the highest percentage of a regional population worldwide. AmongTurkishmales 11% of the population is G.In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. While it is found in percentages higher than 10% among theBakhtiari,GilakiandMazandarani, it is closer to 5% among the IranianArabsand in some large cities.Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples fromAbazinia, 31% fromGeorgia, 18% fromAzerbaijanand 11% fromArmeniaappear to be G samples.Insouthern Asia, haplogroup G is found in concentrations of approximately 18%to 20%ofKalash, approximately 16% ofBrahui,and approximately 11.5% of sampledPashtun,but in only about 3% of the generalPakistanipopulation.The many groups inIndiaandBangladeshhave not been well studied. About 6% of the samples fromSri LankaandMalaysiawere reported as haplogroup G, but none were found in the other coastal lands of theIndian OceanorPacific Oceanin Asia.In theMiddle East,haplogroup G accounts for about 3% of the population in almost all areas.Among theDruzemostly residents ofIsrael10% were found to be haplogroup G.InAfrica, haplogroup G is rarely found insub-Saharan Africaor south of thehorn of Africaamong native populations. InEgypt, studies have provided information that pegs the G percentage there to be between 2% and 9%.3% of North AfricanBerberswere found to be haplogroup G.2% of ArabMoroccansand 8% of Berber Moroccans were likewise found to be G.In theAmericas,the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. It is not found amongNative Americansexcept where intermarriage with non-native persons has occurred.Around 10% ofJewishmales are Haplogroup G.Famous membersSee also:List of genetic results derived from historical figuresJoseph Stalin, from a genetic test on his grandson (his son Vasily's son; Alexander Burdonsky), shows his Y-DNA haplogroup to be G2a1a[3]:DYS39339019391385A385B426388439389I392389II458459A459B455454447437448449464A464B464C464D
Alleles14231591516111211111028179911112516212813131414
KingLouis XVI of Francefrom a genetic test using blood on a handkerchief purported to have been soaked at his beheading and maintained by an Italian family in an ornate gourd decorated withFrench Revolutionthemes. The sample was tested at two laboratories with the same results.The sample is most consistent with G2a3b1a samples and contains unusually high, rare values for markers DYS385B and DYS458 within this G subgroup. In 2012, evidence supporting the claim and supposition that the blood contained on the cloth belonged to Louis XVI was made by DNA testing of tissue samples from King Henry IV of France's (Louis XVI's 5-great grandfather via the paternal line) decapitated embalmed head.The men have been found to have a 5/6STR-match, confirming that the blood on the handkerchief and the human remains both belonged to French kings and that the House of Bourbon was/is in fact in Y-chromosome Hg G2a3b1a.Louis XVI:DYS39339019391385A385B439389I392389II448458456437438YGATAH4DYS635
Alleles1422151013181212113021211515101221
Other notables purported to belong to haplogroup G include American historical figuresPhillip HammanandLinn Banks(U.S. Representative from Virginia), physicistJohn G. Cramer, actorJames Franciscus, and former Chairman of the United StatesFederal Communications Commission(FCC) and Chairman of thePublic Broadcasting Service,Newton Minowandtzi the Iceman.