What is Life Science? A. Life science is a major field of science that

studies living things. B. The life sciences are divided into two major

groups: 1.  BIOLOGY

a.  Zoology: study of animal life b.  Botany: study of plant life c.  Mycology: study of fungi d.  Microbiology: study of bacteria and

protists e.  Cellular Biology: study of living cells f.  Anatomy: study of parts of the body g.  Physiology: study of how the body

functions h.  Taxonomy: classification of living

thing 2.  ECOLOGY

What is Biology? A. BIOLOGY: the study of organisms

1.  All objects on Earth can be divided into two categories a. BIOTIC: all the living and dead

objects on Earth b. ABIOTIC: all the non-living elements

on Earth 2. All organisms are grouped as biotic

a.  ORGANISM: all living things on Earth made of cells

b.  CELL: the smallest unit of life that makes up an organism

B.  Biology focuses on the structure and function of an organism’s parts 1.  BIOLOGICAL STRUCTURE: the

composition and form of cells, tissues, organs and systems of living things

2.  BIOLOGICAL FUNCTION: the purpose or use of a structure

What are the Basic Building Blocks of Life ? A. All organisms are biotic objects

made of matter 1.  Most of the matter found in

organisms are made of six elements from the periodic table a. Carbon, Hydrogen, Oxygen

& Nitrogen are the most abundant

b.  Phosphorus and Sulfur are found in small quantities

2.  Other elements are used for processes in the body but are not as abundant a.  Calcium, Iron, Sodium and

Magnesium are examples b.  These are called trace

elements

carbon

C6

12.011

hydrogen

H1

1.0079

nitrogen

N7

14.007

oxygen

O8

15.999

phosphorus

P15

30.974

sulfur

S16

32.065

What are the Basic Building Blocks of Life ? B.  CHNOPS: six elements held together by

covalent bonds to form biological macro-molecules that are organized to make parts of cells 1.  There are four major macro-molecules

necessary for life a.  CARBOHYDRATES: sugars and

starches used for structure and quick energy storage in cells

b.  PROTEINS: polymers made of amino acids used for chemical reactions to get work done in cells

c.  LIPIDS: fats and oils used for structure of cell membranes slow energy storage

d.  NUCLEIC ACIDS: polymers made of nucleotides used for genetic storage and building proteins

C

C

C

O

O

N

H

H

H

H

H

C H

O

C

N

H

HH

H

C H

H

What is the Smallest Form of Life? A.  The cell is the smallest form of life.

1.  All organisms are formed from one or more cells that are organized to do specific jobs

2.  There are two very different types of cells that organisms can be formed from: a.  PROKARYOTIC CELL: a simple cell with no nucleus and few

organelles b.  EUKARYOTIC CELL: a complex cell with a nucleus and many

different organelles

What is the Smallest Form of Life? B. Organisms are simple or complex based on the number of cells they are

made of. 1.  UNICELLULAR: an organism made of only one cell

a.  Bacteria are unicellular prokaryotes b.  Protists are unicellular eukaryotes

2.  MULTICELLULAR: an organism made of two or more cells a. Fungi, plants, and animals are all multicellular eukaryotes

What is the Smallest Form of Life? C. The cells of organisms are surrounded by either one or two layers of

protection. 1.  CELL MEMBRANE: the flexible outer layer of all cells that only

allows certain things in and out of the cell 2.  CELL WALL: a tough rigid layer that surrounds the cell membrane

of some cells a. Bacteria, some protists, fungi and plant cells are covered in cell

walls

What is the Smallest Form of Life? D. The cells of organisms can get the energy they need to do their work in

one of two ways: 1.  AUTOTROPH: a process where cells can make their own food for

energy a. All plants along with some bacteria and protists are autotrohs

2.  HETEROTROPH: a process where cells must rely on others for their food a. All fungi and animals along with some bacteria and protists are

heterotrophs

What are the Major Parts of Eukaryotic Cells? A.  There are four major structures to every

eukaryotic cell: 1.  CELL MEMBRANE: thin structure

that surrounds and contains the cell 2.  CYTOPLASM: gel-like substance

inside the cell where most activities take place

3.  NUCLEUS: the control center of the cell that contains the cell’s genetic material (DNA)

4.  ORGANELLES: small specialized structures in the cytoplasm responsible for the work done in cells a.  There are many different types

of organelles with specialized jobs

b.  Some organelles are specific to autotrophs since they make their own food.

What is Genetics? A. GENETICS: a field of biology that

studies information contained in DNA and how it is passed from parent to offspring in the form of genes

B.  All eukaryotic organisms possess traits and biological systems that are found encoded in the DNA of their nuclei. 1.  DEOXYRIBONUCLEIC ACID: a

massive macro-molecule found in the nucleus of all eukaryotic cells that carries genetic information.

2.  DNA is a polymer made of a number of different monomers

3.  The 4 major monomers are called nitrogenous bases that make up the code stored inside DNA

a.  ADENINE: a base that pairs with thymine b.  THYMINE: a base that pairs with adenine c.  CYTOSINE: a base that pairs with guanine d.  GUANINE: a base that pairs with cytosine

What is Genetics? C. DNA is a large molecule that needs to be coiled and bundled in order to

fit in the nucleus of every cell.

What is Genetics? 1.  DNA takes the shape of a coiled double-helix 2.  The double-helix is tightly bundled into a chromosome

a.  CHROMOSOME: tightly packed, condensed strands of DNA 3.  DNA are arranged in a number of different ways by geneticists

a.  KARYOTYPE: the exact set of chromosomes of an individual organism b.  KARYOGRAM: an systematic arrangement of chromosomes in

descending order c.  IDIOGRAM: a diagram of an organism’s karyogram

karyotype karyogram

idiogram

2.  The gene for a trait can have a different arrangement of nucleic acids based on the version of that trait i.  ALLELES: alternate versions of the

same gene that code for how the trait is displayed.

ii.  The gene for eye color can read differently based on whether it is blue, brown, green or hazel.

D.  Different sections of a chromosomes DNA will code for certain traits 1.  GENE: a portion of DNA that codes for a

specific trait found in a specific spot on the chromosome. i.  This code is created by the

arrangement of nucleic acids

ATCGCGGGATTAGCATACGATGGCAATA

GCGGGATTAGCATACG

GCGGGATATGCATACG

GCGGGATGCGCATACG

GCGGGATCAGCATACG

Brown Iris

Hazel Iris

Blue Iris

Green Iris

ATATGCATACGGGCCA

ATGCGCATACGGGCCA

Masai Giraffe

Thornicroft Giraffe

Reticulated Giraffe

Rothschild Giraffe

ATGAGCATACGGGCCA

ATTTGCATACGGGCCA

What is Genetics? E.  Most traits or features are made of proteins and the code found in DNA aids

in making proteins needed by an organism. 1.  PROTEIN SYNTHESIS: the formation of proteins in ribosomes through

the stringing together of amino acids 2.  DNA has to be uncoiled and unzipped to begin this process:

a.  TRANSCRIPTION: the use of unzipped DNA to form mRNA in the nucleus i. RNA is different from DNA in that it is single stranded and uses

uracil rather than thymine b.  mRNA is moved to a ribosome where protein is made c.  The strand of mRNA carries smaller codes that match with tRNA

i. CODON: a small code in a mRNA three bases long (AAG, GCA, UGG, CCG)

d.  tRNA attaches to amino acids and carries them to mRNA where the code strings the amino acids together to form proteins i.  ANTICODON: a three base code in tRNA that matches with a

codon in mRNA ii.  Proteins are used as structure (muscle, cartilage, tendon, skin,

hair, feathers, scales, bone, nails), pigments (colors), catalysts (speed up chemical reactions) and energy

F.  GENOTYPE: the genetic code for an organism’s traits 1.  Example: the genetic code of nucleic

acids needed to have brown hair and brown eyes

G.  PHENOTYPE: the expression of the traits that can be seen as physical characteristics 1.  Example: actually having brown hair and

brown eyes H.  Certain alleles can cause different

phenotypes to be expressed more often 1.  DOMINANT ALLELE: a version of a

gene that dominates other versions of the same gene i.  The allele for the Reticulated giraffe

pattern is expressed more than Masai 2.  RECESSIVE ALLELE: a version of a

gene that does not dominate other versions of the same gene i.  The allele for the Masai giraffe pattern

is expressed less than the Reticulated

ATGCGCATACGGGCCA

Masai Giraffe

Reticulated Giraffe

ATGAGCATACGGGCCA

FATHER: rr MOTHER: RR

RR rr R

R

r

r

I.  Organisms receive half of their genetic code from their mother and half their genetic code from their father 1.  Example: humans have 46 chromosomes, they receive 23 from their

mother and 23 from their father J.  Parents and offspring can either have all dominant alleles, all recessive

alleles or a combination of dominant and recessive 1.  HOMOZYGOUS: a genotype where an organism possesses all

dominant alleles (RR) or all recessive alleles (rr) 2.  HETEROZYGOUS: a genotype where an organism possess a

combination of dominant and recessive alleles (Rr) 3.  Dominant alleles are written as uppercase letters to show dominance 4.  Recessive alleles are written as lowercase letters to show a lack of

dominance

R Rr

r

Rr Rr

Rr Rr

Masai Giraffe Reticulated Giraffe

ATGCGCATACGGGCCA ATGAGCATACGGGCCA

FATHER: rr MOTHER: RR

RR rr R

R

r

r

R r R

r

RR Rr

Rr rr

Reticulated Giraffe

ATGCGCATACGGGCCA

FATHER: Rr MOTHER: Rr

Rr Rr R

r

R

r Reticulated Giraffe

ATGCGCATACGGGCCA

How do cells make more of themselves? A. Cells make more of themselves through a

process known as cell division: 1.  MITOSIS : the process of cell division

where a cell duplicates all its DNA and organelles before physically splitting into two new sister cells

2.  DIPLOID CELL: a cell with a full set of chromosomes able to grow and divide

B. There are different stages of mitosis depending on where the cell is in its process of division 1. Interphase: DNA duplicates 2. Prophase: Chromosomes condense 3. Metaphase: Chromosomes align in the middle 4. Anaphase: Chromosomes separate 5. Telophase: Chromosomes spread apart 6. Cytokinesis: Cell splits into two cells