What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right...
Transcript of What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right...
![Page 1: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/1.jpg)
What is DNA barcoding and why is it important?
![Page 2: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/2.jpg)
ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG
Organism is sampled DNA is extracted “Barcode” amplified
DNA barcodes identify species
Sequenced DNA creates a unique “barcode” for each species
![Page 3: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/3.jpg)
How many species can you name?
How many animals did you name? How many mammals? How many plants? How many insects?
“Cat” Felis catus
“Dog” Canis lupus familiaris
“Oak Tree” Quercus alba
“Shark” Ginglymostoma cirratum
“Beetle” Popillia
japonica
![Page 4: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/4.jpg)
Issue #1: No one knows how many species there are.
![Page 5: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/5.jpg)
What is Biodiversity?
– How do you define biological diversity, or biodiversity?
![Page 6: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/6.jpg)
What is Biodiversity?
The three levels of biodiversity Ø Gene=c diversity Ø Species diversity Ø Ecosystem diversity
![Page 7: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/7.jpg)
• How many species are on this page?
![Page 8: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/8.jpg)
?
![Page 9: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/9.jpg)
• Currently between 1.5 and 2 million species are described/known
• This number may represent as little as half of the true number of species
• Perhaps more than 1/3 of all species are threatened (IUCN Red list version 2010.1)
Vertebrates Species
Mammals 5,490
Birds 9,998
Rep=les 9,084
Amphibians 6,433
Fishes 31,300
Total 62,305
Invertebrates Species
Insects 1,000,000
Mollusks 85,00
Crustaceans 47,000
Corals 2,175
Arachnids 102,248
Total (+others) 1,305,250
Plants Species
Angiosperms 281,821
Gymnosperms 1,021
Ferns and Allies 12,000
Mosses 16,236
Algae 10,134
Total 321,212
![Page 10: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/10.jpg)
Issue #2: Traditional taxonomic identification methods may be inadequate/too slow to capture vanishing biodiversity.
![Page 11: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/11.jpg)
Classical taxonomy is difficult for non-experts to understand
The body form ranges from hemispherical (e.g., Cleidostethus) to elongate oval (e.g., Clypastraea) to latridiid-like (e.g., Foadia). Corylophids are typically dull brown, but some species have contrasting yellowish-brown patches on the pronotum or elytra. The integument is often densely punctured and may be glabrous or bear short, fine recumbent setae. Most corylophid adults can be diagnosed using the following morphological features: Maxilla with single apical lobe; Mesotrochanter short and strongly oblique; Head usually covered by pronotum; Frontoclypeal suture absent; Antennae elongate with 3-segmented club; Procoxal cavities closed externally; Tarsal formula 4-4-4; Pygidium exposed
Adding to the complexity: immature, damaged, or incomplete specimen may make identification impossible.
![Page 12: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/12.jpg)
Why DNA barcoding works: genes with the right number of differences.
matK rbcL
CHLOROPLAST MITOCHONDRION
CO1
![Page 13: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/13.jpg)
Fail: Sequence is completely conserved, good for PCR, but uninformative as barcode
Fail: Sequence shows no conservation, impossible for PCR, but good as barcode
Win: Sequence shows ~70% conservation, good for PCR, good as barcode
Why DNA barcoding works: differences allow identification
![Page 14: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/14.jpg)
Contributing to big science
![Page 15: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/15.jpg)
Kate Stoeckle August 23, 2008
![Page 16: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/16.jpg)
READ “DNA BARCODES DEMOCRATIZE GENETICS” BY ASHLEY YEAGER
![Page 17: What is DNA barcoding and why is it important? · Why DNA barcoding works: genes with the right number of differences. rbcL matK CHLOROPLAST MITOCHONDRION CO1 . Fail: Sequence is](https://reader033.fdocuments.us/reader033/viewer/2022060500/5f1aba5e9f170f44e812296b/html5/thumbnails/17.jpg)
While you are reading:
1. Make a list of at least 5 vocabulary words that were unfamiliar to you.
2. Name at least 2 concepts involved with DNA barcoding that you s=ll have ques=ons about.
3. A[er reading, summarize the ar=cle in 5 sentences to someone who hasn’t read it.