Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW...
-
Upload
daisy-harrington -
Category
Documents
-
view
221 -
download
0
Transcript of Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW...
![Page 1: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/1.jpg)
Welcome to Part 3 of Bio 219Lecturer – David Ray
Contact info:Office hours – 1:00-2:00 pm MTW
Office location – LSB 5102Office phone – 293-5102 ext 31454E-mail – [email protected]
Lectures are available online athttp://www.as.wvu.edu/~dray
go to ‘Teaching’ link
![Page 2: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/2.jpg)
How Genes and Genomes Evolve
![Page 3: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/3.jpg)
Variation
• There is obviously variation among and within taxa.
• How does the variation arise in genomes?• Are there patterns to the variation?• How is the variation propagated?• What questions can be addressed using
the variation?• What patterns exist in humans with regard
to genomic variability?
![Page 4: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/4.jpg)
Generating Genetic Variation
• Somatic vs. germ line cells– Somatic cells – “body” cells, no long term
descendants, live only to help germ cells perform their function.
– Germ cells – reproductive cells, give rise to descendants in the next generation of organisms.
![Page 5: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/5.jpg)
![Page 6: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/6.jpg)
Generating Genetic Variation
• Somatic vs. germ line mutations– Somatic mutations – occur in somatic cells
and will only effect those cells and their progeny, cannot not be passed on to subsequent generations of organisms.
– Germ mutations – can be passed on to subsequent generations.
![Page 7: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/7.jpg)
![Page 8: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/8.jpg)
Generating Genetic Variation
• Five types of change contribute to evolution.– Mutation within a gene– Gene duplication– Gene deletion– Exon shuffling– Horizontal transfer – rare in Eukaryotes
![Page 9: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/9.jpg)
![Page 10: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/10.jpg)
Generating Genetic Variation
• Most changes to a genome are caused by mistakes in the normal process of copying and maintaining genomic DNA.
![Page 11: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/11.jpg)
• Mutations within genes– Point mutations – errors in replication at
individual nucleotide sites occur at a rate of about 10-10 in the human genome.
– Most point mutations have no effect on the function of the genome – are selectively neutral.
Generating Genetic Variation
![Page 12: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/12.jpg)
• DNA duplications– Slipped strand mispairing– Unequal crossover during recombination
Generating Genetic Variation
![Page 13: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/13.jpg)
![Page 14: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/14.jpg)
![Page 15: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/15.jpg)
• Gene duplication allows for the acquisition of new functional genes in the genome
Generating Genetic Variation
![Page 16: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/16.jpg)
![Page 17: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/17.jpg)
• Gene Duplication: the globin family– A classic example of gene duplication and evolution– Globin molecules are involved in carrying oxygen in
multicellular organisms– Ancestral globin gene (present in primitive animals)
was duplicated ~500 mya.– Mutations accumulated in both genes to differentiate
them - α and β present in all higher vertebrates– Further gene duplications produced alternative forms
in mammals and in primates
Generating Genetic Variation
![Page 18: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/18.jpg)
Mammals
Primates
![Page 19: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/19.jpg)
• Gene Duplication– Almost every gene in the vertebrate genome
exists in multiple copies– Gene duplication allows for new functions to
arise without having to start from scratch– Studies suggest the early in vertebrate
evolution the entire genome was duplicated at least twice
Generating Genetic Variation
![Page 20: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/20.jpg)
• Exon Duplication– Duplications are not limited to entire genes– Proteins are often collections of distinct amino
acid domains that are encoded by individual exons in a gene
– The separation of exons by introns facilitates the duplication of exons and individual gene evolution
Generating Genetic Variation
![Page 21: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/21.jpg)
![Page 22: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/22.jpg)
• Exon Shuffling– The exons of genes can sometimes be
thought of as individual useful units that can be mixed and matched through exon shuffling to generate new, useful combinations
Generating Genetic Variation
![Page 23: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/23.jpg)
![Page 24: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/24.jpg)
Review from last week• Overall theme – There are lots of ways to create genetic variation.
Genetic variation is the basis of evolutionary change but the variation must be introduced into the germ line to contribute to evolutionary change.
• Two cell lines in multicellular organisms– Somatic – short term genetic repository– Germ line – long term genetic repository
• Variation that occurs in the germ line are the only ones that can contribute to evolutionary change
• Genetic variation can be accumulated through various events– Mutations in genes – point mutations– DNA duplications – microsatellites (small), unequal crossover (large)– Gene and exon duplications are the major method for generating new
gene functions– Exon shuffling can produce new gene functions by creating new
combinations of functional exons/protein domains
![Page 25: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/25.jpg)
• Mobile elements contribute to genome evolution in several ways– Exon shuffling– Insertion mutagenesis– Homologous and non-homologous
recombination
Generating Genetic Variation
![Page 26: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/26.jpg)
• What are mobile elements and how do they work?– Fragments of DNA that can copy itself and
insert those copies back into the genome– Found in most eukaryotic genomes– Humans – Alu (SINE); Ta, PreTa (LINEs);
SVA; plus several families that are no longer active
Generating Genetic Variation
![Page 27: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/27.jpg)
Pol III transcription
Reverse transcription and insertion
1. Usually a single ‘master’ copy
2. Pol III transcription to an RNA intermediate
3. Target primed reverse transcription (TPRT) – enzymatic machinery provided by LINEs
Generating Genetic Variation:Normal SINE mobilization
![Page 28: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/28.jpg)
Generating Genetic Variation
• Mobile elements contribute to genome evolution in several ways– Exon shuffling
![Page 29: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/29.jpg)
Generating Genetic Variation:Exon shuffling via SINE mobilization
exon 1 SINE
intron
exon 2
SINE transcription can extend past the normal stop signal
Reverse transcription creates DNA copies of both the SINE and exon 2
DNA copy of transcript
Reinsertion occurs elsewhere in the genome
SINE exon 2
![Page 30: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/30.jpg)
Generating Genetic Variation
• Mobile elements contribute to genome evolution in several ways– Exon shuffling– Insertion mutagenesis
• The insertion of mobile elements can disrupt gene structure and function
![Page 31: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/31.jpg)
Generating Genetic Variation
![Page 32: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/32.jpg)
ALU INSERTIONS AND DISEASE
LOCUS DISTRIBUTION SUBFAMILY DISEASE REFERENCE
BRCA2 de novo Y Breast cancer Miki et al, 1996Mlvi-2 de novo (somatic?) Ya5 Associated with
leukemiaEconomou-Pachnis andTsichlis, 1985
NF1 de novo Ya5 Neurofibromatosis Wallace et al, 1991APC Familial Yb8 Hereditary desmoid
diseaseHalling et al, 1997
PROGINS about 50% Ya5 Linked with ovariancarcinoma
Rowe et al, 1995
Btk Familial Y X-linkedagammaglobulinaemia
Lester et al, 1997
IL2RG Familial Ya5 XSCID Lester et al, 1997Cholinesterase one Japanese family Yb8 Cholinesterase
deficiencyMuratani et al, 1991
CaR familial Ya4 Hypocalciurichypercalcemia and
neonatal severehyperparathyroidism
Janicic et al, 1995
C1 inhibitor de novo Y Complement deficiency Stoppa Lyonnet et al, 1990ACE about 50% Ya5 Linked with protection
from heart diseaseCambien et al, 1992
Factor IX a grandparent Ya5 Hemophilia Vidaud et al, 19932 x FGFR2 De novo Ya5 Apert’s Syndrome Oldridge et al, 1997GK ? Sx Glycerol kinase
deficiencyMcCabe et al, (personalcomm.)
![Page 33: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/33.jpg)
Generating Genetic Variation
• Gene expression alteration via a P-element mobilization in Drosophila
![Page 34: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/34.jpg)
Generating Genetic Variation
• Mobile elements contribute to genome evolution in several ways– Exon shuffling– Insertion mutagenesis
• The insertion of mobile elements can disrupt gene structure and function
– Homologous and non homologous recombination
• 10,000 – 1,000,000 + nearly identical DNA fragments scattered throughout the genome
![Page 35: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/35.jpg)
Generating Genetic Variation
Unequal crossover due to non-homologous recombination
![Page 36: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/36.jpg)
ALU/ALU RECOMBINATION AND GERM-LINE DISEASE
LOCUS DISTRIBUTION DISEASE REFERENCE
8 x LDLR
Kindreds Hypercholesterolemia Lehrman et al, 1985, 1987 Yamakawa et al, 1989 Rudiger et al, 1991 Chae et al, 1997
5 x -globin Kindreds -thalassaemia Nicholls et al, 1987 Flint et al, 1996 Harteveld et al, 1997 Ko et al, 1997
5 x C1 inhibitor
Kindreds Angioneurotic adema Stoppa-Lyonnet et al, 1990 Ariga et al, 1990
C3 Kindred C3 deficiency Botto et al, 1992 HPRT Individual
Lesch-Nyhan
syndrome Marcus et al, 1993
DMD Kindred Duchenne’s muscular dystrophy
Hu et al, 1991
ADA Individual ADA deficiency-SCID Markert et al, 1988
Ins. Rec. Individual Insulin-independent diabetes
Shimada et al, 1990
Antithrombin Individual Thrombophilia Olds et al, 1993 XY Individual XX male Rouyer et al, 1987 Lysyl hydroxylase Kindreds Ehlers-Danlos
syndrome Pousi et al, 1994
![Page 37: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/37.jpg)
ALU/ALU RECOMBINATION AND CANCER
LOCUS DISTRIBUTION MECHANISM DISEASE REFERENCE
10 xALL-1
Somatic Alu-Alu recombDup. intron 1-6
Acutemyelogenous
leukemia
Strout et al, 1998So et al, 1997;Schichman et al,1994
7 xBCR/Abl
Somatic X-Alu recomb. CML Jeffs et al, 1998Chen et al, 1989de Klein et al, 1986
All-1/AF9 Somatic Alu-Alutranslocation
Acutemyelogenous
leukemia
Super et al, 1997
2 xBRCA1
Somatic &A kindred
Alu-Alu recomb(del exon 17; del.
Promoter)
Breast cancer Puget et al, 1997Swensen et al,1997
2 xMLH1
2 kindreds Alu-Alu recomb.(del exon 16)(exons 13-16)
HNPCC Nystrom-Lahti etal, 1995Mauillon et al,1996
TRE Somatic InterchromosomalAlu-Alu recomb
Ewing's sarcoma Onno et al, 1992
RB Common Alu-Alu recomb.(799 bp del.)
Association withglioma
Rothberg et al,1997
EWS Subset of Africans Alu-Alu recomb.(del 2 kb)
Protective againstEwing Sarcoma?
Zucman-Rossi etal, 1997
![Page 38: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/38.jpg)
Generating Genetic Variation
• Gene transfer can move genes between entire genomes– Horizontal gene transfer
– Main problem with the development of drug resistant strains of bacteria
![Page 39: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/39.jpg)
Generating Genetic Variation• Bacterial conjugation
![Page 40: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/40.jpg)
Reconstructing Life’s Tree
• Evolutionary theory predicts that organisms that are derived from a common ancestor will share genetic signatures
• Organisms that shared an ancestor more recently will be more similar than those that shared a more distant common ancestor
• Similarity can include sequence composition, genome organization, presence/absence of mobile elements, presence/absence of gene families, etc.
![Page 41: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/41.jpg)
09_15_Phylogen.trees.jpg
![Page 42: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/42.jpg)
09_16_Ancestral.gene.jpg
![Page 43: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/43.jpg)
09_22_genetic.info.jpg
![Page 44: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/44.jpg)
09_17_Human_chimp.jpg
Chromosome 1
![Page 45: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/45.jpg)
Review from last time• Overall themes: Genetic variation can be introduced due to the
activities and presence of mobile elements (MEs); Genetic information can be introduced into organisms through horizontal transfer.
• MEs are fragments of DNA that can make copies of themselves and insert those copies back into the genome– MEs can lead to variation through exon shuffling, insertion mutagenisis,
and recombination– Many human diseases are the result of MEs
• Horizontal transfer can introduce genetic variation into bacteria via the process of conjugation
• Introduction of concepts for discussion of “Reconstructing life’s tree”– All sorts of variation provide information on the relationships among
organisms– Homology – derived from the same ancestral source– Phylogeny – a reconstruction of relationships based on observations
![Page 46: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/46.jpg)
• Basic terms – Homologous – derived from a common
ancestral source– Phylogeny – a reconstruction of relationships
based on observed patterns
Reconstructing Life’s Tree
![Page 47: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/47.jpg)
• Homologous genes can be recognized over large amounts of evolutionary time
Reconstructing Life’s Tree
![Page 48: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/48.jpg)
• Homologous genes can be recognized over large amounts of evolutionary time
• Why?– Selectively advantageous genes and
sequences tend to be conserved (preserved)– Selectively disadvantageous genes and
sequences are tend not to be passed on to offspring
Reconstructing Life’s Tree
![Page 49: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/49.jpg)
Reconstructing Life’s Tree
• Most DNA of most genomes is non-coding– Changes to much of this DNA are selectively neutral –
cause no harm or good to the genome– Different portions of the genome will therefore diverge
at different rates depending on their function
The neutral regions tend to change in a clock-like fashion– We can estimate divergence times for certain groups
![Page 50: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/50.jpg)
![Page 51: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/51.jpg)
09_19_human_mouse1.jpg
![Page 52: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/52.jpg)
• Most DNA of most genomes is non-coding– Changes to much of this DNA are selectively neutral –
cause no harm or good to the genome– Different portions of the genome will therefore diverge
at different rates depending on their function
• The neutral regions tend to change in a clock-like fashion– We can estimate divergence times for certain groups
Reconstructing Life’s Tree
![Page 53: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/53.jpg)
• The accumulation of changes can be quantified by several logical methods– Parsimony – the best hypothesis is the one
requiring the fewest steps (i.e. Occam’s razor)– Distance – count the number of differences
between things, the ones with the fewest numbers of differences are most closely related
– Sequence based models – take into account what we know about the ways sequences change over time
Reconstructing Life’s Tree
![Page 54: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/54.jpg)
• These slides and the sequence files used to produce them are available as a supplement on the class website:
• DNA sequence from six taxa
Reconstructing Life’s Tree: An example using distance
![Page 55: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/55.jpg)
![Page 56: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/56.jpg)
![Page 57: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/57.jpg)
![Page 58: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/58.jpg)
![Page 59: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/59.jpg)
human
Sumatran orangBornean orang
bonobo chimpcommon chimp
gorilla
![Page 60: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/60.jpg)
ATGGCT AAGACG AAGACTCAGGCTCAGGCT
T-A
A-C
A-C
Reconstructing Life’s Tree: An example using parsimony
ATGGCT AAGACG AAGACTCAGGCTCAGGCTATGGCT AAGACG AAGACTCAGGCTCAGGCTATGGCT AAGACG AAGACTCAGGCTCAGGCT
T-G
G-AG-A
6 steps
![Page 61: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/61.jpg)
ATGGCT AAGACG AAGACTCAGGCT CAGGCT
T-A
G-A
T-G
A-C
G-A
5 steps
Reconstructing Life’s Tree: An example using parsimony
![Page 62: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/62.jpg)
ATGGCT AAGACGAAGACT CAGGCT CAGGCT
T-A
G-A
T-G
A-C
4 steps
Reconstructing Life’s Tree: An example using parsimony
![Page 63: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/63.jpg)
• The accumulation of changes can be quantified by several logical methods
• The accumulation of mobile elements provides a nearly perfect record of evolutionary relationships
Reconstructing Life’s Tree
![Page 64: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/64.jpg)
Phylogenetic Inference Using SINEs
![Page 65: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/65.jpg)
Species A Species DSpecies CSpecies B
Phylogenetic Inference Using SINEs
![Page 66: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/66.jpg)
Resolution of the Human:Chimp:Gorilla Trichotomy
(H,C)G
(H,G)C
(C,G)H
(H,C,G)
![Page 67: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/67.jpg)
Phylogenetic Analysis
PCR of 133 Alu loci 117 Ye5 13 Yc1 1 Yi6 1 Yd3 1 undefined subfamily
PNAS (2003) 22:12787-91
![Page 68: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/68.jpg)
Alu Elements and Hominid Phylogeny
PNAS (2003) 22:12787-91
![Page 69: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/69.jpg)
Review from last time
• The variation that is present in genomes allows us to make determinations about the relationships among living things
• Different parts of the genome accumulate variation at different rates depending on their function (or lack thereof)
• The presence of different rates allows for different questions to be addressed depending on the level of divergence
• Several methods are available to analyze variation for phylogenetic signal– Parsimony, distance, sequence based models
• Patterns of mobile element insertion can be used to infer relationships among taxa
![Page 70: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/70.jpg)
• Much of the “junk” DNA is dispensible– The Fugu (Takifugu rubripes) genome is
almost completely devoid of unnecessary sequences
– Exon number and organization is similar to mammals
– Compared to other vertebrates• Intron size (not number) is reduced• Intergenic regions are reduced in size• No mobile elements
Reconstructing Life’s Tree
![Page 71: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/71.jpg)
09_21_Fugu.introns.jpg
![Page 72: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/72.jpg)
• Using all of the available information, we can reconstruct relationships between organisms back to the earliest forms of life
Reconstructing Life’s Tree
![Page 73: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/73.jpg)
• The human genome is large and complex– 23 pairs of chromosomes– ~3.2 x 109 (3.2 billion) nucleotide pairs– Human genome composition
Our Own Genome
![Page 74: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/74.jpg)
09_26_noncoding.jpg
![Page 75: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/75.jpg)
09_25_Chromosome22.jpg
![Page 76: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/76.jpg)
• Nuclear genome–3300 Mb–23 (XX) or 24 (XY) linear chromosomes–30-35,000 genes–1 gene/40kb–Introns–3% coding–Repetitive DNA sequences (45%)
Our Own Genome
![Page 77: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/77.jpg)
• The human genome is large and complex– 23 pairs of chromosomes– ~3.2 x 109 (3.2 billion) nucleotide pairs– Human genome composition– The human genome project was one of the
largest undertakings in human history
Our Own Genome
![Page 78: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/78.jpg)
• Progress in human genome sequencing– Hierarchical vs. whole genome shotgun
(WGS) sequencing– Repetitive DNA represents a significant
problem for WGS sequencing in particular
Our Own Genome
![Page 79: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/79.jpg)
10_09_Shotgun.sequenc.jpg
![Page 80: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/80.jpg)
08_03.jpg
![Page 81: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/81.jpg)
• Progress in human genome sequencing– Hierarchical vs. whole genome shotgun
(WGS) sequencing– Repetitive DNA represents a significant
problem for WGS sequencing in particular
Our Own Genome
![Page 82: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/82.jpg)
10_10_Repetit.sequence.jpg
![Page 83: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/83.jpg)
![Page 84: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/84.jpg)
• Progress in human genome sequencing– Hierarchical vs whole genome shotgun
sequencing– Repetitive DNA represents a significant
problem for WGS sequencing in particular–Landmark papers in Nature and Science
(2001)• Venter et al Science 16 February 2001; 291: 1304-
1351 • Lander et al Nature 409 (6822): 860-921
Our Own Genome
![Page 85: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/85.jpg)
• A typical high-throughput genomics facility
Our Own Genome
![Page 86: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/86.jpg)
• Exploring and exploiting the genome sequences
• BLAST/BLAT and other tools– BLAST - Basic local alignment search tool
• Input a sequence and find matches to human or other organisms
– publication information– DNA and protein sequence (if applicable)
Our Own Genome
![Page 87: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/87.jpg)
![Page 88: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/88.jpg)
![Page 89: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/89.jpg)
![Page 90: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/90.jpg)
![Page 91: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/91.jpg)
• Exploring and exploiting the genome sequences
• BLAST/BLAT and other tools– BLAT – BLAST-like alignment tool
• A “genome browser”• Genomes available :
– human, chimp, rhesus monkey, dog, cow, mouse, opossum, rat, chicken, Xenopus, Zebrafish, Tetraodon, Fugu, nematode (x3), Drosophila (x10), Apis (x3), Saccharomyces (yeast), SARS
• example: chr6:121,387,504-121,720,836
Our Own Genome
![Page 92: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/92.jpg)
![Page 93: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/93.jpg)
Query sequence - Callithrix Human ortholog
Our Own Genome• BLAT can be used to make direct comparisons between
our genome and others.
![Page 94: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/94.jpg)
• Comparisons with other genomes inform us about our own–Important genes and regulatory sequences
can easily be identified if they are conserved between genomes
Our Own Genome
![Page 95: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/95.jpg)
• Human variation–~0.1% difference in nucleotide sequence
between any two individual humans–Translates to about 3 million differences in the
genome–Most of these differences are Single
Nucleotide Polymorphisms (SNPs)–We can use these differences to investigate
human variation, population structure and evolution
Our Own Genome
![Page 96: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/96.jpg)
• Human evolution–Coalescence analyses (mtDNA and Y
chromosome)–Mutiregional vs. Out of Africa
• Predictions of the Multiregional Hypothesis– Equal diversity in human subpopulations– No obvious root to the human tree
• Predictions of the Out of Africa Hypothesis– Higher diversity in African subpopulations– Root of the human tree in Africa
Our Own Genome
![Page 97: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/97.jpg)
![Page 98: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/98.jpg)
![Page 99: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/99.jpg)
Population Relationships Based on 100 Autosomal
Alu Elements
Africa
Asia
Europe
S. India
![Page 100: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/100.jpg)
• Human evolution–Higher diversity in African subpopulations
• Insulin minisatellite Table 12.6 in text• 22 divergent lineages exist in the human
population• All are found in Africa. Only 3 are found outside of
Africa.
Our Own Genome
![Page 101: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/101.jpg)
![Page 102: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/102.jpg)
![Page 103: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/103.jpg)
• Interpreting the information generated by the human genome project–The complexity of genome function makes
interpretation difficult–Ex. What are the regulatory sequences?–Ex. Exons can be spliced together in different
ways in different tissues
Our Own Genome
![Page 104: Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW Office location – LSB 5102 Office phone – 293-5102 ext.](https://reader036.fdocuments.us/reader036/viewer/2022062300/56649dd95503460f94ace335/html5/thumbnails/104.jpg)
09_30_alt.splice.RNA.jpg