Web viewThe role of tantalum nanoparticles in bone regeneration involves the BMP2/Smad4/Runx2...

3
The role of tantalum nanoparticles in bone regeneration involves the BMP2/Smad4/Runx2 signaling pathway Guilan Zhang 1,5 , Wenjing Liu 2 , Ruolan Wang 1 , Yanli Zhang 2 , Liangjiao Chen 3 , Aijie Chen 2 , Haiyun Luo 4 , Hui Zhong 1 , Longquan Shao 1,5 1 Department of Stomatology, Nanfang Hospital, Southern Medical University, Guangzhou 510515, China 2 Department of Prosthodontics, Stomatological Hospital, Southern Medical University, Guangzhou 510280, China 3 Department of Orthodontics, Stomatology Hospital of Guangzhou Medical University, Guangzhou 510150, China 4 Department of Endodontics, Stomatological Hospital, Southern Medical University, Guangzhou 510280, China 5 Guangdong Provincial Key Laboratory of Construction and Detection in Tissue Engineering Guangzhou 510515, China Corresponding author: Longquan Shao Department of Stomatology, Nanfang Hospital, Southern Medical University, Guangzhou 510515, China; Guangdong Provincial Key Laboratory of Construction and Detection in Tissue Engineering Guangzhou 510515, China Corresponding author Tel.: +86(0)20 15989283921 (L.Shao)

Transcript of Web viewThe role of tantalum nanoparticles in bone regeneration involves the BMP2/Smad4/Runx2...

Page 1: Web viewThe role of tantalum nanoparticles in bone regeneration involves the BMP2/Smad4/Runx2 signaling pathwayGuilan Zhang1,5, Wenjing Liu2, Ruolan Wang1, Yanli Zhang2, Liangjiao

The role of tantalum nanoparticles in bone regeneration involves the

BMP2/Smad4/Runx2 signaling pathway

Guilan Zhang1,5, Wenjing Liu2, Ruolan Wang1, Yanli Zhang2, Liangjiao Chen3, Aijie

Chen2, Haiyun Luo4, Hui Zhong1, Longquan Shao1,5

1Department of Stomatology, Nanfang Hospital, Southern Medical University, Guangzhou

510515, China

2Department of Prosthodontics, Stomatological Hospital, Southern Medical University,

Guangzhou 510280, China

3Department of Orthodontics, Stomatology Hospital of Guangzhou Medical University,

Guangzhou 510150, China

4Department of Endodontics, Stomatological Hospital, Southern Medical University,

Guangzhou 510280, China

5 Guangdong Provincial Key Laboratory of Construction and Detection in Tissue Engineering

Guangzhou 510515, China

Corresponding author: Longquan Shao

Department of Stomatology, Nanfang Hospital, Southern Medical University, Guangzhou 510515,

China; Guangdong Provincial Key Laboratory of Construction and Detection in Tissue

Engineering Guangzhou 510515, China

Corresponding author Tel.: +86(0)20 15989283921 (L.Shao)

Corresponding author E-mail addresses: [email protected] (L.Shao)

Page 2: Web viewThe role of tantalum nanoparticles in bone regeneration involves the BMP2/Smad4/Runx2 signaling pathwayGuilan Zhang1,5, Wenjing Liu2, Ruolan Wang1, Yanli Zhang2, Liangjiao

Table S1

Osteogenesis-related genes and primers

Genes Forward primer Reverse primer

ALP TCCTGACCAAAAACCTCAAAGG TGCTTCATGCAGAGCCTGC

BMP2 CGGACTGCGGTCTCCTAA GGAAGCAGCAACGCTAGAAG

OPN AGTACGTCAAGCAGGAGTGCAA CCAGCTTGCACCACTCCAA

Runx2 CCACCACTCACTACCACACG TCAGCGTCAACACCATCATT

Smad4 GCAGCTCTTGGGTTTGGGTC GGCAGCAAACCTACTGATCC

GAPD

H

CAACTACATTCAACGGGAAG TTTGATGTTAGTGGGGTCTCG

Figure S1 The mandible following described surgical procedures: (A) Mandible

defects (5 mm in diameter, 1 mm in depth). (B) Bone defect filling material (HA,

HA+Ta). (C) Suture muscle and skin in bone defect area. (D) Mandible specimen (8

and 12 weeks)